http://2012.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=50&target=Olijme&year=&month=2012.igem.org - User contributions [en]2024-03-29T13:01:43ZFrom 2012.igem.orgMediaWiki 1.16.0http://2012.igem.org/Team:Cambridge/SponsorsTeam:Cambridge/Sponsors2012-10-27T04:03:05Z<p>Olijme: </p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<div id="template_content_wide" style="position: absolute; top: 200px; left: 40px; height: 620px; width: 1110px; overflow: auto; overflow-y: scroll;"><br />
<br />
</html><br />
<br />
= Sponsors =<br />
<br />
<br />
Many thanks to all of the sponsors who have made this project possible. A list of our sponsors is displayed below with links to their webpages.<br />
<br />
{|cellspacing="50"<br />
!align="left"|[[Image:Cambio_logo.jpg|200px|link=http://www.cambio.co.uk]]<br />
!align="center"|[[Image:Wtvm050454.jpg |200px|link=http://www.wellcome.ac.uk ]]<br />
!align="right"|[[Image:CAM_dna20.gif|200px|link=http://www.dna20.com]]<br />
|}<br />
<br />
{|cellspacing="50"<br />
!align="left"|[[Image:Logo_ERASynbio.jpeg|200px|link=http://www.erasynbio.net/]]<br />
!align="center"|[[Image:bioline.jpg|200px|link=http://www.bioline.com]]<br />
!align="right"|[[Image:SL_logo.jpg|200px|link=http://www.starlab.co.uk]]<br />
|}<br />
<br />
{|cellspacing="50"<br />
!align="left"|[[Image:Biomatters_logo_med.png|200px|link=http://www.biomatters.com/]]<br />
!align="center"|[[Image:PlantSci.gif|200px|link=http://http://www.plantsci.cam.ac.uk/]]<br />
!align="right"|[[Image:ZoologyDep.png|200px|link=http://www.zoo.cam.ac.uk/]]<br />
|}<br />
<br />
{|cellspacing="50"<br />
!align="center"|[[Image:EngineeringLogo.gif|200px|link=http://www.eng.cam.ac.uk/]]<br />
|}<br />
<br />
= University of Cambridge =<br />
<br />
We would like to express our gratitude to the following departments for supporting the project and our team members' travelling expenses to Amsterdam and Boston:<br />
<br />
*School of Biological Sciences<br />
*Department of Zoology<br />
*Engineering Department<br />
*Department of Plant Sciences<br />
<br />
= Special Thanks =<br />
<br />
The Cambridge iGEM Team would like to offer our most heartfelt thanks to the following people- without them none of this would have been possible.<br />
<br />
==Haseloff Lab, University of Cambridge==<br />
*James Brown<br />
*Fernan Federici<br />
*Paul Grant<br />
*Nuri Purswani<br />
*PJ Steiner<br />
<br />
==Ajioka Lab, University of Cambridge==<br />
*Orr Yarkoni<br />
<br />
==Breaker Lab, Yale University==<br />
Prof. Ronald Breaker's lab at Yale has kindly provided us with the fluoride riboswitch DNA, transformed cells, and valuable advice.<br />
<br />
*Prof. Ronald Breaker<br />
*Keith Corbino<br />
*Narasimhan Sudarsan<br />
<br />
==Department of Molecular, Microbial and Sttructural Biology, University of connecticut Health Center==<br />
Prof. Setlow's lab provided us with the sequences and strains necessary to complete the Fast Germination BioBrick work.<br />
<br />
*Prof. Peter Setlow<br />
*Dr. Barbara Setlow<br />
<br />
==Groningen iGEM 2012==<br />
We have been talking closely with [https://2012.igem.org/Team:Groningen Groningen] regarding our work on sporulation and germination and we'd like to thank them for their tips on Bacillus germination, including suggestion of 'Schaeffer's sporulation media' from which the 2XSG media which we were more successful with is derived. See ou r[https://2012.igem.org/Team:Cambridge/HumanPractices/OutreachCollaboration collaboration] page for more details on this.<br />
<br />
==Dr. Konrad Siegfried==<br />
<br />
Many thanks to Dr. Siegfried of the [http://www.ufz.de/arsolux/index.php?en=20709 ARSOlux team] for giving up his precious time to give his advice to the team.<br />
<br />
==Nanophotonics Department==<br />
<br />
Thanks to Matthew Hawkeye, who helped Tom work on his emission spectra for the DNA2.0 construct.<br />
<br />
<html><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Diary/Week_8Team:Cambridge/Diary/Week 82012-10-27T03:59:52Z<p>Olijme: /* Monday */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<div id="template_content_wide" style="position: absolute; top: 200px; left: 40px; height: 620px; width: 1110px; overflow: auto; overflow-y: scroll;"><br />
<br />
</html><br />
<br />
{|align="center"<br />
!align="center"|Week:<br />
!align="center"|[[Team:Cambridge/Diary/Week 1|1]] <br />
!align="center"|[[Team:Cambridge/Diary/Week 2|2]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 3|3]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 4|4]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 5|5]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 6|6]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 7|7]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 8|8]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 9|9]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 10|10]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 11|11]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 12|12]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 13|13]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 14|14]]<br />
!align="center"|[[Team:Cambridge/Diary/TheFinalMonth|The Final Month]]<br />
|}<br />
<br />
===Monday===<br />
<br />
Got the results from the transformations today. Guess what - they didn't work. Given the cells are definitely competent (the transformation of Jim's YFP DNA into the e.coli seems to have worked), the master mix may be suspect. However, the positive control plates we made yesterday of sfGFP were plated on the wrong type of antibiotic, so we'll change that before we assume anything too rash.<br />
<br />
Tom miniprepped the lux plasmid out of the e. coli and tried to PCR the split backbone again- only half the vector came out. Interestingly, he tried to induce light in some of his overnight cultures of E. coli with the lux plasmid, but found that they don't glow.<br />
<br />
In other news, Oli and Paul began thinking about how to tune our system using an outside parameter, for use with our standardized output system. It may be valuable to spend some time modelling such a system in visual GEC.<br />
<br />
===Tuesday===<br />
<br />
Looks like our master mix for Gibson isn't working, given that only three colonies grew on one of the three control plates. We'll beg some more off Paul G. which should work, and retry the Gibson reaction with his master mix. If ''that'' doesn't work either, we'll have to look for something else to explain our failures...<br />
<br />
The fluoride riboswitch plasmid sent to us was tested by Jolyon again, this time with a higher concentration of X-Gal to try and get a greater colour contrast for our pictures.<br />
<br />
Paul also managed to get some of the tuning ideas up and running in GEC. Surprisingly enough, they do seem to show stability, though more so in the buffered system. If we ever manage to get Gibson to ever work, it will be excellent if we can make such a system.<br />
<br />
On the lux construct front, we started to suspect that some of the colonies (which have been on agar plates in the fridge for almost a month now) have lost part of their plasmid. After consulting Jim H, we decided to do a patch test on agar plates containing arabinose. We should be able to see light on plates tomorrow.<br />
<br />
===Wednesday===<br />
<br />
No colonies today from the positive controls, either with Paul G.'s master mix or our master mix. So it looks like it might be a problem with the DNA itself. Emmy is re-running the PCR of the positive control fragments, but we will concentrate it more than usual using a modified gel extraction protocol, as suggested by Paul. We also try using a smaller amount of T5 exonuclease, as we read from a paper that the amount we are currently using is for 150bp overlaps while we only have 40. Fingers crossed, we should get some (admittedly useless) colonies tomorrow.<br />
<br />
Light from cells on the arabinose plate! So they still have the lux plasmid afterall- looks like the lack of light from Tom's liquid culture might have been due to arabinose concentration problems. In the 4th attempt to PCR out the second half of the lux vector, Tom tried to use GC buffer- still no luck! What is going on...<br />
<br />
On the instrumentation front, further improvements were made on the hardware to improve stability. Andreas and Paul would like to thank the personnel of the Instrument shop of the Engineering department for their help.<br />
<br />
London approaches quickly, and we had to get on with the presentation. As learning experiences go, it was most informative. For example, we learnt that trying to do a presentation between eight people takes an extremely long time.<br />
<br />
Oli also try re-running the &beta;-galactosidase assay on the fluoride riboswitch, as the initial run gave rather variable results.<br />
<br />
===Thursday===<br />
<br />
Successes! The positive control has produced many colonies, now that we used more concentrated DNA. We'll change the protocol to reflect this. The reduced amount of T5 didn't really help (there were fewer colonies on those plates), so we will stick with our original recipe for Gibson mastermix.<br />
<br />
Learning from positive control's success, Paul, Emmy and Andreas went ahead to concentrate the DNA fragments for the fluorescent construct. Paul did minivac, which evaporated some of the liquid from the existing tubes, while Emmy and Andreas worked on re-PCR the fragments from the existing fragments, and using the new gel extraction protocol. Running both solutions at the same time just show how desperate we are... So the minivac-ed fragments are gibsoned together, cells are transformed and plated, and we should know tomorrow if it has worked. The PCR attempt, however, yielded some interesting results: only the fluorescent proteins came out. However we have gotten rather used to the temper of PCR, so we will just try again on Saturday.<br />
<br />
Tom performed a restriction digest on the Lux vector miniprep product- and yes, the restriction map was exactly what we expected. This is followed by a 5th attempt on second half of lux vector- and an unsurprising no. Tom designed sub-split primers and they should come in on Monday...<br />
<br />
The X-Gal assay also produced a beautiful Dulux&trade; colourwheel of blues.<br />
<br />
Final preparation for London tomorrow! We had another long session discussing and fine-tuning our presentation, with many of our advisors present we were starting to feel the pressure! But their advice had been invaluable. Our poster is also printed and ready.<br />
<br />
===Friday===<br />
<br />
UK team meet-up! We had a great day in London meeting people from other UK teams and also hearing about their ideas. Everyone seemed to be working very hard on their projects, so it's good motivation for us to work hard too! Nonetheless it was a nice day out of the lab...<br />
<br />
Emmy dropped by the lab on her way home from London to check on the ratiometrica cells- nothing. Not even the controls... but then, she's realized she has made the oldest mistake in the book- plating the positive controls on amp plates. So she replated some of the leftover culture on Kanamycin plates. We will know tomorrow... (perhaps we should engineer cells that grow extra fast for next year's iGEM project)<br />
<br />
===Saturday===<br />
<br />
The replated positive control on kanamycin plates worked- so the Gibson was working, which means it is possible a design problem. More research into the Gibson protocol tells us we should really not be using Gibson for any fragments shorter than 250bp in the danger of the T5 exo chewing the entire fragments away... which we have two. We will try to tackle the problem by putting in a smaller amount of T5 exo, or/and putting them in later (when the reaction mixture is very close to 50 degrees). Also, we found out that we should use 20x insert to vector. With all these changes, Emmy tried Gibson again with the minivac concentrated DNA. We will know if that has worked tomorrow.<br />
<br />
Emmy re-attempted the PCR from Thursday, with increased DMSO concentration, slightly lower annealing temperature, and some of our new polymerase (velocity from bioline)... no bands at all, not even the positive control. It is probably a problem with the mastermix (see Lab book for details). And on a second look at the gel photos from Thursday- there might actually be some other products, but were mistaken for primer dimers. But nevermind- we will try again tomorrow...<br />
<br />
===Sunday===<br />
<br />
RATIOMETRICA!!!! We *might* finally have it. There are two tiny colonies on one of the plates from yesterday- <strike> though we still cannot tell if they are colonies or bubbles</strike> they are DEFINITELY COLONIES. Hopefully more will grow tomorrow.<br />
<br />
Third attempt at PCR (even though we might have it already we are running out of the original DNA fragments... so it will be good if we have some more anyway)- not much luck, positive control was non-existent/very faint. Looks like we have to troubleshoot PCR again...<br />
<br />
<html><br />
</div><br />
</html><br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Diary/Week_6Team:Cambridge/Diary/Week 62012-10-27T03:59:09Z<p>Olijme: /* Thursday */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<div id="template_content_wide" style="position: absolute; top: 200px; left: 40px; height: 620px; width: 1110px; overflow: auto; overflow-y: scroll;"><br />
<br />
</html><br />
<br />
{|align="center"<br />
!align="center"|Week:<br />
!align="center"|[[Team:Cambridge/Diary/Week 1|1]] <br />
!align="center"|[[Team:Cambridge/Diary/Week 2|2]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 3|3]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 4|4]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 5|5]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 6|6]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 7|7]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 8|8]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 9|9]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 10|10]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 11|11]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 12|12]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 13|13]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 14|14]]<br />
!align="center"|[[Team:Cambridge/Diary/TheFinalMonth|The Final Month]]<br />
|}<br />
<br />
<br />
===Monday===<br />
<br />
We are suffering from some setback on the PCR front. Tom and Emmy's PCR re-runs for the large vectors did not work despite lengthening the elongation time to 5 minutes per cycle. After sequence alignments we discovered that the primers may anneal to various sites on the primer, producing a range of undesired products. We will carry out touch down PCR tomorrow to make the annealing conditions more stringent.<br />
<br />
PCR of the mOrange gene last Friday also yielded no visible products. Looking at the primers' designs again, we think it might be due to problems with the annealing temperature. Therefore we are setting PCR reactions across a temperature gradient today to find the optimum annealing temperature.<br />
<br />
For the first time, we actually did some Gibson assembly in a realistic setting! We (hopefully) fused together the Mg2+ fragment purified last week, along with the riboswitch DNA purified two weeks ago. If all goes according to plan, the transformation on ''bacillus'' that we later performed should provide us with some responsive bacteria by tomorrow morning. If not, we'll try again in e.coli, and see if we can make a new biobrick from the riboswitch in this chassis.<br />
<br />
===Tuesday===<br />
<br />
A day of abject failure. ''Bacillus'' from yesterday has failed to grow at all. We're leaving them in the incubator for another day, but don't hold out much hope of getting any useful results.<br />
<br />
The problem may have been our transformation, in which one of the steps may not have been at the correct 37 &deg;C temperature. Consequently, we're re-running the experiment, as well as trying to get the plasmid working in some TOP10 e.coli.<br />
<br />
Gel electrophoresis of the mOrange PCR products give no visible bands. Tom discovered that a base was missing from the reverse primer- so we have ordered a revised version of it. Curiously, we also seem to have problems with our positive and negative controls.<br />
<br />
Colony PCR of the luciferase vector followed by gel electrophoresis gave a very faint band that seems to be of the right size (the expected product was over 9kb), so the DNA is extracted. We will gibson it with the mOrange once the new primer arrives and the mOrange successfully PCR-ed up.<br />
<br />
[[File:CAM_diary_week6.jpg]]<br />
<br />
Touch-down PCR of pSJ150 for the fluorescent constructed yielded a single product- but not one that we expect. We will have to find a new solution.<br />
<br />
The biobricks from the registry also appeared. Charlie streaked out the bacteria for later use.<br />
<br />
===Wednesday===<br />
<br />
Apparrently, writing off yesterday as a complete failure was somewhat pre-emptive, as it now appears that our ''bacillus'' was actually growing, albeit slowly. Given our bacteria seem to have been transformed therefore, we streaked out potentially functional colonies for testing later.<br />
<br />
PJ suggested that pSJ150 is too large (~8.2kb) to be PCR-ed up as one-piece. He therefore gave Tom and Emmy split primers, which will amplify the vector in two chunks (3.5kb and 4.5kb). We will run the PCR products tomorrow to see if they work.<br />
<br />
===Thursday===<br />
<br />
Two deliveries today, one from our [[Team:Cambridge/Sponsors|Yale contact]] and one from [[Team:Cambridge/Sponsors|Starlabs]]. On the one hand, enough fluoride related ''bacillus'' to make us a couple of biobricks, on the other, enough tips to last us a lifetime. Thanks, you two!<br />
<br />
Not all the day was so joy filled though. After growing up our streaked out ''bacillus'', they have turned out to be e.coli. This makes our assessment that our original assessment was to hasty itself too hasty, which, while gratifyingly meta, is none the less frustrating. We're now going to try and debug our Gibson and PCR, and will probably try to rerun the vector fragments that only seemed to partially work.<br />
<br />
Furthermore, the plates that we made for our (hopefully) transformed e.coli have nothing growing on them, meaning we probably will have to start from the beginning.<br />
<br />
The PCR from yesterday has, however, worked! Having everything in place to perform a Gibson transformation to produce our fluorescent construct, we performed said reaction and transformed it into some TOP10. I will reserve judgement on this until next week.<br />
<br />
===Friday===<br />
<br />
It would appear that our isothermal reaction buffer was not correctly mixed, meaning all our Gibson assembly reactions had no chance of success. Having remixed the buffer, we now hope that the Gibson should work properly.<br />
<br />
Unfortunately, we have now wasted all our TOP10 e.coli on non-functional Gibson assemblies, so now we have to create many more competent e.coli. Consequently, Jolyon got onto ordering all the materials we will need for electroporation, TOP10 being prohibitively expensive for a puny undergraduate research project.<br />
<br />
We have also discovered that the primers for mOrange and luciferase vector (pSB1C3) have been mixed up due to incorrect labelling- that has probably caused all our problems with amplifying up the two over the past week. Nonetheless our new mOrange reversed primer has arrived, so with the corrected labelling and revised primer the mOrange has been amplified up successfully.<br />
<br />
So the faint bands we had on Tuesday for the luciferase vector were probably not our desired product afterall, but learning our lesson from attempting to PCR pSJ150 backbone, Tom has designed split primers for the luciferase backbone and they should be delivered on Monday. With those and the correctly labelled primers hopefully we will obtain the right product that we can gibson to the mOrange. <br />
<br />
Oli has decided to use the split primers for pSJ150 to PCR the pSJ150 backbone for the Mg riboswitch construct as well- the "product" from last Friday's PCR was rather ambiguous and it doesn't seem to have worked in the Gibson. Primers for Charlie's biosensor constructs have also arrived, so parts of the construct are PCR-ed. Unfortunately, none of these PCRs yielded any products- possibly due to a problem with the PCR master mix. We should try these again later.<br />
<br />
<br />
===Saturday===<br />
<br />
Unfortunately there are no visible colonies on our ampicillin plates, which means there might be some problems with the Gibson-ing of the fluorescent construct, or the transformation of E. coli. We will observe for another day.<br />
<br />
Jolyon also started culturing some cells for electroporation so we could start the protocol on Monday.<br />
<br />
===Sunday===<br />
<br />
Still no colonies for the fluorescent construct plates. Meanwhile we redo Oli and Charlie's PCR: half of Oli's vector has came out, as well as Charlie's RFP. We suspect the reasoning for our failure to PCR the Mg promoter might be due to sequence inconsistency of the biobrick from the registry. Oli will attempt the failed PCRs again tomorrow.<br />
<br />
<html><br />
</div><br />
</html><br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOT}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/HumanPractices/MarketResearchTeam:Cambridge/HumanPractices/MarketResearch2012-10-27T03:57:53Z<p>Olijme: Undo revision 298459 by Olijme (talk)</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//down<br />
if (keyCode == 40)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/DesignProcess");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/HumanPractices/OutreachCollaboration");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/HumanPractices/Overview");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/MarketResearch"><br />
<div id="vert_HP_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/DesignProcess"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="vert_RS" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/DesignProcess"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/DesignProcess"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/DesignProcess"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
=Human Practices – Groundwater contamination in rural India=<br />
<br />
As part of our market research we interviewed Dr. Konrad Siegfried from the ARSOlux Team. Check out the interview [https://2012.igem.org/Team:Cambridge/HumanPractices/Interview HERE!]<br />
<br />
Below is a summary of our research into the suitability of our system for use in the field. <br />
<br />
===Finding a Market===<br />
<br />
The potential use of our system in this context first came to light when we became aware of WaterLifeIndia Ltd who won an award for inclusive business models at the G20 conference earlier this year for their work in providing clean, safe water in response to groundwater contamination for B.O.P. (economic base of the pyramid) customers in India.<br />
<br />
We then contacted the British Red Cross, often the first on the ground when disaster strikes, to ask about the human impact of water contamination. When first arriving, all water must be treated as contaminated until it has been tested and shown not to be. For people living in areas with chronic contamination problems, finding clean water is an incredibly time consuming process which can take many hours out of peoples (predominantly women’s) days. <br />
<br />
Further research showed that the problem is extensive and as of April 2011, Arsenic, Fluoride, Iron, Salinity and Nitrate groundwater contamination continued to be a problem in many states – especially in rural areas. Before these problems can be tackled, the scope of the problem must first be determined, requiring sensitive detection apparatus.<br />
<br />
[[File:FluorosisTeeth.jpg|250px|right|thumb|The consequences of fluoride contamination of ground water. Fluoride has been shown to damage the enamel of teeth in children between the ages of 0-8. This dental fluorosis is often accompanied by skeletal fluorosis, associated with skeletal pain and problems with movement. Excessive fluoride ingestion has also been linked to neurological damage in young children.]]<br />
<br />
<br />
<span style="color:green">'''Who is our market?'''</span><br />
<br />
Groundwater contamination can be caused by a variety of factors ranging from natural disasters to improper disposal of industrial waste. Within the topic of groundwater contamination therefore, there is still substantial variety among potential customers. We anticipate that these customers will be looking at levels of a variety of contaminants in different areas though we anticipate that they will need their testing system to provide reliable, accurate quantitative data about more than one contaminant and that testing will probably involve multiple tests over a prolonged time span. Customers may include researchers, charity workers, public health workers or heavy industries aiming to reduce their environmental impact.<br />
<br />
<br />
<span style="color:green">'''What are the current options available?'''</span><br />
<br />
Because of the rural nature of many of the presumed testing sites, standard laboratory equipment is impractical. A portable system is therefore a necessity.<br />
<br />
Currently, two main types of sensing system are readily available for purchase.<br />
<br />
The first is a strip test system. The great advantages of this system is that it is far cheaper than the alternative and highly portable – the strips are extremely light and can easily be carried in pockets if more than one site within a location is to be tested. It is also quick and easy to acquire. Searching the internet for ‘groundwater testing kit’ brings up dozens of websites from which these systems can be purchased instantly and in the possession of the customer within days.<br />
<br />
The downsides to this system are that:<br />
<br />
# the tests are disposable and suitable for a single use only meaning that many have to be used and the product continuously repurchased if long term testing is going to be considered.<br />
# each strip will only test for one contaminant. Where a groundwater source is contaminated, it is unlikely that only a single potential contaminant will be of interest. For highly focussed research this may be acceptable, but in the case of broader research more than one kind of test strip will almost certainly be needed, and as with the problem of disposability, this will push up the costs.<br />
# These tests are often not highly quantitative – quantitative to the extent of orders of magnitude but without providing precise information about contamination levels which makes them unsuitable for detailed examination of contamination levels at a source, especially if the study involves taking multiple readings over a period of time, when the change could be small.<br />
<br />
[[File:TestkitComparison.jpeg|250px|left|thumb|A comparison of the <html><u><a href="https://2012.igem.org/Team:Cambridge/HumanPractices/Interview" style="color:#000066">ARSOlux kit</a></u></html> (160 assays) (left) - a bioreporter kit - and the Arsonator kit (60 assays) (right) - an electronic water testing system. From Siegfried et al. Environ. Sci. Technol. 2012]]<br />
<br />
The other major option is an electronic water testing system. These have the advantages of being far more quantitative, largely reusable and often considering more than one contaminant within the same system. As with the strip tests however, there are major disadvantages. <br />
<br />
# acquiring these systems is not as easy. Often, instead of prices being offered, a quote must be obtained. A level of customisation is sometimes possible with the technology but it is invariably by far the more expensive of the two options.<br />
# electronic systems tend to be bigger and heavier, with complete systems often coming in bulky cases that would be difficult to transport without a vehicle. These systems act more as a field lab, and as such portability is vastly reduced.<br />
<br />
The major disadvantages to these systems are on one side a lack of quantitative results and reusability and on the other high, often prohibitive, costs.<br />
<br />
<br />
<span style="color:green">'''How our system is different'''</span><br />
<br />
Our system has been designed to be relatively low cost and the prices we have paid in producing the project, while not high, would be dramatically reduced by mass production. The system is light and portable but, between the output system and the implementation system, provides highly quantitative data. While the cuvettes and bacteria are single use, the implementation system is reusable. <br />
<br />
We consider there to be a potential market for a reliable, accurate, precise, quantitative measuring system that without the price tag of current electronic systems. We also feel that our system could fill this niche.<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
<br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="hor_overview" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/HumanPractices/MarketResearch"><br />
<div id="hor_marketresearch_on" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/HumanPractices/OutreachCollaboration"><br />
<div id="hor_outreach" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/HumanPractices/FutureDirections"><br />
<div id="hor_futuredirections" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/HumanPractices/OutreachCollaboration"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/HumanPractices/MarketResearchTeam:Cambridge/HumanPractices/MarketResearch2012-10-27T03:57:24Z<p>Olijme: /* Human Practices – Groundwater contamination in rural India */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//down<br />
if (keyCode == 40)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/DesignProcess");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/HumanPractices/OutreachCollaboration");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/HumanPractices/Overview");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/MarketResearch"><br />
<div id="vert_HP_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/DesignProcess"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="vert_RS" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/DesignProcess"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/DesignProcess"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/DesignProcess"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
=Human Practices – Groundwater contamination in rural India=<br />
<br />
Below is a summary of our research into the suitability of our system for use in the field. <br />
<br />
===Finding a Market===<br />
<br />
The potential use of our system in this context first came to light when we became aware of WaterLifeIndia Ltd who won an award for inclusive business models at the G20 conference earlier this year for their work in providing clean, safe water in response to groundwater contamination for B.O.P. (economic base of the pyramid) customers in India.<br />
<br />
We then contacted the British Red Cross, often the first on the ground when disaster strikes, to ask about the human impact of water contamination. When first arriving, all water must be treated as contaminated until it has been tested and shown not to be. For people living in areas with chronic contamination problems, finding clean water is an incredibly time consuming process which can take many hours out of peoples (predominantly women’s) days. <br />
<br />
Further research showed that the problem is extensive and as of April 2011, Arsenic, Fluoride, Iron, Salinity and Nitrate groundwater contamination continued to be a problem in many states – especially in rural areas. Before these problems can be tackled, the scope of the problem must first be determined, requiring sensitive detection apparatus.<br />
<br />
[[File:FluorosisTeeth.jpg|250px|right|thumb|The consequences of fluoride contamination of ground water. Fluoride has been shown to damage the enamel of teeth in children between the ages of 0-8. This dental fluorosis is often accompanied by skeletal fluorosis, associated with skeletal pain and problems with movement. Excessive fluoride ingestion has also been linked to neurological damage in young children.]]<br />
<br />
<br />
<span style="color:green">'''Who is our market?'''</span><br />
<br />
Groundwater contamination can be caused by a variety of factors ranging from natural disasters to improper disposal of industrial waste. Within the topic of groundwater contamination therefore, there is still substantial variety among potential customers. We anticipate that these customers will be looking at levels of a variety of contaminants in different areas though we anticipate that they will need their testing system to provide reliable, accurate quantitative data about more than one contaminant and that testing will probably involve multiple tests over a prolonged time span. Customers may include researchers, charity workers, public health workers or heavy industries aiming to reduce their environmental impact.<br />
<br />
<br />
<span style="color:green">'''What are the current options available?'''</span><br />
<br />
Because of the rural nature of many of the presumed testing sites, standard laboratory equipment is impractical. A portable system is therefore a necessity.<br />
<br />
Currently, two main types of sensing system are readily available for purchase.<br />
<br />
The first is a strip test system. The great advantages of this system is that it is far cheaper than the alternative and highly portable – the strips are extremely light and can easily be carried in pockets if more than one site within a location is to be tested. It is also quick and easy to acquire. Searching the internet for ‘groundwater testing kit’ brings up dozens of websites from which these systems can be purchased instantly and in the possession of the customer within days.<br />
<br />
The downsides to this system are that:<br />
<br />
# the tests are disposable and suitable for a single use only meaning that many have to be used and the product continuously repurchased if long term testing is going to be considered.<br />
# each strip will only test for one contaminant. Where a groundwater source is contaminated, it is unlikely that only a single potential contaminant will be of interest. For highly focussed research this may be acceptable, but in the case of broader research more than one kind of test strip will almost certainly be needed, and as with the problem of disposability, this will push up the costs.<br />
# These tests are often not highly quantitative – quantitative to the extent of orders of magnitude but without providing precise information about contamination levels which makes them unsuitable for detailed examination of contamination levels at a source, especially if the study involves taking multiple readings over a period of time, when the change could be small.<br />
<br />
[[File:TestkitComparison.jpeg|250px|left|thumb|A comparison of the <html><u><a href="https://2012.igem.org/Team:Cambridge/HumanPractices/Interview" style="color:#000066">ARSOlux kit</a></u></html> (160 assays) (left) - a bioreporter kit - and the Arsonator kit (60 assays) (right) - an electronic water testing system. From Siegfried et al. Environ. Sci. Technol. 2012]]<br />
<br />
The other major option is an electronic water testing system. These have the advantages of being far more quantitative, largely reusable and often considering more than one contaminant within the same system. As with the strip tests however, there are major disadvantages. <br />
<br />
# acquiring these systems is not as easy. Often, instead of prices being offered, a quote must be obtained. A level of customisation is sometimes possible with the technology but it is invariably by far the more expensive of the two options.<br />
# electronic systems tend to be bigger and heavier, with complete systems often coming in bulky cases that would be difficult to transport without a vehicle. These systems act more as a field lab, and as such portability is vastly reduced.<br />
<br />
The major disadvantages to these systems are on one side a lack of quantitative results and reusability and on the other high, often prohibitive, costs.<br />
<br />
<br />
<span style="color:green">'''How our system is different'''</span><br />
<br />
Our system has been designed to be relatively low cost and the prices we have paid in producing the project, while not high, would be dramatically reduced by mass production. The system is light and portable but, between the output system and the implementation system, provides highly quantitative data. While the cuvettes and bacteria are single use, the implementation system is reusable. <br />
<br />
We consider there to be a potential market for a reliable, accurate, precise, quantitative measuring system that without the price tag of current electronic systems. We also feel that our system could fill this niche.<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
<br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="hor_overview" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/HumanPractices/MarketResearch"><br />
<div id="hor_marketresearch_on" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/HumanPractices/OutreachCollaboration"><br />
<div id="hor_outreach" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/HumanPractices/FutureDirections"><br />
<div id="hor_futuredirections" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/HumanPractices/OutreachCollaboration"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Diary/Week_4Team:Cambridge/Diary/Week 42012-10-27T03:56:48Z<p>Olijme: /* Thursday */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<div id="template_content_wide" style="position: absolute; top: 200px; left: 40px; height: 620px; width: 1110px; overflow: auto; overflow-y: scroll;"><br />
<br />
</html><br />
<br />
{|align="center"<br />
!align="center"|Week:<br />
!align="center"|[[Team:Cambridge/Diary/Week 1|1]] <br />
!align="center"|[[Team:Cambridge/Diary/Week 2|2]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 3|3]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 4|4]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 5|5]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 6|6]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 7|7]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 8|8]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 9|9]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 10|10]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 11|11]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 12|12]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 13|13]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 14|14]]<br />
!align="center"|[[Team:Cambridge/Diary/TheFinalMonth|The Final Month]]<br />
|}<br />
<br />
===Monday===<br />
<br />
Scandal in the lab! It appears that someone at Caltech has edited our wiki, initially inserting the word 'chicken' into our project page. Then they broke our Java script - potentially accidentally. Easily rectified, but still irritating, especially since the project description deadline was yesterday. Have we been the victim of a not-so-droll ivy league-ish prank? Or is some oddly minded person co-opting this student's account? We've emailed their project supervisor, so hopefully it shouldn't happen again.<br />
<br />
One night seems to have been too little time to accurately determine if the transformation worked, as we now have lots of e.coli colonies on the plates. The ''bacillus'' plates have not been so successful, but the plasmid was not optimized to ''bacillus'', potentially explaining their failure. We will need to make sure that we include more controls in future to work out where our experiments fail, if they should fail.<br />
<br />
In any case, we were able to induce the pBAD promoter with arabinose in the e.coli cells. Results can be seen in the lab book page. We also streaked some further plates to grow up some more transformed e.coli, and inoculated some cells in liquid medium which will hopefully be ready to be tested tomorrow.<br />
<br />
The construct we are hoping to submit to DNA 2.0 has also been partially designed. The fusion of the lux &alpha; subunit and the mOrange protein has been completed, as described in the [[Team:Cambridge/Ratiometrica/Overview|project page]]. The v.haveyi operon that we are hoping to have codon optimized has also been tided up, with more appropriate spacings between the genes.<br />
<br />
Additionally, Andreas managed to finish his Arduino device. It now gives a response that is proportional to the ratio of the light intensities on the two light dependent resistors. By using a couple of coloured filters over the top of these resistors, we can measure the necessary spectral properties of our engineered luciferases. All the engineers need to do now is come up with a user interface.<br />
<br />
===Tuesday===<br />
<br />
Apologies from the editing parties at Caltech, apparently the remaining changes were not meant to be there. Unfortunately they also edited Brown's wiki. A storm may be brewing, depending how seriously they take the changes...<br />
<br />
Anyway, apart from that little drama, lots happened in the lab today. Jolyon recieved his magnesium ion riboswitch primers - see what we did with them in the lab book.<br />
<br />
Tom worked on making the construct we need to get ordered from DNA 2.0 using their program Gene Designer. He ran into a few issues, but Jim A. was able to give a few hints, and put him into contact with some friendly people in Newcastle who specialize in working with ''bacillus''. If they don't know the answers, no one will.<br />
<br />
Paul and Emmy are running into slight trouble with getting the right arabinose concentration for induction of luciferase production for the E. coli. It seems that with the optimum concentration suggested by previous years' teams there was very little light- so we added more arabinose. Cells are still not giving out any visible amount of light after 5 hours, and we now suspect that we might have killed the cells with too much sugar.<br />
<br />
We're also having some problems deciding what approach to take with the input side of things. Our system should be very flexible, so it would be good to use many different biobricks from the registry. However, very few have been characterized in ''bacillus''. Ideally we would want to find some way of transferring existing biobricks from e.coli so that they were reliable in ''bacillus'', but we may find getting the right sensory proteins into ''bacillus'' complex. The idea was floated that we might want to approach the problem as a business problem, and do some market research into what the hypothetical end consumers of our product might want to sense. This would mean pitching to a specific group, potentially obscuring the main point of the project (the breadth and flexibility of the lux based system and its quantitative measurement of concentrations). For example, if we decided to create an agricultural kit as our prototype kit, we would want to create nitrate sensors, iron sensors, osmolarity sensors, fluride sensors etc. However, this would mean leaving out some very interesting additional sensory components. See what we eventually went with on our [[Team:Cambridge/HumanPractices/Overview|human practices page]].<br />
<br />
===Wednesday===<br />
<br />
The day started with gel electrophoresis of the PCR fragments that were made yesterday. As can be seen in the lab book, our genomic extraction appears to have been successful. However, we haven't managed to make our vector properly. Another day of PCR and gel electrophoresis, I fear...<br />
<br />
Paul and Emmy inoculated cells from the streaked plates in liquid medium- hopefully these will work.<br />
<br />
Prototyping of the hardware that we are hoping to use progressed to foam. Andreas is hoping to make the structure look more professional-like by spraying it with various faintly toxic (yet shiny) aerosols.<br />
<br />
In the afternoon James Brown gave an inspiring talk, leading to us redefining our modules and goals. We also have a clearer idea on what our individual roles are.<br />
<br />
===Thursday===<br />
<br />
PCR with more controls and repeats, with slightly tweaked PCR parameters, resulted in yet more failure. The primers probably need to be redesigned.<br />
<br />
Tom gets even deeper into construct design, with some light primer design for some of the simpler constructs to break up the day. With help from Orr from Jim A's lab, we were able to identify some constitutive promoters that we could use in the ratiometric construct. We further discovered that potentially all of the components that we need for the construct are in the iGEM 2012 Spring Distribution Kit! So we could start straight away once we have got the primers.<br />
<br />
Our final designation or the team also occurred today, with us formalising our plans for the Summer in terms of the modules we are hoping to undertake. If all goes well, you should be able to see our modules under the [[Team:Cambridge/Overview/Overview|project page]].<br />
<br />
===Friday===<br />
<br />
Charlie had a brief chat with Dr. Vijayraghavan about potential applications of our project. She offered some useful advice given her proximity to the Bangalore and Caltech teams. See what she had to say in the [[Team:Cambridge/HumanPractices/Overview|human practices page]].<br />
<br />
Our newly inoculated bacteria shine ever brighter, with their induction by arabinose creating more successful results than before. In particular, Andreas and Emmy took them down to the dark room and tested if Andrea's electronics were sensitive to the light levels given off by the cultures. And surprisingly enough, it worked! A consistent 5-6% increase of the original base reading. The change was reliable and repeatable. The only worry is the time period for which light is produced by the bacteria after induction; full luminesence only takes place about 5 hours after the inducing arabinose is added.<br />
<br />
Construct design by Tom continued, with the construct for the ratiometric emission by YFP and CFP based upon inducer concentration being made in a couple of hours. Difficulties persist with the construction of the lux operon for bacillus however. There really isn't enough data in the literature to make the RBS's properly - something which we may aim to rectify.<br />
<br />
Lastly, the primer redesign was successful. Unfortunately, primer ordering is hampered by a lack of any add to basket button on the Sigma-Aldritch. Even more unfortunately, this week seems to be holiday week for the whole of the department, and everyone who could help is away. Something may have to be done over the weekend.<br />
<br />
<html><br />
</div><br />
</html><br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Diary/Week_4Team:Cambridge/Diary/Week 42012-10-27T03:56:26Z<p>Olijme: /* Friday */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<div id="template_content_wide" style="position: absolute; top: 200px; left: 40px; height: 620px; width: 1110px; overflow: auto; overflow-y: scroll;"><br />
<br />
</html><br />
<br />
{|align="center"<br />
!align="center"|Week:<br />
!align="center"|[[Team:Cambridge/Diary/Week 1|1]] <br />
!align="center"|[[Team:Cambridge/Diary/Week 2|2]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 3|3]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 4|4]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 5|5]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 6|6]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 7|7]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 8|8]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 9|9]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 10|10]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 11|11]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 12|12]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 13|13]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 14|14]]<br />
!align="center"|[[Team:Cambridge/Diary/TheFinalMonth|The Final Month]]<br />
|}<br />
<br />
===Monday===<br />
<br />
Scandal in the lab! It appears that someone at Caltech has edited our wiki, initially inserting the word 'chicken' into our project page. Then they broke our Java script - potentially accidentally. Easily rectified, but still irritating, especially since the project description deadline was yesterday. Have we been the victim of a not-so-droll ivy league-ish prank? Or is some oddly minded person co-opting this student's account? We've emailed their project supervisor, so hopefully it shouldn't happen again.<br />
<br />
One night seems to have been too little time to accurately determine if the transformation worked, as we now have lots of e.coli colonies on the plates. The ''bacillus'' plates have not been so successful, but the plasmid was not optimized to ''bacillus'', potentially explaining their failure. We will need to make sure that we include more controls in future to work out where our experiments fail, if they should fail.<br />
<br />
In any case, we were able to induce the pBAD promoter with arabinose in the e.coli cells. Results can be seen in the lab book page. We also streaked some further plates to grow up some more transformed e.coli, and inoculated some cells in liquid medium which will hopefully be ready to be tested tomorrow.<br />
<br />
The construct we are hoping to submit to DNA 2.0 has also been partially designed. The fusion of the lux &alpha; subunit and the mOrange protein has been completed, as described in the [[Team:Cambridge/Ratiometrica/Overview|project page]]. The v.haveyi operon that we are hoping to have codon optimized has also been tided up, with more appropriate spacings between the genes.<br />
<br />
Additionally, Andreas managed to finish his Arduino device. It now gives a response that is proportional to the ratio of the light intensities on the two light dependent resistors. By using a couple of coloured filters over the top of these resistors, we can measure the necessary spectral properties of our engineered luciferases. All the engineers need to do now is come up with a user interface.<br />
<br />
===Tuesday===<br />
<br />
Apologies from the editing parties at Caltech, apparently the remaining changes were not meant to be there. Unfortunately they also edited Brown's wiki. A storm may be brewing, depending how seriously they take the changes...<br />
<br />
Anyway, apart from that little drama, lots happened in the lab today. Jolyon recieved his magnesium ion riboswitch primers - see what we did with them in the lab book.<br />
<br />
Tom worked on making the construct we need to get ordered from DNA 2.0 using their program Gene Designer. He ran into a few issues, but Jim A. was able to give a few hints, and put him into contact with some friendly people in Newcastle who specialize in working with ''bacillus''. If they don't know the answers, no one will.<br />
<br />
Paul and Emmy are running into slight trouble with getting the right arabinose concentration for induction of luciferase production for the E. coli. It seems that with the optimum concentration suggested by previous years' teams there was very little light- so we added more arabinose. Cells are still not giving out any visible amount of light after 5 hours, and we now suspect that we might have killed the cells with too much sugar.<br />
<br />
We're also having some problems deciding what approach to take with the input side of things. Our system should be very flexible, so it would be good to use many different biobricks from the registry. However, very few have been characterized in ''bacillus''. Ideally we would want to find some way of transferring existing biobricks from e.coli so that they were reliable in ''bacillus'', but we may find getting the right sensory proteins into ''bacillus'' complex. The idea was floated that we might want to approach the problem as a business problem, and do some market research into what the hypothetical end consumers of our product might want to sense. This would mean pitching to a specific group, potentially obscuring the main point of the project (the breadth and flexibility of the lux based system and its quantitative measurement of concentrations). For example, if we decided to create an agricultural kit as our prototype kit, we would want to create nitrate sensors, iron sensors, osmolarity sensors, fluride sensors etc. However, this would mean leaving out some very interesting additional sensory components. See what we eventually went with on our [[Team:Cambridge/HumanPractices/Overview|human practices page]].<br />
<br />
===Wednesday===<br />
<br />
The day started with gel electrophoresis of the PCR fragments that were made yesterday. As can be seen in the lab book, our genomic extraction appears to have been successful. However, we haven't managed to make our vector properly. Another day of PCR and gel electrophoresis, I fear...<br />
<br />
Paul and Emmy inoculated cells from the streaked plates in liquid medium- hopefully these will work.<br />
<br />
Prototyping of the hardware that we are hoping to use progressed to foam. Andreas is hoping to make the structure look more professional-like by spraying it with various faintly toxic (yet shiny) aerosols.<br />
<br />
In the afternoon James Brown gave an inspiring talk, leading to us redefining our modules and goals. We also have a clearer idea on what our individual roles are.<br />
<br />
===Thursday===<br />
<br />
PCR with more controls and repeats, with slightly tweaked PCR parameters, resulted in yet more failure. The primers probably need to be redesigned.<br />
<br />
Tom gets even deeper into construct design, with some light primer design for some of the simpler constructs to break up the day. With help from Orr from Jim A's lab, we were able to identify some constitutive promoters that we could use in the ratiometric construct. We further discovered that potentially all of the components that we need for the construct are in the iGEM 2012 Spring Distribution Kit! So we could start straight away once we have got the primers.<br />
<br />
Our final designation or the team also occurred today, with us formalising our plans for the Summer in terms of the modules we are hoping to undertake. If all goes well, you should be able to see our modules under the [[Team:Cambridge/Project|project page]].<br />
<br />
===Friday===<br />
<br />
Charlie had a brief chat with Dr. Vijayraghavan about potential applications of our project. She offered some useful advice given her proximity to the Bangalore and Caltech teams. See what she had to say in the [[Team:Cambridge/HumanPractices/Overview|human practices page]].<br />
<br />
Our newly inoculated bacteria shine ever brighter, with their induction by arabinose creating more successful results than before. In particular, Andreas and Emmy took them down to the dark room and tested if Andrea's electronics were sensitive to the light levels given off by the cultures. And surprisingly enough, it worked! A consistent 5-6% increase of the original base reading. The change was reliable and repeatable. The only worry is the time period for which light is produced by the bacteria after induction; full luminesence only takes place about 5 hours after the inducing arabinose is added.<br />
<br />
Construct design by Tom continued, with the construct for the ratiometric emission by YFP and CFP based upon inducer concentration being made in a couple of hours. Difficulties persist with the construction of the lux operon for bacillus however. There really isn't enough data in the literature to make the RBS's properly - something which we may aim to rectify.<br />
<br />
Lastly, the primer redesign was successful. Unfortunately, primer ordering is hampered by a lack of any add to basket button on the Sigma-Aldritch. Even more unfortunately, this week seems to be holiday week for the whole of the department, and everyone who could help is away. Something may have to be done over the weekend.<br />
<br />
<html><br />
</div><br />
</html><br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Diary/Week_4Team:Cambridge/Diary/Week 42012-10-27T03:55:37Z<p>Olijme: /* Tuesday */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<div id="template_content_wide" style="position: absolute; top: 200px; left: 40px; height: 620px; width: 1110px; overflow: auto; overflow-y: scroll;"><br />
<br />
</html><br />
<br />
{|align="center"<br />
!align="center"|Week:<br />
!align="center"|[[Team:Cambridge/Diary/Week 1|1]] <br />
!align="center"|[[Team:Cambridge/Diary/Week 2|2]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 3|3]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 4|4]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 5|5]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 6|6]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 7|7]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 8|8]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 9|9]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 10|10]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 11|11]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 12|12]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 13|13]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 14|14]]<br />
!align="center"|[[Team:Cambridge/Diary/TheFinalMonth|The Final Month]]<br />
|}<br />
<br />
===Monday===<br />
<br />
Scandal in the lab! It appears that someone at Caltech has edited our wiki, initially inserting the word 'chicken' into our project page. Then they broke our Java script - potentially accidentally. Easily rectified, but still irritating, especially since the project description deadline was yesterday. Have we been the victim of a not-so-droll ivy league-ish prank? Or is some oddly minded person co-opting this student's account? We've emailed their project supervisor, so hopefully it shouldn't happen again.<br />
<br />
One night seems to have been too little time to accurately determine if the transformation worked, as we now have lots of e.coli colonies on the plates. The ''bacillus'' plates have not been so successful, but the plasmid was not optimized to ''bacillus'', potentially explaining their failure. We will need to make sure that we include more controls in future to work out where our experiments fail, if they should fail.<br />
<br />
In any case, we were able to induce the pBAD promoter with arabinose in the e.coli cells. Results can be seen in the lab book page. We also streaked some further plates to grow up some more transformed e.coli, and inoculated some cells in liquid medium which will hopefully be ready to be tested tomorrow.<br />
<br />
The construct we are hoping to submit to DNA 2.0 has also been partially designed. The fusion of the lux &alpha; subunit and the mOrange protein has been completed, as described in the [[Team:Cambridge/Ratiometrica/Overview|project page]]. The v.haveyi operon that we are hoping to have codon optimized has also been tided up, with more appropriate spacings between the genes.<br />
<br />
Additionally, Andreas managed to finish his Arduino device. It now gives a response that is proportional to the ratio of the light intensities on the two light dependent resistors. By using a couple of coloured filters over the top of these resistors, we can measure the necessary spectral properties of our engineered luciferases. All the engineers need to do now is come up with a user interface.<br />
<br />
===Tuesday===<br />
<br />
Apologies from the editing parties at Caltech, apparently the remaining changes were not meant to be there. Unfortunately they also edited Brown's wiki. A storm may be brewing, depending how seriously they take the changes...<br />
<br />
Anyway, apart from that little drama, lots happened in the lab today. Jolyon recieved his magnesium ion riboswitch primers - see what we did with them in the lab book.<br />
<br />
Tom worked on making the construct we need to get ordered from DNA 2.0 using their program Gene Designer. He ran into a few issues, but Jim A. was able to give a few hints, and put him into contact with some friendly people in Newcastle who specialize in working with ''bacillus''. If they don't know the answers, no one will.<br />
<br />
Paul and Emmy are running into slight trouble with getting the right arabinose concentration for induction of luciferase production for the E. coli. It seems that with the optimum concentration suggested by previous years' teams there was very little light- so we added more arabinose. Cells are still not giving out any visible amount of light after 5 hours, and we now suspect that we might have killed the cells with too much sugar.<br />
<br />
We're also having some problems deciding what approach to take with the input side of things. Our system should be very flexible, so it would be good to use many different biobricks from the registry. However, very few have been characterized in ''bacillus''. Ideally we would want to find some way of transferring existing biobricks from e.coli so that they were reliable in ''bacillus'', but we may find getting the right sensory proteins into ''bacillus'' complex. The idea was floated that we might want to approach the problem as a business problem, and do some market research into what the hypothetical end consumers of our product might want to sense. This would mean pitching to a specific group, potentially obscuring the main point of the project (the breadth and flexibility of the lux based system and its quantitative measurement of concentrations). For example, if we decided to create an agricultural kit as our prototype kit, we would want to create nitrate sensors, iron sensors, osmolarity sensors, fluride sensors etc. However, this would mean leaving out some very interesting additional sensory components. See what we eventually went with on our [[Team:Cambridge/HumanPractices/Overview|human practices page]].<br />
<br />
===Wednesday===<br />
<br />
The day started with gel electrophoresis of the PCR fragments that were made yesterday. As can be seen in the lab book, our genomic extraction appears to have been successful. However, we haven't managed to make our vector properly. Another day of PCR and gel electrophoresis, I fear...<br />
<br />
Paul and Emmy inoculated cells from the streaked plates in liquid medium- hopefully these will work.<br />
<br />
Prototyping of the hardware that we are hoping to use progressed to foam. Andreas is hoping to make the structure look more professional-like by spraying it with various faintly toxic (yet shiny) aerosols.<br />
<br />
In the afternoon James Brown gave an inspiring talk, leading to us redefining our modules and goals. We also have a clearer idea on what our individual roles are.<br />
<br />
===Thursday===<br />
<br />
PCR with more controls and repeats, with slightly tweaked PCR parameters, resulted in yet more failure. The primers probably need to be redesigned.<br />
<br />
Tom gets even deeper into construct design, with some light primer design for some of the simpler constructs to break up the day. With help from Orr from Jim A's lab, we were able to identify some constitutive promoters that we could use in the ratiometric construct. We further discovered that potentially all of the components that we need for the construct are in the iGEM 2012 Spring Distribution Kit! So we could start straight away once we have got the primers.<br />
<br />
Our final designation or the team also occurred today, with us formalising our plans for the Summer in terms of the modules we are hoping to undertake. If all goes well, you should be able to see our modules under the [[Team:Cambridge/Project|project page]].<br />
<br />
===Friday===<br />
<br />
Charlie had a brief chat with Dr. Vijayraghavan about potential applications of our project. She offered some useful advice given her proximity to the Bangalore and Caltech teams. See what she had to say in the human practices page '''link!'''.<br />
<br />
Our newly inoculated bacteria shine ever brighter, with their induction by arabinose creating more successful results than before. In particular, Andreas and Emmy took them down to the dark room and tested if Andrea's electronics were sensitive to the light levels given off by the cultures. And surprisingly enough, it worked! A consistent 5-6% increase of the original base reading. The change was reliable and repeatable. The only worry is the time period for which light is produced by the bacteria after induction; full luminesence only takes place about 5 hours after the inducing arabinose is added.<br />
<br />
Construct design by Tom continued, with the construct for the ratiometric emission by YFP and CFP based upon inducer concentration being made in a couple of hours. Difficulties persist with the construction of the lux operon for bacillus however. There really isn't enough data in the literature to make the RBS's properly - something which we may aim to rectify.<br />
<br />
Lastly, the primer redesign was successful. Unfortunately, primer ordering is hampered by a lack of any add to basket button on the Sigma-Aldritch. Even more unfortunately, this week seems to be holiday week for the whole of the department, and everyone who could help is away. Something may have to be done over the weekend.<br />
<br />
<html><br />
</div><br />
</html><br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Diary/Week_4Team:Cambridge/Diary/Week 42012-10-27T03:55:19Z<p>Olijme: /* Tuesday */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<div id="template_content_wide" style="position: absolute; top: 200px; left: 40px; height: 620px; width: 1110px; overflow: auto; overflow-y: scroll;"><br />
<br />
</html><br />
<br />
{|align="center"<br />
!align="center"|Week:<br />
!align="center"|[[Team:Cambridge/Diary/Week 1|1]] <br />
!align="center"|[[Team:Cambridge/Diary/Week 2|2]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 3|3]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 4|4]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 5|5]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 6|6]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 7|7]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 8|8]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 9|9]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 10|10]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 11|11]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 12|12]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 13|13]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 14|14]]<br />
!align="center"|[[Team:Cambridge/Diary/TheFinalMonth|The Final Month]]<br />
|}<br />
<br />
===Monday===<br />
<br />
Scandal in the lab! It appears that someone at Caltech has edited our wiki, initially inserting the word 'chicken' into our project page. Then they broke our Java script - potentially accidentally. Easily rectified, but still irritating, especially since the project description deadline was yesterday. Have we been the victim of a not-so-droll ivy league-ish prank? Or is some oddly minded person co-opting this student's account? We've emailed their project supervisor, so hopefully it shouldn't happen again.<br />
<br />
One night seems to have been too little time to accurately determine if the transformation worked, as we now have lots of e.coli colonies on the plates. The ''bacillus'' plates have not been so successful, but the plasmid was not optimized to ''bacillus'', potentially explaining their failure. We will need to make sure that we include more controls in future to work out where our experiments fail, if they should fail.<br />
<br />
In any case, we were able to induce the pBAD promoter with arabinose in the e.coli cells. Results can be seen in the lab book page. We also streaked some further plates to grow up some more transformed e.coli, and inoculated some cells in liquid medium which will hopefully be ready to be tested tomorrow.<br />
<br />
The construct we are hoping to submit to DNA 2.0 has also been partially designed. The fusion of the lux &alpha; subunit and the mOrange protein has been completed, as described in the [[Team:Cambridge/Ratiometrica/Overview|project page]]. The v.haveyi operon that we are hoping to have codon optimized has also been tided up, with more appropriate spacings between the genes.<br />
<br />
Additionally, Andreas managed to finish his Arduino device. It now gives a response that is proportional to the ratio of the light intensities on the two light dependent resistors. By using a couple of coloured filters over the top of these resistors, we can measure the necessary spectral properties of our engineered luciferases. All the engineers need to do now is come up with a user interface.<br />
<br />
===Tuesday===<br />
<br />
Apologies from the editing parties at Caltech, apparently the remaining changes were not meant to be there. Unfortunately they also edited Brown's wiki. A storm may be brewing, depending how seriously they take the changes...<br />
<br />
Anyway, apart from that little drama, lots happened in the lab today. Jolyon recieved his magnesium ion riboswitch primers - see what we did with them in the lab book.<br />
<br />
Tom worked on making the construct we need to get ordered from DNA 2.0 using their program Gene Designer. He ran into a few issues, but Jim A. was able to give a few hints, and put him into contact with some friendly people in Newcastle who specialize in working with ''bacillus''. If they don't know the answers, no one will.<br />
<br />
Paul and Emmy are running into slight trouble with getting the right arabinose concentration for induction of luciferase production for the E. coli. It seems that with the optimum concentration suggested by previous years' teams there was very little light- so we added more arabinose. Cells are still not giving out any visible amount of light after 5 hours, and we now suspect that we might have killed the cells with too much sugar.<br />
<br />
We're also having some problems deciding what approach to take with the input side of things. Our system should be very flexible, so it would be good to use many different biobricks from the registry. However, very few have been characterized in ''bacillus''. Ideally we would want to find some way of transferring existing biobricks from e.coli so that they were reliable in ''bacillus'', but we may find getting the right sensory proteins into ''bacillus'' complex. The idea was floated that we might want to approach the problem as a business problem, and do some market research into what the hypothetical end consumers of our product might want to sense. This would mean pitching to a specific group, potentially obscuring the main point of the project (the breadth and flexibility of the lux based system and its quantitative measurement of concentrations). For example, if we decided to create an agricultural kit as our prototype kit, we would want to create nitrate sensors, iron sensors, osmolarity sensors, fluride sensors etc. However, this would mean leaving out some very interesting additional sensory components. See what we eventually went with on our human [[Team:Cambridge/HumanPractices/Overview|practices page]].<br />
<br />
===Wednesday===<br />
<br />
The day started with gel electrophoresis of the PCR fragments that were made yesterday. As can be seen in the lab book, our genomic extraction appears to have been successful. However, we haven't managed to make our vector properly. Another day of PCR and gel electrophoresis, I fear...<br />
<br />
Paul and Emmy inoculated cells from the streaked plates in liquid medium- hopefully these will work.<br />
<br />
Prototyping of the hardware that we are hoping to use progressed to foam. Andreas is hoping to make the structure look more professional-like by spraying it with various faintly toxic (yet shiny) aerosols.<br />
<br />
In the afternoon James Brown gave an inspiring talk, leading to us redefining our modules and goals. We also have a clearer idea on what our individual roles are.<br />
<br />
===Thursday===<br />
<br />
PCR with more controls and repeats, with slightly tweaked PCR parameters, resulted in yet more failure. The primers probably need to be redesigned.<br />
<br />
Tom gets even deeper into construct design, with some light primer design for some of the simpler constructs to break up the day. With help from Orr from Jim A's lab, we were able to identify some constitutive promoters that we could use in the ratiometric construct. We further discovered that potentially all of the components that we need for the construct are in the iGEM 2012 Spring Distribution Kit! So we could start straight away once we have got the primers.<br />
<br />
Our final designation or the team also occurred today, with us formalising our plans for the Summer in terms of the modules we are hoping to undertake. If all goes well, you should be able to see our modules under the [[Team:Cambridge/Project|project page]].<br />
<br />
===Friday===<br />
<br />
Charlie had a brief chat with Dr. Vijayraghavan about potential applications of our project. She offered some useful advice given her proximity to the Bangalore and Caltech teams. See what she had to say in the human practices page '''link!'''.<br />
<br />
Our newly inoculated bacteria shine ever brighter, with their induction by arabinose creating more successful results than before. In particular, Andreas and Emmy took them down to the dark room and tested if Andrea's electronics were sensitive to the light levels given off by the cultures. And surprisingly enough, it worked! A consistent 5-6% increase of the original base reading. The change was reliable and repeatable. The only worry is the time period for which light is produced by the bacteria after induction; full luminesence only takes place about 5 hours after the inducing arabinose is added.<br />
<br />
Construct design by Tom continued, with the construct for the ratiometric emission by YFP and CFP based upon inducer concentration being made in a couple of hours. Difficulties persist with the construction of the lux operon for bacillus however. There really isn't enough data in the literature to make the RBS's properly - something which we may aim to rectify.<br />
<br />
Lastly, the primer redesign was successful. Unfortunately, primer ordering is hampered by a lack of any add to basket button on the Sigma-Aldritch. Even more unfortunately, this week seems to be holiday week for the whole of the department, and everyone who could help is away. Something may have to be done over the weekend.<br />
<br />
<html><br />
</div><br />
</html><br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Diary/Week_4Team:Cambridge/Diary/Week 42012-10-27T03:53:04Z<p>Olijme: /* Monday */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<div id="template_content_wide" style="position: absolute; top: 200px; left: 40px; height: 620px; width: 1110px; overflow: auto; overflow-y: scroll;"><br />
<br />
</html><br />
<br />
{|align="center"<br />
!align="center"|Week:<br />
!align="center"|[[Team:Cambridge/Diary/Week 1|1]] <br />
!align="center"|[[Team:Cambridge/Diary/Week 2|2]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 3|3]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 4|4]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 5|5]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 6|6]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 7|7]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 8|8]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 9|9]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 10|10]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 11|11]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 12|12]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 13|13]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 14|14]]<br />
!align="center"|[[Team:Cambridge/Diary/TheFinalMonth|The Final Month]]<br />
|}<br />
<br />
===Monday===<br />
<br />
Scandal in the lab! It appears that someone at Caltech has edited our wiki, initially inserting the word 'chicken' into our project page. Then they broke our Java script - potentially accidentally. Easily rectified, but still irritating, especially since the project description deadline was yesterday. Have we been the victim of a not-so-droll ivy league-ish prank? Or is some oddly minded person co-opting this student's account? We've emailed their project supervisor, so hopefully it shouldn't happen again.<br />
<br />
One night seems to have been too little time to accurately determine if the transformation worked, as we now have lots of e.coli colonies on the plates. The ''bacillus'' plates have not been so successful, but the plasmid was not optimized to ''bacillus'', potentially explaining their failure. We will need to make sure that we include more controls in future to work out where our experiments fail, if they should fail.<br />
<br />
In any case, we were able to induce the pBAD promoter with arabinose in the e.coli cells. Results can be seen in the lab book page. We also streaked some further plates to grow up some more transformed e.coli, and inoculated some cells in liquid medium which will hopefully be ready to be tested tomorrow.<br />
<br />
The construct we are hoping to submit to DNA 2.0 has also been partially designed. The fusion of the lux &alpha; subunit and the mOrange protein has been completed, as described in the [[Team:Cambridge/Ratiometrica/Overview|project page]]. The v.haveyi operon that we are hoping to have codon optimized has also been tided up, with more appropriate spacings between the genes.<br />
<br />
Additionally, Andreas managed to finish his Arduino device. It now gives a response that is proportional to the ratio of the light intensities on the two light dependent resistors. By using a couple of coloured filters over the top of these resistors, we can measure the necessary spectral properties of our engineered luciferases. All the engineers need to do now is come up with a user interface.<br />
<br />
===Tuesday===<br />
<br />
Apologies from the editing parties at Caltech, apparently the remaining changes were not meant to be there. Unfortunately they also edited Brown's wiki. A storm may be brewing, depending how seriously they take the changes...<br />
<br />
Anyway, apart from that little drama, lots happened in the lab today. Jolyon recieved his magnesium ion riboswitch primers - see what we did with them in the lab book.<br />
<br />
Tom worked on making the construct we need to get ordered from DNA 2.0 using their program Gene Designer. He ran into a few issues, but Jim A. was able to give a few hints, and put him into contact with some friendly people in Newcastle who specialize in working with ''bacillus''. If they don't know the answers, no one will.<br />
<br />
Paul and Emmy are running into slight trouble with getting the right arabinose concentration for induction of luciferase production for the E. coli. It seems that with the optimum concentration suggested by previous years' teams there was very little light- so we added more arabinose. Cells are still not giving out any visible amount of light after 5 hours, and we now suspect that we might have killed the cells with too much sugar.<br />
<br />
We're also having some problems deciding what approach to take with the input side of things. Our system should be very flexible, so it would be good to use many different biobricks from the registry. However, very few have been characterized in ''bacillus''. Ideally we would want to find some way of transferring existing biobricks from e.coli so that they were reliable in ''bacillus'', but we may find getting the right sensory proteins into ''bacillus'' complex. The idea was floated that we might want to approach the problem as a business problem, and do some market research into what the hypothetical end consumers of our product might want to sense. This would mean pitching to a specific group, potentially obscuring the main point of the project (the breadth and flexibility of the lux based system and its quantitative measurement of concentrations). For example, if we decided to create an agricultural kit as our prototype kit, we would want to create nitrate sensors, iron sensors, osmolarity sensors, fluride sensors etc. However, this would mean leaving out some very interesting additional sensory components. See what we eventually went with on our human practices page '''link here when we've decided'''.<br />
<br />
===Wednesday===<br />
<br />
The day started with gel electrophoresis of the PCR fragments that were made yesterday. As can be seen in the lab book, our genomic extraction appears to have been successful. However, we haven't managed to make our vector properly. Another day of PCR and gel electrophoresis, I fear...<br />
<br />
Paul and Emmy inoculated cells from the streaked plates in liquid medium- hopefully these will work.<br />
<br />
Prototyping of the hardware that we are hoping to use progressed to foam. Andreas is hoping to make the structure look more professional-like by spraying it with various faintly toxic (yet shiny) aerosols.<br />
<br />
In the afternoon James Brown gave an inspiring talk, leading to us redefining our modules and goals. We also have a clearer idea on what our individual roles are.<br />
<br />
===Thursday===<br />
<br />
PCR with more controls and repeats, with slightly tweaked PCR parameters, resulted in yet more failure. The primers probably need to be redesigned.<br />
<br />
Tom gets even deeper into construct design, with some light primer design for some of the simpler constructs to break up the day. With help from Orr from Jim A's lab, we were able to identify some constitutive promoters that we could use in the ratiometric construct. We further discovered that potentially all of the components that we need for the construct are in the iGEM 2012 Spring Distribution Kit! So we could start straight away once we have got the primers.<br />
<br />
Our final designation or the team also occurred today, with us formalising our plans for the Summer in terms of the modules we are hoping to undertake. If all goes well, you should be able to see our modules under the [[Team:Cambridge/Project|project page]].<br />
<br />
===Friday===<br />
<br />
Charlie had a brief chat with Dr. Vijayraghavan about potential applications of our project. She offered some useful advice given her proximity to the Bangalore and Caltech teams. See what she had to say in the human practices page '''link!'''.<br />
<br />
Our newly inoculated bacteria shine ever brighter, with their induction by arabinose creating more successful results than before. In particular, Andreas and Emmy took them down to the dark room and tested if Andrea's electronics were sensitive to the light levels given off by the cultures. And surprisingly enough, it worked! A consistent 5-6% increase of the original base reading. The change was reliable and repeatable. The only worry is the time period for which light is produced by the bacteria after induction; full luminesence only takes place about 5 hours after the inducing arabinose is added.<br />
<br />
Construct design by Tom continued, with the construct for the ratiometric emission by YFP and CFP based upon inducer concentration being made in a couple of hours. Difficulties persist with the construction of the lux operon for bacillus however. There really isn't enough data in the literature to make the RBS's properly - something which we may aim to rectify.<br />
<br />
Lastly, the primer redesign was successful. Unfortunately, primer ordering is hampered by a lack of any add to basket button on the Sigma-Aldritch. Even more unfortunately, this week seems to be holiday week for the whole of the department, and everyone who could help is away. Something may have to be done over the weekend.<br />
<br />
<html><br />
</div><br />
</html><br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Diary/Week_3Team:Cambridge/Diary/Week 32012-10-27T03:52:00Z<p>Olijme: /* Thursday */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<div id="template_content_wide" style="position: absolute; top: 200px; left: 40px; height: 620px; width: 1110px; overflow: auto; overflow-y: scroll;"><br />
<br />
</html><br />
<br />
<br />
{|align="center"<br />
!align="center"|Week:<br />
!align="center"|[[Team:Cambridge/Diary/Week 1|1]] <br />
!align="center"|[[Team:Cambridge/Diary/Week 2|2]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 3|3]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 4|4]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 5|5]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 6|6]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 7|7]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 8|8]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 9|9]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 10|10]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 11|11]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 12|12]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 13|13]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 14|14]]<br />
!align="center"|[[Team:Cambridge/Diary/TheFinalMonth|The Final Month]]<br />
|}<br />
<br />
<br />
===Monday===<br />
<br />
We aimed to start doing something towards our project today. To this end, Tom and Oli began making up a batch of competent ''bacillus'' (strain 168) for freezing and future use. The protocol for this can be found [[Team:Cambridge/Protocols/TransformationofB.subtilis|here]].<br />
<br />
Paul and Andreas went over to the photonics department to begin the process of making our circuit for the analysis of the bacterial luciferase signal. They also began formalizing the design of the actual instrumentation so it could be made over the next few days.<br />
<br />
Jolyon managed to find an endogenous fluoride riboswitch that had been reported in bacillus subtilis. As a novel biobrick, this would have obvious applications in the analysis of water purity. Such a device could also be pitched at persons a la General Ripper, concerned about fluride contaminating their "precious bodily fluids", though such a marketing strategy could produce somewhat sporadic orders. <br />
<br />
Some of us also started using the faintly egomaniacal geneious program for the analysis of DNA. <br />
<br />
All in all, a fairly productive first day!<br />
<br />
===Tuesday===<br />
<br />
Oli and Tom continued with the rather elongated protocol for creating competent ''bacillus''. <br />
<br />
Jolyon contacted the team in Yale who had discovered the ''bacillus'' based riboswitch for the detection of fluoride. Hopefullly we should be able to integrate it into some sort of reasonably fast acting novel bacterial biosensor which we can then hook up to our standardized bioluminescence. In order to bring about this standardization, Andreas introduced the biologists to some of the principles of control theory, so we had some of the conceptual tools to change the shapes of the input/output curves. One important possibility is using these control theory principles to reduce the noise of the response.<br />
<br />
Andreas and Paul also started on the software for our device today. Our current plan is to use an Arduino board to detect our inputs, communicate this information to a python script and then present this on a user interface. Very snazzy.<br />
<br />
In addition to this, Emmy got the completed home page online! Considerable! A graphic designer as well as a biologist in our midst...<br />
<br />
===Wednesday===<br />
<br />
The first results of our light sensor made by Andreas and the user interface made by Paul came out today. See the lab book for the results.<br />
<br />
We also built up a schedule for when each of our individual modules should be finished by. Our final schedule can be seen on the calendar. Hopefully we shouldn't look too unprepared when UEA visit tomorrow. By the way, UEA are visiting tomorrow.<br />
<br />
Continued wrangling for the already constructed plasmids also took place, with Tom trying to get his hands on an optimized lux operon for use in ''bacillus''. Whether or not it is actually codon optimized is, at this time, unknown. If the worst comes to the worst however, we can just get DNA 2.0 to synthesize the whole thing and optimize it for ''bacillus''. We may have finally found a use for our synthesis budget.<br />
<br />
Lastly, we finally manage to make up and freeze our stocks of ''bacillus''. At eight fifteen, Tom and Oli finally exited the building after a ten hour [[Team:Cambridge/Protocols/TransformationofB.subtilis|protocol]]. At least we won't have to do it again for a while.<br />
<br />
Just how competent our attempts at competency were will be tested tomorrow.<br />
<br />
===Thursday===<br />
<br />
The UEA team visited today. See pictures of their visit in the gallery. Hopefully we should be able to collaborate as soon as they manage to create their biosensor for nitrate.<br />
<br />
Andreas and Oli tried transforming the ''bacillus'' stock we made up yesterday. The plasmid used was Tag RFP-T which gives choramphenicol resistance and should turn the colonies pink. We will have to wait overnight to see if the week has been wasted.<br />
<br />
We've also started designing the primers we need for the various steps in the procedures. Jolyon made some potentially effective ones for extracting the fluoride riboswitch region from the ''bacillus'' genome. Using Gibson assembly, it should then be possible to insert this upstream of our reporter, i.e the mOrange/luciferase fusion. See our [[Team:Cambridge/Ribosense/Overview|project page]] for how we imagine this should turn out in the end.<br />
<br />
===Friday===<br />
<br />
Our transformants actually seem to have worked! See the lab book for a lovely image of our pink colonies.<br />
<br />
Stuart took an inventory of the large quantity of freezer stocks left over from last year. Lots of molecular biology stuff - enzymes, buffers, DNA ladders, loading dyes etc. etc. Plus many helpfully unlabeled tubes from years before 2011. We probably won't be risking those.<br />
<br />
Emmy and Paul worked with the old lux operons from 2010, inserting the plasmids into the ''bacillus'' made up two days ago, as well as into some e.coli. Hopefully we should have some bioluminescence to test by the end of the weekend - useful for the Arduino kit which is becoming ever more developed as the hours go by. <br />
<br />
Cake days were instituted today, with the inaugural sample being Emmy's banana bread. They may also act as excellent bargaining chips for enlisting the aid of reticent PhD students.<br />
<br />
Andreas has managed to find some optical filters, which he later tested in the spectrophotometer. The data was plotted in MATLAB by Oli. Andreas has also discovered that he hates the odour of e.coli. How fortunate that we are working mostly with ''bacillus'' instead, which has the delightful aroma of unwashed feet.<br />
<br />
===Saturday===<br />
<br />
Emmy came in today to check on the e.coli and ''bacillus'' plates she and Paul made up yesterday. They don't seem to have grown...<br />
<br />
<html><br />
</div><br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Diary/Week_2Team:Cambridge/Diary/Week 22012-10-27T03:51:01Z<p>Olijme: /* Tuesday */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<div id="template_content_wide" style="position: absolute; top: 200px; left: 40px; height: 620px; width: 1110px; overflow: auto; overflow-y: scroll;"><br />
<br />
</html><br />
<br />
{|align="center"<br />
!align="center"|Week:<br />
!align="center"|[[Team:Cambridge/Diary/Week 1|1]] <br />
!align="center"|[[Team:Cambridge/Diary/Week 2|2]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 3|3]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 4|4]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 5|5]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 6|6]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 7|7]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 8|8]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 9|9]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 10|10]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 11|11]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 12|12]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 13|13]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 14|14]]<br />
!align="center"|[[Team:Cambridge/Diary/TheFinalMonth|The Final Month]]<br />
|}<br />
<br />
<br />
===Monday===<br />
<br />
We did the final jobs with our sample colonies today, subjecting them to a [[Team:Cambridge/Protocols/RestrictionDigest|restriction digest]] after extracting their DNA with a [[Team:Cambridge/Protocols/MiniPrep|miniprep kit]]. This allowed us to check that the GFP gene had been integrated in the correct way. To aid in this, we were introduced to the plasmid analysis tool ApE, which helped us to choose which restriction enzymes could be used diagnostically. Another crucial ability for the successful integration of artificial plasmids into the bacteria we will be using.<br />
<br />
The restriction fragments were then characterized with DNA gel electrophoresis.<br />
<br />
In between these steps, we continued our brainstorming sessions. We are aiming to have a basic project description complete by Wednesday, so we are really trying to pull together lots of different ideas to create a cohesive project with a well defined end goal. Input from our Human Practices specialist (Charlie) helps with this.<br />
<br />
===Tuesday===<br />
<br />
More brainstorming today. Although the ideas that were pitched in the morning were not particularly promising, we finally hit on a good idea just after coffee. It has the potential to integrate many of the ideas that we already had into a single project, and everyone seems keen to get started on it. A description can be found [[Team:Cambridge/Overview/Overview|here]]. We still need to thrash out the details of the project, but as a general goal it looks highly promising.<br />
<br />
On top of this, we started the wiki properly. Paul, Andreas and Emmy are looking into the ways we can make it look flash with html, css and javascript.<br />
<br />
===Wednesday===<br />
<br />
Today we had a presentation from one of the guys at Microsoft Research, who demonstrated their (very useful) visual GEC tool for constructing and modeling genetic circuits. We had a go at designing a few different systems, learning the syntax and structure of the software. Of particular note was the XOR gate we constructed, which despite being a fairly complex device could quickly and realistically be constructed and modeled without having to spend days building genetic constructs. This could come in very handy, given our ambitions to standardize these many different biosensors - we really want a high throughput system for constructing them, something which is only really feasible if we have a good idea that our constructs will eventually work.<br />
<br />
Later there was a workshop from one of the PhD students in Jim H's lab. He discussed the possibility of using computer programs to model bacterial populations. For example, he demonstrated a program in python that was capable of making simulated bacterial colonies with many of the same emergent properties as those seen in real bacteria.<br />
<br />
The day was capped off with, what else, brainstorming. Aptamers seem to be beginning to gain some interest.<br />
<br />
===Thursday===<br />
<br />
Our focus today was on the electronic side of the project. Jim H. talked to us about the Arduino open source integrated chip, and what things it could be used for. In the afternoon we were set loose with several Arduino kits, learning how to use the programming environment.<br />
<br />
Unfortunately, a single afternoon was not enough time to recapitulate the successes of the Tyrell corporation, but we were still able to come up with a few cool devices. Given that our biosensor idea would ideally be both open source and cheap, using design principles similar to the Arduino could be a lucrative avenue. Additionally, the use of open source electronics such as the Arduino or the Raspberry Pi could directly make our product cheaper and more easily accessible for modification and improvement.<br />
<br />
===Friday===<br />
<br />
The last of the seminars today. This one was about the genetic systems that we will be hijacking with our project (in particular fleshing out the central dogma). A big emphasis on the challenges faced by synthetic biology due to the vast complexity of the chemical systems we are trying to insert new constructs into. However, this just goes further to demonstrate the potential value of our project - managing to put any biosensor into a system and be confident that the genetic system will not simply break could have an incredible impact upon synthetic biology.<br />
<br />
At two o'clock, everyone pitched their own ideas for potential modules. Aptamers, yeast GPCRs and the different techniques for tuning the response curves were presented, along with potential circuits for the instrumentation portion of the project. The ensuing discussion took... some time, but at the end we had a general idea of what to do in the ensuing weeks, on both the biological and technological fronts.<br />
<br />
We still lack any real direction on finding some sort of novel biological system to apply however. Something for us to think about over the weekend.<br />
<br />
<html><br />
</div><br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/SponsorsTeam:Cambridge/Sponsors2012-10-27T03:50:02Z<p>Olijme: </p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<div id="template_content_wide" style="position: absolute; top: 200px; left: 40px; height: 620px; width: 1110px; overflow: auto; overflow-y: scroll;"><br />
<br />
</html><br />
<br />
= Sponsors =<br />
<br />
<br />
Many thanks to all of the sponsors who have made this project possible. A list of our sponsors is displayed below with links to their webpages.<br />
<br />
{|cellspacing="50"<br />
!align="left"|[[Image:Cambio_logo.jpg|200px|link=http://www.cambio.co.uk]]<br />
!align="center"|[[Image:Wtvm050454.jpg |200px|link=http://www.wellcome.ac.uk ]]<br />
!align="right"|[[Image:CAM_dna20.gif|200px|link=http://www.dna20.com]]<br />
|}<br />
<br />
{|cellspacing="50"<br />
!align="left"|[[Image:Logo_ERASynbio.jpeg|200px|link=http://www.erasynbio.net/]]<br />
!align="center"|[[Image:bioline.jpg|200px|link=http://www.bioline.com]]<br />
!align="right"|[[Image:SL_logo.jpg|200px|link=http://www.starlab.co.uk]]<br />
|}<br />
<br />
{|cellspacing="50"<br />
!align="left"|[[Image:Biomatters_logo_med.png|200px|link=http://www.biomatters.com/]]<br />
!align="center"|[[Image:PlantSci.gif|200px|link=http://http://www.plantsci.cam.ac.uk/]]<br />
!align="right"|[[Image:ZoologyDep.png|200px|link=http://www.zoo.cam.ac.uk/]]<br />
|}<br />
<br />
{|cellspacing="50"<br />
!align="center"|[[Image:EngineeringLogo.gif|200px|link=http://www.eng.cam.ac.uk/]]<br />
|}<br />
<br />
= University of Cambridge =<br />
<br />
We would like to express our gratitude to the following departments for supporting the project and our team members' travelling expenses to Amsterdam and Boston:<br />
<br />
*School of Biological Sciences<br />
*Department of Zoology<br />
*Engineering Department<br />
*Department of Plant Sciences<br />
<br />
= Special Thanks =<br />
<br />
The Cambridge iGEM Team would like to offer our most heartfelt thanks to the following people- without them none of this would have been possible.<br />
<br />
==Haseloff Lab, University of Cambridge==<br />
*James Brown<br />
*Fernan Federici<br />
*Paul Grant<br />
*Nuri Purswani<br />
*PJ Steiner<br />
<br />
==Ajioka Lab, University of Cambridge==<br />
*Orr Yarkoni<br />
<br />
==Breaker Lab, Yale University==<br />
Prof. Ronald Breaker's lab at Yale has kindly provided us with the fluoride riboswitch DNA, transformed cells, and valuable advice.<br />
<br />
*Prof. Ronald Breaker<br />
*Keith Corbino<br />
*Narasimhan Sudarsan<br />
<br />
==Department of Molecular, Microbial and Sttructural Biology, University of connecticut Health Center==<br />
Prof. Setlow's lab provided us with the sequences and strains necessary to complete the Fast Germination BioBrick work.<br />
<br />
*Prof. Peter Setlow<br />
*Dr. Barbara Setlow<br />
<br />
==Groningen iGEM 2012==<br />
We have been talking closely with [https://2012.igem.org/Team:Groningen Groningen] regarding our work on sporulation and germination and we'd like to thank them for their tips on Bacillus germination, including suggestion of 'Schaeffer's sporulation media' from which the 2XSG media which we were more successful with is derived. <br />
<br />
==Dr. Konrad Siegfried==<br />
<br />
Many thanks to Dr. Siegfried of the [http://www.ufz.de/arsolux/index.php?en=20709 ARSOlux team] for giving up his precious time to give his advice to the team.<br />
<br />
<html><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/The_ColumnTeam:Cambridge/The Column2012-10-27T03:46:20Z<p>Olijme: </p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<div id="template_content_wide" style="position: absolute; top: 200px; left: 40px; height: 620px; width: 1110px; overflow: auto; overflow-y: scroll;"><br />
<br />
</html><br />
<br />
=The Column=<br />
<br />
[[File:Column1.jpg|240px|left]]<br />
<br />
[[File:Column3.jpg|240px|right]]<br />
<br />
[[File:Column5.jpg|240px|center]]<br />
<br />
[[File:Column2.jpg|240px|center]]<br />
<br />
[[File:Column4.jpg|240px|center]]<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
<br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="hor_overview_on" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/HumanPractices/MarketResearch"><br />
<div id="hor_marketresearch" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/HumanPractices/OutreachCollaboration"><br />
<div id="hor_outreach" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/HumanPractices/FutureDirections"><br />
<div id="hor_futuredirections" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/HumanPractices/MarketResearch"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/HumanPractices/OverviewTeam:Cambridge/HumanPractices/Overview2012-10-27T03:45:30Z<p>Olijme: /* Sharing */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//down<br />
if (keyCode == 40)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Overview");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/HumanPractices/MarketResearch");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Overview"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Overview"><br />
<div id="vert_RS" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Overview"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Overview"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Overview"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
=Overview of Human Practices and Outreach =<br />
<br />
'''iGEM criterion:''' Outline and detail a new approach to an issue of Human Practice in synthetic biology as it relates to your project, such as safety, security, ethics, or ownership, sharing, and innovation.<br />
<br />
<br />
Our human practices this year has been a driving force of our project from the start, defining many of its key features. This part of our project has drawn on the safety, sharing and innovation criteria in a three part sub-project as well as incorporating outreach. In the safety category, we go beyond the iGEM requirement of the safety questions to present our idea of the standard of obvious safety consciousness that teams should provide. In sharing, we explain how the desire to produce a system that would encourage sharing between iGEM teams and allow collaborative projects with greater ease was one of the factors that helped define our project from the start and how the necessity for this became increasingly obvious as the project continued and we faced problems trying to build on the research of other teams.<br />
<br />
===Innovation===<br />
<br />
We took the idea of considering our project as a product. Clearly in its current state it is not a product ready to go to market, but could be considered as a prototype for one that might be. Our system is designed to be used in a huge variety of circumstances, but for the sake of this exercise we have used just one.<br />
<br />
The idea was to consider the process of taking our ‘product’ and putting it in a ‘market'. We have considered a suitable market for the product – in this case groundwater contamination in rural India, weighed up the strengths and weaknesses of currently available systems that cater for this market and how our system differs.<br />
<br />
We then consider the likely problems that would be faced were we attempting to attempt this now, ranging from mistrust of GMOs to bacterial disposal.<br />
<br />
'''Why is this relevant?'''<br />
<br />
The majority of us, whether we pursue careers in research or industry will probably at some point be involved with the production or release of a product. We have tried to use this as a trial run, to show teams what they might expect to come up against. We hope that this might inspire teams to consider human practices as a foundation for their projects as we did. Fluoride contamination was a major factor in the decision to design a system from start to finish that could quantifiably test for fluoride. We hope that this might encourage teams to think innovatively about their project when in the design phase, to consider a real world problem to which their project could be a solution and to consider the problems they might encounter in the course of applying that solution so that they can be tackled in the course of the project.<br />
<br />
Our innovation project can be found [[Team:Cambridge/HumanPractices/MarketResearch|here]].<br />
<br />
===Safety===<br />
<br />
Safety is core to the iGEM competition and all teams must complete a series of safety questions on their wiki to qualify for a medal to prove that they have considered the safety implications of their project as a whole and have set about working in compliance with good laboratory practice. In addition to this criterion we have also produced protocols for reference for all of the techniques we use in the lab. These also have risk assessments for the major risks associated with them and precaution suggestion where appropriate as well as MSDS sheets for all reagents used available in the safety section of our wiki.<br />
<br />
We assume that, like us, most iGEMers do not relish the thought of vast quantities of paperwork to accompany their projects. Our safety criteria do not impose this, but do demand further proof of safety consciousness than current requirements. <br />
<br />
'''Why is this relevant?'''<br />
<br />
The current team has found having this information readily accessible on the wiki (where it cannot be lost or tidied away) to be extremely useful and we consider it the duty of iGEM teams to leave their project in a sufficiently well documented state that future teams could pick up more or less where the previous team stopped. <br />
<br />
Where teams choose to modularise their project into several sub-projects, different teams may be working with different experiments at any given time. It may be weeks before certain teams use techniques that others utilised on their first day. This is where having reliably accessible information comes into its own. Which reagent comes next? It’s on the wiki. Waste disposal? On the wiki. Do I need a mask for this? On the wiki. Is it supposed to go that colour? It’s on the wiki.<br />
<br />
Perhaps more importantly, we have found that constantly updating and adding to the safety element of our project prevented it from slipping to the back of mind. We have found that we spent more time than anticipated considering the safety implications of experiments as we were planning and doing them, in the knowledge that we would be written up formally. <br />
<br />
The provision of detailed protocols, MSDS and at least basic risk assessments can be hugely helpful to future teams, especially students coming to the iGEM competition from non-biological disciplines. Even those of us thoroughly familiar with techniques like PCR found the last team’s notes useful for reference in the early weeks of our project. Many excellent projects have been stopped short because of time constraints. If another team wanted to build on it, they might be able to ask the previous team if it is the next year and at the same institution, but if it is several years before the project catches the imagination of another team, then the wiki is probably all they’ll have to work with.<br />
<br />
===Sharing===<br />
<br />
Early in the summer, when we were trying to define our project, we started thinking about what we wanted it to do. We eventually settled on one of the key principles of synthetic biology – standardisation (strongly promoted by the engineers on the team). Biological research is currently a highly bespoke process with predominantly non-standardised biosensors – a multitude of output systems with a plethora of sensitivity curves exist. This renders individual sets of results amost meaningless as research from different teams is not directly comparable. This limits the capacity for sharing and collaboration as teams are effectively working on their own and this in turn limits the rate of progress.<br />
<br />
To this end our project was focussed on producing a standardised output system with instrumentation for biosensor experiments to promote facilitate sharing and collaboration between iGEM teams, with a myriad of possible applications. A ratiometric system was chosen to provide a reliable quantification system, it was decided that the system should be portable so that it could be used for field research as well as laboratory based research and relatively cheap, to make it accessible to other iGEM teams. We felt it important that the code used in the instrumentation be open source like the rest of the project, so that it could be tweaked by future users to match their needs.<br />
<br />
'''Why is this relevant?'''<br />
<br />
iGEM is open source and high value is placed on sharing, collaboration and building on the work of previous teams. Where there is a lack of standardisation however, it is hard for teams to know what they can expect when working with another team’s project. We have attributed at least some of the problems we have experienced when trying to work with previous teams’ biobricks this summer to this problem.<br />
<br />
We believe that a standardised output for biosensor experiments would be of enormous help to teams, giving them the tools to compare results, share and collaborate more effectively.<br />
<br />
All of these issues were discussed in our interview with Dr. <html><u><a href="https://2012.igem.org/Team:Cambridge/HumanPractices/Interview" style="color:#000066">Konrad Seigfried</a></u></html> , an environmental researcher who is particularly interested in the opportunities that genetically modified biosensors can afford.<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
<br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="hor_overview_on" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/HumanPractices/MarketResearch"><br />
<div id="hor_marketresearch" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/HumanPractices/OutreachCollaboration"><br />
<div id="hor_outreach" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/HumanPractices/FutureDirections"><br />
<div id="hor_futuredirections" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/HumanPractices/MarketResearch"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/HumanPractices/OverviewTeam:Cambridge/HumanPractices/Overview2012-10-27T03:45:00Z<p>Olijme: /* Overview of Human Practices and Outreach */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//down<br />
if (keyCode == 40)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Overview");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/HumanPractices/MarketResearch");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Overview"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Overview"><br />
<div id="vert_RS" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Overview"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Overview"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Overview"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
=Overview of Human Practices and Outreach =<br />
<br />
'''iGEM criterion:''' Outline and detail a new approach to an issue of Human Practice in synthetic biology as it relates to your project, such as safety, security, ethics, or ownership, sharing, and innovation.<br />
<br />
<br />
Our human practices this year has been a driving force of our project from the start, defining many of its key features. This part of our project has drawn on the safety, sharing and innovation criteria in a three part sub-project as well as incorporating outreach. In the safety category, we go beyond the iGEM requirement of the safety questions to present our idea of the standard of obvious safety consciousness that teams should provide. In sharing, we explain how the desire to produce a system that would encourage sharing between iGEM teams and allow collaborative projects with greater ease was one of the factors that helped define our project from the start and how the necessity for this became increasingly obvious as the project continued and we faced problems trying to build on the research of other teams.<br />
<br />
===Innovation===<br />
<br />
We took the idea of considering our project as a product. Clearly in its current state it is not a product ready to go to market, but could be considered as a prototype for one that might be. Our system is designed to be used in a huge variety of circumstances, but for the sake of this exercise we have used just one.<br />
<br />
The idea was to consider the process of taking our ‘product’ and putting it in a ‘market'. We have considered a suitable market for the product – in this case groundwater contamination in rural India, weighed up the strengths and weaknesses of currently available systems that cater for this market and how our system differs.<br />
<br />
We then consider the likely problems that would be faced were we attempting to attempt this now, ranging from mistrust of GMOs to bacterial disposal.<br />
<br />
'''Why is this relevant?'''<br />
<br />
The majority of us, whether we pursue careers in research or industry will probably at some point be involved with the production or release of a product. We have tried to use this as a trial run, to show teams what they might expect to come up against. We hope that this might inspire teams to consider human practices as a foundation for their projects as we did. Fluoride contamination was a major factor in the decision to design a system from start to finish that could quantifiably test for fluoride. We hope that this might encourage teams to think innovatively about their project when in the design phase, to consider a real world problem to which their project could be a solution and to consider the problems they might encounter in the course of applying that solution so that they can be tackled in the course of the project.<br />
<br />
Our innovation project can be found [[Team:Cambridge/HumanPractices/MarketResearch|here]].<br />
<br />
===Safety===<br />
<br />
Safety is core to the iGEM competition and all teams must complete a series of safety questions on their wiki to qualify for a medal to prove that they have considered the safety implications of their project as a whole and have set about working in compliance with good laboratory practice. In addition to this criterion we have also produced protocols for reference for all of the techniques we use in the lab. These also have risk assessments for the major risks associated with them and precaution suggestion where appropriate as well as MSDS sheets for all reagents used available in the safety section of our wiki.<br />
<br />
We assume that, like us, most iGEMers do not relish the thought of vast quantities of paperwork to accompany their projects. Our safety criteria do not impose this, but do demand further proof of safety consciousness than current requirements. <br />
<br />
'''Why is this relevant?'''<br />
<br />
The current team has found having this information readily accessible on the wiki (where it cannot be lost or tidied away) to be extremely useful and we consider it the duty of iGEM teams to leave their project in a sufficiently well documented state that future teams could pick up more or less where the previous team stopped. <br />
<br />
Where teams choose to modularise their project into several sub-projects, different teams may be working with different experiments at any given time. It may be weeks before certain teams use techniques that others utilised on their first day. This is where having reliably accessible information comes into its own. Which reagent comes next? It’s on the wiki. Waste disposal? On the wiki. Do I need a mask for this? On the wiki. Is it supposed to go that colour? It’s on the wiki.<br />
<br />
Perhaps more importantly, we have found that constantly updating and adding to the safety element of our project prevented it from slipping to the back of mind. We have found that we spent more time than anticipated considering the safety implications of experiments as we were planning and doing them, in the knowledge that we would be written up formally. <br />
<br />
The provision of detailed protocols, MSDS and at least basic risk assessments can be hugely helpful to future teams, especially students coming to the iGEM competition from non-biological disciplines. Even those of us thoroughly familiar with techniques like PCR found the last team’s notes useful for reference in the early weeks of our project. Many excellent projects have been stopped short because of time constraints. If another team wanted to build on it, they might be able to ask the previous team if it is the next year and at the same institution, but if it is several years before the project catches the imagination of another team, then the wiki is probably all they’ll have to work with.<br />
<br />
===Sharing===<br />
<br />
Early in the summer, when we were trying to define our project, we started thinking about what we wanted it to do. We eventually settled on one of the key principles of synthetic biology – standardisation (strongly promoted by the engineers on the team). Biological research is currently a highly bespoke process with predominantly non-standardised biosensors – a multitude of output systems with a plethora of sensitivity curves exist. This renders individual sets of results amost meaningless as research from different teams is not directly comparable. This limits the capacity for sharing and collaboration as teams are effectively working on their own and this in turn limits the rate of progress.<br />
<br />
To this end our project was focussed on producing a standardised output system with instrumentation for biosensor experiments to promote facilitate sharing and collaboration between iGEM teams, with a myriad of possible applications. A ratiometric system was chosen to provide a reliable quantification system, it was decided that the system should be portable so that it could be used for field research as well as laboratory based research and relatively cheap, to make it accessible to other iGEM teams. We felt it important that the code used in the instrumentation be open source like the rest of the project, so that it could be tweaked by future users to match their needs.<br />
<br />
'''Why is this relevant?'''<br />
<br />
iGEM is open source and high value is placed on sharing, collaboration and building on the work of previous teams. Where there is a lack of standardisation however, it is hard for teams to know what they can expect when working with another team’s project. We have attributed at least some of the problems we have experienced when trying to work with previous teams’ biobricks this summer to this problem.<br />
<br />
We believe that a standardised output for biosensor experiments would be of enormous help to teams, giving them the tools to compare results, share and collaborate more effectively.<br />
<br />
All of these issues were discussed in our interview with Dr. <html><u><a href="https://2012.igem.org/Team:Cambridge/HumanPractices/Interview" style="color:#000066">ARSOlux kit</a></u></html> , an environmental researcher who is particularly interested in the opportunities that genetically modified biosensors can afford.<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
<br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="hor_overview_on" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/HumanPractices/MarketResearch"><br />
<div id="hor_marketresearch" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/HumanPractices/OutreachCollaboration"><br />
<div id="hor_outreach" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/HumanPractices/FutureDirections"><br />
<div id="hor_futuredirections" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/HumanPractices/MarketResearch"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Ribosense/LabbookTeam:Cambridge/Ribosense/Labbook2012-10-27T03:34:32Z<p>Olijme: /* Week 14 */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Labbook");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= Ribosense Labbook =<br />
<br />
==Week 4 ==<br />
<br />
===Tuesday (17/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of MGRS vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 58 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 180secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain 168 used as template for this experiment.<br />
<br />
* Primers used:<br />
<br />
:* Forward: cggagggagacgattttgTGTTCCGTAATTGTGATGTAAG<br />
<br />
:* Reverse: acaccggcatactctgcgacGTCATAGGTCATGTTTTGAACC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Wednesday (18/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:Mg2+ Gel PCR 1.jpg|250px|right|thumb|Results of gel electrophoresis of PCR fragments from yesterday. 550bp fragments in lanes 2+3 were removed before the image was taken]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2 + 3: Riboswitch DNA from genome (replicates) - 550bp fragment expected.<br />
<br />
:*Lane 4 + 5: Vector DNA from pJS130 (replicates)- Chloramphenicol resistance marker - 9.0kbp fragment expected<br />
<br />
:*Lane 6: Postitive control - 1.9kbp fragment expected<br />
<br />
*Riboswitch DNA was successfully amplified. However, vector DNA was not. Given that the postive control was also successful, it seems likely that something went wrong with some stage before the PCR amplification. We will try to rectify the problem tomorrow.<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of riboswitch DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful riboswitch DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
===Thursday (19/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 55 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 240secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
*Settings changed - Annealing temperature and elongation time - attempting to debug PCR.<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:PCR Gel Mg2+ 2.jpg|right|250px|thumb|PCR products from today. Note the unusual band in the negative control and the vector lanes]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2, 3 + 4: Vector DNA from pJS130 (replicates) - 9.0kbp fragment expected<br />
<br />
:*Lane 5: Postitive control - 1.9kbp fragment expected<br />
<br />
:*Lane 6: Negative control - no fragments expected<br />
<br />
*Once more, the PCR appears to have failed. We will try to redesign the primers tomorrow to make them functional.<br />
<br />
==Week 5==<br />
<br />
===Thursday (26/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome and Lux genes from e.coli genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain pJS130 used as template for riboswitch, colony of previously transformed e.coli used as template for lux operon.<br />
<br />
:*M2+ RS<br />
<br />
::*Forward: cggagggagacgattttg|TGTTCCGTAATTGTGATGTAAG<br />
<br />
::*Reverse: tataacgttactggtttcat|CGGGACTCGTACCTCC<br />
<br />
:*Lux operon<br />
<br />
::*Forward: gctgtacaag|GGAGGAGGAGGAAGTGGAGGAGGAGGAAGT|atgaagtttggaaatatttgtttttc<br />
<br />
::*Reverse: cctcgcccttgctcaccat|ACTCTATTCCTTTTTGGTGATTC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Friday (27/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
{|cellspacing="20"<br />
|[[File:CAM_120727_1_edited.jpg|200px|left|thumb|Vector amplification gel. Lanes 2-4 Lux containing vector. Lanes 5-7 Fluorescent construct vector. No products from this gel were amplified.]]<br />
|[[File:CAM_120727_2_edited.jpg|200px|left|thumb|Various. Lanes 3-5 mOrange amplification. Lanes 6-8 eCFP (E0020) amplification. mOrange amplification did not work.]]<br />
|[[File:CAM_120727_3_edited.jpg|200px|left|thumb|Small products for fluorescent construct. Lanes 1-3 Terminator (B0015). Lanes 4-6 Promotor pVEG + SpoVG (K143053).]]<br />
|-<br />
|[[File:CAM_120727_4_edited.jpg|200px|left|thumb|Various. Lanes 2-4 eYFP (E0030) amplification. Lanes 5-7 Mg2+ vector +8 codons. Lane 8 Mg2+ vector -8 codons. Lane 8 amplification did not work.]]<br />
|[[File:CAM_120727_5_edited.jpg|200px|left|thumb|Mg2+ riboswitch gel. Lanes 6+7 positive and negative controls respectively for entire run. Lanes 3-5 genomic riboswitch amplification -8 codons. Lanes 2+3 vector -8 codons.]]<br />
|}<br />
<br />
*PCR fragments for Mg2+ riboswitch, luxA/mOrange fusion and fluorescent construct from yesterday separated on gels. 90mins at 100V.<br />
<br />
*Mostly successful, but will need to repeat four runs: Three vectors (fluorescent, fusion (lux) and Mg2+ riboswitch (-8 codons) and mOrange gene.<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of successfully amplified DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful CFP, YFP, B0015, Pveg + SpoVG (K143053), riboswitch and vector DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
==Week 6==<br />
<br />
===Monday (30/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vectors and mOrange]]'''<br />
<br />
----<br />
<br />
[[File:mOrangegel.jpg|250px|thumb|mOrange PCR run at multiple temperatures, every two lanes increacing the temperature of the annealing step by 2 &deg;C. No lanes worked.]]<br />
<br />
[[File:vectorgel1.jpg|250px|thumb|Top: Fusion, lux containing vector gel. Lanes 2-4, Vector DNA. Lane 5, +ve control. Lane 6, -ve control. Bottom: Vector gel. Lanes 1-3, Fluorescent construct vector DNA. Lanes 4-6, Riboswitch construct vector DNA.]]<br />
<br />
*Not all products were obtained during Friday's PCR. Most of these missing products were large vector backbones. They are being run again, with a much longer extension time of 300s. If that fails, primers will be ordered to split the vectors into manageable chunks, and the PCR reattempted when they arrive.<br />
<br />
*PCR cycle x35: <br />
<br />
:* 15s Denaturing at 95 C<br />
:* 45s Annealing at 60 C<br />
:* 300s Extension at 72 C<br />
<br />
*Remaining stray product had a slightly tricky secondary structure at the 3' end. It will be run at a series of annealing temperatures in a PCR machine capable of a temperature gradient.<br />
<br />
*mOrange PCR run at many different temperatures, from 62 &deg;C to 76 &deg;C. However this doesn't seem to solve our problem (refer to Gel photos). It seems likely that it is a primer design problem.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Construction of riboswitch plasmid with Gibson Assembly]]'''<br />
<br />
----<br />
<br />
*DNA from lanes 27+28, 27+29, 27+30 from gels run on Friday fused together with Gibson assembly to produce riboswitch construct. This does not have replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
*DNA from lanes 22,23 and 24 fused with riboswitch DNA produced two weeks ago to produce riboswitch construct. This has replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
===Tuesday (01/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of TOP10 E.coli with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into TOP10 e.coli cells and transformants plated out on 100&mu;g/ml ampicillin plates.<br />
<br />
===Wednesday (01/08/12)===<br />
<br />
'''Mg2+ Riboswitch'''<br />
<br />
----<br />
<br />
*Successful colonies produced from transformations two days ago streaked out onto chloramphenicol (5 &mu;g/ml) containing plates.<br />
<br />
*Colonies also grown up in 10ml of medium A for use with plate reader later.<br />
<br />
===Friday (03/08/12)<br />
<br />
''' [[Team:Cambridge/Protocols/PCRProtocol|PCR of split Mg2+ vector]]'''<br />
<br />
----<br />
<br />
[[File:split Mg2+ 1.jpg|left|250px|thumb|results of split magnesium vector PCR. None of the products worked]]<br />
<br />
*PCR of magnesium riboswitch vector repeated with primers to split plasmid.<br />
<br />
*Lanes 2 + 3: Fragment A (center - cut site (promotor side))<br />
<br />
*Lanes 4 + 5: Fragment B (without 8 codon substitution) (cut site (lac I side) - center)<br />
<br />
*Lanes 6 + 7: Fragment B (with 8 codon substitution) (cut stie (lac I side) - center)<br />
<br />
*Gels run, found PCR was unsuccessful.<br />
<br />
===Sunday (05/08/12)===<br />
<br />
'''Ribosense: [[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg Riboswitch vector fragments]]'''<br />
<br />
----<br />
<br />
*2nd attempt since the PCR on Friday did not work, possibly due to mastermix problems<br />
<br />
*PCR Programme:<br />
<br />
*Results: Fragment A was successfully PCR-ed (lanes 3-4); Fragment B did not come out, with or without the 8 codons (lanes 5-6 (-8); lanes 7-8 (+8))<br />
<br />
==Week 7==<br />
<br />
===Monday (06/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Magnesium riboswitch vector fragment B and Magnesium promoter]]'''<br />
<br />
----<br />
<br />
[[File:MgRS vector frag. B.jpg|right|250px|thumb|Riboswitch and promoter gel. Lanes 2+3: Fragment B without 8 codon substitution, lanes 4+5: Fragment B with 8 codon substitution, lanes 6+7: magnesium sensitive promoter, lane 8: +ve control]]<br />
<br />
*Normal PCR settings used, annealing temperature 57 &deg;C, elongation step 90s long.<br />
<br />
*Lane 5 accidentally loaded with a DNA ladder instead of loading dye.<br />
<br />
*Expected fragment sizes:<br />
<br />
:*Lane 2-5: 3kbp<br />
<br />
:*Lane 6-7: 300bp<br />
<br />
*After electrophoresis, found vector products had, for the most part, worked. Promoter elements were not amplified - no band of the expected size was observed.<br />
<br />
*Positive control also failed, although this has ceased to work for several days, potentially due to DNA degradation.<br />
<br />
===Tuesday (07/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of magnesium riboswitch]]'''<br />
<br />
----<br />
<br />
*NAD+ added to '''isothermal buffer'''*5 mix<br />
<br />
*Gel slices from yesterday (of vector fragment B) purified.<br />
<br />
*DNA added as follows:<br />
<br />
:*Without 8 codon substitution:<br />
<br />
::*Reaction 1: Tube 2 (07/08/12) (fragment B), Tube 1 (05/08/12) (fragment A), Tube 28 (29/08/12) (riboswitch DNA).<br />
<br />
::*Reaction 2: Tube 3 (07/08/12) (fragment B), Tube 2 (05/08/12) (fragment A), Tube 29 (29/08/12) (riboswitch DNA).<br />
<br />
:*With 8 codon substitution:<br />
<br />
::*Reaction 3: Tube 4 (07/08/12) (fragment B), Tube 1 (05/08/12) (fragment A), Tube 2 (18/07/12) (riboswitch DNA).<br />
<br />
===Wednesday (08/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/ElectricalTransformation|Electrical transformation of competent e.coli with Gibson products]]'''<br />
<br />
----<br />
<br />
*Gibson constructs from yesterday (fluorescent and magnesium riboswitch) transformed into e.coli produced yesterday.<br />
<br />
*Cells plated out onto 50 &mu;g/ml ampicillin plates. Put in incubator overnight.<br />
<br />
===Friday (10/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay|Characterization of fluoride riboswitch sensitivity with &beta;-galactosidase]]'''<br />
<br />
----<br />
<br />
*X-Gal made up to a concentration of 400 &mu;g/ml with water.<br />
<br />
*Fluoride of concentrations 0.5 - 30 mM mixed with bacterial culture (Yale construct containing) grown up overnight.<br />
<br />
===Saturday (11/08/12)===<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/RestrictionDigest|Restriction digest of Yale plasmid]]'''<br />
<br />
----<br />
<br />
*Cells from electroporation of e.coli with plasmid from Yale (08/08/12) [[Team:Cambridge/Protocols/MiniPrep|miniprepped]] to extract plasmid DNA.<br />
<br />
*DNA digested with XhoI and SalI, expected fragment sizes 5580, 3139, 1437<br />
<br />
*Gel run, results not shown as gel was very 'messy'. Gel had probably already begun to set when poured and so had many artefacts when imaged. As a result each lane required different brightness and contrast settings to visualise and so the full gel was not clearly visible on the printout. However, all of the bands could be identified on the screen and were exactly as expected and very clear and pure.<br />
<br />
*Bands in correct places, indicating that expected plasmid was present in the cells. This indicates that, although they work at a very low efficiency, our electro-competent cells still work. It may be valuable to use these when trying to grow up plasmids that we already have at high concentration. <br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of e.coli with Magnesium riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Gibson products from 07/08/12 transformed into chemically competent cells.<br />
<br />
*Transformants plated out on 100 &mu;g/ml ampicillin plates<br />
<br />
==Week 8==<br />
<br />
===Wednesday (15/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay| Characterization of fluoride riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Strain of ''bacillus'' lacking fluoride transporter system tested. Concentrations used:<br />
<br />
:*0mM - 0.5mM - 1mM - 2.5mM - 5mM - 10mM - 20mM - 30mM<br />
<br />
===Thursday (16/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay| Characterization of fluoride riboswitch construct]]'''<br />
<br />
----<br />
<br />
[[File:fluoridegradient.jpg|250px|right|thumb|The results of our fluoride assay.]]<br />
<br />
* Eppindorfs containing the ''bacillus'' with the fluoride riboswitch removed from incubator and imaged.<br />
<br />
* Now this definitely works, we will try quantifying this riboswitch with an ONPG assay and the plate reader.<br />
<br />
===Saturday (18/08/12)===<br />
<br />
'''Colonies picked in preparation for Miller assay'''<br />
<br />
----<br />
<br />
*2 ''E. coli'' colonies transformed with the purified plasmid were picked and inoculated in LB with 50&mu;g/ml Amp<br />
<br />
*2 colonies each from the 168 strain and crcB knockout ''B. subtilis'' containing the fluoride riboswitch were picked and inoculated in LB with 5&mu;g/ml Chlor<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Fluoride biobrick format]]'''<br />
<br />
----<br />
<br />
[[File:FluorideBB1gel.jpg|right|250px|thumb|Gels from PCR of Fluoride BB and PJS130 fragments. Top: Lanes 2-4: Gibson compatable Fluoride biobrick fragment. Lanes 5-7: Ligation compatable Fluoride biobrick fragment. Lane 8: PJS130 fragment A. Bottom: Lanes 1-2: PJS130 fragment A. Lanes 3-5: PJS 130 fragment B. Lane 6: Positive control. Lane 7: Negative control.]]<br />
<br />
*Two sets of primers used: one to allow insertion into backbone by ligation, and one to allow insertion by Gibson assembly.<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 100 seconds<br />
<br />
*Products run on gel. Fragments produced of correct size, however they overlapped with the primer dimer band due to the small size of the fragments.<br />
<br />
*DNA extracted and purified.<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg2+ riboswitch construct vector]]'''<br />
<br />
----<br />
<br />
*Separate reactions for<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 100 seconds <br />
<br />
*Products run on gel. No fragments produced. Positive control worked however, so master mix clearly works.<br />
<br />
*Given this PCR has worked in the past, will try to re-run with the same settings and hope for success in the future.<br />
<br />
===Sunday (19/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/MillerAssay|Miller Assay of Fluoride construct]]'''<br />
<br />
----<br />
<br />
* Colonies picked from overnight and Miller assay run as directed on protocols page<br />
<br />
* Lack of filters meant that only A450 data recorderd<br />
<br />
==Week 9==<br />
<br />
===Tuesday (21/08/12)===<br />
<br />
'''PCR for Mg Riboswitch'''<br />
<br />
----<br />
*[[Team:Cambridge/Protocols/PCRProtocol| PCRs]] were run for pJS130.1 split vector ('+8 codons')<br />
*[[Team:Cambridge/Protocols/PCRcolony| Colony PCR]] for endogenous ''Bacillus subtilis'' Mg Riboswitch ('+8 codons') was run<br />
*Gels were run for above reactions, only one band for half of the pJS130 vector was visible.<br />
<br />
===Wednesday (22/08/12)===<br />
<br />
'''PCR for Mg Riboswitch'''<br />
<br />
----<br />
<br />
*[[Team:Cambridge/Protocols/PCRProtocol| PCRs]] were run for F Riboswitch from Yale's plasmid with overhangs for standard assembly.<br />
*[[Team:Cambridge/Protocols/PCRcolony| Colony PCR]] for endogenous ''Bacillus subtilis'' Mg Riboswitch (both '+8 codons' and '-8 codons' versions) were re-run.<br />
*Gels were run for above reactions, only one band for positive control was visible.<br />
<br />
'''Cells cultured for Miller assay'''<br />
----<br />
*''B. subtilis'' strains carrying F riboswitch and 'KO' strains cultured separately in LB and 5µg/mL Chloramphenicol at 37°C<br />
*''E.Coli'' carrying F riboswitch cultured in LB and 50mg/ml Ampicillin at 37°C<br />
<br />
===Thursday (23/08/12)===<br />
* Miller assay set up and running with the wild type and crcB knock-out ''Bacillus'' strains and an ''E. coli'' strain which contains the construct on an episomal plasmid.<br />
<br />
===Friday (24/08/12)===<br />
*Miller assay data collected for analysis over the weekend<br />
<br />
==Week 10==<br />
<br />
===Monday (27/08/12)===<br />
'''RiboSense:[[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg RS from bacillus genomic DNA]]'''<br />
<br />
----<br />
<br />
*3 part primers used, to amplify the 486bp from the genome, and the vector in two parts<br />
*PCR failed, only positive control came out. Will re run when new primers arrive.<br />
<br />
===Thursday (30/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of Mg2+ riboswitch from genomic DNA]]'''<br />
<br />
----<br />
<br />
[[File: MGRSgel1.jpg|right|250px|thumb|Gel from amplification of the riboswitch DNA. Lanes 2 + 3: with 8 codon substitution. Lanes 4 + 5: without 8 codon substitution.]]<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 30 seconds<br />
<br />
*Fragments of correct size produced for all except lane 5 produced. In this lane, DNA appears to have accumulated in the well, indicating it may be genomic. In future, will use lower numbers of template cells to avoid getting so much genomic DNA.<br />
<br />
*Products extracted and purified.<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of PJS130 vector for Mg riboswitch construct]]'''<br />
<br />
----<br />
<br />
[[File:PJS130gel2.jpg|250px|right|thumb|Gel from amplification of PJS130 vector for MGRS construct. Lanes 2 + 3: Fragment A. Lanes 4 + 5: Fragment B with 8 codon substitution. Lanes 6 + 7: Fragment B without 8 codon substitution.]]<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 60 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 110 seconds<br />
<br />
*Fragment of correct size produced in lane 5, but too faint to be extracted successfully. None of the other lanes were successful. We will try this again tomorrow, at 58 &deg;C and with 35 cycles (as is usual) instead of 30.<br />
<br />
*Note that phusion enzyme was left with primers and template DNA for about half an hour before reaction began, possibly causing degradation of the primer DNA.<br />
<br />
===Friday (31/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of PJS130 vector for MgRS construct]]'''<br />
<br />
----<br />
<br />
[[File:PJS130gel1.jpg|250px|left|thumb|Gel from amplification of PJS130 fragments. Lanes 2 + 3: Fragment A. Lanes 4 + 5: Fragment B with eight codon substitution. Lanes 6 + 7: Fragment B without eight codon substitution. Lane 8: Negative control.]]<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 120 seconds<br />
<br />
*Products of correct sizes (5.5kbp and 3.5 kbp) produced for all reactions, although lanes 2 and 4 failed to produce any product, despite primer smear. Most likely, template was not added, or one of the primers was not added.<br />
<br />
*Products excised and purified.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of Mg2+ riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Reaction 1: Without 8 codon substitution: Vec A, Vec B -8 (replicate 1), Genomic -8.<br />
<br />
*Reaction 2: Without 8 codon substitution: Vec A, Vec B -8 (replicate 2), Genomic -8. <br />
<br />
*Reaction 3: With 8 codon substitution: Vec A, Vec B +8, Genomic +8 (replicate 1).<br />
<br />
*Reaction 4: With 8 codon substitution: Vec A, Vec B +8, Genomic +8 (replicate 2).<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of e.coli with Gibson products]]'''<br />
<br />
----<br />
<br />
*20 &mu;l of Gibson reaction mix transformed into e.coli cells. Transformants plated out onto 100 &mu;g/ml ampicillin plates.<br />
<br />
===Saturday (01/09/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Verification of Mg2+ gel extractions]]'''<br />
<br />
----<br />
<br />
[[File:Mg2+verificationgel1.jpg|250px|right|thumb|Verification gel of extracted DNA. Lanes 1,7 + 13: Ladder. Lanes 2 - 4: Old vector DNA (06/08/12). Lane 5: PJS130 fragment A. Lanes 6,8 + 9: PJS130 fragment B. Lanes 10 - 12: Genomic riboswitch DNA.]]<br />
<br />
*DNA used in Gibson from yesterday and several weeks ago. Run on gel to verify the presence of DNA fragments of the correct size after gel extraction.<br />
<br />
*Old DNA appears to have degraded, or else products were produced in too small a quantity to show up on the gel. Fortunately, these are not/ have not been used.<br />
<br />
*Bands of the correct size for fragment A (5.5kbp), fragment B (3.5kbp) and the genomic DNA (550bp) present. Though riboswitch DNA has not come out well in this image, it was present under visual examination.<br />
<br />
*Approximate DNA concentrations in the range of 2 - 6 ng/&mu;l.<br />
<br />
===Sunday (02/09/12)===<br />
<br />
[[File:MGRSverification1.jpg|left|250px|thumb|Results from colony PCR (right of central ladder) and of restriction digest (left of central ladder). Restriction digest produced inconclusive results, however colony PCR indicates that the riboswitch only inserted into the second of the two colonies picked from the +8 version plate (last two lanes before ladder).]]<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|Verification of Mg2+ riboswitch construct by colony PCR]]'''<br />
<br />
----<br />
<br />
*Gibson primers used to amplify out riboswitch section of plasmid produced and transformed into e.coli to verify if riboswitch had inserted into PJS130.<br />
*Band at ~550bp in lanes 8 and 9 (replicates) indicate that the riboswich has only been successfuly transformed into the second of the two colonies picked on the +8 plate, and not at all for the -8 construct.<br />
<br />
'''[[Team:Cambridge/Protocols/MiniPrep|Miniprep of plasmid DNA]]'''<br />
<br />
----<br />
<br />
*E.coli from strains made yesterday miniprepped to get plasmid DNA at high concentration. After colony PCR results, all DNA other than that of the successful colony discarded.<br />
<br />
'''[[Team:Cambridge/Protocols/RestrictionDigest|Verification of Mg2+ riboswitch construct by restriction digest]]'''<br />
<br />
----<br />
<br />
*BamH1 and Sal1 used to digest plasmid DNA produced from miniprep.<br />
*Resultant fragment run on gel.<br />
*Bands produced inconclusive, possibly because of too short an incubation time with restriction enzymes. Expected bands at ~4900bp and ~4500bp. Will re-run experiment in future to check results of colony PCR.<br />
<br />
==Week 11==<br />
<br />
===Wednesday (05/09/12)===<br />
<br />
[[File:BBPCR1.jpg|250px|left|thumb|PCR products from Wednesday's PCR. Lanes 2 - 3: Fluoride riboswitch biobrick genomic DNA. Lanes 4 - 5: MGRS construct genomic DNA (+8). Lanes 6 - 7: MGRS construct genomic DNA (-8). Lane 8: MGRS biobrick genomic DNA (+8).]]<br />
<br />
[[File:BBPCR2.jpg|250px|right|thumb|PCR products from Wednesday's PCR. Top: Lane 2: MGRS biobrick genomic DNA (+8). Lanes 3 - 4: MGRS construct backbone (expected size 9kbp) (+8). Lanes 5 - 6: MGRS construct backbone (expected size 9kbp) (-8). Lane 7: MGRS biobrick vector (+8). Lane 8: Positive control. Bottom: Lane 2: MGRS biobrick vector (+8). lane 3: Negative control.]]<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of biobrick fragments and MGRS construct fragments.]]'''<br />
<br />
----<br />
<br />
*Fluoride and magnesium riboswitch genomic DNA amplified with PCR, along with vector fragments for turning the MGRS into a biobrick and for producing the magnesium riboswitch construct.<br />
*PCR settings: Annealing temperature - 58 &deg;C, Elongation step - 60 seconds.<br />
*Genomic fragments worked well, but longer backbone fragments mostly failed.<br />
*Extractions of DNA from these gels failed almost completely. Will try purifying directly from PCR products next time - results may not produce such a high purity of the precise DNA we want, but the increase in yield should outweigh this problem.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of -8 MGRS construct]]<br />
<br />
----<br />
<br />
*Fragments gel extracted earlier assembled with Gibson assembly.<br />
*Fragments used:<br />
:*9kbp fragment from tube 13 used as backbone.<br />
:*Genomic fragments from tubes 6 + 7.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of E.coli with Gibson products]]<br />
<br />
----<br />
<br />
*Gibson products from earlier today used to transform e.coli.<br />
*Resultant transformants plated out on 100 &mu;g/ml ampicillin plates.<br />
<br />
==Week 12==<br />
<br />
===Monday (10/09/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of biobrick vector DNA]]'''<br />
<br />
----<br />
<br />
*Attempted to run PCR of the backbone for the biobricks once more. Settings: Annealing temperature: 56&deg;C, elongation time: 30secs.<br />
<br />
*After running on gel, saw that while the -8 vector amplification appears to be producing some correctly sized (~2kb) bands, the other two only seem to be forming many primer dimers. Analysis of the sequence of the prefix and suffix revealed a CG palindrome that appears to be causing self annealing. Inserts are not affected, as they have the palindrome at the 5' end of the primer.<br />
<br />
*Will retry at higher temperatures tomorrow.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of biobricks]]'''<br />
<br />
----<br />
<br />
*Attempted Gibson assembly for the -8 magnesium riboswitch biobrick with the backbone fragments produced earlier today and the insert fragments produced yesterday.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of e.coli with Gibson products]]<br />
<br />
----<br />
<br />
*E.coli cells transformed with Gibson products produced earlier today.<br />
<br />
*Transformants plated out on 25&mu;/ml chloramphenicol plates.<br />
<br />
'''[[Team:Cambridge/Protocols/RestrictionDigest|Restriction digest of magnesium riboswitch construct plasmids]]'''<br />
<br />
----<br />
<br />
*Colonies grown up from colonies produced from Gibson products made on '''Check!!!''' were miniprepped and plasmid DNA extracted.<br />
<br />
*Restriction digest performed with Sal1 and BamH1. Expected fragment sizes: 4900bp and 4500bp. If plasmid lacks insert: 4900bp and 3950bp. These two possibilities should be distinguishable.<br />
<br />
*Correct banding pattern seen for all colonies grown up, with both -8 and +8 construct. Shall verify identity further with colony PCR.<br />
<br />
===Thursday (13/09/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/MgFreeCells#Production_of_Magnesium_Free_Cells|Magnesium Riboswitch Plate-Reader Assay]]'''<br />
<br />
----<br />
<br />
*Plate reader assay set up with magnesium riboswitch construct made over the last few days.<br />
<br />
*Mg2+ concentrations used:<br />
<br />
:*5&mu;M, 10&mu;M, 20&mu;M, 50&mu;M, 100&mu;M, 200&mu;M, 500&mu;M, 1mM, 2mM, 5mM, 10mM, 20mM<br />
<br />
*IPTG concentrations used:<br />
<br />
:*0.05mM, 0.1mM, 0.2mM, 0.5mM, 1mM, 2mM, 5mM, 10mM<br />
<br />
*Magnesium free medium B used as growth medium<br />
<br />
*Results: fluorescence curves are constant, except for a distinct dip during the exponential phase of bacterial growth. After looking at various cultures under the fluorescence microscope and discussing the results with our advisors, we have decided that this is because the amino acids in the medium are fluorescing. Our bacteria are then degrading these, causing the dip observed. We will switch to M9 minimal medium for our assays in the future, as this does not autofluoresce.<br />
<br />
==Week 13==<br />
<br />
==Week 14==<br />
<br />
===Wednesday (26/09/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/MillerAssay|Miller Assay of Fluoride construct]]'''<br />
<br />
----<br />
<br />
* colonies picked from overnight and Miller assay run again as directed on protocols page<br />
<br />
* 2 colonies each of ''E. coli'', 168 strain, and crcB knockout strain ''Bacillus'' assayed<br />
<br />
* Greater resolution at lower fluoride concentrations to test theory from previous assay<br />
<br />
* Lack of filters meant that only A450 data recorderd<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Ribosense/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Ribosense/LabbookTeam:Cambridge/Ribosense/Labbook2012-10-27T03:33:01Z<p>Olijme: /* General Labbook */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Labbook");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= Ribosense Labbook =<br />
<br />
==Week 4 ==<br />
<br />
===Tuesday (17/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of MGRS vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 58 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 180secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain 168 used as template for this experiment.<br />
<br />
* Primers used:<br />
<br />
:* Forward: cggagggagacgattttgTGTTCCGTAATTGTGATGTAAG<br />
<br />
:* Reverse: acaccggcatactctgcgacGTCATAGGTCATGTTTTGAACC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Wednesday (18/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:Mg2+ Gel PCR 1.jpg|250px|right|thumb|Results of gel electrophoresis of PCR fragments from yesterday. 550bp fragments in lanes 2+3 were removed before the image was taken]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2 + 3: Riboswitch DNA from genome (replicates) - 550bp fragment expected.<br />
<br />
:*Lane 4 + 5: Vector DNA from pJS130 (replicates)- Chloramphenicol resistance marker - 9.0kbp fragment expected<br />
<br />
:*Lane 6: Postitive control - 1.9kbp fragment expected<br />
<br />
*Riboswitch DNA was successfully amplified. However, vector DNA was not. Given that the postive control was also successful, it seems likely that something went wrong with some stage before the PCR amplification. We will try to rectify the problem tomorrow.<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of riboswitch DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful riboswitch DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
===Thursday (19/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 55 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 240secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
*Settings changed - Annealing temperature and elongation time - attempting to debug PCR.<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:PCR Gel Mg2+ 2.jpg|right|250px|thumb|PCR products from today. Note the unusual band in the negative control and the vector lanes]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2, 3 + 4: Vector DNA from pJS130 (replicates) - 9.0kbp fragment expected<br />
<br />
:*Lane 5: Postitive control - 1.9kbp fragment expected<br />
<br />
:*Lane 6: Negative control - no fragments expected<br />
<br />
*Once more, the PCR appears to have failed. We will try to redesign the primers tomorrow to make them functional.<br />
<br />
==Week 5==<br />
<br />
===Thursday (26/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome and Lux genes from e.coli genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain pJS130 used as template for riboswitch, colony of previously transformed e.coli used as template for lux operon.<br />
<br />
:*M2+ RS<br />
<br />
::*Forward: cggagggagacgattttg|TGTTCCGTAATTGTGATGTAAG<br />
<br />
::*Reverse: tataacgttactggtttcat|CGGGACTCGTACCTCC<br />
<br />
:*Lux operon<br />
<br />
::*Forward: gctgtacaag|GGAGGAGGAGGAAGTGGAGGAGGAGGAAGT|atgaagtttggaaatatttgtttttc<br />
<br />
::*Reverse: cctcgcccttgctcaccat|ACTCTATTCCTTTTTGGTGATTC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Friday (27/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
{|cellspacing="20"<br />
|[[File:CAM_120727_1_edited.jpg|200px|left|thumb|Vector amplification gel. Lanes 2-4 Lux containing vector. Lanes 5-7 Fluorescent construct vector. No products from this gel were amplified.]]<br />
|[[File:CAM_120727_2_edited.jpg|200px|left|thumb|Various. Lanes 3-5 mOrange amplification. Lanes 6-8 eCFP (E0020) amplification. mOrange amplification did not work.]]<br />
|[[File:CAM_120727_3_edited.jpg|200px|left|thumb|Small products for fluorescent construct. Lanes 1-3 Terminator (B0015). Lanes 4-6 Promotor pVEG + SpoVG (K143053).]]<br />
|-<br />
|[[File:CAM_120727_4_edited.jpg|200px|left|thumb|Various. Lanes 2-4 eYFP (E0030) amplification. Lanes 5-7 Mg2+ vector +8 codons. Lane 8 Mg2+ vector -8 codons. Lane 8 amplification did not work.]]<br />
|[[File:CAM_120727_5_edited.jpg|200px|left|thumb|Mg2+ riboswitch gel. Lanes 6+7 positive and negative controls respectively for entire run. Lanes 3-5 genomic riboswitch amplification -8 codons. Lanes 2+3 vector -8 codons.]]<br />
|}<br />
<br />
*PCR fragments for Mg2+ riboswitch, luxA/mOrange fusion and fluorescent construct from yesterday separated on gels. 90mins at 100V.<br />
<br />
*Mostly successful, but will need to repeat four runs: Three vectors (fluorescent, fusion (lux) and Mg2+ riboswitch (-8 codons) and mOrange gene.<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of successfully amplified DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful CFP, YFP, B0015, Pveg + SpoVG (K143053), riboswitch and vector DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
==Week 6==<br />
<br />
===Monday (30/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vectors and mOrange]]'''<br />
<br />
----<br />
<br />
[[File:mOrangegel.jpg|250px|thumb|mOrange PCR run at multiple temperatures, every two lanes increacing the temperature of the annealing step by 2 &deg;C. No lanes worked.]]<br />
<br />
[[File:vectorgel1.jpg|250px|thumb|Top: Fusion, lux containing vector gel. Lanes 2-4, Vector DNA. Lane 5, +ve control. Lane 6, -ve control. Bottom: Vector gel. Lanes 1-3, Fluorescent construct vector DNA. Lanes 4-6, Riboswitch construct vector DNA.]]<br />
<br />
*Not all products were obtained during Friday's PCR. Most of these missing products were large vector backbones. They are being run again, with a much longer extension time of 300s. If that fails, primers will be ordered to split the vectors into manageable chunks, and the PCR reattempted when they arrive.<br />
<br />
*PCR cycle x35: <br />
<br />
:* 15s Denaturing at 95 C<br />
:* 45s Annealing at 60 C<br />
:* 300s Extension at 72 C<br />
<br />
*Remaining stray product had a slightly tricky secondary structure at the 3' end. It will be run at a series of annealing temperatures in a PCR machine capable of a temperature gradient.<br />
<br />
*mOrange PCR run at many different temperatures, from 62 &deg;C to 76 &deg;C. However this doesn't seem to solve our problem (refer to Gel photos). It seems likely that it is a primer design problem.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Construction of riboswitch plasmid with Gibson Assembly]]'''<br />
<br />
----<br />
<br />
*DNA from lanes 27+28, 27+29, 27+30 from gels run on Friday fused together with Gibson assembly to produce riboswitch construct. This does not have replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
*DNA from lanes 22,23 and 24 fused with riboswitch DNA produced two weeks ago to produce riboswitch construct. This has replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
===Tuesday (01/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of TOP10 E.coli with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into TOP10 e.coli cells and transformants plated out on 100&mu;g/ml ampicillin plates.<br />
<br />
===Wednesday (01/08/12)===<br />
<br />
'''Mg2+ Riboswitch'''<br />
<br />
----<br />
<br />
*Successful colonies produced from transformations two days ago streaked out onto chloramphenicol (5 &mu;g/ml) containing plates.<br />
<br />
*Colonies also grown up in 10ml of medium A for use with plate reader later.<br />
<br />
===Friday (03/08/12)<br />
<br />
''' [[Team:Cambridge/Protocols/PCRProtocol|PCR of split Mg2+ vector]]'''<br />
<br />
----<br />
<br />
[[File:split Mg2+ 1.jpg|left|250px|thumb|results of split magnesium vector PCR. None of the products worked]]<br />
<br />
*PCR of magnesium riboswitch vector repeated with primers to split plasmid.<br />
<br />
*Lanes 2 + 3: Fragment A (center - cut site (promotor side))<br />
<br />
*Lanes 4 + 5: Fragment B (without 8 codon substitution) (cut site (lac I side) - center)<br />
<br />
*Lanes 6 + 7: Fragment B (with 8 codon substitution) (cut stie (lac I side) - center)<br />
<br />
*Gels run, found PCR was unsuccessful.<br />
<br />
===Sunday (05/08/12)===<br />
<br />
'''Ribosense: [[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg Riboswitch vector fragments]]'''<br />
<br />
----<br />
<br />
*2nd attempt since the PCR on Friday did not work, possibly due to mastermix problems<br />
<br />
*PCR Programme:<br />
<br />
*Results: Fragment A was successfully PCR-ed (lanes 3-4); Fragment B did not come out, with or without the 8 codons (lanes 5-6 (-8); lanes 7-8 (+8))<br />
<br />
==Week 7==<br />
<br />
===Monday (06/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Magnesium riboswitch vector fragment B and Magnesium promoter]]'''<br />
<br />
----<br />
<br />
[[File:MgRS vector frag. B.jpg|right|250px|thumb|Riboswitch and promoter gel. Lanes 2+3: Fragment B without 8 codon substitution, lanes 4+5: Fragment B with 8 codon substitution, lanes 6+7: magnesium sensitive promoter, lane 8: +ve control]]<br />
<br />
*Normal PCR settings used, annealing temperature 57 &deg;C, elongation step 90s long.<br />
<br />
*Lane 5 accidentally loaded with a DNA ladder instead of loading dye.<br />
<br />
*Expected fragment sizes:<br />
<br />
:*Lane 2-5: 3kbp<br />
<br />
:*Lane 6-7: 300bp<br />
<br />
*After electrophoresis, found vector products had, for the most part, worked. Promoter elements were not amplified - no band of the expected size was observed.<br />
<br />
*Positive control also failed, although this has ceased to work for several days, potentially due to DNA degradation.<br />
<br />
===Tuesday (07/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of magnesium riboswitch]]'''<br />
<br />
----<br />
<br />
*NAD+ added to '''isothermal buffer'''*5 mix<br />
<br />
*Gel slices from yesterday (of vector fragment B) purified.<br />
<br />
*DNA added as follows:<br />
<br />
:*Without 8 codon substitution:<br />
<br />
::*Reaction 1: Tube 2 (07/08/12) (fragment B), Tube 1 (05/08/12) (fragment A), Tube 28 (29/08/12) (riboswitch DNA).<br />
<br />
::*Reaction 2: Tube 3 (07/08/12) (fragment B), Tube 2 (05/08/12) (fragment A), Tube 29 (29/08/12) (riboswitch DNA).<br />
<br />
:*With 8 codon substitution:<br />
<br />
::*Reaction 3: Tube 4 (07/08/12) (fragment B), Tube 1 (05/08/12) (fragment A), Tube 2 (18/07/12) (riboswitch DNA).<br />
<br />
===Wednesday (08/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/ElectricalTransformation|Electrical transformation of competent e.coli with Gibson products]]'''<br />
<br />
----<br />
<br />
*Gibson constructs from yesterday (fluorescent and magnesium riboswitch) transformed into e.coli produced yesterday.<br />
<br />
*Cells plated out onto 50 &mu;g/ml ampicillin plates. Put in incubator overnight.<br />
<br />
===Friday (10/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay|Characterization of fluoride riboswitch sensitivity with &beta;-galactosidase]]'''<br />
<br />
----<br />
<br />
*X-Gal made up to a concentration of 400 &mu;g/ml with water.<br />
<br />
*Fluoride of concentrations 0.5 - 30 mM mixed with bacterial culture (Yale construct containing) grown up overnight.<br />
<br />
===Saturday (11/08/12)===<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/RestrictionDigest|Restriction digest of Yale plasmid]]'''<br />
<br />
----<br />
<br />
*Cells from electroporation of e.coli with plasmid from Yale (08/08/12) [[Team:Cambridge/Protocols/MiniPrep|miniprepped]] to extract plasmid DNA.<br />
<br />
*DNA digested with XhoI and SalI, expected fragment sizes 5580, 3139, 1437<br />
<br />
*Gel run, results not shown as gel was very 'messy'. Gel had probably already begun to set when poured and so had many artefacts when imaged. As a result each lane required different brightness and contrast settings to visualise and so the full gel was not clearly visible on the printout. However, all of the bands could be identified on the screen and were exactly as expected and very clear and pure.<br />
<br />
*Bands in correct places, indicating that expected plasmid was present in the cells. This indicates that, although they work at a very low efficiency, our electro-competent cells still work. It may be valuable to use these when trying to grow up plasmids that we already have at high concentration. <br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of e.coli with Magnesium riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Gibson products from 07/08/12 transformed into chemically competent cells.<br />
<br />
*Transformants plated out on 100 &mu;g/ml ampicillin plates<br />
<br />
==Week 8==<br />
<br />
===Wednesday (15/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay| Characterization of fluoride riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Strain of ''bacillus'' lacking fluoride transporter system tested. Concentrations used:<br />
<br />
:*0mM - 0.5mM - 1mM - 2.5mM - 5mM - 10mM - 20mM - 30mM<br />
<br />
===Thursday (16/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay| Characterization of fluoride riboswitch construct]]'''<br />
<br />
----<br />
<br />
[[File:fluoridegradient.jpg|250px|right|thumb|The results of our fluoride assay.]]<br />
<br />
* Eppindorfs containing the ''bacillus'' with the fluoride riboswitch removed from incubator and imaged.<br />
<br />
* Now this definitely works, we will try quantifying this riboswitch with an ONPG assay and the plate reader.<br />
<br />
===Saturday (18/08/12)===<br />
<br />
'''Colonies picked in preparation for Miller assay'''<br />
<br />
----<br />
<br />
*2 ''E. coli'' colonies transformed with the purified plasmid were picked and inoculated in LB with 50&mu;g/ml Amp<br />
<br />
*2 colonies each from the 168 strain and crcB knockout ''B. subtilis'' containing the fluoride riboswitch were picked and inoculated in LB with 5&mu;g/ml Chlor<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Fluoride biobrick format]]'''<br />
<br />
----<br />
<br />
[[File:FluorideBB1gel.jpg|right|250px|thumb|Gels from PCR of Fluoride BB and PJS130 fragments. Top: Lanes 2-4: Gibson compatable Fluoride biobrick fragment. Lanes 5-7: Ligation compatable Fluoride biobrick fragment. Lane 8: PJS130 fragment A. Bottom: Lanes 1-2: PJS130 fragment A. Lanes 3-5: PJS 130 fragment B. Lane 6: Positive control. Lane 7: Negative control.]]<br />
<br />
*Two sets of primers used: one to allow insertion into backbone by ligation, and one to allow insertion by Gibson assembly.<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 100 seconds<br />
<br />
*Products run on gel. Fragments produced of correct size, however they overlapped with the primer dimer band due to the small size of the fragments.<br />
<br />
*DNA extracted and purified.<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg2+ riboswitch construct vector]]'''<br />
<br />
----<br />
<br />
*Separate reactions for<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 100 seconds <br />
<br />
*Products run on gel. No fragments produced. Positive control worked however, so master mix clearly works.<br />
<br />
*Given this PCR has worked in the past, will try to re-run with the same settings and hope for success in the future.<br />
<br />
===Sunday (19/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/MillerAssay|Miller Assay of Fluoride construct]]'''<br />
<br />
----<br />
<br />
* Colonies picked from overnight and Miller assay run as directed on protocols page<br />
<br />
* Lack of filters meant that only A450 data recorderd<br />
<br />
==Week 9==<br />
<br />
===Tuesday (21/08/12)===<br />
<br />
'''PCR for Mg Riboswitch'''<br />
<br />
----<br />
*[[Team:Cambridge/Protocols/PCRProtocol| PCRs]] were run for pJS130.1 split vector ('+8 codons')<br />
*[[Team:Cambridge/Protocols/PCRcolony| Colony PCR]] for endogenous ''Bacillus subtilis'' Mg Riboswitch ('+8 codons') was run<br />
*Gels were run for above reactions, only one band for half of the pJS130 vector was visible.<br />
<br />
===Wednesday (22/08/12)===<br />
<br />
'''PCR for Mg Riboswitch'''<br />
<br />
----<br />
<br />
*[[Team:Cambridge/Protocols/PCRProtocol| PCRs]] were run for F Riboswitch from Yale's plasmid with overhangs for standard assembly.<br />
*[[Team:Cambridge/Protocols/PCRcolony| Colony PCR]] for endogenous ''Bacillus subtilis'' Mg Riboswitch (both '+8 codons' and '-8 codons' versions) were re-run.<br />
*Gels were run for above reactions, only one band for positive control was visible.<br />
<br />
'''Cells cultured for Miller assay'''<br />
----<br />
*''B. subtilis'' strains carrying F riboswitch and 'KO' strains cultured separately in LB and 5µg/mL Chloramphenicol at 37°C<br />
*''E.Coli'' carrying F riboswitch cultured in LB and 50mg/ml Ampicillin at 37°C<br />
<br />
===Thursday (23/08/12)===<br />
* Miller assay set up and running with the wild type and crcB knock-out ''Bacillus'' strains and an ''E. coli'' strain which contains the construct on an episomal plasmid.<br />
<br />
===Friday (24/08/12)===<br />
*Miller assay data collected for analysis over the weekend<br />
<br />
==Week 10==<br />
<br />
===Monday (27/08/12)===<br />
'''RiboSense:[[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg RS from bacillus genomic DNA]]'''<br />
<br />
----<br />
<br />
*3 part primers used, to amplify the 486bp from the genome, and the vector in two parts<br />
*PCR failed, only positive control came out. Will re run when new primers arrive.<br />
<br />
===Thursday (30/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of Mg2+ riboswitch from genomic DNA]]'''<br />
<br />
----<br />
<br />
[[File: MGRSgel1.jpg|right|250px|thumb|Gel from amplification of the riboswitch DNA. Lanes 2 + 3: with 8 codon substitution. Lanes 4 + 5: without 8 codon substitution.]]<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 30 seconds<br />
<br />
*Fragments of correct size produced for all except lane 5 produced. In this lane, DNA appears to have accumulated in the well, indicating it may be genomic. In future, will use lower numbers of template cells to avoid getting so much genomic DNA.<br />
<br />
*Products extracted and purified.<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of PJS130 vector for Mg riboswitch construct]]'''<br />
<br />
----<br />
<br />
[[File:PJS130gel2.jpg|250px|right|thumb|Gel from amplification of PJS130 vector for MGRS construct. Lanes 2 + 3: Fragment A. Lanes 4 + 5: Fragment B with 8 codon substitution. Lanes 6 + 7: Fragment B without 8 codon substitution.]]<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 60 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 110 seconds<br />
<br />
*Fragment of correct size produced in lane 5, but too faint to be extracted successfully. None of the other lanes were successful. We will try this again tomorrow, at 58 &deg;C and with 35 cycles (as is usual) instead of 30.<br />
<br />
*Note that phusion enzyme was left with primers and template DNA for about half an hour before reaction began, possibly causing degradation of the primer DNA.<br />
<br />
===Friday (31/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of PJS130 vector for MgRS construct]]'''<br />
<br />
----<br />
<br />
[[File:PJS130gel1.jpg|250px|left|thumb|Gel from amplification of PJS130 fragments. Lanes 2 + 3: Fragment A. Lanes 4 + 5: Fragment B with eight codon substitution. Lanes 6 + 7: Fragment B without eight codon substitution. Lane 8: Negative control.]]<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 120 seconds<br />
<br />
*Products of correct sizes (5.5kbp and 3.5 kbp) produced for all reactions, although lanes 2 and 4 failed to produce any product, despite primer smear. Most likely, template was not added, or one of the primers was not added.<br />
<br />
*Products excised and purified.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of Mg2+ riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Reaction 1: Without 8 codon substitution: Vec A, Vec B -8 (replicate 1), Genomic -8.<br />
<br />
*Reaction 2: Without 8 codon substitution: Vec A, Vec B -8 (replicate 2), Genomic -8. <br />
<br />
*Reaction 3: With 8 codon substitution: Vec A, Vec B +8, Genomic +8 (replicate 1).<br />
<br />
*Reaction 4: With 8 codon substitution: Vec A, Vec B +8, Genomic +8 (replicate 2).<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of e.coli with Gibson products]]'''<br />
<br />
----<br />
<br />
*20 &mu;l of Gibson reaction mix transformed into e.coli cells. Transformants plated out onto 100 &mu;g/ml ampicillin plates.<br />
<br />
===Saturday (01/09/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Verification of Mg2+ gel extractions]]'''<br />
<br />
----<br />
<br />
[[File:Mg2+verificationgel1.jpg|250px|right|thumb|Verification gel of extracted DNA. Lanes 1,7 + 13: Ladder. Lanes 2 - 4: Old vector DNA (06/08/12). Lane 5: PJS130 fragment A. Lanes 6,8 + 9: PJS130 fragment B. Lanes 10 - 12: Genomic riboswitch DNA.]]<br />
<br />
*DNA used in Gibson from yesterday and several weeks ago. Run on gel to verify the presence of DNA fragments of the correct size after gel extraction.<br />
<br />
*Old DNA appears to have degraded, or else products were produced in too small a quantity to show up on the gel. Fortunately, these are not/ have not been used.<br />
<br />
*Bands of the correct size for fragment A (5.5kbp), fragment B (3.5kbp) and the genomic DNA (550bp) present. Though riboswitch DNA has not come out well in this image, it was present under visual examination.<br />
<br />
*Approximate DNA concentrations in the range of 2 - 6 ng/&mu;l.<br />
<br />
===Sunday (02/09/12)===<br />
<br />
[[File:MGRSverification1.jpg|left|250px|thumb|Results from colony PCR (right of central ladder) and of restriction digest (left of central ladder). Restriction digest produced inconclusive results, however colony PCR indicates that the riboswitch only inserted into the second of the two colonies picked from the +8 version plate (last two lanes before ladder).]]<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|Verification of Mg2+ riboswitch construct by colony PCR]]'''<br />
<br />
----<br />
<br />
*Gibson primers used to amplify out riboswitch section of plasmid produced and transformed into e.coli to verify if riboswitch had inserted into PJS130.<br />
*Band at ~550bp in lanes 8 and 9 (replicates) indicate that the riboswich has only been successfuly transformed into the second of the two colonies picked on the +8 plate, and not at all for the -8 construct.<br />
<br />
'''[[Team:Cambridge/Protocols/MiniPrep|Miniprep of plasmid DNA]]'''<br />
<br />
----<br />
<br />
*E.coli from strains made yesterday miniprepped to get plasmid DNA at high concentration. After colony PCR results, all DNA other than that of the successful colony discarded.<br />
<br />
'''[[Team:Cambridge/Protocols/RestrictionDigest|Verification of Mg2+ riboswitch construct by restriction digest]]'''<br />
<br />
----<br />
<br />
*BamH1 and Sal1 used to digest plasmid DNA produced from miniprep.<br />
*Resultant fragment run on gel.<br />
*Bands produced inconclusive, possibly because of too short an incubation time with restriction enzymes. Expected bands at ~4900bp and ~4500bp. Will re-run experiment in future to check results of colony PCR.<br />
<br />
==Week 11==<br />
<br />
===Wednesday (05/09/12)===<br />
<br />
[[File:BBPCR1.jpg|250px|left|thumb|PCR products from Wednesday's PCR. Lanes 2 - 3: Fluoride riboswitch biobrick genomic DNA. Lanes 4 - 5: MGRS construct genomic DNA (+8). Lanes 6 - 7: MGRS construct genomic DNA (-8). Lane 8: MGRS biobrick genomic DNA (+8).]]<br />
<br />
[[File:BBPCR2.jpg|250px|right|thumb|PCR products from Wednesday's PCR. Top: Lane 2: MGRS biobrick genomic DNA (+8). Lanes 3 - 4: MGRS construct backbone (expected size 9kbp) (+8). Lanes 5 - 6: MGRS construct backbone (expected size 9kbp) (-8). Lane 7: MGRS biobrick vector (+8). Lane 8: Positive control. Bottom: Lane 2: MGRS biobrick vector (+8). lane 3: Negative control.]]<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of biobrick fragments and MGRS construct fragments.]]'''<br />
<br />
----<br />
<br />
*Fluoride and magnesium riboswitch genomic DNA amplified with PCR, along with vector fragments for turning the MGRS into a biobrick and for producing the magnesium riboswitch construct.<br />
*PCR settings: Annealing temperature - 58 &deg;C, Elongation step - 60 seconds.<br />
*Genomic fragments worked well, but longer backbone fragments mostly failed.<br />
*Extractions of DNA from these gels failed almost completely. Will try purifying directly from PCR products next time - results may not produce such a high purity of the precise DNA we want, but the increase in yield should outweigh this problem.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of -8 MGRS construct]]<br />
<br />
----<br />
<br />
*Fragments gel extracted earlier assembled with Gibson assembly.<br />
*Fragments used:<br />
:*9kbp fragment from tube 13 used as backbone.<br />
:*Genomic fragments from tubes 6 + 7.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of E.coli with Gibson products]]<br />
<br />
----<br />
<br />
*Gibson products from earlier today used to transform e.coli.<br />
*Resultant transformants plated out on 100 &mu;g/ml ampicillin plates.<br />
<br />
==Week 12==<br />
<br />
===Monday (10/09/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of biobrick vector DNA]]'''<br />
<br />
----<br />
<br />
*Attempted to run PCR of the backbone for the biobricks once more. Settings: Annealing temperature: 56&deg;C, elongation time: 30secs.<br />
<br />
*After running on gel, saw that while the -8 vector amplification appears to be producing some correctly sized (~2kb) bands, the other two only seem to be forming many primer dimers. Analysis of the sequence of the prefix and suffix revealed a CG palindrome that appears to be causing self annealing. Inserts are not affected, as they have the palindrome at the 5' end of the primer.<br />
<br />
*Will retry at higher temperatures tomorrow.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of biobricks]]'''<br />
<br />
----<br />
<br />
*Attempted Gibson assembly for the -8 magnesium riboswitch biobrick with the backbone fragments produced earlier today and the insert fragments produced yesterday.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of e.coli with Gibson products]]<br />
<br />
----<br />
<br />
*E.coli cells transformed with Gibson products produced earlier today.<br />
<br />
*Transformants plated out on 25&mu;/ml chloramphenicol plates.<br />
<br />
'''[[Team:Cambridge/Protocols/RestrictionDigest|Restriction digest of magnesium riboswitch construct plasmids]]'''<br />
<br />
----<br />
<br />
*Colonies grown up from colonies produced from Gibson products made on '''Check!!!''' were miniprepped and plasmid DNA extracted.<br />
<br />
*Restriction digest performed with Sal1 and BamH1. Expected fragment sizes: 4900bp and 4500bp. If plasmid lacks insert: 4900bp and 3950bp. These two possibilities should be distinguishable.<br />
<br />
*Correct banding pattern seen for all colonies grown up, with both -8 and +8 construct. Shall verify identity further with colony PCR.<br />
<br />
===Thursday (13/09/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/MgFreeCells#Production_of_Magnesium_Free_Cells|Magnesium Riboswitch Plate-Reader Assay]]'''<br />
<br />
----<br />
<br />
*Plate reader assay set up with magnesium riboswitch construct made over the last few days.<br />
<br />
*Mg2+ concentrations used:<br />
<br />
:*5&mu;M, 10&mu;M, 20&mu;M, 50&mu;M, 100&mu;M, 200&mu;M, 500&mu;M, 1mM, 2mM, 5mM, 10mM, 20mM<br />
<br />
*IPTG concentrations used:<br />
<br />
:*0.05mM, 0.1mM, 0.2mM, 0.5mM, 1mM, 2mM, 5mM, 10mM<br />
<br />
*Magnesium free medium B used as growth medium<br />
<br />
*Results: fluorescence curves are constant, except for a distinct dip during the exponential phase of bacterial growth. After looking at various cultures under the fluorescence microscope and discussing the results with our advisors, we have decided that this is because the amino acids in the medium are fluorescing. Our bacteria are then degrading these, causing the dip observed. We will switch to M9 minimal medium for our assays in the future, as this does not autofluoresce.<br />
<br />
==Week 13==<br />
<br />
==Week 14==<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Ribosense/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Ribosense/LabbookTeam:Cambridge/Ribosense/Labbook2012-10-27T03:32:19Z<p>Olijme: /* Week 12 */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Labbook");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= General Labbook =<br />
<br />
==Week 4 ==<br />
<br />
===Tuesday (17/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of MGRS vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 58 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 180secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain 168 used as template for this experiment.<br />
<br />
* Primers used:<br />
<br />
:* Forward: cggagggagacgattttgTGTTCCGTAATTGTGATGTAAG<br />
<br />
:* Reverse: acaccggcatactctgcgacGTCATAGGTCATGTTTTGAACC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Wednesday (18/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:Mg2+ Gel PCR 1.jpg|250px|right|thumb|Results of gel electrophoresis of PCR fragments from yesterday. 550bp fragments in lanes 2+3 were removed before the image was taken]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2 + 3: Riboswitch DNA from genome (replicates) - 550bp fragment expected.<br />
<br />
:*Lane 4 + 5: Vector DNA from pJS130 (replicates)- Chloramphenicol resistance marker - 9.0kbp fragment expected<br />
<br />
:*Lane 6: Postitive control - 1.9kbp fragment expected<br />
<br />
*Riboswitch DNA was successfully amplified. However, vector DNA was not. Given that the postive control was also successful, it seems likely that something went wrong with some stage before the PCR amplification. We will try to rectify the problem tomorrow.<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of riboswitch DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful riboswitch DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
===Thursday (19/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 55 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 240secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
*Settings changed - Annealing temperature and elongation time - attempting to debug PCR.<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:PCR Gel Mg2+ 2.jpg|right|250px|thumb|PCR products from today. Note the unusual band in the negative control and the vector lanes]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2, 3 + 4: Vector DNA from pJS130 (replicates) - 9.0kbp fragment expected<br />
<br />
:*Lane 5: Postitive control - 1.9kbp fragment expected<br />
<br />
:*Lane 6: Negative control - no fragments expected<br />
<br />
*Once more, the PCR appears to have failed. We will try to redesign the primers tomorrow to make them functional.<br />
<br />
==Week 5==<br />
<br />
===Thursday (26/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome and Lux genes from e.coli genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain pJS130 used as template for riboswitch, colony of previously transformed e.coli used as template for lux operon.<br />
<br />
:*M2+ RS<br />
<br />
::*Forward: cggagggagacgattttg|TGTTCCGTAATTGTGATGTAAG<br />
<br />
::*Reverse: tataacgttactggtttcat|CGGGACTCGTACCTCC<br />
<br />
:*Lux operon<br />
<br />
::*Forward: gctgtacaag|GGAGGAGGAGGAAGTGGAGGAGGAGGAAGT|atgaagtttggaaatatttgtttttc<br />
<br />
::*Reverse: cctcgcccttgctcaccat|ACTCTATTCCTTTTTGGTGATTC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Friday (27/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
{|cellspacing="20"<br />
|[[File:CAM_120727_1_edited.jpg|200px|left|thumb|Vector amplification gel. Lanes 2-4 Lux containing vector. Lanes 5-7 Fluorescent construct vector. No products from this gel were amplified.]]<br />
|[[File:CAM_120727_2_edited.jpg|200px|left|thumb|Various. Lanes 3-5 mOrange amplification. Lanes 6-8 eCFP (E0020) amplification. mOrange amplification did not work.]]<br />
|[[File:CAM_120727_3_edited.jpg|200px|left|thumb|Small products for fluorescent construct. Lanes 1-3 Terminator (B0015). Lanes 4-6 Promotor pVEG + SpoVG (K143053).]]<br />
|-<br />
|[[File:CAM_120727_4_edited.jpg|200px|left|thumb|Various. Lanes 2-4 eYFP (E0030) amplification. Lanes 5-7 Mg2+ vector +8 codons. Lane 8 Mg2+ vector -8 codons. Lane 8 amplification did not work.]]<br />
|[[File:CAM_120727_5_edited.jpg|200px|left|thumb|Mg2+ riboswitch gel. Lanes 6+7 positive and negative controls respectively for entire run. Lanes 3-5 genomic riboswitch amplification -8 codons. Lanes 2+3 vector -8 codons.]]<br />
|}<br />
<br />
*PCR fragments for Mg2+ riboswitch, luxA/mOrange fusion and fluorescent construct from yesterday separated on gels. 90mins at 100V.<br />
<br />
*Mostly successful, but will need to repeat four runs: Three vectors (fluorescent, fusion (lux) and Mg2+ riboswitch (-8 codons) and mOrange gene.<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of successfully amplified DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful CFP, YFP, B0015, Pveg + SpoVG (K143053), riboswitch and vector DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
==Week 6==<br />
<br />
===Monday (30/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vectors and mOrange]]'''<br />
<br />
----<br />
<br />
[[File:mOrangegel.jpg|250px|thumb|mOrange PCR run at multiple temperatures, every two lanes increacing the temperature of the annealing step by 2 &deg;C. No lanes worked.]]<br />
<br />
[[File:vectorgel1.jpg|250px|thumb|Top: Fusion, lux containing vector gel. Lanes 2-4, Vector DNA. Lane 5, +ve control. Lane 6, -ve control. Bottom: Vector gel. Lanes 1-3, Fluorescent construct vector DNA. Lanes 4-6, Riboswitch construct vector DNA.]]<br />
<br />
*Not all products were obtained during Friday's PCR. Most of these missing products were large vector backbones. They are being run again, with a much longer extension time of 300s. If that fails, primers will be ordered to split the vectors into manageable chunks, and the PCR reattempted when they arrive.<br />
<br />
*PCR cycle x35: <br />
<br />
:* 15s Denaturing at 95 C<br />
:* 45s Annealing at 60 C<br />
:* 300s Extension at 72 C<br />
<br />
*Remaining stray product had a slightly tricky secondary structure at the 3' end. It will be run at a series of annealing temperatures in a PCR machine capable of a temperature gradient.<br />
<br />
*mOrange PCR run at many different temperatures, from 62 &deg;C to 76 &deg;C. However this doesn't seem to solve our problem (refer to Gel photos). It seems likely that it is a primer design problem.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Construction of riboswitch plasmid with Gibson Assembly]]'''<br />
<br />
----<br />
<br />
*DNA from lanes 27+28, 27+29, 27+30 from gels run on Friday fused together with Gibson assembly to produce riboswitch construct. This does not have replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
*DNA from lanes 22,23 and 24 fused with riboswitch DNA produced two weeks ago to produce riboswitch construct. This has replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
===Tuesday (01/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of TOP10 E.coli with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into TOP10 e.coli cells and transformants plated out on 100&mu;g/ml ampicillin plates.<br />
<br />
===Wednesday (01/08/12)===<br />
<br />
'''Mg2+ Riboswitch'''<br />
<br />
----<br />
<br />
*Successful colonies produced from transformations two days ago streaked out onto chloramphenicol (5 &mu;g/ml) containing plates.<br />
<br />
*Colonies also grown up in 10ml of medium A for use with plate reader later.<br />
<br />
===Friday (03/08/12)<br />
<br />
''' [[Team:Cambridge/Protocols/PCRProtocol|PCR of split Mg2+ vector]]'''<br />
<br />
----<br />
<br />
[[File:split Mg2+ 1.jpg|left|250px|thumb|results of split magnesium vector PCR. None of the products worked]]<br />
<br />
*PCR of magnesium riboswitch vector repeated with primers to split plasmid.<br />
<br />
*Lanes 2 + 3: Fragment A (center - cut site (promotor side))<br />
<br />
*Lanes 4 + 5: Fragment B (without 8 codon substitution) (cut site (lac I side) - center)<br />
<br />
*Lanes 6 + 7: Fragment B (with 8 codon substitution) (cut stie (lac I side) - center)<br />
<br />
*Gels run, found PCR was unsuccessful.<br />
<br />
===Sunday (05/08/12)===<br />
<br />
'''Ribosense: [[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg Riboswitch vector fragments]]'''<br />
<br />
----<br />
<br />
*2nd attempt since the PCR on Friday did not work, possibly due to mastermix problems<br />
<br />
*PCR Programme:<br />
<br />
*Results: Fragment A was successfully PCR-ed (lanes 3-4); Fragment B did not come out, with or without the 8 codons (lanes 5-6 (-8); lanes 7-8 (+8))<br />
<br />
==Week 7==<br />
<br />
===Monday (06/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Magnesium riboswitch vector fragment B and Magnesium promoter]]'''<br />
<br />
----<br />
<br />
[[File:MgRS vector frag. B.jpg|right|250px|thumb|Riboswitch and promoter gel. Lanes 2+3: Fragment B without 8 codon substitution, lanes 4+5: Fragment B with 8 codon substitution, lanes 6+7: magnesium sensitive promoter, lane 8: +ve control]]<br />
<br />
*Normal PCR settings used, annealing temperature 57 &deg;C, elongation step 90s long.<br />
<br />
*Lane 5 accidentally loaded with a DNA ladder instead of loading dye.<br />
<br />
*Expected fragment sizes:<br />
<br />
:*Lane 2-5: 3kbp<br />
<br />
:*Lane 6-7: 300bp<br />
<br />
*After electrophoresis, found vector products had, for the most part, worked. Promoter elements were not amplified - no band of the expected size was observed.<br />
<br />
*Positive control also failed, although this has ceased to work for several days, potentially due to DNA degradation.<br />
<br />
===Tuesday (07/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of magnesium riboswitch]]'''<br />
<br />
----<br />
<br />
*NAD+ added to '''isothermal buffer'''*5 mix<br />
<br />
*Gel slices from yesterday (of vector fragment B) purified.<br />
<br />
*DNA added as follows:<br />
<br />
:*Without 8 codon substitution:<br />
<br />
::*Reaction 1: Tube 2 (07/08/12) (fragment B), Tube 1 (05/08/12) (fragment A), Tube 28 (29/08/12) (riboswitch DNA).<br />
<br />
::*Reaction 2: Tube 3 (07/08/12) (fragment B), Tube 2 (05/08/12) (fragment A), Tube 29 (29/08/12) (riboswitch DNA).<br />
<br />
:*With 8 codon substitution:<br />
<br />
::*Reaction 3: Tube 4 (07/08/12) (fragment B), Tube 1 (05/08/12) (fragment A), Tube 2 (18/07/12) (riboswitch DNA).<br />
<br />
===Wednesday (08/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/ElectricalTransformation|Electrical transformation of competent e.coli with Gibson products]]'''<br />
<br />
----<br />
<br />
*Gibson constructs from yesterday (fluorescent and magnesium riboswitch) transformed into e.coli produced yesterday.<br />
<br />
*Cells plated out onto 50 &mu;g/ml ampicillin plates. Put in incubator overnight.<br />
<br />
===Friday (10/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay|Characterization of fluoride riboswitch sensitivity with &beta;-galactosidase]]'''<br />
<br />
----<br />
<br />
*X-Gal made up to a concentration of 400 &mu;g/ml with water.<br />
<br />
*Fluoride of concentrations 0.5 - 30 mM mixed with bacterial culture (Yale construct containing) grown up overnight.<br />
<br />
===Saturday (11/08/12)===<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/RestrictionDigest|Restriction digest of Yale plasmid]]'''<br />
<br />
----<br />
<br />
*Cells from electroporation of e.coli with plasmid from Yale (08/08/12) [[Team:Cambridge/Protocols/MiniPrep|miniprepped]] to extract plasmid DNA.<br />
<br />
*DNA digested with XhoI and SalI, expected fragment sizes 5580, 3139, 1437<br />
<br />
*Gel run, results not shown as gel was very 'messy'. Gel had probably already begun to set when poured and so had many artefacts when imaged. As a result each lane required different brightness and contrast settings to visualise and so the full gel was not clearly visible on the printout. However, all of the bands could be identified on the screen and were exactly as expected and very clear and pure.<br />
<br />
*Bands in correct places, indicating that expected plasmid was present in the cells. This indicates that, although they work at a very low efficiency, our electro-competent cells still work. It may be valuable to use these when trying to grow up plasmids that we already have at high concentration. <br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of e.coli with Magnesium riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Gibson products from 07/08/12 transformed into chemically competent cells.<br />
<br />
*Transformants plated out on 100 &mu;g/ml ampicillin plates<br />
<br />
==Week 8==<br />
<br />
===Wednesday (15/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay| Characterization of fluoride riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Strain of ''bacillus'' lacking fluoride transporter system tested. Concentrations used:<br />
<br />
:*0mM - 0.5mM - 1mM - 2.5mM - 5mM - 10mM - 20mM - 30mM<br />
<br />
===Thursday (16/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay| Characterization of fluoride riboswitch construct]]'''<br />
<br />
----<br />
<br />
[[File:fluoridegradient.jpg|250px|right|thumb|The results of our fluoride assay.]]<br />
<br />
* Eppindorfs containing the ''bacillus'' with the fluoride riboswitch removed from incubator and imaged.<br />
<br />
* Now this definitely works, we will try quantifying this riboswitch with an ONPG assay and the plate reader.<br />
<br />
===Saturday (18/08/12)===<br />
<br />
'''Colonies picked in preparation for Miller assay'''<br />
<br />
----<br />
<br />
*2 ''E. coli'' colonies transformed with the purified plasmid were picked and inoculated in LB with 50&mu;g/ml Amp<br />
<br />
*2 colonies each from the 168 strain and crcB knockout ''B. subtilis'' containing the fluoride riboswitch were picked and inoculated in LB with 5&mu;g/ml Chlor<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Fluoride biobrick format]]'''<br />
<br />
----<br />
<br />
[[File:FluorideBB1gel.jpg|right|250px|thumb|Gels from PCR of Fluoride BB and PJS130 fragments. Top: Lanes 2-4: Gibson compatable Fluoride biobrick fragment. Lanes 5-7: Ligation compatable Fluoride biobrick fragment. Lane 8: PJS130 fragment A. Bottom: Lanes 1-2: PJS130 fragment A. Lanes 3-5: PJS 130 fragment B. Lane 6: Positive control. Lane 7: Negative control.]]<br />
<br />
*Two sets of primers used: one to allow insertion into backbone by ligation, and one to allow insertion by Gibson assembly.<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 100 seconds<br />
<br />
*Products run on gel. Fragments produced of correct size, however they overlapped with the primer dimer band due to the small size of the fragments.<br />
<br />
*DNA extracted and purified.<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg2+ riboswitch construct vector]]'''<br />
<br />
----<br />
<br />
*Separate reactions for<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 100 seconds <br />
<br />
*Products run on gel. No fragments produced. Positive control worked however, so master mix clearly works.<br />
<br />
*Given this PCR has worked in the past, will try to re-run with the same settings and hope for success in the future.<br />
<br />
===Sunday (19/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/MillerAssay|Miller Assay of Fluoride construct]]'''<br />
<br />
----<br />
<br />
* Colonies picked from overnight and Miller assay run as directed on protocols page<br />
<br />
* Lack of filters meant that only A450 data recorderd<br />
<br />
==Week 9==<br />
<br />
===Tuesday (21/08/12)===<br />
<br />
'''PCR for Mg Riboswitch'''<br />
<br />
----<br />
*[[Team:Cambridge/Protocols/PCRProtocol| PCRs]] were run for pJS130.1 split vector ('+8 codons')<br />
*[[Team:Cambridge/Protocols/PCRcolony| Colony PCR]] for endogenous ''Bacillus subtilis'' Mg Riboswitch ('+8 codons') was run<br />
*Gels were run for above reactions, only one band for half of the pJS130 vector was visible.<br />
<br />
===Wednesday (22/08/12)===<br />
<br />
'''PCR for Mg Riboswitch'''<br />
<br />
----<br />
<br />
*[[Team:Cambridge/Protocols/PCRProtocol| PCRs]] were run for F Riboswitch from Yale's plasmid with overhangs for standard assembly.<br />
*[[Team:Cambridge/Protocols/PCRcolony| Colony PCR]] for endogenous ''Bacillus subtilis'' Mg Riboswitch (both '+8 codons' and '-8 codons' versions) were re-run.<br />
*Gels were run for above reactions, only one band for positive control was visible.<br />
<br />
'''Cells cultured for Miller assay'''<br />
----<br />
*''B. subtilis'' strains carrying F riboswitch and 'KO' strains cultured separately in LB and 5µg/mL Chloramphenicol at 37°C<br />
*''E.Coli'' carrying F riboswitch cultured in LB and 50mg/ml Ampicillin at 37°C<br />
<br />
===Thursday (23/08/12)===<br />
* Miller assay set up and running with the wild type and crcB knock-out ''Bacillus'' strains and an ''E. coli'' strain which contains the construct on an episomal plasmid.<br />
<br />
===Friday (24/08/12)===<br />
*Miller assay data collected for analysis over the weekend<br />
<br />
==Week 10==<br />
<br />
===Monday (27/08/12)===<br />
'''RiboSense:[[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg RS from bacillus genomic DNA]]'''<br />
<br />
----<br />
<br />
*3 part primers used, to amplify the 486bp from the genome, and the vector in two parts<br />
*PCR failed, only positive control came out. Will re run when new primers arrive.<br />
<br />
===Thursday (30/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of Mg2+ riboswitch from genomic DNA]]'''<br />
<br />
----<br />
<br />
[[File: MGRSgel1.jpg|right|250px|thumb|Gel from amplification of the riboswitch DNA. Lanes 2 + 3: with 8 codon substitution. Lanes 4 + 5: without 8 codon substitution.]]<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 30 seconds<br />
<br />
*Fragments of correct size produced for all except lane 5 produced. In this lane, DNA appears to have accumulated in the well, indicating it may be genomic. In future, will use lower numbers of template cells to avoid getting so much genomic DNA.<br />
<br />
*Products extracted and purified.<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of PJS130 vector for Mg riboswitch construct]]'''<br />
<br />
----<br />
<br />
[[File:PJS130gel2.jpg|250px|right|thumb|Gel from amplification of PJS130 vector for MGRS construct. Lanes 2 + 3: Fragment A. Lanes 4 + 5: Fragment B with 8 codon substitution. Lanes 6 + 7: Fragment B without 8 codon substitution.]]<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 60 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 110 seconds<br />
<br />
*Fragment of correct size produced in lane 5, but too faint to be extracted successfully. None of the other lanes were successful. We will try this again tomorrow, at 58 &deg;C and with 35 cycles (as is usual) instead of 30.<br />
<br />
*Note that phusion enzyme was left with primers and template DNA for about half an hour before reaction began, possibly causing degradation of the primer DNA.<br />
<br />
===Friday (31/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of PJS130 vector for MgRS construct]]'''<br />
<br />
----<br />
<br />
[[File:PJS130gel1.jpg|250px|left|thumb|Gel from amplification of PJS130 fragments. Lanes 2 + 3: Fragment A. Lanes 4 + 5: Fragment B with eight codon substitution. Lanes 6 + 7: Fragment B without eight codon substitution. Lane 8: Negative control.]]<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 120 seconds<br />
<br />
*Products of correct sizes (5.5kbp and 3.5 kbp) produced for all reactions, although lanes 2 and 4 failed to produce any product, despite primer smear. Most likely, template was not added, or one of the primers was not added.<br />
<br />
*Products excised and purified.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of Mg2+ riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Reaction 1: Without 8 codon substitution: Vec A, Vec B -8 (replicate 1), Genomic -8.<br />
<br />
*Reaction 2: Without 8 codon substitution: Vec A, Vec B -8 (replicate 2), Genomic -8. <br />
<br />
*Reaction 3: With 8 codon substitution: Vec A, Vec B +8, Genomic +8 (replicate 1).<br />
<br />
*Reaction 4: With 8 codon substitution: Vec A, Vec B +8, Genomic +8 (replicate 2).<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of e.coli with Gibson products]]'''<br />
<br />
----<br />
<br />
*20 &mu;l of Gibson reaction mix transformed into e.coli cells. Transformants plated out onto 100 &mu;g/ml ampicillin plates.<br />
<br />
===Saturday (01/09/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Verification of Mg2+ gel extractions]]'''<br />
<br />
----<br />
<br />
[[File:Mg2+verificationgel1.jpg|250px|right|thumb|Verification gel of extracted DNA. Lanes 1,7 + 13: Ladder. Lanes 2 - 4: Old vector DNA (06/08/12). Lane 5: PJS130 fragment A. Lanes 6,8 + 9: PJS130 fragment B. Lanes 10 - 12: Genomic riboswitch DNA.]]<br />
<br />
*DNA used in Gibson from yesterday and several weeks ago. Run on gel to verify the presence of DNA fragments of the correct size after gel extraction.<br />
<br />
*Old DNA appears to have degraded, or else products were produced in too small a quantity to show up on the gel. Fortunately, these are not/ have not been used.<br />
<br />
*Bands of the correct size for fragment A (5.5kbp), fragment B (3.5kbp) and the genomic DNA (550bp) present. Though riboswitch DNA has not come out well in this image, it was present under visual examination.<br />
<br />
*Approximate DNA concentrations in the range of 2 - 6 ng/&mu;l.<br />
<br />
===Sunday (02/09/12)===<br />
<br />
[[File:MGRSverification1.jpg|left|250px|thumb|Results from colony PCR (right of central ladder) and of restriction digest (left of central ladder). Restriction digest produced inconclusive results, however colony PCR indicates that the riboswitch only inserted into the second of the two colonies picked from the +8 version plate (last two lanes before ladder).]]<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|Verification of Mg2+ riboswitch construct by colony PCR]]'''<br />
<br />
----<br />
<br />
*Gibson primers used to amplify out riboswitch section of plasmid produced and transformed into e.coli to verify if riboswitch had inserted into PJS130.<br />
*Band at ~550bp in lanes 8 and 9 (replicates) indicate that the riboswich has only been successfuly transformed into the second of the two colonies picked on the +8 plate, and not at all for the -8 construct.<br />
<br />
'''[[Team:Cambridge/Protocols/MiniPrep|Miniprep of plasmid DNA]]'''<br />
<br />
----<br />
<br />
*E.coli from strains made yesterday miniprepped to get plasmid DNA at high concentration. After colony PCR results, all DNA other than that of the successful colony discarded.<br />
<br />
'''[[Team:Cambridge/Protocols/RestrictionDigest|Verification of Mg2+ riboswitch construct by restriction digest]]'''<br />
<br />
----<br />
<br />
*BamH1 and Sal1 used to digest plasmid DNA produced from miniprep.<br />
*Resultant fragment run on gel.<br />
*Bands produced inconclusive, possibly because of too short an incubation time with restriction enzymes. Expected bands at ~4900bp and ~4500bp. Will re-run experiment in future to check results of colony PCR.<br />
<br />
==Week 11==<br />
<br />
===Wednesday (05/09/12)===<br />
<br />
[[File:BBPCR1.jpg|250px|left|thumb|PCR products from Wednesday's PCR. Lanes 2 - 3: Fluoride riboswitch biobrick genomic DNA. Lanes 4 - 5: MGRS construct genomic DNA (+8). Lanes 6 - 7: MGRS construct genomic DNA (-8). Lane 8: MGRS biobrick genomic DNA (+8).]]<br />
<br />
[[File:BBPCR2.jpg|250px|right|thumb|PCR products from Wednesday's PCR. Top: Lane 2: MGRS biobrick genomic DNA (+8). Lanes 3 - 4: MGRS construct backbone (expected size 9kbp) (+8). Lanes 5 - 6: MGRS construct backbone (expected size 9kbp) (-8). Lane 7: MGRS biobrick vector (+8). Lane 8: Positive control. Bottom: Lane 2: MGRS biobrick vector (+8). lane 3: Negative control.]]<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of biobrick fragments and MGRS construct fragments.]]'''<br />
<br />
----<br />
<br />
*Fluoride and magnesium riboswitch genomic DNA amplified with PCR, along with vector fragments for turning the MGRS into a biobrick and for producing the magnesium riboswitch construct.<br />
*PCR settings: Annealing temperature - 58 &deg;C, Elongation step - 60 seconds.<br />
*Genomic fragments worked well, but longer backbone fragments mostly failed.<br />
*Extractions of DNA from these gels failed almost completely. Will try purifying directly from PCR products next time - results may not produce such a high purity of the precise DNA we want, but the increase in yield should outweigh this problem.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of -8 MGRS construct]]<br />
<br />
----<br />
<br />
*Fragments gel extracted earlier assembled with Gibson assembly.<br />
*Fragments used:<br />
:*9kbp fragment from tube 13 used as backbone.<br />
:*Genomic fragments from tubes 6 + 7.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of E.coli with Gibson products]]<br />
<br />
----<br />
<br />
*Gibson products from earlier today used to transform e.coli.<br />
*Resultant transformants plated out on 100 &mu;g/ml ampicillin plates.<br />
<br />
==Week 12==<br />
<br />
===Monday (10/09/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of biobrick vector DNA]]'''<br />
<br />
----<br />
<br />
*Attempted to run PCR of the backbone for the biobricks once more. Settings: Annealing temperature: 56&deg;C, elongation time: 30secs.<br />
<br />
*After running on gel, saw that while the -8 vector amplification appears to be producing some correctly sized (~2kb) bands, the other two only seem to be forming many primer dimers. Analysis of the sequence of the prefix and suffix revealed a CG palindrome that appears to be causing self annealing. Inserts are not affected, as they have the palindrome at the 5' end of the primer.<br />
<br />
*Will retry at higher temperatures tomorrow.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of biobricks]]'''<br />
<br />
----<br />
<br />
*Attempted Gibson assembly for the -8 magnesium riboswitch biobrick with the backbone fragments produced earlier today and the insert fragments produced yesterday.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of e.coli with Gibson products]]<br />
<br />
----<br />
<br />
*E.coli cells transformed with Gibson products produced earlier today.<br />
<br />
*Transformants plated out on 25&mu;/ml chloramphenicol plates.<br />
<br />
'''[[Team:Cambridge/Protocols/RestrictionDigest|Restriction digest of magnesium riboswitch construct plasmids]]'''<br />
<br />
----<br />
<br />
*Colonies grown up from colonies produced from Gibson products made on '''Check!!!''' were miniprepped and plasmid DNA extracted.<br />
<br />
*Restriction digest performed with Sal1 and BamH1. Expected fragment sizes: 4900bp and 4500bp. If plasmid lacks insert: 4900bp and 3950bp. These two possibilities should be distinguishable.<br />
<br />
*Correct banding pattern seen for all colonies grown up, with both -8 and +8 construct. Shall verify identity further with colony PCR.<br />
<br />
===Thursday (13/09/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/MgFreeCells#Production_of_Magnesium_Free_Cells|Magnesium Riboswitch Plate-Reader Assay]]'''<br />
<br />
----<br />
<br />
*Plate reader assay set up with magnesium riboswitch construct made over the last few days.<br />
<br />
*Mg2+ concentrations used:<br />
<br />
:*5&mu;M, 10&mu;M, 20&mu;M, 50&mu;M, 100&mu;M, 200&mu;M, 500&mu;M, 1mM, 2mM, 5mM, 10mM, 20mM<br />
<br />
*IPTG concentrations used:<br />
<br />
:*0.05mM, 0.1mM, 0.2mM, 0.5mM, 1mM, 2mM, 5mM, 10mM<br />
<br />
*Magnesium free medium B used as growth medium<br />
<br />
*Results: fluorescence curves are constant, except for a distinct dip during the exponential phase of bacterial growth. After looking at various cultures under the fluorescence microscope and discussing the results with our advisors, we have decided that this is because the amino acids in the medium are fluorescing. Our bacteria are then degrading these, causing the dip observed. We will switch to M9 minimal medium for our assays in the future, as this does not autofluoresce.<br />
<br />
==Week 13==<br />
<br />
==Week 14==<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Ribosense/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Ribosense/LabbookTeam:Cambridge/Ribosense/Labbook2012-10-27T03:29:50Z<p>Olijme: /* Week 11 */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Labbook");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= General Labbook =<br />
<br />
==Week 4 ==<br />
<br />
===Tuesday (17/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of MGRS vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 58 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 180secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain 168 used as template for this experiment.<br />
<br />
* Primers used:<br />
<br />
:* Forward: cggagggagacgattttgTGTTCCGTAATTGTGATGTAAG<br />
<br />
:* Reverse: acaccggcatactctgcgacGTCATAGGTCATGTTTTGAACC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Wednesday (18/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:Mg2+ Gel PCR 1.jpg|250px|right|thumb|Results of gel electrophoresis of PCR fragments from yesterday. 550bp fragments in lanes 2+3 were removed before the image was taken]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2 + 3: Riboswitch DNA from genome (replicates) - 550bp fragment expected.<br />
<br />
:*Lane 4 + 5: Vector DNA from pJS130 (replicates)- Chloramphenicol resistance marker - 9.0kbp fragment expected<br />
<br />
:*Lane 6: Postitive control - 1.9kbp fragment expected<br />
<br />
*Riboswitch DNA was successfully amplified. However, vector DNA was not. Given that the postive control was also successful, it seems likely that something went wrong with some stage before the PCR amplification. We will try to rectify the problem tomorrow.<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of riboswitch DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful riboswitch DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
===Thursday (19/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 55 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 240secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
*Settings changed - Annealing temperature and elongation time - attempting to debug PCR.<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:PCR Gel Mg2+ 2.jpg|right|250px|thumb|PCR products from today. Note the unusual band in the negative control and the vector lanes]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2, 3 + 4: Vector DNA from pJS130 (replicates) - 9.0kbp fragment expected<br />
<br />
:*Lane 5: Postitive control - 1.9kbp fragment expected<br />
<br />
:*Lane 6: Negative control - no fragments expected<br />
<br />
*Once more, the PCR appears to have failed. We will try to redesign the primers tomorrow to make them functional.<br />
<br />
==Week 5==<br />
<br />
===Thursday (26/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome and Lux genes from e.coli genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain pJS130 used as template for riboswitch, colony of previously transformed e.coli used as template for lux operon.<br />
<br />
:*M2+ RS<br />
<br />
::*Forward: cggagggagacgattttg|TGTTCCGTAATTGTGATGTAAG<br />
<br />
::*Reverse: tataacgttactggtttcat|CGGGACTCGTACCTCC<br />
<br />
:*Lux operon<br />
<br />
::*Forward: gctgtacaag|GGAGGAGGAGGAAGTGGAGGAGGAGGAAGT|atgaagtttggaaatatttgtttttc<br />
<br />
::*Reverse: cctcgcccttgctcaccat|ACTCTATTCCTTTTTGGTGATTC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Friday (27/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
{|cellspacing="20"<br />
|[[File:CAM_120727_1_edited.jpg|200px|left|thumb|Vector amplification gel. Lanes 2-4 Lux containing vector. Lanes 5-7 Fluorescent construct vector. No products from this gel were amplified.]]<br />
|[[File:CAM_120727_2_edited.jpg|200px|left|thumb|Various. Lanes 3-5 mOrange amplification. Lanes 6-8 eCFP (E0020) amplification. mOrange amplification did not work.]]<br />
|[[File:CAM_120727_3_edited.jpg|200px|left|thumb|Small products for fluorescent construct. Lanes 1-3 Terminator (B0015). Lanes 4-6 Promotor pVEG + SpoVG (K143053).]]<br />
|-<br />
|[[File:CAM_120727_4_edited.jpg|200px|left|thumb|Various. Lanes 2-4 eYFP (E0030) amplification. Lanes 5-7 Mg2+ vector +8 codons. Lane 8 Mg2+ vector -8 codons. Lane 8 amplification did not work.]]<br />
|[[File:CAM_120727_5_edited.jpg|200px|left|thumb|Mg2+ riboswitch gel. Lanes 6+7 positive and negative controls respectively for entire run. Lanes 3-5 genomic riboswitch amplification -8 codons. Lanes 2+3 vector -8 codons.]]<br />
|}<br />
<br />
*PCR fragments for Mg2+ riboswitch, luxA/mOrange fusion and fluorescent construct from yesterday separated on gels. 90mins at 100V.<br />
<br />
*Mostly successful, but will need to repeat four runs: Three vectors (fluorescent, fusion (lux) and Mg2+ riboswitch (-8 codons) and mOrange gene.<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of successfully amplified DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful CFP, YFP, B0015, Pveg + SpoVG (K143053), riboswitch and vector DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
==Week 6==<br />
<br />
===Monday (30/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vectors and mOrange]]'''<br />
<br />
----<br />
<br />
[[File:mOrangegel.jpg|250px|thumb|mOrange PCR run at multiple temperatures, every two lanes increacing the temperature of the annealing step by 2 &deg;C. No lanes worked.]]<br />
<br />
[[File:vectorgel1.jpg|250px|thumb|Top: Fusion, lux containing vector gel. Lanes 2-4, Vector DNA. Lane 5, +ve control. Lane 6, -ve control. Bottom: Vector gel. Lanes 1-3, Fluorescent construct vector DNA. Lanes 4-6, Riboswitch construct vector DNA.]]<br />
<br />
*Not all products were obtained during Friday's PCR. Most of these missing products were large vector backbones. They are being run again, with a much longer extension time of 300s. If that fails, primers will be ordered to split the vectors into manageable chunks, and the PCR reattempted when they arrive.<br />
<br />
*PCR cycle x35: <br />
<br />
:* 15s Denaturing at 95 C<br />
:* 45s Annealing at 60 C<br />
:* 300s Extension at 72 C<br />
<br />
*Remaining stray product had a slightly tricky secondary structure at the 3' end. It will be run at a series of annealing temperatures in a PCR machine capable of a temperature gradient.<br />
<br />
*mOrange PCR run at many different temperatures, from 62 &deg;C to 76 &deg;C. However this doesn't seem to solve our problem (refer to Gel photos). It seems likely that it is a primer design problem.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Construction of riboswitch plasmid with Gibson Assembly]]'''<br />
<br />
----<br />
<br />
*DNA from lanes 27+28, 27+29, 27+30 from gels run on Friday fused together with Gibson assembly to produce riboswitch construct. This does not have replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
*DNA from lanes 22,23 and 24 fused with riboswitch DNA produced two weeks ago to produce riboswitch construct. This has replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
===Tuesday (01/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of TOP10 E.coli with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into TOP10 e.coli cells and transformants plated out on 100&mu;g/ml ampicillin plates.<br />
<br />
===Wednesday (01/08/12)===<br />
<br />
'''Mg2+ Riboswitch'''<br />
<br />
----<br />
<br />
*Successful colonies produced from transformations two days ago streaked out onto chloramphenicol (5 &mu;g/ml) containing plates.<br />
<br />
*Colonies also grown up in 10ml of medium A for use with plate reader later.<br />
<br />
===Friday (03/08/12)<br />
<br />
''' [[Team:Cambridge/Protocols/PCRProtocol|PCR of split Mg2+ vector]]'''<br />
<br />
----<br />
<br />
[[File:split Mg2+ 1.jpg|left|250px|thumb|results of split magnesium vector PCR. None of the products worked]]<br />
<br />
*PCR of magnesium riboswitch vector repeated with primers to split plasmid.<br />
<br />
*Lanes 2 + 3: Fragment A (center - cut site (promotor side))<br />
<br />
*Lanes 4 + 5: Fragment B (without 8 codon substitution) (cut site (lac I side) - center)<br />
<br />
*Lanes 6 + 7: Fragment B (with 8 codon substitution) (cut stie (lac I side) - center)<br />
<br />
*Gels run, found PCR was unsuccessful.<br />
<br />
===Sunday (05/08/12)===<br />
<br />
'''Ribosense: [[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg Riboswitch vector fragments]]'''<br />
<br />
----<br />
<br />
*2nd attempt since the PCR on Friday did not work, possibly due to mastermix problems<br />
<br />
*PCR Programme:<br />
<br />
*Results: Fragment A was successfully PCR-ed (lanes 3-4); Fragment B did not come out, with or without the 8 codons (lanes 5-6 (-8); lanes 7-8 (+8))<br />
<br />
==Week 7==<br />
<br />
===Monday (06/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Magnesium riboswitch vector fragment B and Magnesium promoter]]'''<br />
<br />
----<br />
<br />
[[File:MgRS vector frag. B.jpg|right|250px|thumb|Riboswitch and promoter gel. Lanes 2+3: Fragment B without 8 codon substitution, lanes 4+5: Fragment B with 8 codon substitution, lanes 6+7: magnesium sensitive promoter, lane 8: +ve control]]<br />
<br />
*Normal PCR settings used, annealing temperature 57 &deg;C, elongation step 90s long.<br />
<br />
*Lane 5 accidentally loaded with a DNA ladder instead of loading dye.<br />
<br />
*Expected fragment sizes:<br />
<br />
:*Lane 2-5: 3kbp<br />
<br />
:*Lane 6-7: 300bp<br />
<br />
*After electrophoresis, found vector products had, for the most part, worked. Promoter elements were not amplified - no band of the expected size was observed.<br />
<br />
*Positive control also failed, although this has ceased to work for several days, potentially due to DNA degradation.<br />
<br />
===Tuesday (07/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of magnesium riboswitch]]'''<br />
<br />
----<br />
<br />
*NAD+ added to '''isothermal buffer'''*5 mix<br />
<br />
*Gel slices from yesterday (of vector fragment B) purified.<br />
<br />
*DNA added as follows:<br />
<br />
:*Without 8 codon substitution:<br />
<br />
::*Reaction 1: Tube 2 (07/08/12) (fragment B), Tube 1 (05/08/12) (fragment A), Tube 28 (29/08/12) (riboswitch DNA).<br />
<br />
::*Reaction 2: Tube 3 (07/08/12) (fragment B), Tube 2 (05/08/12) (fragment A), Tube 29 (29/08/12) (riboswitch DNA).<br />
<br />
:*With 8 codon substitution:<br />
<br />
::*Reaction 3: Tube 4 (07/08/12) (fragment B), Tube 1 (05/08/12) (fragment A), Tube 2 (18/07/12) (riboswitch DNA).<br />
<br />
===Wednesday (08/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/ElectricalTransformation|Electrical transformation of competent e.coli with Gibson products]]'''<br />
<br />
----<br />
<br />
*Gibson constructs from yesterday (fluorescent and magnesium riboswitch) transformed into e.coli produced yesterday.<br />
<br />
*Cells plated out onto 50 &mu;g/ml ampicillin plates. Put in incubator overnight.<br />
<br />
===Friday (10/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay|Characterization of fluoride riboswitch sensitivity with &beta;-galactosidase]]'''<br />
<br />
----<br />
<br />
*X-Gal made up to a concentration of 400 &mu;g/ml with water.<br />
<br />
*Fluoride of concentrations 0.5 - 30 mM mixed with bacterial culture (Yale construct containing) grown up overnight.<br />
<br />
===Saturday (11/08/12)===<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/RestrictionDigest|Restriction digest of Yale plasmid]]'''<br />
<br />
----<br />
<br />
*Cells from electroporation of e.coli with plasmid from Yale (08/08/12) [[Team:Cambridge/Protocols/MiniPrep|miniprepped]] to extract plasmid DNA.<br />
<br />
*DNA digested with XhoI and SalI, expected fragment sizes 5580, 3139, 1437<br />
<br />
*Gel run, results not shown as gel was very 'messy'. Gel had probably already begun to set when poured and so had many artefacts when imaged. As a result each lane required different brightness and contrast settings to visualise and so the full gel was not clearly visible on the printout. However, all of the bands could be identified on the screen and were exactly as expected and very clear and pure.<br />
<br />
*Bands in correct places, indicating that expected plasmid was present in the cells. This indicates that, although they work at a very low efficiency, our electro-competent cells still work. It may be valuable to use these when trying to grow up plasmids that we already have at high concentration. <br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of e.coli with Magnesium riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Gibson products from 07/08/12 transformed into chemically competent cells.<br />
<br />
*Transformants plated out on 100 &mu;g/ml ampicillin plates<br />
<br />
==Week 8==<br />
<br />
===Wednesday (15/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay| Characterization of fluoride riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Strain of ''bacillus'' lacking fluoride transporter system tested. Concentrations used:<br />
<br />
:*0mM - 0.5mM - 1mM - 2.5mM - 5mM - 10mM - 20mM - 30mM<br />
<br />
===Thursday (16/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay| Characterization of fluoride riboswitch construct]]'''<br />
<br />
----<br />
<br />
[[File:fluoridegradient.jpg|250px|right|thumb|The results of our fluoride assay.]]<br />
<br />
* Eppindorfs containing the ''bacillus'' with the fluoride riboswitch removed from incubator and imaged.<br />
<br />
* Now this definitely works, we will try quantifying this riboswitch with an ONPG assay and the plate reader.<br />
<br />
===Saturday (18/08/12)===<br />
<br />
'''Colonies picked in preparation for Miller assay'''<br />
<br />
----<br />
<br />
*2 ''E. coli'' colonies transformed with the purified plasmid were picked and inoculated in LB with 50&mu;g/ml Amp<br />
<br />
*2 colonies each from the 168 strain and crcB knockout ''B. subtilis'' containing the fluoride riboswitch were picked and inoculated in LB with 5&mu;g/ml Chlor<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Fluoride biobrick format]]'''<br />
<br />
----<br />
<br />
[[File:FluorideBB1gel.jpg|right|250px|thumb|Gels from PCR of Fluoride BB and PJS130 fragments. Top: Lanes 2-4: Gibson compatable Fluoride biobrick fragment. Lanes 5-7: Ligation compatable Fluoride biobrick fragment. Lane 8: PJS130 fragment A. Bottom: Lanes 1-2: PJS130 fragment A. Lanes 3-5: PJS 130 fragment B. Lane 6: Positive control. Lane 7: Negative control.]]<br />
<br />
*Two sets of primers used: one to allow insertion into backbone by ligation, and one to allow insertion by Gibson assembly.<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 100 seconds<br />
<br />
*Products run on gel. Fragments produced of correct size, however they overlapped with the primer dimer band due to the small size of the fragments.<br />
<br />
*DNA extracted and purified.<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg2+ riboswitch construct vector]]'''<br />
<br />
----<br />
<br />
*Separate reactions for<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 100 seconds <br />
<br />
*Products run on gel. No fragments produced. Positive control worked however, so master mix clearly works.<br />
<br />
*Given this PCR has worked in the past, will try to re-run with the same settings and hope for success in the future.<br />
<br />
===Sunday (19/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/MillerAssay|Miller Assay of Fluoride construct]]'''<br />
<br />
----<br />
<br />
* Colonies picked from overnight and Miller assay run as directed on protocols page<br />
<br />
* Lack of filters meant that only A450 data recorderd<br />
<br />
==Week 9==<br />
<br />
===Tuesday (21/08/12)===<br />
<br />
'''PCR for Mg Riboswitch'''<br />
<br />
----<br />
*[[Team:Cambridge/Protocols/PCRProtocol| PCRs]] were run for pJS130.1 split vector ('+8 codons')<br />
*[[Team:Cambridge/Protocols/PCRcolony| Colony PCR]] for endogenous ''Bacillus subtilis'' Mg Riboswitch ('+8 codons') was run<br />
*Gels were run for above reactions, only one band for half of the pJS130 vector was visible.<br />
<br />
===Wednesday (22/08/12)===<br />
<br />
'''PCR for Mg Riboswitch'''<br />
<br />
----<br />
<br />
*[[Team:Cambridge/Protocols/PCRProtocol| PCRs]] were run for F Riboswitch from Yale's plasmid with overhangs for standard assembly.<br />
*[[Team:Cambridge/Protocols/PCRcolony| Colony PCR]] for endogenous ''Bacillus subtilis'' Mg Riboswitch (both '+8 codons' and '-8 codons' versions) were re-run.<br />
*Gels were run for above reactions, only one band for positive control was visible.<br />
<br />
'''Cells cultured for Miller assay'''<br />
----<br />
*''B. subtilis'' strains carrying F riboswitch and 'KO' strains cultured separately in LB and 5µg/mL Chloramphenicol at 37°C<br />
*''E.Coli'' carrying F riboswitch cultured in LB and 50mg/ml Ampicillin at 37°C<br />
<br />
===Thursday (23/08/12)===<br />
* Miller assay set up and running with the wild type and crcB knock-out ''Bacillus'' strains and an ''E. coli'' strain which contains the construct on an episomal plasmid.<br />
<br />
===Friday (24/08/12)===<br />
*Miller assay data collected for analysis over the weekend<br />
<br />
==Week 10==<br />
<br />
===Monday (27/08/12)===<br />
'''RiboSense:[[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg RS from bacillus genomic DNA]]'''<br />
<br />
----<br />
<br />
*3 part primers used, to amplify the 486bp from the genome, and the vector in two parts<br />
*PCR failed, only positive control came out. Will re run when new primers arrive.<br />
<br />
===Thursday (30/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of Mg2+ riboswitch from genomic DNA]]'''<br />
<br />
----<br />
<br />
[[File: MGRSgel1.jpg|right|250px|thumb|Gel from amplification of the riboswitch DNA. Lanes 2 + 3: with 8 codon substitution. Lanes 4 + 5: without 8 codon substitution.]]<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 30 seconds<br />
<br />
*Fragments of correct size produced for all except lane 5 produced. In this lane, DNA appears to have accumulated in the well, indicating it may be genomic. In future, will use lower numbers of template cells to avoid getting so much genomic DNA.<br />
<br />
*Products extracted and purified.<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of PJS130 vector for Mg riboswitch construct]]'''<br />
<br />
----<br />
<br />
[[File:PJS130gel2.jpg|250px|right|thumb|Gel from amplification of PJS130 vector for MGRS construct. Lanes 2 + 3: Fragment A. Lanes 4 + 5: Fragment B with 8 codon substitution. Lanes 6 + 7: Fragment B without 8 codon substitution.]]<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 60 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 110 seconds<br />
<br />
*Fragment of correct size produced in lane 5, but too faint to be extracted successfully. None of the other lanes were successful. We will try this again tomorrow, at 58 &deg;C and with 35 cycles (as is usual) instead of 30.<br />
<br />
*Note that phusion enzyme was left with primers and template DNA for about half an hour before reaction began, possibly causing degradation of the primer DNA.<br />
<br />
===Friday (31/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of PJS130 vector for MgRS construct]]'''<br />
<br />
----<br />
<br />
[[File:PJS130gel1.jpg|250px|left|thumb|Gel from amplification of PJS130 fragments. Lanes 2 + 3: Fragment A. Lanes 4 + 5: Fragment B with eight codon substitution. Lanes 6 + 7: Fragment B without eight codon substitution. Lane 8: Negative control.]]<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 120 seconds<br />
<br />
*Products of correct sizes (5.5kbp and 3.5 kbp) produced for all reactions, although lanes 2 and 4 failed to produce any product, despite primer smear. Most likely, template was not added, or one of the primers was not added.<br />
<br />
*Products excised and purified.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of Mg2+ riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Reaction 1: Without 8 codon substitution: Vec A, Vec B -8 (replicate 1), Genomic -8.<br />
<br />
*Reaction 2: Without 8 codon substitution: Vec A, Vec B -8 (replicate 2), Genomic -8. <br />
<br />
*Reaction 3: With 8 codon substitution: Vec A, Vec B +8, Genomic +8 (replicate 1).<br />
<br />
*Reaction 4: With 8 codon substitution: Vec A, Vec B +8, Genomic +8 (replicate 2).<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of e.coli with Gibson products]]'''<br />
<br />
----<br />
<br />
*20 &mu;l of Gibson reaction mix transformed into e.coli cells. Transformants plated out onto 100 &mu;g/ml ampicillin plates.<br />
<br />
===Saturday (01/09/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Verification of Mg2+ gel extractions]]'''<br />
<br />
----<br />
<br />
[[File:Mg2+verificationgel1.jpg|250px|right|thumb|Verification gel of extracted DNA. Lanes 1,7 + 13: Ladder. Lanes 2 - 4: Old vector DNA (06/08/12). Lane 5: PJS130 fragment A. Lanes 6,8 + 9: PJS130 fragment B. Lanes 10 - 12: Genomic riboswitch DNA.]]<br />
<br />
*DNA used in Gibson from yesterday and several weeks ago. Run on gel to verify the presence of DNA fragments of the correct size after gel extraction.<br />
<br />
*Old DNA appears to have degraded, or else products were produced in too small a quantity to show up on the gel. Fortunately, these are not/ have not been used.<br />
<br />
*Bands of the correct size for fragment A (5.5kbp), fragment B (3.5kbp) and the genomic DNA (550bp) present. Though riboswitch DNA has not come out well in this image, it was present under visual examination.<br />
<br />
*Approximate DNA concentrations in the range of 2 - 6 ng/&mu;l.<br />
<br />
===Sunday (02/09/12)===<br />
<br />
[[File:MGRSverification1.jpg|left|250px|thumb|Results from colony PCR (right of central ladder) and of restriction digest (left of central ladder). Restriction digest produced inconclusive results, however colony PCR indicates that the riboswitch only inserted into the second of the two colonies picked from the +8 version plate (last two lanes before ladder).]]<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|Verification of Mg2+ riboswitch construct by colony PCR]]'''<br />
<br />
----<br />
<br />
*Gibson primers used to amplify out riboswitch section of plasmid produced and transformed into e.coli to verify if riboswitch had inserted into PJS130.<br />
*Band at ~550bp in lanes 8 and 9 (replicates) indicate that the riboswich has only been successfuly transformed into the second of the two colonies picked on the +8 plate, and not at all for the -8 construct.<br />
<br />
'''[[Team:Cambridge/Protocols/MiniPrep|Miniprep of plasmid DNA]]'''<br />
<br />
----<br />
<br />
*E.coli from strains made yesterday miniprepped to get plasmid DNA at high concentration. After colony PCR results, all DNA other than that of the successful colony discarded.<br />
<br />
'''[[Team:Cambridge/Protocols/RestrictionDigest|Verification of Mg2+ riboswitch construct by restriction digest]]'''<br />
<br />
----<br />
<br />
*BamH1 and Sal1 used to digest plasmid DNA produced from miniprep.<br />
*Resultant fragment run on gel.<br />
*Bands produced inconclusive, possibly because of too short an incubation time with restriction enzymes. Expected bands at ~4900bp and ~4500bp. Will re-run experiment in future to check results of colony PCR.<br />
<br />
==Week 11==<br />
<br />
===Wednesday (05/09/12)===<br />
<br />
[[File:BBPCR1.jpg|250px|left|thumb|PCR products from Wednesday's PCR. Lanes 2 - 3: Fluoride riboswitch biobrick genomic DNA. Lanes 4 - 5: MGRS construct genomic DNA (+8). Lanes 6 - 7: MGRS construct genomic DNA (-8). Lane 8: MGRS biobrick genomic DNA (+8).]]<br />
<br />
[[File:BBPCR2.jpg|250px|right|thumb|PCR products from Wednesday's PCR. Top: Lane 2: MGRS biobrick genomic DNA (+8). Lanes 3 - 4: MGRS construct backbone (expected size 9kbp) (+8). Lanes 5 - 6: MGRS construct backbone (expected size 9kbp) (-8). Lane 7: MGRS biobrick vector (+8). Lane 8: Positive control. Bottom: Lane 2: MGRS biobrick vector (+8). lane 3: Negative control.]]<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of biobrick fragments and MGRS construct fragments.]]'''<br />
<br />
----<br />
<br />
*Fluoride and magnesium riboswitch genomic DNA amplified with PCR, along with vector fragments for turning the MGRS into a biobrick and for producing the magnesium riboswitch construct.<br />
*PCR settings: Annealing temperature - 58 &deg;C, Elongation step - 60 seconds.<br />
*Genomic fragments worked well, but longer backbone fragments mostly failed.<br />
*Extractions of DNA from these gels failed almost completely. Will try purifying directly from PCR products next time - results may not produce such a high purity of the precise DNA we want, but the increase in yield should outweigh this problem.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of -8 MGRS construct]]<br />
<br />
----<br />
<br />
*Fragments gel extracted earlier assembled with Gibson assembly.<br />
*Fragments used:<br />
:*9kbp fragment from tube 13 used as backbone.<br />
:*Genomic fragments from tubes 6 + 7.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of E.coli with Gibson products]]<br />
<br />
----<br />
<br />
*Gibson products from earlier today used to transform e.coli.<br />
*Resultant transformants plated out on 100 &mu;g/ml ampicillin plates.<br />
<br />
==Week 12==<br />
<br />
==Week 13==<br />
<br />
==Week 14==<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Ribosense/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Ribosense/LabbookTeam:Cambridge/Ribosense/Labbook2012-10-27T03:28:51Z<p>Olijme: /* Week 10 */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Labbook");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= General Labbook =<br />
<br />
==Week 4 ==<br />
<br />
===Tuesday (17/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of MGRS vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 58 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 180secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain 168 used as template for this experiment.<br />
<br />
* Primers used:<br />
<br />
:* Forward: cggagggagacgattttgTGTTCCGTAATTGTGATGTAAG<br />
<br />
:* Reverse: acaccggcatactctgcgacGTCATAGGTCATGTTTTGAACC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Wednesday (18/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:Mg2+ Gel PCR 1.jpg|250px|right|thumb|Results of gel electrophoresis of PCR fragments from yesterday. 550bp fragments in lanes 2+3 were removed before the image was taken]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2 + 3: Riboswitch DNA from genome (replicates) - 550bp fragment expected.<br />
<br />
:*Lane 4 + 5: Vector DNA from pJS130 (replicates)- Chloramphenicol resistance marker - 9.0kbp fragment expected<br />
<br />
:*Lane 6: Postitive control - 1.9kbp fragment expected<br />
<br />
*Riboswitch DNA was successfully amplified. However, vector DNA was not. Given that the postive control was also successful, it seems likely that something went wrong with some stage before the PCR amplification. We will try to rectify the problem tomorrow.<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of riboswitch DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful riboswitch DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
===Thursday (19/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 55 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 240secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
*Settings changed - Annealing temperature and elongation time - attempting to debug PCR.<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:PCR Gel Mg2+ 2.jpg|right|250px|thumb|PCR products from today. Note the unusual band in the negative control and the vector lanes]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2, 3 + 4: Vector DNA from pJS130 (replicates) - 9.0kbp fragment expected<br />
<br />
:*Lane 5: Postitive control - 1.9kbp fragment expected<br />
<br />
:*Lane 6: Negative control - no fragments expected<br />
<br />
*Once more, the PCR appears to have failed. We will try to redesign the primers tomorrow to make them functional.<br />
<br />
==Week 5==<br />
<br />
===Thursday (26/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome and Lux genes from e.coli genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain pJS130 used as template for riboswitch, colony of previously transformed e.coli used as template for lux operon.<br />
<br />
:*M2+ RS<br />
<br />
::*Forward: cggagggagacgattttg|TGTTCCGTAATTGTGATGTAAG<br />
<br />
::*Reverse: tataacgttactggtttcat|CGGGACTCGTACCTCC<br />
<br />
:*Lux operon<br />
<br />
::*Forward: gctgtacaag|GGAGGAGGAGGAAGTGGAGGAGGAGGAAGT|atgaagtttggaaatatttgtttttc<br />
<br />
::*Reverse: cctcgcccttgctcaccat|ACTCTATTCCTTTTTGGTGATTC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Friday (27/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
{|cellspacing="20"<br />
|[[File:CAM_120727_1_edited.jpg|200px|left|thumb|Vector amplification gel. Lanes 2-4 Lux containing vector. Lanes 5-7 Fluorescent construct vector. No products from this gel were amplified.]]<br />
|[[File:CAM_120727_2_edited.jpg|200px|left|thumb|Various. Lanes 3-5 mOrange amplification. Lanes 6-8 eCFP (E0020) amplification. mOrange amplification did not work.]]<br />
|[[File:CAM_120727_3_edited.jpg|200px|left|thumb|Small products for fluorescent construct. Lanes 1-3 Terminator (B0015). Lanes 4-6 Promotor pVEG + SpoVG (K143053).]]<br />
|-<br />
|[[File:CAM_120727_4_edited.jpg|200px|left|thumb|Various. Lanes 2-4 eYFP (E0030) amplification. Lanes 5-7 Mg2+ vector +8 codons. Lane 8 Mg2+ vector -8 codons. Lane 8 amplification did not work.]]<br />
|[[File:CAM_120727_5_edited.jpg|200px|left|thumb|Mg2+ riboswitch gel. Lanes 6+7 positive and negative controls respectively for entire run. Lanes 3-5 genomic riboswitch amplification -8 codons. Lanes 2+3 vector -8 codons.]]<br />
|}<br />
<br />
*PCR fragments for Mg2+ riboswitch, luxA/mOrange fusion and fluorescent construct from yesterday separated on gels. 90mins at 100V.<br />
<br />
*Mostly successful, but will need to repeat four runs: Three vectors (fluorescent, fusion (lux) and Mg2+ riboswitch (-8 codons) and mOrange gene.<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of successfully amplified DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful CFP, YFP, B0015, Pveg + SpoVG (K143053), riboswitch and vector DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
==Week 6==<br />
<br />
===Monday (30/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vectors and mOrange]]'''<br />
<br />
----<br />
<br />
[[File:mOrangegel.jpg|250px|thumb|mOrange PCR run at multiple temperatures, every two lanes increacing the temperature of the annealing step by 2 &deg;C. No lanes worked.]]<br />
<br />
[[File:vectorgel1.jpg|250px|thumb|Top: Fusion, lux containing vector gel. Lanes 2-4, Vector DNA. Lane 5, +ve control. Lane 6, -ve control. Bottom: Vector gel. Lanes 1-3, Fluorescent construct vector DNA. Lanes 4-6, Riboswitch construct vector DNA.]]<br />
<br />
*Not all products were obtained during Friday's PCR. Most of these missing products were large vector backbones. They are being run again, with a much longer extension time of 300s. If that fails, primers will be ordered to split the vectors into manageable chunks, and the PCR reattempted when they arrive.<br />
<br />
*PCR cycle x35: <br />
<br />
:* 15s Denaturing at 95 C<br />
:* 45s Annealing at 60 C<br />
:* 300s Extension at 72 C<br />
<br />
*Remaining stray product had a slightly tricky secondary structure at the 3' end. It will be run at a series of annealing temperatures in a PCR machine capable of a temperature gradient.<br />
<br />
*mOrange PCR run at many different temperatures, from 62 &deg;C to 76 &deg;C. However this doesn't seem to solve our problem (refer to Gel photos). It seems likely that it is a primer design problem.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Construction of riboswitch plasmid with Gibson Assembly]]'''<br />
<br />
----<br />
<br />
*DNA from lanes 27+28, 27+29, 27+30 from gels run on Friday fused together with Gibson assembly to produce riboswitch construct. This does not have replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
*DNA from lanes 22,23 and 24 fused with riboswitch DNA produced two weeks ago to produce riboswitch construct. This has replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
===Tuesday (01/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of TOP10 E.coli with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into TOP10 e.coli cells and transformants plated out on 100&mu;g/ml ampicillin plates.<br />
<br />
===Wednesday (01/08/12)===<br />
<br />
'''Mg2+ Riboswitch'''<br />
<br />
----<br />
<br />
*Successful colonies produced from transformations two days ago streaked out onto chloramphenicol (5 &mu;g/ml) containing plates.<br />
<br />
*Colonies also grown up in 10ml of medium A for use with plate reader later.<br />
<br />
===Friday (03/08/12)<br />
<br />
''' [[Team:Cambridge/Protocols/PCRProtocol|PCR of split Mg2+ vector]]'''<br />
<br />
----<br />
<br />
[[File:split Mg2+ 1.jpg|left|250px|thumb|results of split magnesium vector PCR. None of the products worked]]<br />
<br />
*PCR of magnesium riboswitch vector repeated with primers to split plasmid.<br />
<br />
*Lanes 2 + 3: Fragment A (center - cut site (promotor side))<br />
<br />
*Lanes 4 + 5: Fragment B (without 8 codon substitution) (cut site (lac I side) - center)<br />
<br />
*Lanes 6 + 7: Fragment B (with 8 codon substitution) (cut stie (lac I side) - center)<br />
<br />
*Gels run, found PCR was unsuccessful.<br />
<br />
===Sunday (05/08/12)===<br />
<br />
'''Ribosense: [[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg Riboswitch vector fragments]]'''<br />
<br />
----<br />
<br />
*2nd attempt since the PCR on Friday did not work, possibly due to mastermix problems<br />
<br />
*PCR Programme:<br />
<br />
*Results: Fragment A was successfully PCR-ed (lanes 3-4); Fragment B did not come out, with or without the 8 codons (lanes 5-6 (-8); lanes 7-8 (+8))<br />
<br />
==Week 7==<br />
<br />
===Monday (06/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Magnesium riboswitch vector fragment B and Magnesium promoter]]'''<br />
<br />
----<br />
<br />
[[File:MgRS vector frag. B.jpg|right|250px|thumb|Riboswitch and promoter gel. Lanes 2+3: Fragment B without 8 codon substitution, lanes 4+5: Fragment B with 8 codon substitution, lanes 6+7: magnesium sensitive promoter, lane 8: +ve control]]<br />
<br />
*Normal PCR settings used, annealing temperature 57 &deg;C, elongation step 90s long.<br />
<br />
*Lane 5 accidentally loaded with a DNA ladder instead of loading dye.<br />
<br />
*Expected fragment sizes:<br />
<br />
:*Lane 2-5: 3kbp<br />
<br />
:*Lane 6-7: 300bp<br />
<br />
*After electrophoresis, found vector products had, for the most part, worked. Promoter elements were not amplified - no band of the expected size was observed.<br />
<br />
*Positive control also failed, although this has ceased to work for several days, potentially due to DNA degradation.<br />
<br />
===Tuesday (07/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of magnesium riboswitch]]'''<br />
<br />
----<br />
<br />
*NAD+ added to '''isothermal buffer'''*5 mix<br />
<br />
*Gel slices from yesterday (of vector fragment B) purified.<br />
<br />
*DNA added as follows:<br />
<br />
:*Without 8 codon substitution:<br />
<br />
::*Reaction 1: Tube 2 (07/08/12) (fragment B), Tube 1 (05/08/12) (fragment A), Tube 28 (29/08/12) (riboswitch DNA).<br />
<br />
::*Reaction 2: Tube 3 (07/08/12) (fragment B), Tube 2 (05/08/12) (fragment A), Tube 29 (29/08/12) (riboswitch DNA).<br />
<br />
:*With 8 codon substitution:<br />
<br />
::*Reaction 3: Tube 4 (07/08/12) (fragment B), Tube 1 (05/08/12) (fragment A), Tube 2 (18/07/12) (riboswitch DNA).<br />
<br />
===Wednesday (08/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/ElectricalTransformation|Electrical transformation of competent e.coli with Gibson products]]'''<br />
<br />
----<br />
<br />
*Gibson constructs from yesterday (fluorescent and magnesium riboswitch) transformed into e.coli produced yesterday.<br />
<br />
*Cells plated out onto 50 &mu;g/ml ampicillin plates. Put in incubator overnight.<br />
<br />
===Friday (10/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay|Characterization of fluoride riboswitch sensitivity with &beta;-galactosidase]]'''<br />
<br />
----<br />
<br />
*X-Gal made up to a concentration of 400 &mu;g/ml with water.<br />
<br />
*Fluoride of concentrations 0.5 - 30 mM mixed with bacterial culture (Yale construct containing) grown up overnight.<br />
<br />
===Saturday (11/08/12)===<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/RestrictionDigest|Restriction digest of Yale plasmid]]'''<br />
<br />
----<br />
<br />
*Cells from electroporation of e.coli with plasmid from Yale (08/08/12) [[Team:Cambridge/Protocols/MiniPrep|miniprepped]] to extract plasmid DNA.<br />
<br />
*DNA digested with XhoI and SalI, expected fragment sizes 5580, 3139, 1437<br />
<br />
*Gel run, results not shown as gel was very 'messy'. Gel had probably already begun to set when poured and so had many artefacts when imaged. As a result each lane required different brightness and contrast settings to visualise and so the full gel was not clearly visible on the printout. However, all of the bands could be identified on the screen and were exactly as expected and very clear and pure.<br />
<br />
*Bands in correct places, indicating that expected plasmid was present in the cells. This indicates that, although they work at a very low efficiency, our electro-competent cells still work. It may be valuable to use these when trying to grow up plasmids that we already have at high concentration. <br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of e.coli with Magnesium riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Gibson products from 07/08/12 transformed into chemically competent cells.<br />
<br />
*Transformants plated out on 100 &mu;g/ml ampicillin plates<br />
<br />
==Week 8==<br />
<br />
===Wednesday (15/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay| Characterization of fluoride riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Strain of ''bacillus'' lacking fluoride transporter system tested. Concentrations used:<br />
<br />
:*0mM - 0.5mM - 1mM - 2.5mM - 5mM - 10mM - 20mM - 30mM<br />
<br />
===Thursday (16/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay| Characterization of fluoride riboswitch construct]]'''<br />
<br />
----<br />
<br />
[[File:fluoridegradient.jpg|250px|right|thumb|The results of our fluoride assay.]]<br />
<br />
* Eppindorfs containing the ''bacillus'' with the fluoride riboswitch removed from incubator and imaged.<br />
<br />
* Now this definitely works, we will try quantifying this riboswitch with an ONPG assay and the plate reader.<br />
<br />
===Saturday (18/08/12)===<br />
<br />
'''Colonies picked in preparation for Miller assay'''<br />
<br />
----<br />
<br />
*2 ''E. coli'' colonies transformed with the purified plasmid were picked and inoculated in LB with 50&mu;g/ml Amp<br />
<br />
*2 colonies each from the 168 strain and crcB knockout ''B. subtilis'' containing the fluoride riboswitch were picked and inoculated in LB with 5&mu;g/ml Chlor<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Fluoride biobrick format]]'''<br />
<br />
----<br />
<br />
[[File:FluorideBB1gel.jpg|right|250px|thumb|Gels from PCR of Fluoride BB and PJS130 fragments. Top: Lanes 2-4: Gibson compatable Fluoride biobrick fragment. Lanes 5-7: Ligation compatable Fluoride biobrick fragment. Lane 8: PJS130 fragment A. Bottom: Lanes 1-2: PJS130 fragment A. Lanes 3-5: PJS 130 fragment B. Lane 6: Positive control. Lane 7: Negative control.]]<br />
<br />
*Two sets of primers used: one to allow insertion into backbone by ligation, and one to allow insertion by Gibson assembly.<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 100 seconds<br />
<br />
*Products run on gel. Fragments produced of correct size, however they overlapped with the primer dimer band due to the small size of the fragments.<br />
<br />
*DNA extracted and purified.<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg2+ riboswitch construct vector]]'''<br />
<br />
----<br />
<br />
*Separate reactions for<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 100 seconds <br />
<br />
*Products run on gel. No fragments produced. Positive control worked however, so master mix clearly works.<br />
<br />
*Given this PCR has worked in the past, will try to re-run with the same settings and hope for success in the future.<br />
<br />
===Sunday (19/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/MillerAssay|Miller Assay of Fluoride construct]]'''<br />
<br />
----<br />
<br />
* Colonies picked from overnight and Miller assay run as directed on protocols page<br />
<br />
* Lack of filters meant that only A450 data recorderd<br />
<br />
==Week 9==<br />
<br />
===Tuesday (21/08/12)===<br />
<br />
'''PCR for Mg Riboswitch'''<br />
<br />
----<br />
*[[Team:Cambridge/Protocols/PCRProtocol| PCRs]] were run for pJS130.1 split vector ('+8 codons')<br />
*[[Team:Cambridge/Protocols/PCRcolony| Colony PCR]] for endogenous ''Bacillus subtilis'' Mg Riboswitch ('+8 codons') was run<br />
*Gels were run for above reactions, only one band for half of the pJS130 vector was visible.<br />
<br />
===Wednesday (22/08/12)===<br />
<br />
'''PCR for Mg Riboswitch'''<br />
<br />
----<br />
<br />
*[[Team:Cambridge/Protocols/PCRProtocol| PCRs]] were run for F Riboswitch from Yale's plasmid with overhangs for standard assembly.<br />
*[[Team:Cambridge/Protocols/PCRcolony| Colony PCR]] for endogenous ''Bacillus subtilis'' Mg Riboswitch (both '+8 codons' and '-8 codons' versions) were re-run.<br />
*Gels were run for above reactions, only one band for positive control was visible.<br />
<br />
'''Cells cultured for Miller assay'''<br />
----<br />
*''B. subtilis'' strains carrying F riboswitch and 'KO' strains cultured separately in LB and 5µg/mL Chloramphenicol at 37°C<br />
*''E.Coli'' carrying F riboswitch cultured in LB and 50mg/ml Ampicillin at 37°C<br />
<br />
===Thursday (23/08/12)===<br />
* Miller assay set up and running with the wild type and crcB knock-out ''Bacillus'' strains and an ''E. coli'' strain which contains the construct on an episomal plasmid.<br />
<br />
===Friday (24/08/12)===<br />
*Miller assay data collected for analysis over the weekend<br />
<br />
==Week 10==<br />
<br />
===Monday (27/08/12)===<br />
'''RiboSense:[[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg RS from bacillus genomic DNA]]'''<br />
<br />
----<br />
<br />
*3 part primers used, to amplify the 486bp from the genome, and the vector in two parts<br />
*PCR failed, only positive control came out. Will re run when new primers arrive.<br />
<br />
===Thursday (30/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of Mg2+ riboswitch from genomic DNA]]'''<br />
<br />
----<br />
<br />
[[File: MGRSgel1.jpg|right|250px|thumb|Gel from amplification of the riboswitch DNA. Lanes 2 + 3: with 8 codon substitution. Lanes 4 + 5: without 8 codon substitution.]]<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 30 seconds<br />
<br />
*Fragments of correct size produced for all except lane 5 produced. In this lane, DNA appears to have accumulated in the well, indicating it may be genomic. In future, will use lower numbers of template cells to avoid getting so much genomic DNA.<br />
<br />
*Products extracted and purified.<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of PJS130 vector for Mg riboswitch construct]]'''<br />
<br />
----<br />
<br />
[[File:PJS130gel2.jpg|250px|right|thumb|Gel from amplification of PJS130 vector for MGRS construct. Lanes 2 + 3: Fragment A. Lanes 4 + 5: Fragment B with 8 codon substitution. Lanes 6 + 7: Fragment B without 8 codon substitution.]]<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 60 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 110 seconds<br />
<br />
*Fragment of correct size produced in lane 5, but too faint to be extracted successfully. None of the other lanes were successful. We will try this again tomorrow, at 58 &deg;C and with 35 cycles (as is usual) instead of 30.<br />
<br />
*Note that phusion enzyme was left with primers and template DNA for about half an hour before reaction began, possibly causing degradation of the primer DNA.<br />
<br />
===Friday (31/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of PJS130 vector for MgRS construct]]'''<br />
<br />
----<br />
<br />
[[File:PJS130gel1.jpg|250px|left|thumb|Gel from amplification of PJS130 fragments. Lanes 2 + 3: Fragment A. Lanes 4 + 5: Fragment B with eight codon substitution. Lanes 6 + 7: Fragment B without eight codon substitution. Lane 8: Negative control.]]<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 120 seconds<br />
<br />
*Products of correct sizes (5.5kbp and 3.5 kbp) produced for all reactions, although lanes 2 and 4 failed to produce any product, despite primer smear. Most likely, template was not added, or one of the primers was not added.<br />
<br />
*Products excised and purified.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of Mg2+ riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Reaction 1: Without 8 codon substitution: Vec A, Vec B -8 (replicate 1), Genomic -8.<br />
<br />
*Reaction 2: Without 8 codon substitution: Vec A, Vec B -8 (replicate 2), Genomic -8. <br />
<br />
*Reaction 3: With 8 codon substitution: Vec A, Vec B +8, Genomic +8 (replicate 1).<br />
<br />
*Reaction 4: With 8 codon substitution: Vec A, Vec B +8, Genomic +8 (replicate 2).<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of e.coli with Gibson products]]'''<br />
<br />
----<br />
<br />
*20 &mu;l of Gibson reaction mix transformed into e.coli cells. Transformants plated out onto 100 &mu;g/ml ampicillin plates.<br />
<br />
===Saturday (01/09/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Verification of Mg2+ gel extractions]]'''<br />
<br />
----<br />
<br />
[[File:Mg2+verificationgel1.jpg|250px|right|thumb|Verification gel of extracted DNA. Lanes 1,7 + 13: Ladder. Lanes 2 - 4: Old vector DNA (06/08/12). Lane 5: PJS130 fragment A. Lanes 6,8 + 9: PJS130 fragment B. Lanes 10 - 12: Genomic riboswitch DNA.]]<br />
<br />
*DNA used in Gibson from yesterday and several weeks ago. Run on gel to verify the presence of DNA fragments of the correct size after gel extraction.<br />
<br />
*Old DNA appears to have degraded, or else products were produced in too small a quantity to show up on the gel. Fortunately, these are not/ have not been used.<br />
<br />
*Bands of the correct size for fragment A (5.5kbp), fragment B (3.5kbp) and the genomic DNA (550bp) present. Though riboswitch DNA has not come out well in this image, it was present under visual examination.<br />
<br />
*Approximate DNA concentrations in the range of 2 - 6 ng/&mu;l.<br />
<br />
===Sunday (02/09/12)===<br />
<br />
[[File:MGRSverification1.jpg|left|250px|thumb|Results from colony PCR (right of central ladder) and of restriction digest (left of central ladder). Restriction digest produced inconclusive results, however colony PCR indicates that the riboswitch only inserted into the second of the two colonies picked from the +8 version plate (last two lanes before ladder).]]<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|Verification of Mg2+ riboswitch construct by colony PCR]]'''<br />
<br />
----<br />
<br />
*Gibson primers used to amplify out riboswitch section of plasmid produced and transformed into e.coli to verify if riboswitch had inserted into PJS130.<br />
*Band at ~550bp in lanes 8 and 9 (replicates) indicate that the riboswich has only been successfuly transformed into the second of the two colonies picked on the +8 plate, and not at all for the -8 construct.<br />
<br />
'''[[Team:Cambridge/Protocols/MiniPrep|Miniprep of plasmid DNA]]'''<br />
<br />
----<br />
<br />
*E.coli from strains made yesterday miniprepped to get plasmid DNA at high concentration. After colony PCR results, all DNA other than that of the successful colony discarded.<br />
<br />
'''[[Team:Cambridge/Protocols/RestrictionDigest|Verification of Mg2+ riboswitch construct by restriction digest]]'''<br />
<br />
----<br />
<br />
*BamH1 and Sal1 used to digest plasmid DNA produced from miniprep.<br />
*Resultant fragment run on gel.<br />
*Bands produced inconclusive, possibly because of too short an incubation time with restriction enzymes. Expected bands at ~4900bp and ~4500bp. Will re-run experiment in future to check results of colony PCR.<br />
<br />
==Week 11==<br />
<br />
==Week 12==<br />
<br />
==Week 13==<br />
<br />
==Week 14==<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Ribosense/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Ribosense/LabbookTeam:Cambridge/Ribosense/Labbook2012-10-27T03:27:22Z<p>Olijme: /* Week 10 */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Labbook");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= General Labbook =<br />
<br />
==Week 4 ==<br />
<br />
===Tuesday (17/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of MGRS vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 58 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 180secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain 168 used as template for this experiment.<br />
<br />
* Primers used:<br />
<br />
:* Forward: cggagggagacgattttgTGTTCCGTAATTGTGATGTAAG<br />
<br />
:* Reverse: acaccggcatactctgcgacGTCATAGGTCATGTTTTGAACC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Wednesday (18/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:Mg2+ Gel PCR 1.jpg|250px|right|thumb|Results of gel electrophoresis of PCR fragments from yesterday. 550bp fragments in lanes 2+3 were removed before the image was taken]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2 + 3: Riboswitch DNA from genome (replicates) - 550bp fragment expected.<br />
<br />
:*Lane 4 + 5: Vector DNA from pJS130 (replicates)- Chloramphenicol resistance marker - 9.0kbp fragment expected<br />
<br />
:*Lane 6: Postitive control - 1.9kbp fragment expected<br />
<br />
*Riboswitch DNA was successfully amplified. However, vector DNA was not. Given that the postive control was also successful, it seems likely that something went wrong with some stage before the PCR amplification. We will try to rectify the problem tomorrow.<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of riboswitch DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful riboswitch DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
===Thursday (19/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 55 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 240secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
*Settings changed - Annealing temperature and elongation time - attempting to debug PCR.<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:PCR Gel Mg2+ 2.jpg|right|250px|thumb|PCR products from today. Note the unusual band in the negative control and the vector lanes]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2, 3 + 4: Vector DNA from pJS130 (replicates) - 9.0kbp fragment expected<br />
<br />
:*Lane 5: Postitive control - 1.9kbp fragment expected<br />
<br />
:*Lane 6: Negative control - no fragments expected<br />
<br />
*Once more, the PCR appears to have failed. We will try to redesign the primers tomorrow to make them functional.<br />
<br />
==Week 5==<br />
<br />
===Thursday (26/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome and Lux genes from e.coli genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain pJS130 used as template for riboswitch, colony of previously transformed e.coli used as template for lux operon.<br />
<br />
:*M2+ RS<br />
<br />
::*Forward: cggagggagacgattttg|TGTTCCGTAATTGTGATGTAAG<br />
<br />
::*Reverse: tataacgttactggtttcat|CGGGACTCGTACCTCC<br />
<br />
:*Lux operon<br />
<br />
::*Forward: gctgtacaag|GGAGGAGGAGGAAGTGGAGGAGGAGGAAGT|atgaagtttggaaatatttgtttttc<br />
<br />
::*Reverse: cctcgcccttgctcaccat|ACTCTATTCCTTTTTGGTGATTC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Friday (27/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
{|cellspacing="20"<br />
|[[File:CAM_120727_1_edited.jpg|200px|left|thumb|Vector amplification gel. Lanes 2-4 Lux containing vector. Lanes 5-7 Fluorescent construct vector. No products from this gel were amplified.]]<br />
|[[File:CAM_120727_2_edited.jpg|200px|left|thumb|Various. Lanes 3-5 mOrange amplification. Lanes 6-8 eCFP (E0020) amplification. mOrange amplification did not work.]]<br />
|[[File:CAM_120727_3_edited.jpg|200px|left|thumb|Small products for fluorescent construct. Lanes 1-3 Terminator (B0015). Lanes 4-6 Promotor pVEG + SpoVG (K143053).]]<br />
|-<br />
|[[File:CAM_120727_4_edited.jpg|200px|left|thumb|Various. Lanes 2-4 eYFP (E0030) amplification. Lanes 5-7 Mg2+ vector +8 codons. Lane 8 Mg2+ vector -8 codons. Lane 8 amplification did not work.]]<br />
|[[File:CAM_120727_5_edited.jpg|200px|left|thumb|Mg2+ riboswitch gel. Lanes 6+7 positive and negative controls respectively for entire run. Lanes 3-5 genomic riboswitch amplification -8 codons. Lanes 2+3 vector -8 codons.]]<br />
|}<br />
<br />
*PCR fragments for Mg2+ riboswitch, luxA/mOrange fusion and fluorescent construct from yesterday separated on gels. 90mins at 100V.<br />
<br />
*Mostly successful, but will need to repeat four runs: Three vectors (fluorescent, fusion (lux) and Mg2+ riboswitch (-8 codons) and mOrange gene.<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of successfully amplified DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful CFP, YFP, B0015, Pveg + SpoVG (K143053), riboswitch and vector DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
==Week 6==<br />
<br />
===Monday (30/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vectors and mOrange]]'''<br />
<br />
----<br />
<br />
[[File:mOrangegel.jpg|250px|thumb|mOrange PCR run at multiple temperatures, every two lanes increacing the temperature of the annealing step by 2 &deg;C. No lanes worked.]]<br />
<br />
[[File:vectorgel1.jpg|250px|thumb|Top: Fusion, lux containing vector gel. Lanes 2-4, Vector DNA. Lane 5, +ve control. Lane 6, -ve control. Bottom: Vector gel. Lanes 1-3, Fluorescent construct vector DNA. Lanes 4-6, Riboswitch construct vector DNA.]]<br />
<br />
*Not all products were obtained during Friday's PCR. Most of these missing products were large vector backbones. They are being run again, with a much longer extension time of 300s. If that fails, primers will be ordered to split the vectors into manageable chunks, and the PCR reattempted when they arrive.<br />
<br />
*PCR cycle x35: <br />
<br />
:* 15s Denaturing at 95 C<br />
:* 45s Annealing at 60 C<br />
:* 300s Extension at 72 C<br />
<br />
*Remaining stray product had a slightly tricky secondary structure at the 3' end. It will be run at a series of annealing temperatures in a PCR machine capable of a temperature gradient.<br />
<br />
*mOrange PCR run at many different temperatures, from 62 &deg;C to 76 &deg;C. However this doesn't seem to solve our problem (refer to Gel photos). It seems likely that it is a primer design problem.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Construction of riboswitch plasmid with Gibson Assembly]]'''<br />
<br />
----<br />
<br />
*DNA from lanes 27+28, 27+29, 27+30 from gels run on Friday fused together with Gibson assembly to produce riboswitch construct. This does not have replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
*DNA from lanes 22,23 and 24 fused with riboswitch DNA produced two weeks ago to produce riboswitch construct. This has replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
===Tuesday (01/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of TOP10 E.coli with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into TOP10 e.coli cells and transformants plated out on 100&mu;g/ml ampicillin plates.<br />
<br />
===Wednesday (01/08/12)===<br />
<br />
'''Mg2+ Riboswitch'''<br />
<br />
----<br />
<br />
*Successful colonies produced from transformations two days ago streaked out onto chloramphenicol (5 &mu;g/ml) containing plates.<br />
<br />
*Colonies also grown up in 10ml of medium A for use with plate reader later.<br />
<br />
===Friday (03/08/12)<br />
<br />
''' [[Team:Cambridge/Protocols/PCRProtocol|PCR of split Mg2+ vector]]'''<br />
<br />
----<br />
<br />
[[File:split Mg2+ 1.jpg|left|250px|thumb|results of split magnesium vector PCR. None of the products worked]]<br />
<br />
*PCR of magnesium riboswitch vector repeated with primers to split plasmid.<br />
<br />
*Lanes 2 + 3: Fragment A (center - cut site (promotor side))<br />
<br />
*Lanes 4 + 5: Fragment B (without 8 codon substitution) (cut site (lac I side) - center)<br />
<br />
*Lanes 6 + 7: Fragment B (with 8 codon substitution) (cut stie (lac I side) - center)<br />
<br />
*Gels run, found PCR was unsuccessful.<br />
<br />
===Sunday (05/08/12)===<br />
<br />
'''Ribosense: [[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg Riboswitch vector fragments]]'''<br />
<br />
----<br />
<br />
*2nd attempt since the PCR on Friday did not work, possibly due to mastermix problems<br />
<br />
*PCR Programme:<br />
<br />
*Results: Fragment A was successfully PCR-ed (lanes 3-4); Fragment B did not come out, with or without the 8 codons (lanes 5-6 (-8); lanes 7-8 (+8))<br />
<br />
==Week 7==<br />
<br />
===Monday (06/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Magnesium riboswitch vector fragment B and Magnesium promoter]]'''<br />
<br />
----<br />
<br />
[[File:MgRS vector frag. B.jpg|right|250px|thumb|Riboswitch and promoter gel. Lanes 2+3: Fragment B without 8 codon substitution, lanes 4+5: Fragment B with 8 codon substitution, lanes 6+7: magnesium sensitive promoter, lane 8: +ve control]]<br />
<br />
*Normal PCR settings used, annealing temperature 57 &deg;C, elongation step 90s long.<br />
<br />
*Lane 5 accidentally loaded with a DNA ladder instead of loading dye.<br />
<br />
*Expected fragment sizes:<br />
<br />
:*Lane 2-5: 3kbp<br />
<br />
:*Lane 6-7: 300bp<br />
<br />
*After electrophoresis, found vector products had, for the most part, worked. Promoter elements were not amplified - no band of the expected size was observed.<br />
<br />
*Positive control also failed, although this has ceased to work for several days, potentially due to DNA degradation.<br />
<br />
===Tuesday (07/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of magnesium riboswitch]]'''<br />
<br />
----<br />
<br />
*NAD+ added to '''isothermal buffer'''*5 mix<br />
<br />
*Gel slices from yesterday (of vector fragment B) purified.<br />
<br />
*DNA added as follows:<br />
<br />
:*Without 8 codon substitution:<br />
<br />
::*Reaction 1: Tube 2 (07/08/12) (fragment B), Tube 1 (05/08/12) (fragment A), Tube 28 (29/08/12) (riboswitch DNA).<br />
<br />
::*Reaction 2: Tube 3 (07/08/12) (fragment B), Tube 2 (05/08/12) (fragment A), Tube 29 (29/08/12) (riboswitch DNA).<br />
<br />
:*With 8 codon substitution:<br />
<br />
::*Reaction 3: Tube 4 (07/08/12) (fragment B), Tube 1 (05/08/12) (fragment A), Tube 2 (18/07/12) (riboswitch DNA).<br />
<br />
===Wednesday (08/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/ElectricalTransformation|Electrical transformation of competent e.coli with Gibson products]]'''<br />
<br />
----<br />
<br />
*Gibson constructs from yesterday (fluorescent and magnesium riboswitch) transformed into e.coli produced yesterday.<br />
<br />
*Cells plated out onto 50 &mu;g/ml ampicillin plates. Put in incubator overnight.<br />
<br />
===Friday (10/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay|Characterization of fluoride riboswitch sensitivity with &beta;-galactosidase]]'''<br />
<br />
----<br />
<br />
*X-Gal made up to a concentration of 400 &mu;g/ml with water.<br />
<br />
*Fluoride of concentrations 0.5 - 30 mM mixed with bacterial culture (Yale construct containing) grown up overnight.<br />
<br />
===Saturday (11/08/12)===<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/RestrictionDigest|Restriction digest of Yale plasmid]]'''<br />
<br />
----<br />
<br />
*Cells from electroporation of e.coli with plasmid from Yale (08/08/12) [[Team:Cambridge/Protocols/MiniPrep|miniprepped]] to extract plasmid DNA.<br />
<br />
*DNA digested with XhoI and SalI, expected fragment sizes 5580, 3139, 1437<br />
<br />
*Gel run, results not shown as gel was very 'messy'. Gel had probably already begun to set when poured and so had many artefacts when imaged. As a result each lane required different brightness and contrast settings to visualise and so the full gel was not clearly visible on the printout. However, all of the bands could be identified on the screen and were exactly as expected and very clear and pure.<br />
<br />
*Bands in correct places, indicating that expected plasmid was present in the cells. This indicates that, although they work at a very low efficiency, our electro-competent cells still work. It may be valuable to use these when trying to grow up plasmids that we already have at high concentration. <br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of e.coli with Magnesium riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Gibson products from 07/08/12 transformed into chemically competent cells.<br />
<br />
*Transformants plated out on 100 &mu;g/ml ampicillin plates<br />
<br />
==Week 8==<br />
<br />
===Wednesday (15/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay| Characterization of fluoride riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Strain of ''bacillus'' lacking fluoride transporter system tested. Concentrations used:<br />
<br />
:*0mM - 0.5mM - 1mM - 2.5mM - 5mM - 10mM - 20mM - 30mM<br />
<br />
===Thursday (16/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay| Characterization of fluoride riboswitch construct]]'''<br />
<br />
----<br />
<br />
[[File:fluoridegradient.jpg|250px|right|thumb|The results of our fluoride assay.]]<br />
<br />
* Eppindorfs containing the ''bacillus'' with the fluoride riboswitch removed from incubator and imaged.<br />
<br />
* Now this definitely works, we will try quantifying this riboswitch with an ONPG assay and the plate reader.<br />
<br />
===Saturday (18/08/12)===<br />
<br />
'''Colonies picked in preparation for Miller assay'''<br />
<br />
----<br />
<br />
*2 ''E. coli'' colonies transformed with the purified plasmid were picked and inoculated in LB with 50&mu;g/ml Amp<br />
<br />
*2 colonies each from the 168 strain and crcB knockout ''B. subtilis'' containing the fluoride riboswitch were picked and inoculated in LB with 5&mu;g/ml Chlor<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Fluoride biobrick format]]'''<br />
<br />
----<br />
<br />
[[File:FluorideBB1gel.jpg|right|250px|thumb|Gels from PCR of Fluoride BB and PJS130 fragments. Top: Lanes 2-4: Gibson compatable Fluoride biobrick fragment. Lanes 5-7: Ligation compatable Fluoride biobrick fragment. Lane 8: PJS130 fragment A. Bottom: Lanes 1-2: PJS130 fragment A. Lanes 3-5: PJS 130 fragment B. Lane 6: Positive control. Lane 7: Negative control.]]<br />
<br />
*Two sets of primers used: one to allow insertion into backbone by ligation, and one to allow insertion by Gibson assembly.<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 100 seconds<br />
<br />
*Products run on gel. Fragments produced of correct size, however they overlapped with the primer dimer band due to the small size of the fragments.<br />
<br />
*DNA extracted and purified.<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg2+ riboswitch construct vector]]'''<br />
<br />
----<br />
<br />
*Separate reactions for<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 100 seconds <br />
<br />
*Products run on gel. No fragments produced. Positive control worked however, so master mix clearly works.<br />
<br />
*Given this PCR has worked in the past, will try to re-run with the same settings and hope for success in the future.<br />
<br />
===Sunday (19/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/MillerAssay|Miller Assay of Fluoride construct]]'''<br />
<br />
----<br />
<br />
* Colonies picked from overnight and Miller assay run as directed on protocols page<br />
<br />
* Lack of filters meant that only A450 data recorderd<br />
<br />
==Week 9==<br />
<br />
===Tuesday (21/08/12)===<br />
<br />
'''PCR for Mg Riboswitch'''<br />
<br />
----<br />
*[[Team:Cambridge/Protocols/PCRProtocol| PCRs]] were run for pJS130.1 split vector ('+8 codons')<br />
*[[Team:Cambridge/Protocols/PCRcolony| Colony PCR]] for endogenous ''Bacillus subtilis'' Mg Riboswitch ('+8 codons') was run<br />
*Gels were run for above reactions, only one band for half of the pJS130 vector was visible.<br />
<br />
===Wednesday (22/08/12)===<br />
<br />
'''PCR for Mg Riboswitch'''<br />
<br />
----<br />
<br />
*[[Team:Cambridge/Protocols/PCRProtocol| PCRs]] were run for F Riboswitch from Yale's plasmid with overhangs for standard assembly.<br />
*[[Team:Cambridge/Protocols/PCRcolony| Colony PCR]] for endogenous ''Bacillus subtilis'' Mg Riboswitch (both '+8 codons' and '-8 codons' versions) were re-run.<br />
*Gels were run for above reactions, only one band for positive control was visible.<br />
<br />
'''Cells cultured for Miller assay'''<br />
----<br />
*''B. subtilis'' strains carrying F riboswitch and 'KO' strains cultured separately in LB and 5µg/mL Chloramphenicol at 37°C<br />
*''E.Coli'' carrying F riboswitch cultured in LB and 50mg/ml Ampicillin at 37°C<br />
<br />
===Thursday (23/08/12)===<br />
* Miller assay set up and running with the wild type and crcB knock-out ''Bacillus'' strains and an ''E. coli'' strain which contains the construct on an episomal plasmid.<br />
<br />
===Friday (24/08/12)===<br />
*Miller assay data collected for analysis over the weekend<br />
<br />
==Week 10==<br />
<br />
===Monday (27/08/12)===<br />
'''RiboSense:[[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg RS from bacillus genomic DNA]]'''<br />
<br />
----<br />
<br />
*3 part primers used, to amplify the 486bp from the genome, and the vector in two parts<br />
*PCR failed, only positive control came out. Will re run when new primers arrive.<br />
<br />
===Thursday (30/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of Mg2+ riboswitch from genomic DNA]]'''<br />
<br />
----<br />
<br />
[[File: MGRSgel1.jpg|right|250px|thumb|Gel from amplification of the riboswitch DNA. Lanes 2 + 3: with 8 codon substitution. Lanes 4 + 5: without 8 codon substitution.]]<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 30 seconds<br />
<br />
*Fragments of correct size produced for all except lane 5 produced. In this lane, DNA appears to have accumulated in the well, indicating it may be genomic. In future, will use lower numbers of template cells to avoid getting so much genomic DNA.<br />
<br />
*Products extracted and purified.<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of PJS130 vector for Mg riboswitch construct]]'''<br />
<br />
----<br />
<br />
[[File:PJS130gel2.jpg|250px|right|thumb|Gel from amplification of PJS130 vector for MGRS construct. Lanes 2 + 3: Fragment A. Lanes 4 + 5: Fragment B with 8 codon substitution. Lanes 6 + 7: Fragment B without 8 codon substitution.]]<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 60 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 110 seconds<br />
<br />
*Fragment of correct size produced in lane 5, but too faint to be extracted successfully. None of the other lanes were successful. We will try this again tomorrow, at 58 &deg;C and with 35 cycles (as is usual) instead of 30.<br />
<br />
*Note that phusion enzyme was left with primers and template DNA for about half an hour before reaction began, possibly causing degradation of the primer DNA.<br />
<br />
===Friday (31/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of PJS130 vector for MgRS construct]]'''<br />
<br />
----<br />
<br />
[[File:PJS130gel1.jpg|250px|left|thumb|Gel from amplification of PJS130 fragments. Lanes 2 + 3: Fragment A. Lanes 4 + 5: Fragment B with eight codon substitution. Lanes 6 + 7: Fragment B without eight codon substitution. Lane 8: Negative control.]]<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 120 seconds<br />
<br />
*Products of correct sizes (5.5kbp and 3.5 kbp) produced for all reactions, although lanes 2 and 4 failed to produce any product, despite primer smear. Most likely, template was not added, or one of the primers was not added.<br />
<br />
*Products excised and purified.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of Mg2+ riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Reaction 1: Without 8 codon substitution: Vec A, Vec B -8 (replicate 1), Genomic -8.<br />
<br />
*Reaction 2: Without 8 codon substitution: Vec A, Vec B -8 (replicate 2), Genomic -8. <br />
<br />
*Reaction 3: With 8 codon substitution: Vec A, Vec B +8, Genomic +8 (replicate 1).<br />
<br />
*Reaction 4: With 8 codon substitution: Vec A, Vec B +8, Genomic +8 (replicate 2).<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of e.coli with Gibson products]]'''<br />
<br />
----<br />
<br />
*20 &mu;l of Gibson reaction mix transformed into e.coli cells. Transformants plated out onto 100 &mu;g/ml ampicillin plates.<br />
<br />
===Saturday (01/09/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Verification of Mg2+ gel extractions]]'''<br />
<br />
----<br />
<br />
[[File:Mg2+verificationgel1.jpg|250px|right|thumb|Verification gel of extracted DNA. Lanes 1,7 + 13: Ladder. Lanes 2 - 4: Old vector DNA (06/08/12). Lane 5: PJS130 fragment A. Lanes 6,8 + 9: PJS130 fragment B. Lanes 10 - 12: Genomic riboswitch DNA.]]<br />
<br />
*DNA used in Gibson from yesterday and several weeks ago. Run on gel to verify the presence of DNA fragments of the correct size after gel extraction.<br />
<br />
*Old DNA appears to have degraded, or else products were produced in too small a quantity to show up on the gel. Fortunately, these are not/ have not been used.<br />
<br />
*Bands of the correct size for fragment A (5.5kbp), fragment B (3.5kbp) and the genomic DNA (550bp) present. Though riboswitch DNA has not come out well in this image, it was present under visual examination.<br />
<br />
*Approximate DNA concentrations in the range of 2 - 6 ng/&mu;l.<br />
<br />
==Week 11==<br />
<br />
==Week 12==<br />
<br />
==Week 13==<br />
<br />
==Week 14==<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Ribosense/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Ribosense/LabbookTeam:Cambridge/Ribosense/Labbook2012-10-27T03:26:51Z<p>Olijme: /* Week 10 */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Labbook");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= General Labbook =<br />
<br />
==Week 4 ==<br />
<br />
===Tuesday (17/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of MGRS vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 58 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 180secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain 168 used as template for this experiment.<br />
<br />
* Primers used:<br />
<br />
:* Forward: cggagggagacgattttgTGTTCCGTAATTGTGATGTAAG<br />
<br />
:* Reverse: acaccggcatactctgcgacGTCATAGGTCATGTTTTGAACC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Wednesday (18/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:Mg2+ Gel PCR 1.jpg|250px|right|thumb|Results of gel electrophoresis of PCR fragments from yesterday. 550bp fragments in lanes 2+3 were removed before the image was taken]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2 + 3: Riboswitch DNA from genome (replicates) - 550bp fragment expected.<br />
<br />
:*Lane 4 + 5: Vector DNA from pJS130 (replicates)- Chloramphenicol resistance marker - 9.0kbp fragment expected<br />
<br />
:*Lane 6: Postitive control - 1.9kbp fragment expected<br />
<br />
*Riboswitch DNA was successfully amplified. However, vector DNA was not. Given that the postive control was also successful, it seems likely that something went wrong with some stage before the PCR amplification. We will try to rectify the problem tomorrow.<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of riboswitch DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful riboswitch DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
===Thursday (19/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 55 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 240secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
*Settings changed - Annealing temperature and elongation time - attempting to debug PCR.<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:PCR Gel Mg2+ 2.jpg|right|250px|thumb|PCR products from today. Note the unusual band in the negative control and the vector lanes]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2, 3 + 4: Vector DNA from pJS130 (replicates) - 9.0kbp fragment expected<br />
<br />
:*Lane 5: Postitive control - 1.9kbp fragment expected<br />
<br />
:*Lane 6: Negative control - no fragments expected<br />
<br />
*Once more, the PCR appears to have failed. We will try to redesign the primers tomorrow to make them functional.<br />
<br />
==Week 5==<br />
<br />
===Thursday (26/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome and Lux genes from e.coli genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain pJS130 used as template for riboswitch, colony of previously transformed e.coli used as template for lux operon.<br />
<br />
:*M2+ RS<br />
<br />
::*Forward: cggagggagacgattttg|TGTTCCGTAATTGTGATGTAAG<br />
<br />
::*Reverse: tataacgttactggtttcat|CGGGACTCGTACCTCC<br />
<br />
:*Lux operon<br />
<br />
::*Forward: gctgtacaag|GGAGGAGGAGGAAGTGGAGGAGGAGGAAGT|atgaagtttggaaatatttgtttttc<br />
<br />
::*Reverse: cctcgcccttgctcaccat|ACTCTATTCCTTTTTGGTGATTC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Friday (27/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
{|cellspacing="20"<br />
|[[File:CAM_120727_1_edited.jpg|200px|left|thumb|Vector amplification gel. Lanes 2-4 Lux containing vector. Lanes 5-7 Fluorescent construct vector. No products from this gel were amplified.]]<br />
|[[File:CAM_120727_2_edited.jpg|200px|left|thumb|Various. Lanes 3-5 mOrange amplification. Lanes 6-8 eCFP (E0020) amplification. mOrange amplification did not work.]]<br />
|[[File:CAM_120727_3_edited.jpg|200px|left|thumb|Small products for fluorescent construct. Lanes 1-3 Terminator (B0015). Lanes 4-6 Promotor pVEG + SpoVG (K143053).]]<br />
|-<br />
|[[File:CAM_120727_4_edited.jpg|200px|left|thumb|Various. Lanes 2-4 eYFP (E0030) amplification. Lanes 5-7 Mg2+ vector +8 codons. Lane 8 Mg2+ vector -8 codons. Lane 8 amplification did not work.]]<br />
|[[File:CAM_120727_5_edited.jpg|200px|left|thumb|Mg2+ riboswitch gel. Lanes 6+7 positive and negative controls respectively for entire run. Lanes 3-5 genomic riboswitch amplification -8 codons. Lanes 2+3 vector -8 codons.]]<br />
|}<br />
<br />
*PCR fragments for Mg2+ riboswitch, luxA/mOrange fusion and fluorescent construct from yesterday separated on gels. 90mins at 100V.<br />
<br />
*Mostly successful, but will need to repeat four runs: Three vectors (fluorescent, fusion (lux) and Mg2+ riboswitch (-8 codons) and mOrange gene.<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of successfully amplified DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful CFP, YFP, B0015, Pveg + SpoVG (K143053), riboswitch and vector DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
==Week 6==<br />
<br />
===Monday (30/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vectors and mOrange]]'''<br />
<br />
----<br />
<br />
[[File:mOrangegel.jpg|250px|thumb|mOrange PCR run at multiple temperatures, every two lanes increacing the temperature of the annealing step by 2 &deg;C. No lanes worked.]]<br />
<br />
[[File:vectorgel1.jpg|250px|thumb|Top: Fusion, lux containing vector gel. Lanes 2-4, Vector DNA. Lane 5, +ve control. Lane 6, -ve control. Bottom: Vector gel. Lanes 1-3, Fluorescent construct vector DNA. Lanes 4-6, Riboswitch construct vector DNA.]]<br />
<br />
*Not all products were obtained during Friday's PCR. Most of these missing products were large vector backbones. They are being run again, with a much longer extension time of 300s. If that fails, primers will be ordered to split the vectors into manageable chunks, and the PCR reattempted when they arrive.<br />
<br />
*PCR cycle x35: <br />
<br />
:* 15s Denaturing at 95 C<br />
:* 45s Annealing at 60 C<br />
:* 300s Extension at 72 C<br />
<br />
*Remaining stray product had a slightly tricky secondary structure at the 3' end. It will be run at a series of annealing temperatures in a PCR machine capable of a temperature gradient.<br />
<br />
*mOrange PCR run at many different temperatures, from 62 &deg;C to 76 &deg;C. However this doesn't seem to solve our problem (refer to Gel photos). It seems likely that it is a primer design problem.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Construction of riboswitch plasmid with Gibson Assembly]]'''<br />
<br />
----<br />
<br />
*DNA from lanes 27+28, 27+29, 27+30 from gels run on Friday fused together with Gibson assembly to produce riboswitch construct. This does not have replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
*DNA from lanes 22,23 and 24 fused with riboswitch DNA produced two weeks ago to produce riboswitch construct. This has replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
===Tuesday (01/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of TOP10 E.coli with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into TOP10 e.coli cells and transformants plated out on 100&mu;g/ml ampicillin plates.<br />
<br />
===Wednesday (01/08/12)===<br />
<br />
'''Mg2+ Riboswitch'''<br />
<br />
----<br />
<br />
*Successful colonies produced from transformations two days ago streaked out onto chloramphenicol (5 &mu;g/ml) containing plates.<br />
<br />
*Colonies also grown up in 10ml of medium A for use with plate reader later.<br />
<br />
===Friday (03/08/12)<br />
<br />
''' [[Team:Cambridge/Protocols/PCRProtocol|PCR of split Mg2+ vector]]'''<br />
<br />
----<br />
<br />
[[File:split Mg2+ 1.jpg|left|250px|thumb|results of split magnesium vector PCR. None of the products worked]]<br />
<br />
*PCR of magnesium riboswitch vector repeated with primers to split plasmid.<br />
<br />
*Lanes 2 + 3: Fragment A (center - cut site (promotor side))<br />
<br />
*Lanes 4 + 5: Fragment B (without 8 codon substitution) (cut site (lac I side) - center)<br />
<br />
*Lanes 6 + 7: Fragment B (with 8 codon substitution) (cut stie (lac I side) - center)<br />
<br />
*Gels run, found PCR was unsuccessful.<br />
<br />
===Sunday (05/08/12)===<br />
<br />
'''Ribosense: [[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg Riboswitch vector fragments]]'''<br />
<br />
----<br />
<br />
*2nd attempt since the PCR on Friday did not work, possibly due to mastermix problems<br />
<br />
*PCR Programme:<br />
<br />
*Results: Fragment A was successfully PCR-ed (lanes 3-4); Fragment B did not come out, with or without the 8 codons (lanes 5-6 (-8); lanes 7-8 (+8))<br />
<br />
==Week 7==<br />
<br />
===Monday (06/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Magnesium riboswitch vector fragment B and Magnesium promoter]]'''<br />
<br />
----<br />
<br />
[[File:MgRS vector frag. B.jpg|right|250px|thumb|Riboswitch and promoter gel. Lanes 2+3: Fragment B without 8 codon substitution, lanes 4+5: Fragment B with 8 codon substitution, lanes 6+7: magnesium sensitive promoter, lane 8: +ve control]]<br />
<br />
*Normal PCR settings used, annealing temperature 57 &deg;C, elongation step 90s long.<br />
<br />
*Lane 5 accidentally loaded with a DNA ladder instead of loading dye.<br />
<br />
*Expected fragment sizes:<br />
<br />
:*Lane 2-5: 3kbp<br />
<br />
:*Lane 6-7: 300bp<br />
<br />
*After electrophoresis, found vector products had, for the most part, worked. Promoter elements were not amplified - no band of the expected size was observed.<br />
<br />
*Positive control also failed, although this has ceased to work for several days, potentially due to DNA degradation.<br />
<br />
===Tuesday (07/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of magnesium riboswitch]]'''<br />
<br />
----<br />
<br />
*NAD+ added to '''isothermal buffer'''*5 mix<br />
<br />
*Gel slices from yesterday (of vector fragment B) purified.<br />
<br />
*DNA added as follows:<br />
<br />
:*Without 8 codon substitution:<br />
<br />
::*Reaction 1: Tube 2 (07/08/12) (fragment B), Tube 1 (05/08/12) (fragment A), Tube 28 (29/08/12) (riboswitch DNA).<br />
<br />
::*Reaction 2: Tube 3 (07/08/12) (fragment B), Tube 2 (05/08/12) (fragment A), Tube 29 (29/08/12) (riboswitch DNA).<br />
<br />
:*With 8 codon substitution:<br />
<br />
::*Reaction 3: Tube 4 (07/08/12) (fragment B), Tube 1 (05/08/12) (fragment A), Tube 2 (18/07/12) (riboswitch DNA).<br />
<br />
===Wednesday (08/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/ElectricalTransformation|Electrical transformation of competent e.coli with Gibson products]]'''<br />
<br />
----<br />
<br />
*Gibson constructs from yesterday (fluorescent and magnesium riboswitch) transformed into e.coli produced yesterday.<br />
<br />
*Cells plated out onto 50 &mu;g/ml ampicillin plates. Put in incubator overnight.<br />
<br />
===Friday (10/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay|Characterization of fluoride riboswitch sensitivity with &beta;-galactosidase]]'''<br />
<br />
----<br />
<br />
*X-Gal made up to a concentration of 400 &mu;g/ml with water.<br />
<br />
*Fluoride of concentrations 0.5 - 30 mM mixed with bacterial culture (Yale construct containing) grown up overnight.<br />
<br />
===Saturday (11/08/12)===<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/RestrictionDigest|Restriction digest of Yale plasmid]]'''<br />
<br />
----<br />
<br />
*Cells from electroporation of e.coli with plasmid from Yale (08/08/12) [[Team:Cambridge/Protocols/MiniPrep|miniprepped]] to extract plasmid DNA.<br />
<br />
*DNA digested with XhoI and SalI, expected fragment sizes 5580, 3139, 1437<br />
<br />
*Gel run, results not shown as gel was very 'messy'. Gel had probably already begun to set when poured and so had many artefacts when imaged. As a result each lane required different brightness and contrast settings to visualise and so the full gel was not clearly visible on the printout. However, all of the bands could be identified on the screen and were exactly as expected and very clear and pure.<br />
<br />
*Bands in correct places, indicating that expected plasmid was present in the cells. This indicates that, although they work at a very low efficiency, our electro-competent cells still work. It may be valuable to use these when trying to grow up plasmids that we already have at high concentration. <br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of e.coli with Magnesium riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Gibson products from 07/08/12 transformed into chemically competent cells.<br />
<br />
*Transformants plated out on 100 &mu;g/ml ampicillin plates<br />
<br />
==Week 8==<br />
<br />
===Wednesday (15/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay| Characterization of fluoride riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Strain of ''bacillus'' lacking fluoride transporter system tested. Concentrations used:<br />
<br />
:*0mM - 0.5mM - 1mM - 2.5mM - 5mM - 10mM - 20mM - 30mM<br />
<br />
===Thursday (16/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay| Characterization of fluoride riboswitch construct]]'''<br />
<br />
----<br />
<br />
[[File:fluoridegradient.jpg|250px|right|thumb|The results of our fluoride assay.]]<br />
<br />
* Eppindorfs containing the ''bacillus'' with the fluoride riboswitch removed from incubator and imaged.<br />
<br />
* Now this definitely works, we will try quantifying this riboswitch with an ONPG assay and the plate reader.<br />
<br />
===Saturday (18/08/12)===<br />
<br />
'''Colonies picked in preparation for Miller assay'''<br />
<br />
----<br />
<br />
*2 ''E. coli'' colonies transformed with the purified plasmid were picked and inoculated in LB with 50&mu;g/ml Amp<br />
<br />
*2 colonies each from the 168 strain and crcB knockout ''B. subtilis'' containing the fluoride riboswitch were picked and inoculated in LB with 5&mu;g/ml Chlor<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Fluoride biobrick format]]'''<br />
<br />
----<br />
<br />
[[File:FluorideBB1gel.jpg|right|250px|thumb|Gels from PCR of Fluoride BB and PJS130 fragments. Top: Lanes 2-4: Gibson compatable Fluoride biobrick fragment. Lanes 5-7: Ligation compatable Fluoride biobrick fragment. Lane 8: PJS130 fragment A. Bottom: Lanes 1-2: PJS130 fragment A. Lanes 3-5: PJS 130 fragment B. Lane 6: Positive control. Lane 7: Negative control.]]<br />
<br />
*Two sets of primers used: one to allow insertion into backbone by ligation, and one to allow insertion by Gibson assembly.<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 100 seconds<br />
<br />
*Products run on gel. Fragments produced of correct size, however they overlapped with the primer dimer band due to the small size of the fragments.<br />
<br />
*DNA extracted and purified.<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg2+ riboswitch construct vector]]'''<br />
<br />
----<br />
<br />
*Separate reactions for<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 100 seconds <br />
<br />
*Products run on gel. No fragments produced. Positive control worked however, so master mix clearly works.<br />
<br />
*Given this PCR has worked in the past, will try to re-run with the same settings and hope for success in the future.<br />
<br />
===Sunday (19/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/MillerAssay|Miller Assay of Fluoride construct]]'''<br />
<br />
----<br />
<br />
* Colonies picked from overnight and Miller assay run as directed on protocols page<br />
<br />
* Lack of filters meant that only A450 data recorderd<br />
<br />
==Week 9==<br />
<br />
===Tuesday (21/08/12)===<br />
<br />
'''PCR for Mg Riboswitch'''<br />
<br />
----<br />
*[[Team:Cambridge/Protocols/PCRProtocol| PCRs]] were run for pJS130.1 split vector ('+8 codons')<br />
*[[Team:Cambridge/Protocols/PCRcolony| Colony PCR]] for endogenous ''Bacillus subtilis'' Mg Riboswitch ('+8 codons') was run<br />
*Gels were run for above reactions, only one band for half of the pJS130 vector was visible.<br />
<br />
===Wednesday (22/08/12)===<br />
<br />
'''PCR for Mg Riboswitch'''<br />
<br />
----<br />
<br />
*[[Team:Cambridge/Protocols/PCRProtocol| PCRs]] were run for F Riboswitch from Yale's plasmid with overhangs for standard assembly.<br />
*[[Team:Cambridge/Protocols/PCRcolony| Colony PCR]] for endogenous ''Bacillus subtilis'' Mg Riboswitch (both '+8 codons' and '-8 codons' versions) were re-run.<br />
*Gels were run for above reactions, only one band for positive control was visible.<br />
<br />
'''Cells cultured for Miller assay'''<br />
----<br />
*''B. subtilis'' strains carrying F riboswitch and 'KO' strains cultured separately in LB and 5µg/mL Chloramphenicol at 37°C<br />
*''E.Coli'' carrying F riboswitch cultured in LB and 50mg/ml Ampicillin at 37°C<br />
<br />
===Thursday (23/08/12)===<br />
* Miller assay set up and running with the wild type and crcB knock-out ''Bacillus'' strains and an ''E. coli'' strain which contains the construct on an episomal plasmid.<br />
<br />
===Friday (24/08/12)===<br />
*Miller assay data collected for analysis over the weekend<br />
<br />
==Week 10==<br />
<br />
===Monday (27/08/12)===<br />
'''RiboSense:[[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg RS from bacillus genomic DNA]]'''<br />
<br />
----<br />
<br />
*3 part primers used, to amplify the 486bp from the genome, and the vector in two parts<br />
*PCR failed, only positive control came out. Will re run when new primers arrive.<br />
<br />
===Thursday (30/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of Mg2+ riboswitch from genomic DNA]]'''<br />
<br />
----<br />
<br />
[[File: MGRSgel1.jpg|right|250px|thumb|Gel from amplification of the riboswitch DNA. Lanes 2 + 3: with 8 codon substitution. Lanes 4 + 5: without 8 codon substitution.]]<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 30 seconds<br />
<br />
*Fragments of correct size produced for all except lane 5 produced. In this lane, DNA appears to have accumulated in the well, indicating it may be genomic. In future, will use lower numbers of template cells to avoid getting so much genomic DNA.<br />
<br />
*Products extracted and purified.<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of PJS130 vector for Mg riboswitch construct]]'''<br />
<br />
----<br />
<br />
[[File:PJS130gel2.jpg|250px|right|thumb|Gel from amplification of PJS130 vector for MGRS construct. Lanes 2 + 3: Fragment A. Lanes 4 + 5: Fragment B with 8 codon substitution. Lanes 6 + 7: Fragment B without 8 codon substitution.]]<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 60 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 110 seconds<br />
<br />
*Fragment of correct size produced in lane 5, but too faint to be extracted successfully. None of the other lanes were successful. We will try this again tomorrow, at 58 &deg;C and with 35 cycles (as is usual) instead of 30.<br />
<br />
*Note that phusion enzyme was left with primers and template DNA for about half an hour before reaction began, possibly causing degradation of the primer DNA.<br />
<br />
===Friday (31/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of PJS130 vector for MgRS construct]]'''<br />
<br />
----<br />
<br />
[[File:PJS130gel1.jpg|250px|right|thumb|Gel from amplification of PJS130 fragments. Lanes 2 + 3: Fragment A. Lanes 4 + 5: Fragment B with eight codon substitution. Lanes 6 + 7: Fragment B without eight codon substitution. Lane 8: Negative control.]]<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 120 seconds<br />
<br />
*Products of correct sizes (5.5kbp and 3.5 kbp) produced for all reactions, although lanes 2 and 4 failed to produce any product, despite primer smear. Most likely, template was not added, or one of the primers was not added.<br />
<br />
*Products excised and purified.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of Mg2+ riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Reaction 1: Without 8 codon substitution: Vec A, Vec B -8 (replicate 1), Genomic -8.<br />
<br />
*Reaction 2: Without 8 codon substitution: Vec A, Vec B -8 (replicate 2), Genomic -8. <br />
<br />
*Reaction 3: With 8 codon substitution: Vec A, Vec B +8, Genomic +8 (replicate 1).<br />
<br />
*Reaction 4: With 8 codon substitution: Vec A, Vec B +8, Genomic +8 (replicate 2).<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of e.coli with Gibson products]]'''<br />
<br />
----<br />
<br />
*20 &mu;l of Gibson reaction mix transformed into e.coli cells. Transformants plated out onto 100 &mu;g/ml ampicillin plates.<br />
<br />
===Saturday (01/09/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Verification of Mg2+ gel extractions]]'''<br />
<br />
----<br />
<br />
[[File:Mg2+verificationgel1.jpg|250px|right|thumb|Verification gel of extracted DNA. Lanes 1,7 + 13: Ladder. Lanes 2 - 4: Old vector DNA (06/08/12). Lane 5: PJS130 fragment A. Lanes 6,8 + 9: PJS130 fragment B. Lanes 10 - 12: Genomic riboswitch DNA.]]<br />
<br />
*DNA used in Gibson from yesterday and several weeks ago. Run on gel to verify the presence of DNA fragments of the correct size after gel extraction.<br />
<br />
*Old DNA appears to have degraded, or else products were produced in too small a quantity to show up on the gel. Fortunately, these are not/ have not been used.<br />
<br />
*Bands of the correct size for fragment A (5.5kbp), fragment B (3.5kbp) and the genomic DNA (550bp) present. Though riboswitch DNA has not come out well in this image, it was present under visual examination.<br />
<br />
*Approximate DNA concentrations in the range of 2 - 6 ng/&mu;l.<br />
<br />
==Week 11==<br />
<br />
==Week 12==<br />
<br />
==Week 13==<br />
<br />
==Week 14==<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Ribosense/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Ribosense/LabbookTeam:Cambridge/Ribosense/Labbook2012-10-27T03:24:49Z<p>Olijme: /* Week 9 */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Labbook");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= General Labbook =<br />
<br />
==Week 4 ==<br />
<br />
===Tuesday (17/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of MGRS vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 58 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 180secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain 168 used as template for this experiment.<br />
<br />
* Primers used:<br />
<br />
:* Forward: cggagggagacgattttgTGTTCCGTAATTGTGATGTAAG<br />
<br />
:* Reverse: acaccggcatactctgcgacGTCATAGGTCATGTTTTGAACC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Wednesday (18/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:Mg2+ Gel PCR 1.jpg|250px|right|thumb|Results of gel electrophoresis of PCR fragments from yesterday. 550bp fragments in lanes 2+3 were removed before the image was taken]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2 + 3: Riboswitch DNA from genome (replicates) - 550bp fragment expected.<br />
<br />
:*Lane 4 + 5: Vector DNA from pJS130 (replicates)- Chloramphenicol resistance marker - 9.0kbp fragment expected<br />
<br />
:*Lane 6: Postitive control - 1.9kbp fragment expected<br />
<br />
*Riboswitch DNA was successfully amplified. However, vector DNA was not. Given that the postive control was also successful, it seems likely that something went wrong with some stage before the PCR amplification. We will try to rectify the problem tomorrow.<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of riboswitch DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful riboswitch DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
===Thursday (19/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 55 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 240secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
*Settings changed - Annealing temperature and elongation time - attempting to debug PCR.<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:PCR Gel Mg2+ 2.jpg|right|250px|thumb|PCR products from today. Note the unusual band in the negative control and the vector lanes]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2, 3 + 4: Vector DNA from pJS130 (replicates) - 9.0kbp fragment expected<br />
<br />
:*Lane 5: Postitive control - 1.9kbp fragment expected<br />
<br />
:*Lane 6: Negative control - no fragments expected<br />
<br />
*Once more, the PCR appears to have failed. We will try to redesign the primers tomorrow to make them functional.<br />
<br />
==Week 5==<br />
<br />
===Thursday (26/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome and Lux genes from e.coli genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain pJS130 used as template for riboswitch, colony of previously transformed e.coli used as template for lux operon.<br />
<br />
:*M2+ RS<br />
<br />
::*Forward: cggagggagacgattttg|TGTTCCGTAATTGTGATGTAAG<br />
<br />
::*Reverse: tataacgttactggtttcat|CGGGACTCGTACCTCC<br />
<br />
:*Lux operon<br />
<br />
::*Forward: gctgtacaag|GGAGGAGGAGGAAGTGGAGGAGGAGGAAGT|atgaagtttggaaatatttgtttttc<br />
<br />
::*Reverse: cctcgcccttgctcaccat|ACTCTATTCCTTTTTGGTGATTC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Friday (27/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
{|cellspacing="20"<br />
|[[File:CAM_120727_1_edited.jpg|200px|left|thumb|Vector amplification gel. Lanes 2-4 Lux containing vector. Lanes 5-7 Fluorescent construct vector. No products from this gel were amplified.]]<br />
|[[File:CAM_120727_2_edited.jpg|200px|left|thumb|Various. Lanes 3-5 mOrange amplification. Lanes 6-8 eCFP (E0020) amplification. mOrange amplification did not work.]]<br />
|[[File:CAM_120727_3_edited.jpg|200px|left|thumb|Small products for fluorescent construct. Lanes 1-3 Terminator (B0015). Lanes 4-6 Promotor pVEG + SpoVG (K143053).]]<br />
|-<br />
|[[File:CAM_120727_4_edited.jpg|200px|left|thumb|Various. Lanes 2-4 eYFP (E0030) amplification. Lanes 5-7 Mg2+ vector +8 codons. Lane 8 Mg2+ vector -8 codons. Lane 8 amplification did not work.]]<br />
|[[File:CAM_120727_5_edited.jpg|200px|left|thumb|Mg2+ riboswitch gel. Lanes 6+7 positive and negative controls respectively for entire run. Lanes 3-5 genomic riboswitch amplification -8 codons. Lanes 2+3 vector -8 codons.]]<br />
|}<br />
<br />
*PCR fragments for Mg2+ riboswitch, luxA/mOrange fusion and fluorescent construct from yesterday separated on gels. 90mins at 100V.<br />
<br />
*Mostly successful, but will need to repeat four runs: Three vectors (fluorescent, fusion (lux) and Mg2+ riboswitch (-8 codons) and mOrange gene.<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of successfully amplified DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful CFP, YFP, B0015, Pveg + SpoVG (K143053), riboswitch and vector DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
==Week 6==<br />
<br />
===Monday (30/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vectors and mOrange]]'''<br />
<br />
----<br />
<br />
[[File:mOrangegel.jpg|250px|thumb|mOrange PCR run at multiple temperatures, every two lanes increacing the temperature of the annealing step by 2 &deg;C. No lanes worked.]]<br />
<br />
[[File:vectorgel1.jpg|250px|thumb|Top: Fusion, lux containing vector gel. Lanes 2-4, Vector DNA. Lane 5, +ve control. Lane 6, -ve control. Bottom: Vector gel. Lanes 1-3, Fluorescent construct vector DNA. Lanes 4-6, Riboswitch construct vector DNA.]]<br />
<br />
*Not all products were obtained during Friday's PCR. Most of these missing products were large vector backbones. They are being run again, with a much longer extension time of 300s. If that fails, primers will be ordered to split the vectors into manageable chunks, and the PCR reattempted when they arrive.<br />
<br />
*PCR cycle x35: <br />
<br />
:* 15s Denaturing at 95 C<br />
:* 45s Annealing at 60 C<br />
:* 300s Extension at 72 C<br />
<br />
*Remaining stray product had a slightly tricky secondary structure at the 3' end. It will be run at a series of annealing temperatures in a PCR machine capable of a temperature gradient.<br />
<br />
*mOrange PCR run at many different temperatures, from 62 &deg;C to 76 &deg;C. However this doesn't seem to solve our problem (refer to Gel photos). It seems likely that it is a primer design problem.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Construction of riboswitch plasmid with Gibson Assembly]]'''<br />
<br />
----<br />
<br />
*DNA from lanes 27+28, 27+29, 27+30 from gels run on Friday fused together with Gibson assembly to produce riboswitch construct. This does not have replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
*DNA from lanes 22,23 and 24 fused with riboswitch DNA produced two weeks ago to produce riboswitch construct. This has replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
===Tuesday (01/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of TOP10 E.coli with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into TOP10 e.coli cells and transformants plated out on 100&mu;g/ml ampicillin plates.<br />
<br />
===Wednesday (01/08/12)===<br />
<br />
'''Mg2+ Riboswitch'''<br />
<br />
----<br />
<br />
*Successful colonies produced from transformations two days ago streaked out onto chloramphenicol (5 &mu;g/ml) containing plates.<br />
<br />
*Colonies also grown up in 10ml of medium A for use with plate reader later.<br />
<br />
===Friday (03/08/12)<br />
<br />
''' [[Team:Cambridge/Protocols/PCRProtocol|PCR of split Mg2+ vector]]'''<br />
<br />
----<br />
<br />
[[File:split Mg2+ 1.jpg|left|250px|thumb|results of split magnesium vector PCR. None of the products worked]]<br />
<br />
*PCR of magnesium riboswitch vector repeated with primers to split plasmid.<br />
<br />
*Lanes 2 + 3: Fragment A (center - cut site (promotor side))<br />
<br />
*Lanes 4 + 5: Fragment B (without 8 codon substitution) (cut site (lac I side) - center)<br />
<br />
*Lanes 6 + 7: Fragment B (with 8 codon substitution) (cut stie (lac I side) - center)<br />
<br />
*Gels run, found PCR was unsuccessful.<br />
<br />
===Sunday (05/08/12)===<br />
<br />
'''Ribosense: [[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg Riboswitch vector fragments]]'''<br />
<br />
----<br />
<br />
*2nd attempt since the PCR on Friday did not work, possibly due to mastermix problems<br />
<br />
*PCR Programme:<br />
<br />
*Results: Fragment A was successfully PCR-ed (lanes 3-4); Fragment B did not come out, with or without the 8 codons (lanes 5-6 (-8); lanes 7-8 (+8))<br />
<br />
==Week 7==<br />
<br />
===Monday (06/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Magnesium riboswitch vector fragment B and Magnesium promoter]]'''<br />
<br />
----<br />
<br />
[[File:MgRS vector frag. B.jpg|right|250px|thumb|Riboswitch and promoter gel. Lanes 2+3: Fragment B without 8 codon substitution, lanes 4+5: Fragment B with 8 codon substitution, lanes 6+7: magnesium sensitive promoter, lane 8: +ve control]]<br />
<br />
*Normal PCR settings used, annealing temperature 57 &deg;C, elongation step 90s long.<br />
<br />
*Lane 5 accidentally loaded with a DNA ladder instead of loading dye.<br />
<br />
*Expected fragment sizes:<br />
<br />
:*Lane 2-5: 3kbp<br />
<br />
:*Lane 6-7: 300bp<br />
<br />
*After electrophoresis, found vector products had, for the most part, worked. Promoter elements were not amplified - no band of the expected size was observed.<br />
<br />
*Positive control also failed, although this has ceased to work for several days, potentially due to DNA degradation.<br />
<br />
===Tuesday (07/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of magnesium riboswitch]]'''<br />
<br />
----<br />
<br />
*NAD+ added to '''isothermal buffer'''*5 mix<br />
<br />
*Gel slices from yesterday (of vector fragment B) purified.<br />
<br />
*DNA added as follows:<br />
<br />
:*Without 8 codon substitution:<br />
<br />
::*Reaction 1: Tube 2 (07/08/12) (fragment B), Tube 1 (05/08/12) (fragment A), Tube 28 (29/08/12) (riboswitch DNA).<br />
<br />
::*Reaction 2: Tube 3 (07/08/12) (fragment B), Tube 2 (05/08/12) (fragment A), Tube 29 (29/08/12) (riboswitch DNA).<br />
<br />
:*With 8 codon substitution:<br />
<br />
::*Reaction 3: Tube 4 (07/08/12) (fragment B), Tube 1 (05/08/12) (fragment A), Tube 2 (18/07/12) (riboswitch DNA).<br />
<br />
===Wednesday (08/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/ElectricalTransformation|Electrical transformation of competent e.coli with Gibson products]]'''<br />
<br />
----<br />
<br />
*Gibson constructs from yesterday (fluorescent and magnesium riboswitch) transformed into e.coli produced yesterday.<br />
<br />
*Cells plated out onto 50 &mu;g/ml ampicillin plates. Put in incubator overnight.<br />
<br />
===Friday (10/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay|Characterization of fluoride riboswitch sensitivity with &beta;-galactosidase]]'''<br />
<br />
----<br />
<br />
*X-Gal made up to a concentration of 400 &mu;g/ml with water.<br />
<br />
*Fluoride of concentrations 0.5 - 30 mM mixed with bacterial culture (Yale construct containing) grown up overnight.<br />
<br />
===Saturday (11/08/12)===<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/RestrictionDigest|Restriction digest of Yale plasmid]]'''<br />
<br />
----<br />
<br />
*Cells from electroporation of e.coli with plasmid from Yale (08/08/12) [[Team:Cambridge/Protocols/MiniPrep|miniprepped]] to extract plasmid DNA.<br />
<br />
*DNA digested with XhoI and SalI, expected fragment sizes 5580, 3139, 1437<br />
<br />
*Gel run, results not shown as gel was very 'messy'. Gel had probably already begun to set when poured and so had many artefacts when imaged. As a result each lane required different brightness and contrast settings to visualise and so the full gel was not clearly visible on the printout. However, all of the bands could be identified on the screen and were exactly as expected and very clear and pure.<br />
<br />
*Bands in correct places, indicating that expected plasmid was present in the cells. This indicates that, although they work at a very low efficiency, our electro-competent cells still work. It may be valuable to use these when trying to grow up plasmids that we already have at high concentration. <br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of e.coli with Magnesium riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Gibson products from 07/08/12 transformed into chemically competent cells.<br />
<br />
*Transformants plated out on 100 &mu;g/ml ampicillin plates<br />
<br />
==Week 8==<br />
<br />
===Wednesday (15/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay| Characterization of fluoride riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Strain of ''bacillus'' lacking fluoride transporter system tested. Concentrations used:<br />
<br />
:*0mM - 0.5mM - 1mM - 2.5mM - 5mM - 10mM - 20mM - 30mM<br />
<br />
===Thursday (16/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay| Characterization of fluoride riboswitch construct]]'''<br />
<br />
----<br />
<br />
[[File:fluoridegradient.jpg|250px|right|thumb|The results of our fluoride assay.]]<br />
<br />
* Eppindorfs containing the ''bacillus'' with the fluoride riboswitch removed from incubator and imaged.<br />
<br />
* Now this definitely works, we will try quantifying this riboswitch with an ONPG assay and the plate reader.<br />
<br />
===Saturday (18/08/12)===<br />
<br />
'''Colonies picked in preparation for Miller assay'''<br />
<br />
----<br />
<br />
*2 ''E. coli'' colonies transformed with the purified plasmid were picked and inoculated in LB with 50&mu;g/ml Amp<br />
<br />
*2 colonies each from the 168 strain and crcB knockout ''B. subtilis'' containing the fluoride riboswitch were picked and inoculated in LB with 5&mu;g/ml Chlor<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Fluoride biobrick format]]'''<br />
<br />
----<br />
<br />
[[File:FluorideBB1gel.jpg|right|250px|thumb|Gels from PCR of Fluoride BB and PJS130 fragments. Top: Lanes 2-4: Gibson compatable Fluoride biobrick fragment. Lanes 5-7: Ligation compatable Fluoride biobrick fragment. Lane 8: PJS130 fragment A. Bottom: Lanes 1-2: PJS130 fragment A. Lanes 3-5: PJS 130 fragment B. Lane 6: Positive control. Lane 7: Negative control.]]<br />
<br />
*Two sets of primers used: one to allow insertion into backbone by ligation, and one to allow insertion by Gibson assembly.<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 100 seconds<br />
<br />
*Products run on gel. Fragments produced of correct size, however they overlapped with the primer dimer band due to the small size of the fragments.<br />
<br />
*DNA extracted and purified.<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg2+ riboswitch construct vector]]'''<br />
<br />
----<br />
<br />
*Separate reactions for<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 100 seconds <br />
<br />
*Products run on gel. No fragments produced. Positive control worked however, so master mix clearly works.<br />
<br />
*Given this PCR has worked in the past, will try to re-run with the same settings and hope for success in the future.<br />
<br />
===Sunday (19/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/MillerAssay|Miller Assay of Fluoride construct]]'''<br />
<br />
----<br />
<br />
* Colonies picked from overnight and Miller assay run as directed on protocols page<br />
<br />
* Lack of filters meant that only A450 data recorderd<br />
<br />
==Week 9==<br />
<br />
===Tuesday (21/08/12)===<br />
<br />
'''PCR for Mg Riboswitch'''<br />
<br />
----<br />
*[[Team:Cambridge/Protocols/PCRProtocol| PCRs]] were run for pJS130.1 split vector ('+8 codons')<br />
*[[Team:Cambridge/Protocols/PCRcolony| Colony PCR]] for endogenous ''Bacillus subtilis'' Mg Riboswitch ('+8 codons') was run<br />
*Gels were run for above reactions, only one band for half of the pJS130 vector was visible.<br />
<br />
===Wednesday (22/08/12)===<br />
<br />
'''PCR for Mg Riboswitch'''<br />
<br />
----<br />
<br />
*[[Team:Cambridge/Protocols/PCRProtocol| PCRs]] were run for F Riboswitch from Yale's plasmid with overhangs for standard assembly.<br />
*[[Team:Cambridge/Protocols/PCRcolony| Colony PCR]] for endogenous ''Bacillus subtilis'' Mg Riboswitch (both '+8 codons' and '-8 codons' versions) were re-run.<br />
*Gels were run for above reactions, only one band for positive control was visible.<br />
<br />
'''Cells cultured for Miller assay'''<br />
----<br />
*''B. subtilis'' strains carrying F riboswitch and 'KO' strains cultured separately in LB and 5µg/mL Chloramphenicol at 37°C<br />
*''E.Coli'' carrying F riboswitch cultured in LB and 50mg/ml Ampicillin at 37°C<br />
<br />
===Thursday (23/08/12)===<br />
* Miller assay set up and running with the wild type and crcB knock-out ''Bacillus'' strains and an ''E. coli'' strain which contains the construct on an episomal plasmid.<br />
<br />
===Friday (24/08/12)===<br />
*Miller assay data collected for analysis over the weekend<br />
<br />
==Week 10==<br />
<br />
==Week 11==<br />
<br />
==Week 12==<br />
<br />
==Week 13==<br />
<br />
==Week 14==<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Ribosense/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Ribosense/LabbookTeam:Cambridge/Ribosense/Labbook2012-10-27T03:24:01Z<p>Olijme: /* Wednesday (22/08/12) */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Labbook");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= General Labbook =<br />
<br />
==Week 4 ==<br />
<br />
===Tuesday (17/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of MGRS vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 58 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 180secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain 168 used as template for this experiment.<br />
<br />
* Primers used:<br />
<br />
:* Forward: cggagggagacgattttgTGTTCCGTAATTGTGATGTAAG<br />
<br />
:* Reverse: acaccggcatactctgcgacGTCATAGGTCATGTTTTGAACC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Wednesday (18/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:Mg2+ Gel PCR 1.jpg|250px|right|thumb|Results of gel electrophoresis of PCR fragments from yesterday. 550bp fragments in lanes 2+3 were removed before the image was taken]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2 + 3: Riboswitch DNA from genome (replicates) - 550bp fragment expected.<br />
<br />
:*Lane 4 + 5: Vector DNA from pJS130 (replicates)- Chloramphenicol resistance marker - 9.0kbp fragment expected<br />
<br />
:*Lane 6: Postitive control - 1.9kbp fragment expected<br />
<br />
*Riboswitch DNA was successfully amplified. However, vector DNA was not. Given that the postive control was also successful, it seems likely that something went wrong with some stage before the PCR amplification. We will try to rectify the problem tomorrow.<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of riboswitch DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful riboswitch DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
===Thursday (19/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 55 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 240secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
*Settings changed - Annealing temperature and elongation time - attempting to debug PCR.<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:PCR Gel Mg2+ 2.jpg|right|250px|thumb|PCR products from today. Note the unusual band in the negative control and the vector lanes]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2, 3 + 4: Vector DNA from pJS130 (replicates) - 9.0kbp fragment expected<br />
<br />
:*Lane 5: Postitive control - 1.9kbp fragment expected<br />
<br />
:*Lane 6: Negative control - no fragments expected<br />
<br />
*Once more, the PCR appears to have failed. We will try to redesign the primers tomorrow to make them functional.<br />
<br />
==Week 5==<br />
<br />
===Thursday (26/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome and Lux genes from e.coli genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain pJS130 used as template for riboswitch, colony of previously transformed e.coli used as template for lux operon.<br />
<br />
:*M2+ RS<br />
<br />
::*Forward: cggagggagacgattttg|TGTTCCGTAATTGTGATGTAAG<br />
<br />
::*Reverse: tataacgttactggtttcat|CGGGACTCGTACCTCC<br />
<br />
:*Lux operon<br />
<br />
::*Forward: gctgtacaag|GGAGGAGGAGGAAGTGGAGGAGGAGGAAGT|atgaagtttggaaatatttgtttttc<br />
<br />
::*Reverse: cctcgcccttgctcaccat|ACTCTATTCCTTTTTGGTGATTC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Friday (27/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
{|cellspacing="20"<br />
|[[File:CAM_120727_1_edited.jpg|200px|left|thumb|Vector amplification gel. Lanes 2-4 Lux containing vector. Lanes 5-7 Fluorescent construct vector. No products from this gel were amplified.]]<br />
|[[File:CAM_120727_2_edited.jpg|200px|left|thumb|Various. Lanes 3-5 mOrange amplification. Lanes 6-8 eCFP (E0020) amplification. mOrange amplification did not work.]]<br />
|[[File:CAM_120727_3_edited.jpg|200px|left|thumb|Small products for fluorescent construct. Lanes 1-3 Terminator (B0015). Lanes 4-6 Promotor pVEG + SpoVG (K143053).]]<br />
|-<br />
|[[File:CAM_120727_4_edited.jpg|200px|left|thumb|Various. Lanes 2-4 eYFP (E0030) amplification. Lanes 5-7 Mg2+ vector +8 codons. Lane 8 Mg2+ vector -8 codons. Lane 8 amplification did not work.]]<br />
|[[File:CAM_120727_5_edited.jpg|200px|left|thumb|Mg2+ riboswitch gel. Lanes 6+7 positive and negative controls respectively for entire run. Lanes 3-5 genomic riboswitch amplification -8 codons. Lanes 2+3 vector -8 codons.]]<br />
|}<br />
<br />
*PCR fragments for Mg2+ riboswitch, luxA/mOrange fusion and fluorescent construct from yesterday separated on gels. 90mins at 100V.<br />
<br />
*Mostly successful, but will need to repeat four runs: Three vectors (fluorescent, fusion (lux) and Mg2+ riboswitch (-8 codons) and mOrange gene.<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of successfully amplified DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful CFP, YFP, B0015, Pveg + SpoVG (K143053), riboswitch and vector DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
==Week 6==<br />
<br />
===Monday (30/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vectors and mOrange]]'''<br />
<br />
----<br />
<br />
[[File:mOrangegel.jpg|250px|thumb|mOrange PCR run at multiple temperatures, every two lanes increacing the temperature of the annealing step by 2 &deg;C. No lanes worked.]]<br />
<br />
[[File:vectorgel1.jpg|250px|thumb|Top: Fusion, lux containing vector gel. Lanes 2-4, Vector DNA. Lane 5, +ve control. Lane 6, -ve control. Bottom: Vector gel. Lanes 1-3, Fluorescent construct vector DNA. Lanes 4-6, Riboswitch construct vector DNA.]]<br />
<br />
*Not all products were obtained during Friday's PCR. Most of these missing products were large vector backbones. They are being run again, with a much longer extension time of 300s. If that fails, primers will be ordered to split the vectors into manageable chunks, and the PCR reattempted when they arrive.<br />
<br />
*PCR cycle x35: <br />
<br />
:* 15s Denaturing at 95 C<br />
:* 45s Annealing at 60 C<br />
:* 300s Extension at 72 C<br />
<br />
*Remaining stray product had a slightly tricky secondary structure at the 3' end. It will be run at a series of annealing temperatures in a PCR machine capable of a temperature gradient.<br />
<br />
*mOrange PCR run at many different temperatures, from 62 &deg;C to 76 &deg;C. However this doesn't seem to solve our problem (refer to Gel photos). It seems likely that it is a primer design problem.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Construction of riboswitch plasmid with Gibson Assembly]]'''<br />
<br />
----<br />
<br />
*DNA from lanes 27+28, 27+29, 27+30 from gels run on Friday fused together with Gibson assembly to produce riboswitch construct. This does not have replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
*DNA from lanes 22,23 and 24 fused with riboswitch DNA produced two weeks ago to produce riboswitch construct. This has replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
===Tuesday (01/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of TOP10 E.coli with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into TOP10 e.coli cells and transformants plated out on 100&mu;g/ml ampicillin plates.<br />
<br />
===Wednesday (01/08/12)===<br />
<br />
'''Mg2+ Riboswitch'''<br />
<br />
----<br />
<br />
*Successful colonies produced from transformations two days ago streaked out onto chloramphenicol (5 &mu;g/ml) containing plates.<br />
<br />
*Colonies also grown up in 10ml of medium A for use with plate reader later.<br />
<br />
===Friday (03/08/12)<br />
<br />
''' [[Team:Cambridge/Protocols/PCRProtocol|PCR of split Mg2+ vector]]'''<br />
<br />
----<br />
<br />
[[File:split Mg2+ 1.jpg|left|250px|thumb|results of split magnesium vector PCR. None of the products worked]]<br />
<br />
*PCR of magnesium riboswitch vector repeated with primers to split plasmid.<br />
<br />
*Lanes 2 + 3: Fragment A (center - cut site (promotor side))<br />
<br />
*Lanes 4 + 5: Fragment B (without 8 codon substitution) (cut site (lac I side) - center)<br />
<br />
*Lanes 6 + 7: Fragment B (with 8 codon substitution) (cut stie (lac I side) - center)<br />
<br />
*Gels run, found PCR was unsuccessful.<br />
<br />
===Sunday (05/08/12)===<br />
<br />
'''Ribosense: [[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg Riboswitch vector fragments]]'''<br />
<br />
----<br />
<br />
*2nd attempt since the PCR on Friday did not work, possibly due to mastermix problems<br />
<br />
*PCR Programme:<br />
<br />
*Results: Fragment A was successfully PCR-ed (lanes 3-4); Fragment B did not come out, with or without the 8 codons (lanes 5-6 (-8); lanes 7-8 (+8))<br />
<br />
==Week 7==<br />
<br />
===Monday (06/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Magnesium riboswitch vector fragment B and Magnesium promoter]]'''<br />
<br />
----<br />
<br />
[[File:MgRS vector frag. B.jpg|right|250px|thumb|Riboswitch and promoter gel. Lanes 2+3: Fragment B without 8 codon substitution, lanes 4+5: Fragment B with 8 codon substitution, lanes 6+7: magnesium sensitive promoter, lane 8: +ve control]]<br />
<br />
*Normal PCR settings used, annealing temperature 57 &deg;C, elongation step 90s long.<br />
<br />
*Lane 5 accidentally loaded with a DNA ladder instead of loading dye.<br />
<br />
*Expected fragment sizes:<br />
<br />
:*Lane 2-5: 3kbp<br />
<br />
:*Lane 6-7: 300bp<br />
<br />
*After electrophoresis, found vector products had, for the most part, worked. Promoter elements were not amplified - no band of the expected size was observed.<br />
<br />
*Positive control also failed, although this has ceased to work for several days, potentially due to DNA degradation.<br />
<br />
===Tuesday (07/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of magnesium riboswitch]]'''<br />
<br />
----<br />
<br />
*NAD+ added to '''isothermal buffer'''*5 mix<br />
<br />
*Gel slices from yesterday (of vector fragment B) purified.<br />
<br />
*DNA added as follows:<br />
<br />
:*Without 8 codon substitution:<br />
<br />
::*Reaction 1: Tube 2 (07/08/12) (fragment B), Tube 1 (05/08/12) (fragment A), Tube 28 (29/08/12) (riboswitch DNA).<br />
<br />
::*Reaction 2: Tube 3 (07/08/12) (fragment B), Tube 2 (05/08/12) (fragment A), Tube 29 (29/08/12) (riboswitch DNA).<br />
<br />
:*With 8 codon substitution:<br />
<br />
::*Reaction 3: Tube 4 (07/08/12) (fragment B), Tube 1 (05/08/12) (fragment A), Tube 2 (18/07/12) (riboswitch DNA).<br />
<br />
===Wednesday (08/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/ElectricalTransformation|Electrical transformation of competent e.coli with Gibson products]]'''<br />
<br />
----<br />
<br />
*Gibson constructs from yesterday (fluorescent and magnesium riboswitch) transformed into e.coli produced yesterday.<br />
<br />
*Cells plated out onto 50 &mu;g/ml ampicillin plates. Put in incubator overnight.<br />
<br />
===Friday (10/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay|Characterization of fluoride riboswitch sensitivity with &beta;-galactosidase]]'''<br />
<br />
----<br />
<br />
*X-Gal made up to a concentration of 400 &mu;g/ml with water.<br />
<br />
*Fluoride of concentrations 0.5 - 30 mM mixed with bacterial culture (Yale construct containing) grown up overnight.<br />
<br />
===Saturday (11/08/12)===<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/RestrictionDigest|Restriction digest of Yale plasmid]]'''<br />
<br />
----<br />
<br />
*Cells from electroporation of e.coli with plasmid from Yale (08/08/12) [[Team:Cambridge/Protocols/MiniPrep|miniprepped]] to extract plasmid DNA.<br />
<br />
*DNA digested with XhoI and SalI, expected fragment sizes 5580, 3139, 1437<br />
<br />
*Gel run, results not shown as gel was very 'messy'. Gel had probably already begun to set when poured and so had many artefacts when imaged. As a result each lane required different brightness and contrast settings to visualise and so the full gel was not clearly visible on the printout. However, all of the bands could be identified on the screen and were exactly as expected and very clear and pure.<br />
<br />
*Bands in correct places, indicating that expected plasmid was present in the cells. This indicates that, although they work at a very low efficiency, our electro-competent cells still work. It may be valuable to use these when trying to grow up plasmids that we already have at high concentration. <br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of e.coli with Magnesium riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Gibson products from 07/08/12 transformed into chemically competent cells.<br />
<br />
*Transformants plated out on 100 &mu;g/ml ampicillin plates<br />
<br />
==Week 8==<br />
<br />
===Wednesday (15/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay| Characterization of fluoride riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Strain of ''bacillus'' lacking fluoride transporter system tested. Concentrations used:<br />
<br />
:*0mM - 0.5mM - 1mM - 2.5mM - 5mM - 10mM - 20mM - 30mM<br />
<br />
===Thursday (16/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay| Characterization of fluoride riboswitch construct]]'''<br />
<br />
----<br />
<br />
[[File:fluoridegradient.jpg|250px|right|thumb|The results of our fluoride assay.]]<br />
<br />
* Eppindorfs containing the ''bacillus'' with the fluoride riboswitch removed from incubator and imaged.<br />
<br />
* Now this definitely works, we will try quantifying this riboswitch with an ONPG assay and the plate reader.<br />
<br />
===Saturday (18/08/12)===<br />
<br />
'''Colonies picked in preparation for Miller assay'''<br />
<br />
----<br />
<br />
*2 ''E. coli'' colonies transformed with the purified plasmid were picked and inoculated in LB with 50&mu;g/ml Amp<br />
<br />
*2 colonies each from the 168 strain and crcB knockout ''B. subtilis'' containing the fluoride riboswitch were picked and inoculated in LB with 5&mu;g/ml Chlor<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Fluoride biobrick format]]'''<br />
<br />
----<br />
<br />
[[File:FluorideBB1gel.jpg|right|250px|thumb|Gels from PCR of Fluoride BB and PJS130 fragments. Top: Lanes 2-4: Gibson compatable Fluoride biobrick fragment. Lanes 5-7: Ligation compatable Fluoride biobrick fragment. Lane 8: PJS130 fragment A. Bottom: Lanes 1-2: PJS130 fragment A. Lanes 3-5: PJS 130 fragment B. Lane 6: Positive control. Lane 7: Negative control.]]<br />
<br />
*Two sets of primers used: one to allow insertion into backbone by ligation, and one to allow insertion by Gibson assembly.<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 100 seconds<br />
<br />
*Products run on gel. Fragments produced of correct size, however they overlapped with the primer dimer band due to the small size of the fragments.<br />
<br />
*DNA extracted and purified.<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg2+ riboswitch construct vector]]'''<br />
<br />
----<br />
<br />
*Separate reactions for<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 100 seconds <br />
<br />
*Products run on gel. No fragments produced. Positive control worked however, so master mix clearly works.<br />
<br />
*Given this PCR has worked in the past, will try to re-run with the same settings and hope for success in the future.<br />
<br />
===Sunday (19/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/MillerAssay|Miller Assay of Fluoride construct]]'''<br />
<br />
----<br />
<br />
* Colonies picked from overnight and Miller assay run as directed on protocols page<br />
<br />
* Lack of filters meant that only A450 data recorderd<br />
<br />
==Week 9==<br />
<br />
===Tuesday (21/08/12)===<br />
<br />
'''PCR for Mg Riboswitch'''<br />
<br />
----<br />
*[[Team:Cambridge/Protocols/PCRProtocol| PCRs]] were run for pJS130.1 split vector ('+8 codons')<br />
*[[Team:Cambridge/Protocols/PCRcolony| Colony PCR]] for endogenous ''Bacillus subtilis'' Mg Riboswitch ('+8 codons') was run<br />
*Gels were run for above reactions, only one band for half of the pJS130 vector was visible.<br />
<br />
===Wednesday (22/08/12)===<br />
<br />
'''PCR for Mg Riboswitch'''<br />
<br />
----<br />
<br />
*[[Team:Cambridge/Protocols/PCRProtocol| PCRs]] were run for F Riboswitch from Yale's plasmid with overhangs for standard assembly.<br />
*[[Team:Cambridge/Protocols/PCRcolony| Colony PCR]] for endogenous ''Bacillus subtilis'' Mg Riboswitch (both '+8 codons' and '-8 codons' versions) were re-run.<br />
*Gels were run for above reactions, only one band for positive control was visible.<br />
<br />
'''Cells cultured for Miller assay'''<br />
----<br />
*''B. subtilis'' strains carrying F riboswitch and 'KO' strains cultured separately in LB and 5µg/mL Chloramphenicol at 37°C<br />
*''E.Coli'' carrying F riboswitch cultured in LB and 50mg/ml Ampicillin at 37°C<br />
<br />
==Week 10==<br />
<br />
==Week 11==<br />
<br />
==Week 12==<br />
<br />
==Week 13==<br />
<br />
==Week 14==<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Ribosense/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Ribosense/LabbookTeam:Cambridge/Ribosense/Labbook2012-10-27T03:23:47Z<p>Olijme: /* Week 9 */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Labbook");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= General Labbook =<br />
<br />
==Week 4 ==<br />
<br />
===Tuesday (17/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of MGRS vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 58 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 180secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain 168 used as template for this experiment.<br />
<br />
* Primers used:<br />
<br />
:* Forward: cggagggagacgattttgTGTTCCGTAATTGTGATGTAAG<br />
<br />
:* Reverse: acaccggcatactctgcgacGTCATAGGTCATGTTTTGAACC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Wednesday (18/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:Mg2+ Gel PCR 1.jpg|250px|right|thumb|Results of gel electrophoresis of PCR fragments from yesterday. 550bp fragments in lanes 2+3 were removed before the image was taken]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2 + 3: Riboswitch DNA from genome (replicates) - 550bp fragment expected.<br />
<br />
:*Lane 4 + 5: Vector DNA from pJS130 (replicates)- Chloramphenicol resistance marker - 9.0kbp fragment expected<br />
<br />
:*Lane 6: Postitive control - 1.9kbp fragment expected<br />
<br />
*Riboswitch DNA was successfully amplified. However, vector DNA was not. Given that the postive control was also successful, it seems likely that something went wrong with some stage before the PCR amplification. We will try to rectify the problem tomorrow.<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of riboswitch DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful riboswitch DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
===Thursday (19/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 55 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 240secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
*Settings changed - Annealing temperature and elongation time - attempting to debug PCR.<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:PCR Gel Mg2+ 2.jpg|right|250px|thumb|PCR products from today. Note the unusual band in the negative control and the vector lanes]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2, 3 + 4: Vector DNA from pJS130 (replicates) - 9.0kbp fragment expected<br />
<br />
:*Lane 5: Postitive control - 1.9kbp fragment expected<br />
<br />
:*Lane 6: Negative control - no fragments expected<br />
<br />
*Once more, the PCR appears to have failed. We will try to redesign the primers tomorrow to make them functional.<br />
<br />
==Week 5==<br />
<br />
===Thursday (26/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome and Lux genes from e.coli genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain pJS130 used as template for riboswitch, colony of previously transformed e.coli used as template for lux operon.<br />
<br />
:*M2+ RS<br />
<br />
::*Forward: cggagggagacgattttg|TGTTCCGTAATTGTGATGTAAG<br />
<br />
::*Reverse: tataacgttactggtttcat|CGGGACTCGTACCTCC<br />
<br />
:*Lux operon<br />
<br />
::*Forward: gctgtacaag|GGAGGAGGAGGAAGTGGAGGAGGAGGAAGT|atgaagtttggaaatatttgtttttc<br />
<br />
::*Reverse: cctcgcccttgctcaccat|ACTCTATTCCTTTTTGGTGATTC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Friday (27/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
{|cellspacing="20"<br />
|[[File:CAM_120727_1_edited.jpg|200px|left|thumb|Vector amplification gel. Lanes 2-4 Lux containing vector. Lanes 5-7 Fluorescent construct vector. No products from this gel were amplified.]]<br />
|[[File:CAM_120727_2_edited.jpg|200px|left|thumb|Various. Lanes 3-5 mOrange amplification. Lanes 6-8 eCFP (E0020) amplification. mOrange amplification did not work.]]<br />
|[[File:CAM_120727_3_edited.jpg|200px|left|thumb|Small products for fluorescent construct. Lanes 1-3 Terminator (B0015). Lanes 4-6 Promotor pVEG + SpoVG (K143053).]]<br />
|-<br />
|[[File:CAM_120727_4_edited.jpg|200px|left|thumb|Various. Lanes 2-4 eYFP (E0030) amplification. Lanes 5-7 Mg2+ vector +8 codons. Lane 8 Mg2+ vector -8 codons. Lane 8 amplification did not work.]]<br />
|[[File:CAM_120727_5_edited.jpg|200px|left|thumb|Mg2+ riboswitch gel. Lanes 6+7 positive and negative controls respectively for entire run. Lanes 3-5 genomic riboswitch amplification -8 codons. Lanes 2+3 vector -8 codons.]]<br />
|}<br />
<br />
*PCR fragments for Mg2+ riboswitch, luxA/mOrange fusion and fluorescent construct from yesterday separated on gels. 90mins at 100V.<br />
<br />
*Mostly successful, but will need to repeat four runs: Three vectors (fluorescent, fusion (lux) and Mg2+ riboswitch (-8 codons) and mOrange gene.<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of successfully amplified DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful CFP, YFP, B0015, Pveg + SpoVG (K143053), riboswitch and vector DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
==Week 6==<br />
<br />
===Monday (30/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vectors and mOrange]]'''<br />
<br />
----<br />
<br />
[[File:mOrangegel.jpg|250px|thumb|mOrange PCR run at multiple temperatures, every two lanes increacing the temperature of the annealing step by 2 &deg;C. No lanes worked.]]<br />
<br />
[[File:vectorgel1.jpg|250px|thumb|Top: Fusion, lux containing vector gel. Lanes 2-4, Vector DNA. Lane 5, +ve control. Lane 6, -ve control. Bottom: Vector gel. Lanes 1-3, Fluorescent construct vector DNA. Lanes 4-6, Riboswitch construct vector DNA.]]<br />
<br />
*Not all products were obtained during Friday's PCR. Most of these missing products were large vector backbones. They are being run again, with a much longer extension time of 300s. If that fails, primers will be ordered to split the vectors into manageable chunks, and the PCR reattempted when they arrive.<br />
<br />
*PCR cycle x35: <br />
<br />
:* 15s Denaturing at 95 C<br />
:* 45s Annealing at 60 C<br />
:* 300s Extension at 72 C<br />
<br />
*Remaining stray product had a slightly tricky secondary structure at the 3' end. It will be run at a series of annealing temperatures in a PCR machine capable of a temperature gradient.<br />
<br />
*mOrange PCR run at many different temperatures, from 62 &deg;C to 76 &deg;C. However this doesn't seem to solve our problem (refer to Gel photos). It seems likely that it is a primer design problem.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Construction of riboswitch plasmid with Gibson Assembly]]'''<br />
<br />
----<br />
<br />
*DNA from lanes 27+28, 27+29, 27+30 from gels run on Friday fused together with Gibson assembly to produce riboswitch construct. This does not have replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
*DNA from lanes 22,23 and 24 fused with riboswitch DNA produced two weeks ago to produce riboswitch construct. This has replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
===Tuesday (01/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of TOP10 E.coli with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into TOP10 e.coli cells and transformants plated out on 100&mu;g/ml ampicillin plates.<br />
<br />
===Wednesday (01/08/12)===<br />
<br />
'''Mg2+ Riboswitch'''<br />
<br />
----<br />
<br />
*Successful colonies produced from transformations two days ago streaked out onto chloramphenicol (5 &mu;g/ml) containing plates.<br />
<br />
*Colonies also grown up in 10ml of medium A for use with plate reader later.<br />
<br />
===Friday (03/08/12)<br />
<br />
''' [[Team:Cambridge/Protocols/PCRProtocol|PCR of split Mg2+ vector]]'''<br />
<br />
----<br />
<br />
[[File:split Mg2+ 1.jpg|left|250px|thumb|results of split magnesium vector PCR. None of the products worked]]<br />
<br />
*PCR of magnesium riboswitch vector repeated with primers to split plasmid.<br />
<br />
*Lanes 2 + 3: Fragment A (center - cut site (promotor side))<br />
<br />
*Lanes 4 + 5: Fragment B (without 8 codon substitution) (cut site (lac I side) - center)<br />
<br />
*Lanes 6 + 7: Fragment B (with 8 codon substitution) (cut stie (lac I side) - center)<br />
<br />
*Gels run, found PCR was unsuccessful.<br />
<br />
===Sunday (05/08/12)===<br />
<br />
'''Ribosense: [[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg Riboswitch vector fragments]]'''<br />
<br />
----<br />
<br />
*2nd attempt since the PCR on Friday did not work, possibly due to mastermix problems<br />
<br />
*PCR Programme:<br />
<br />
*Results: Fragment A was successfully PCR-ed (lanes 3-4); Fragment B did not come out, with or without the 8 codons (lanes 5-6 (-8); lanes 7-8 (+8))<br />
<br />
==Week 7==<br />
<br />
===Monday (06/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Magnesium riboswitch vector fragment B and Magnesium promoter]]'''<br />
<br />
----<br />
<br />
[[File:MgRS vector frag. B.jpg|right|250px|thumb|Riboswitch and promoter gel. Lanes 2+3: Fragment B without 8 codon substitution, lanes 4+5: Fragment B with 8 codon substitution, lanes 6+7: magnesium sensitive promoter, lane 8: +ve control]]<br />
<br />
*Normal PCR settings used, annealing temperature 57 &deg;C, elongation step 90s long.<br />
<br />
*Lane 5 accidentally loaded with a DNA ladder instead of loading dye.<br />
<br />
*Expected fragment sizes:<br />
<br />
:*Lane 2-5: 3kbp<br />
<br />
:*Lane 6-7: 300bp<br />
<br />
*After electrophoresis, found vector products had, for the most part, worked. Promoter elements were not amplified - no band of the expected size was observed.<br />
<br />
*Positive control also failed, although this has ceased to work for several days, potentially due to DNA degradation.<br />
<br />
===Tuesday (07/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of magnesium riboswitch]]'''<br />
<br />
----<br />
<br />
*NAD+ added to '''isothermal buffer'''*5 mix<br />
<br />
*Gel slices from yesterday (of vector fragment B) purified.<br />
<br />
*DNA added as follows:<br />
<br />
:*Without 8 codon substitution:<br />
<br />
::*Reaction 1: Tube 2 (07/08/12) (fragment B), Tube 1 (05/08/12) (fragment A), Tube 28 (29/08/12) (riboswitch DNA).<br />
<br />
::*Reaction 2: Tube 3 (07/08/12) (fragment B), Tube 2 (05/08/12) (fragment A), Tube 29 (29/08/12) (riboswitch DNA).<br />
<br />
:*With 8 codon substitution:<br />
<br />
::*Reaction 3: Tube 4 (07/08/12) (fragment B), Tube 1 (05/08/12) (fragment A), Tube 2 (18/07/12) (riboswitch DNA).<br />
<br />
===Wednesday (08/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/ElectricalTransformation|Electrical transformation of competent e.coli with Gibson products]]'''<br />
<br />
----<br />
<br />
*Gibson constructs from yesterday (fluorescent and magnesium riboswitch) transformed into e.coli produced yesterday.<br />
<br />
*Cells plated out onto 50 &mu;g/ml ampicillin plates. Put in incubator overnight.<br />
<br />
===Friday (10/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay|Characterization of fluoride riboswitch sensitivity with &beta;-galactosidase]]'''<br />
<br />
----<br />
<br />
*X-Gal made up to a concentration of 400 &mu;g/ml with water.<br />
<br />
*Fluoride of concentrations 0.5 - 30 mM mixed with bacterial culture (Yale construct containing) grown up overnight.<br />
<br />
===Saturday (11/08/12)===<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/RestrictionDigest|Restriction digest of Yale plasmid]]'''<br />
<br />
----<br />
<br />
*Cells from electroporation of e.coli with plasmid from Yale (08/08/12) [[Team:Cambridge/Protocols/MiniPrep|miniprepped]] to extract plasmid DNA.<br />
<br />
*DNA digested with XhoI and SalI, expected fragment sizes 5580, 3139, 1437<br />
<br />
*Gel run, results not shown as gel was very 'messy'. Gel had probably already begun to set when poured and so had many artefacts when imaged. As a result each lane required different brightness and contrast settings to visualise and so the full gel was not clearly visible on the printout. However, all of the bands could be identified on the screen and were exactly as expected and very clear and pure.<br />
<br />
*Bands in correct places, indicating that expected plasmid was present in the cells. This indicates that, although they work at a very low efficiency, our electro-competent cells still work. It may be valuable to use these when trying to grow up plasmids that we already have at high concentration. <br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of e.coli with Magnesium riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Gibson products from 07/08/12 transformed into chemically competent cells.<br />
<br />
*Transformants plated out on 100 &mu;g/ml ampicillin plates<br />
<br />
==Week 8==<br />
<br />
===Wednesday (15/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay| Characterization of fluoride riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Strain of ''bacillus'' lacking fluoride transporter system tested. Concentrations used:<br />
<br />
:*0mM - 0.5mM - 1mM - 2.5mM - 5mM - 10mM - 20mM - 30mM<br />
<br />
===Thursday (16/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay| Characterization of fluoride riboswitch construct]]'''<br />
<br />
----<br />
<br />
[[File:fluoridegradient.jpg|250px|right|thumb|The results of our fluoride assay.]]<br />
<br />
* Eppindorfs containing the ''bacillus'' with the fluoride riboswitch removed from incubator and imaged.<br />
<br />
* Now this definitely works, we will try quantifying this riboswitch with an ONPG assay and the plate reader.<br />
<br />
===Saturday (18/08/12)===<br />
<br />
'''Colonies picked in preparation for Miller assay'''<br />
<br />
----<br />
<br />
*2 ''E. coli'' colonies transformed with the purified plasmid were picked and inoculated in LB with 50&mu;g/ml Amp<br />
<br />
*2 colonies each from the 168 strain and crcB knockout ''B. subtilis'' containing the fluoride riboswitch were picked and inoculated in LB with 5&mu;g/ml Chlor<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Fluoride biobrick format]]'''<br />
<br />
----<br />
<br />
[[File:FluorideBB1gel.jpg|right|250px|thumb|Gels from PCR of Fluoride BB and PJS130 fragments. Top: Lanes 2-4: Gibson compatable Fluoride biobrick fragment. Lanes 5-7: Ligation compatable Fluoride biobrick fragment. Lane 8: PJS130 fragment A. Bottom: Lanes 1-2: PJS130 fragment A. Lanes 3-5: PJS 130 fragment B. Lane 6: Positive control. Lane 7: Negative control.]]<br />
<br />
*Two sets of primers used: one to allow insertion into backbone by ligation, and one to allow insertion by Gibson assembly.<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 100 seconds<br />
<br />
*Products run on gel. Fragments produced of correct size, however they overlapped with the primer dimer band due to the small size of the fragments.<br />
<br />
*DNA extracted and purified.<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg2+ riboswitch construct vector]]'''<br />
<br />
----<br />
<br />
*Separate reactions for<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 100 seconds <br />
<br />
*Products run on gel. No fragments produced. Positive control worked however, so master mix clearly works.<br />
<br />
*Given this PCR has worked in the past, will try to re-run with the same settings and hope for success in the future.<br />
<br />
===Sunday (19/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/MillerAssay|Miller Assay of Fluoride construct]]'''<br />
<br />
----<br />
<br />
* Colonies picked from overnight and Miller assay run as directed on protocols page<br />
<br />
* Lack of filters meant that only A450 data recorderd<br />
<br />
==Week 9==<br />
<br />
===Tuesday (21/08/12)===<br />
<br />
'''PCR for Mg Riboswitch'''<br />
<br />
----<br />
*[[Team:Cambridge/Protocols/PCRProtocol| PCRs]] were run for pJS130.1 split vector ('+8 codons')<br />
*[[Team:Cambridge/Protocols/PCRcolony| Colony PCR]] for endogenous ''Bacillus subtilis'' Mg Riboswitch ('+8 codons') was run<br />
*Gels were run for above reactions, only one band for half of the pJS130 vector was visible.<br />
<br />
===Wednesday (22/08/12)===<br />
<br />
''PCR for Mg Riboswitch'''<br />
<br />
----<br />
<br />
*[[Team:Cambridge/Protocols/PCRProtocol| PCRs]] were run for F Riboswitch from Yale's plasmid with overhangs for standard assembly.<br />
*[[Team:Cambridge/Protocols/PCRcolony| Colony PCR]] for endogenous ''Bacillus subtilis'' Mg Riboswitch (both '+8 codons' and '-8 codons' versions) were re-run.<br />
*Gels were run for above reactions, only one band for positive control was visible.<br />
<br />
''Cells cultured for Miller assay'''<br />
----<br />
*''B. subtilis'' strains carrying F riboswitch and 'KO' strains cultured separately in LB and 5µg/mL Chloramphenicol at 37°C<br />
*''E.Coli'' carrying F riboswitch cultured in LB and 50mg/ml Ampicillin at 37°C<br />
<br />
==Week 10==<br />
<br />
==Week 11==<br />
<br />
==Week 12==<br />
<br />
==Week 13==<br />
<br />
==Week 14==<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Ribosense/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Ribosense/LabbookTeam:Cambridge/Ribosense/Labbook2012-10-27T03:22:34Z<p>Olijme: /* Week 9 */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Labbook");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= General Labbook =<br />
<br />
==Week 4 ==<br />
<br />
===Tuesday (17/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of MGRS vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 58 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 180secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain 168 used as template for this experiment.<br />
<br />
* Primers used:<br />
<br />
:* Forward: cggagggagacgattttgTGTTCCGTAATTGTGATGTAAG<br />
<br />
:* Reverse: acaccggcatactctgcgacGTCATAGGTCATGTTTTGAACC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Wednesday (18/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:Mg2+ Gel PCR 1.jpg|250px|right|thumb|Results of gel electrophoresis of PCR fragments from yesterday. 550bp fragments in lanes 2+3 were removed before the image was taken]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2 + 3: Riboswitch DNA from genome (replicates) - 550bp fragment expected.<br />
<br />
:*Lane 4 + 5: Vector DNA from pJS130 (replicates)- Chloramphenicol resistance marker - 9.0kbp fragment expected<br />
<br />
:*Lane 6: Postitive control - 1.9kbp fragment expected<br />
<br />
*Riboswitch DNA was successfully amplified. However, vector DNA was not. Given that the postive control was also successful, it seems likely that something went wrong with some stage before the PCR amplification. We will try to rectify the problem tomorrow.<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of riboswitch DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful riboswitch DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
===Thursday (19/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 55 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 240secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
*Settings changed - Annealing temperature and elongation time - attempting to debug PCR.<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:PCR Gel Mg2+ 2.jpg|right|250px|thumb|PCR products from today. Note the unusual band in the negative control and the vector lanes]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2, 3 + 4: Vector DNA from pJS130 (replicates) - 9.0kbp fragment expected<br />
<br />
:*Lane 5: Postitive control - 1.9kbp fragment expected<br />
<br />
:*Lane 6: Negative control - no fragments expected<br />
<br />
*Once more, the PCR appears to have failed. We will try to redesign the primers tomorrow to make them functional.<br />
<br />
==Week 5==<br />
<br />
===Thursday (26/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome and Lux genes from e.coli genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain pJS130 used as template for riboswitch, colony of previously transformed e.coli used as template for lux operon.<br />
<br />
:*M2+ RS<br />
<br />
::*Forward: cggagggagacgattttg|TGTTCCGTAATTGTGATGTAAG<br />
<br />
::*Reverse: tataacgttactggtttcat|CGGGACTCGTACCTCC<br />
<br />
:*Lux operon<br />
<br />
::*Forward: gctgtacaag|GGAGGAGGAGGAAGTGGAGGAGGAGGAAGT|atgaagtttggaaatatttgtttttc<br />
<br />
::*Reverse: cctcgcccttgctcaccat|ACTCTATTCCTTTTTGGTGATTC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Friday (27/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
{|cellspacing="20"<br />
|[[File:CAM_120727_1_edited.jpg|200px|left|thumb|Vector amplification gel. Lanes 2-4 Lux containing vector. Lanes 5-7 Fluorescent construct vector. No products from this gel were amplified.]]<br />
|[[File:CAM_120727_2_edited.jpg|200px|left|thumb|Various. Lanes 3-5 mOrange amplification. Lanes 6-8 eCFP (E0020) amplification. mOrange amplification did not work.]]<br />
|[[File:CAM_120727_3_edited.jpg|200px|left|thumb|Small products for fluorescent construct. Lanes 1-3 Terminator (B0015). Lanes 4-6 Promotor pVEG + SpoVG (K143053).]]<br />
|-<br />
|[[File:CAM_120727_4_edited.jpg|200px|left|thumb|Various. Lanes 2-4 eYFP (E0030) amplification. Lanes 5-7 Mg2+ vector +8 codons. Lane 8 Mg2+ vector -8 codons. Lane 8 amplification did not work.]]<br />
|[[File:CAM_120727_5_edited.jpg|200px|left|thumb|Mg2+ riboswitch gel. Lanes 6+7 positive and negative controls respectively for entire run. Lanes 3-5 genomic riboswitch amplification -8 codons. Lanes 2+3 vector -8 codons.]]<br />
|}<br />
<br />
*PCR fragments for Mg2+ riboswitch, luxA/mOrange fusion and fluorescent construct from yesterday separated on gels. 90mins at 100V.<br />
<br />
*Mostly successful, but will need to repeat four runs: Three vectors (fluorescent, fusion (lux) and Mg2+ riboswitch (-8 codons) and mOrange gene.<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of successfully amplified DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful CFP, YFP, B0015, Pveg + SpoVG (K143053), riboswitch and vector DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
==Week 6==<br />
<br />
===Monday (30/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vectors and mOrange]]'''<br />
<br />
----<br />
<br />
[[File:mOrangegel.jpg|250px|thumb|mOrange PCR run at multiple temperatures, every two lanes increacing the temperature of the annealing step by 2 &deg;C. No lanes worked.]]<br />
<br />
[[File:vectorgel1.jpg|250px|thumb|Top: Fusion, lux containing vector gel. Lanes 2-4, Vector DNA. Lane 5, +ve control. Lane 6, -ve control. Bottom: Vector gel. Lanes 1-3, Fluorescent construct vector DNA. Lanes 4-6, Riboswitch construct vector DNA.]]<br />
<br />
*Not all products were obtained during Friday's PCR. Most of these missing products were large vector backbones. They are being run again, with a much longer extension time of 300s. If that fails, primers will be ordered to split the vectors into manageable chunks, and the PCR reattempted when they arrive.<br />
<br />
*PCR cycle x35: <br />
<br />
:* 15s Denaturing at 95 C<br />
:* 45s Annealing at 60 C<br />
:* 300s Extension at 72 C<br />
<br />
*Remaining stray product had a slightly tricky secondary structure at the 3' end. It will be run at a series of annealing temperatures in a PCR machine capable of a temperature gradient.<br />
<br />
*mOrange PCR run at many different temperatures, from 62 &deg;C to 76 &deg;C. However this doesn't seem to solve our problem (refer to Gel photos). It seems likely that it is a primer design problem.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Construction of riboswitch plasmid with Gibson Assembly]]'''<br />
<br />
----<br />
<br />
*DNA from lanes 27+28, 27+29, 27+30 from gels run on Friday fused together with Gibson assembly to produce riboswitch construct. This does not have replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
*DNA from lanes 22,23 and 24 fused with riboswitch DNA produced two weeks ago to produce riboswitch construct. This has replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
===Tuesday (01/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of TOP10 E.coli with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into TOP10 e.coli cells and transformants plated out on 100&mu;g/ml ampicillin plates.<br />
<br />
===Wednesday (01/08/12)===<br />
<br />
'''Mg2+ Riboswitch'''<br />
<br />
----<br />
<br />
*Successful colonies produced from transformations two days ago streaked out onto chloramphenicol (5 &mu;g/ml) containing plates.<br />
<br />
*Colonies also grown up in 10ml of medium A for use with plate reader later.<br />
<br />
===Friday (03/08/12)<br />
<br />
''' [[Team:Cambridge/Protocols/PCRProtocol|PCR of split Mg2+ vector]]'''<br />
<br />
----<br />
<br />
[[File:split Mg2+ 1.jpg|left|250px|thumb|results of split magnesium vector PCR. None of the products worked]]<br />
<br />
*PCR of magnesium riboswitch vector repeated with primers to split plasmid.<br />
<br />
*Lanes 2 + 3: Fragment A (center - cut site (promotor side))<br />
<br />
*Lanes 4 + 5: Fragment B (without 8 codon substitution) (cut site (lac I side) - center)<br />
<br />
*Lanes 6 + 7: Fragment B (with 8 codon substitution) (cut stie (lac I side) - center)<br />
<br />
*Gels run, found PCR was unsuccessful.<br />
<br />
===Sunday (05/08/12)===<br />
<br />
'''Ribosense: [[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg Riboswitch vector fragments]]'''<br />
<br />
----<br />
<br />
*2nd attempt since the PCR on Friday did not work, possibly due to mastermix problems<br />
<br />
*PCR Programme:<br />
<br />
*Results: Fragment A was successfully PCR-ed (lanes 3-4); Fragment B did not come out, with or without the 8 codons (lanes 5-6 (-8); lanes 7-8 (+8))<br />
<br />
==Week 7==<br />
<br />
===Monday (06/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Magnesium riboswitch vector fragment B and Magnesium promoter]]'''<br />
<br />
----<br />
<br />
[[File:MgRS vector frag. B.jpg|right|250px|thumb|Riboswitch and promoter gel. Lanes 2+3: Fragment B without 8 codon substitution, lanes 4+5: Fragment B with 8 codon substitution, lanes 6+7: magnesium sensitive promoter, lane 8: +ve control]]<br />
<br />
*Normal PCR settings used, annealing temperature 57 &deg;C, elongation step 90s long.<br />
<br />
*Lane 5 accidentally loaded with a DNA ladder instead of loading dye.<br />
<br />
*Expected fragment sizes:<br />
<br />
:*Lane 2-5: 3kbp<br />
<br />
:*Lane 6-7: 300bp<br />
<br />
*After electrophoresis, found vector products had, for the most part, worked. Promoter elements were not amplified - no band of the expected size was observed.<br />
<br />
*Positive control also failed, although this has ceased to work for several days, potentially due to DNA degradation.<br />
<br />
===Tuesday (07/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of magnesium riboswitch]]'''<br />
<br />
----<br />
<br />
*NAD+ added to '''isothermal buffer'''*5 mix<br />
<br />
*Gel slices from yesterday (of vector fragment B) purified.<br />
<br />
*DNA added as follows:<br />
<br />
:*Without 8 codon substitution:<br />
<br />
::*Reaction 1: Tube 2 (07/08/12) (fragment B), Tube 1 (05/08/12) (fragment A), Tube 28 (29/08/12) (riboswitch DNA).<br />
<br />
::*Reaction 2: Tube 3 (07/08/12) (fragment B), Tube 2 (05/08/12) (fragment A), Tube 29 (29/08/12) (riboswitch DNA).<br />
<br />
:*With 8 codon substitution:<br />
<br />
::*Reaction 3: Tube 4 (07/08/12) (fragment B), Tube 1 (05/08/12) (fragment A), Tube 2 (18/07/12) (riboswitch DNA).<br />
<br />
===Wednesday (08/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/ElectricalTransformation|Electrical transformation of competent e.coli with Gibson products]]'''<br />
<br />
----<br />
<br />
*Gibson constructs from yesterday (fluorescent and magnesium riboswitch) transformed into e.coli produced yesterday.<br />
<br />
*Cells plated out onto 50 &mu;g/ml ampicillin plates. Put in incubator overnight.<br />
<br />
===Friday (10/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay|Characterization of fluoride riboswitch sensitivity with &beta;-galactosidase]]'''<br />
<br />
----<br />
<br />
*X-Gal made up to a concentration of 400 &mu;g/ml with water.<br />
<br />
*Fluoride of concentrations 0.5 - 30 mM mixed with bacterial culture (Yale construct containing) grown up overnight.<br />
<br />
===Saturday (11/08/12)===<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/RestrictionDigest|Restriction digest of Yale plasmid]]'''<br />
<br />
----<br />
<br />
*Cells from electroporation of e.coli with plasmid from Yale (08/08/12) [[Team:Cambridge/Protocols/MiniPrep|miniprepped]] to extract plasmid DNA.<br />
<br />
*DNA digested with XhoI and SalI, expected fragment sizes 5580, 3139, 1437<br />
<br />
*Gel run, results not shown as gel was very 'messy'. Gel had probably already begun to set when poured and so had many artefacts when imaged. As a result each lane required different brightness and contrast settings to visualise and so the full gel was not clearly visible on the printout. However, all of the bands could be identified on the screen and were exactly as expected and very clear and pure.<br />
<br />
*Bands in correct places, indicating that expected plasmid was present in the cells. This indicates that, although they work at a very low efficiency, our electro-competent cells still work. It may be valuable to use these when trying to grow up plasmids that we already have at high concentration. <br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of e.coli with Magnesium riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Gibson products from 07/08/12 transformed into chemically competent cells.<br />
<br />
*Transformants plated out on 100 &mu;g/ml ampicillin plates<br />
<br />
==Week 8==<br />
<br />
===Wednesday (15/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay| Characterization of fluoride riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Strain of ''bacillus'' lacking fluoride transporter system tested. Concentrations used:<br />
<br />
:*0mM - 0.5mM - 1mM - 2.5mM - 5mM - 10mM - 20mM - 30mM<br />
<br />
===Thursday (16/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay| Characterization of fluoride riboswitch construct]]'''<br />
<br />
----<br />
<br />
[[File:fluoridegradient.jpg|250px|right|thumb|The results of our fluoride assay.]]<br />
<br />
* Eppindorfs containing the ''bacillus'' with the fluoride riboswitch removed from incubator and imaged.<br />
<br />
* Now this definitely works, we will try quantifying this riboswitch with an ONPG assay and the plate reader.<br />
<br />
===Saturday (18/08/12)===<br />
<br />
'''Colonies picked in preparation for Miller assay'''<br />
<br />
----<br />
<br />
*2 ''E. coli'' colonies transformed with the purified plasmid were picked and inoculated in LB with 50&mu;g/ml Amp<br />
<br />
*2 colonies each from the 168 strain and crcB knockout ''B. subtilis'' containing the fluoride riboswitch were picked and inoculated in LB with 5&mu;g/ml Chlor<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Fluoride biobrick format]]'''<br />
<br />
----<br />
<br />
[[File:FluorideBB1gel.jpg|right|250px|thumb|Gels from PCR of Fluoride BB and PJS130 fragments. Top: Lanes 2-4: Gibson compatable Fluoride biobrick fragment. Lanes 5-7: Ligation compatable Fluoride biobrick fragment. Lane 8: PJS130 fragment A. Bottom: Lanes 1-2: PJS130 fragment A. Lanes 3-5: PJS 130 fragment B. Lane 6: Positive control. Lane 7: Negative control.]]<br />
<br />
*Two sets of primers used: one to allow insertion into backbone by ligation, and one to allow insertion by Gibson assembly.<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 100 seconds<br />
<br />
*Products run on gel. Fragments produced of correct size, however they overlapped with the primer dimer band due to the small size of the fragments.<br />
<br />
*DNA extracted and purified.<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg2+ riboswitch construct vector]]'''<br />
<br />
----<br />
<br />
*Separate reactions for<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 100 seconds <br />
<br />
*Products run on gel. No fragments produced. Positive control worked however, so master mix clearly works.<br />
<br />
*Given this PCR has worked in the past, will try to re-run with the same settings and hope for success in the future.<br />
<br />
===Sunday (19/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/MillerAssay|Miller Assay of Fluoride construct]]'''<br />
<br />
----<br />
<br />
* Colonies picked from overnight and Miller assay run as directed on protocols page<br />
<br />
* Lack of filters meant that only A450 data recorderd<br />
<br />
==Week 9==<br />
<br />
===Tuesday (21/08/12)===<br />
<br />
'''PCR for Mg Riboswitch'''<br />
<br />
----<br />
*[[Team:Cambridge/Protocols/PCRProtocol| PCRs]] were run for pJS130.1 split vector ('+8 codons')<br />
*[[Team:Cambridge/Protocols/PCRcolony| Colony PCR]] for endogenous ''Bacillus subtilis'' Mg Riboswitch ('+8 codons') was run<br />
*Gels were run for above reactions, only one band for half of the pJS130 vector was visible.<br />
<br />
==Week 10==<br />
<br />
==Week 11==<br />
<br />
==Week 12==<br />
<br />
==Week 13==<br />
<br />
==Week 14==<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Ribosense/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Ribosense/LabbookTeam:Cambridge/Ribosense/Labbook2012-10-27T03:21:17Z<p>Olijme: /* Week 8 */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Labbook");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= General Labbook =<br />
<br />
==Week 4 ==<br />
<br />
===Tuesday (17/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of MGRS vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 58 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 180secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain 168 used as template for this experiment.<br />
<br />
* Primers used:<br />
<br />
:* Forward: cggagggagacgattttgTGTTCCGTAATTGTGATGTAAG<br />
<br />
:* Reverse: acaccggcatactctgcgacGTCATAGGTCATGTTTTGAACC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Wednesday (18/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:Mg2+ Gel PCR 1.jpg|250px|right|thumb|Results of gel electrophoresis of PCR fragments from yesterday. 550bp fragments in lanes 2+3 were removed before the image was taken]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2 + 3: Riboswitch DNA from genome (replicates) - 550bp fragment expected.<br />
<br />
:*Lane 4 + 5: Vector DNA from pJS130 (replicates)- Chloramphenicol resistance marker - 9.0kbp fragment expected<br />
<br />
:*Lane 6: Postitive control - 1.9kbp fragment expected<br />
<br />
*Riboswitch DNA was successfully amplified. However, vector DNA was not. Given that the postive control was also successful, it seems likely that something went wrong with some stage before the PCR amplification. We will try to rectify the problem tomorrow.<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of riboswitch DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful riboswitch DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
===Thursday (19/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 55 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 240secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
*Settings changed - Annealing temperature and elongation time - attempting to debug PCR.<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:PCR Gel Mg2+ 2.jpg|right|250px|thumb|PCR products from today. Note the unusual band in the negative control and the vector lanes]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2, 3 + 4: Vector DNA from pJS130 (replicates) - 9.0kbp fragment expected<br />
<br />
:*Lane 5: Postitive control - 1.9kbp fragment expected<br />
<br />
:*Lane 6: Negative control - no fragments expected<br />
<br />
*Once more, the PCR appears to have failed. We will try to redesign the primers tomorrow to make them functional.<br />
<br />
==Week 5==<br />
<br />
===Thursday (26/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome and Lux genes from e.coli genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain pJS130 used as template for riboswitch, colony of previously transformed e.coli used as template for lux operon.<br />
<br />
:*M2+ RS<br />
<br />
::*Forward: cggagggagacgattttg|TGTTCCGTAATTGTGATGTAAG<br />
<br />
::*Reverse: tataacgttactggtttcat|CGGGACTCGTACCTCC<br />
<br />
:*Lux operon<br />
<br />
::*Forward: gctgtacaag|GGAGGAGGAGGAAGTGGAGGAGGAGGAAGT|atgaagtttggaaatatttgtttttc<br />
<br />
::*Reverse: cctcgcccttgctcaccat|ACTCTATTCCTTTTTGGTGATTC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Friday (27/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
{|cellspacing="20"<br />
|[[File:CAM_120727_1_edited.jpg|200px|left|thumb|Vector amplification gel. Lanes 2-4 Lux containing vector. Lanes 5-7 Fluorescent construct vector. No products from this gel were amplified.]]<br />
|[[File:CAM_120727_2_edited.jpg|200px|left|thumb|Various. Lanes 3-5 mOrange amplification. Lanes 6-8 eCFP (E0020) amplification. mOrange amplification did not work.]]<br />
|[[File:CAM_120727_3_edited.jpg|200px|left|thumb|Small products for fluorescent construct. Lanes 1-3 Terminator (B0015). Lanes 4-6 Promotor pVEG + SpoVG (K143053).]]<br />
|-<br />
|[[File:CAM_120727_4_edited.jpg|200px|left|thumb|Various. Lanes 2-4 eYFP (E0030) amplification. Lanes 5-7 Mg2+ vector +8 codons. Lane 8 Mg2+ vector -8 codons. Lane 8 amplification did not work.]]<br />
|[[File:CAM_120727_5_edited.jpg|200px|left|thumb|Mg2+ riboswitch gel. Lanes 6+7 positive and negative controls respectively for entire run. Lanes 3-5 genomic riboswitch amplification -8 codons. Lanes 2+3 vector -8 codons.]]<br />
|}<br />
<br />
*PCR fragments for Mg2+ riboswitch, luxA/mOrange fusion and fluorescent construct from yesterday separated on gels. 90mins at 100V.<br />
<br />
*Mostly successful, but will need to repeat four runs: Three vectors (fluorescent, fusion (lux) and Mg2+ riboswitch (-8 codons) and mOrange gene.<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of successfully amplified DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful CFP, YFP, B0015, Pveg + SpoVG (K143053), riboswitch and vector DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
==Week 6==<br />
<br />
===Monday (30/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vectors and mOrange]]'''<br />
<br />
----<br />
<br />
[[File:mOrangegel.jpg|250px|thumb|mOrange PCR run at multiple temperatures, every two lanes increacing the temperature of the annealing step by 2 &deg;C. No lanes worked.]]<br />
<br />
[[File:vectorgel1.jpg|250px|thumb|Top: Fusion, lux containing vector gel. Lanes 2-4, Vector DNA. Lane 5, +ve control. Lane 6, -ve control. Bottom: Vector gel. Lanes 1-3, Fluorescent construct vector DNA. Lanes 4-6, Riboswitch construct vector DNA.]]<br />
<br />
*Not all products were obtained during Friday's PCR. Most of these missing products were large vector backbones. They are being run again, with a much longer extension time of 300s. If that fails, primers will be ordered to split the vectors into manageable chunks, and the PCR reattempted when they arrive.<br />
<br />
*PCR cycle x35: <br />
<br />
:* 15s Denaturing at 95 C<br />
:* 45s Annealing at 60 C<br />
:* 300s Extension at 72 C<br />
<br />
*Remaining stray product had a slightly tricky secondary structure at the 3' end. It will be run at a series of annealing temperatures in a PCR machine capable of a temperature gradient.<br />
<br />
*mOrange PCR run at many different temperatures, from 62 &deg;C to 76 &deg;C. However this doesn't seem to solve our problem (refer to Gel photos). It seems likely that it is a primer design problem.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Construction of riboswitch plasmid with Gibson Assembly]]'''<br />
<br />
----<br />
<br />
*DNA from lanes 27+28, 27+29, 27+30 from gels run on Friday fused together with Gibson assembly to produce riboswitch construct. This does not have replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
*DNA from lanes 22,23 and 24 fused with riboswitch DNA produced two weeks ago to produce riboswitch construct. This has replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
===Tuesday (01/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of TOP10 E.coli with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into TOP10 e.coli cells and transformants plated out on 100&mu;g/ml ampicillin plates.<br />
<br />
===Wednesday (01/08/12)===<br />
<br />
'''Mg2+ Riboswitch'''<br />
<br />
----<br />
<br />
*Successful colonies produced from transformations two days ago streaked out onto chloramphenicol (5 &mu;g/ml) containing plates.<br />
<br />
*Colonies also grown up in 10ml of medium A for use with plate reader later.<br />
<br />
===Friday (03/08/12)<br />
<br />
''' [[Team:Cambridge/Protocols/PCRProtocol|PCR of split Mg2+ vector]]'''<br />
<br />
----<br />
<br />
[[File:split Mg2+ 1.jpg|left|250px|thumb|results of split magnesium vector PCR. None of the products worked]]<br />
<br />
*PCR of magnesium riboswitch vector repeated with primers to split plasmid.<br />
<br />
*Lanes 2 + 3: Fragment A (center - cut site (promotor side))<br />
<br />
*Lanes 4 + 5: Fragment B (without 8 codon substitution) (cut site (lac I side) - center)<br />
<br />
*Lanes 6 + 7: Fragment B (with 8 codon substitution) (cut stie (lac I side) - center)<br />
<br />
*Gels run, found PCR was unsuccessful.<br />
<br />
===Sunday (05/08/12)===<br />
<br />
'''Ribosense: [[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg Riboswitch vector fragments]]'''<br />
<br />
----<br />
<br />
*2nd attempt since the PCR on Friday did not work, possibly due to mastermix problems<br />
<br />
*PCR Programme:<br />
<br />
*Results: Fragment A was successfully PCR-ed (lanes 3-4); Fragment B did not come out, with or without the 8 codons (lanes 5-6 (-8); lanes 7-8 (+8))<br />
<br />
==Week 7==<br />
<br />
===Monday (06/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Magnesium riboswitch vector fragment B and Magnesium promoter]]'''<br />
<br />
----<br />
<br />
[[File:MgRS vector frag. B.jpg|right|250px|thumb|Riboswitch and promoter gel. Lanes 2+3: Fragment B without 8 codon substitution, lanes 4+5: Fragment B with 8 codon substitution, lanes 6+7: magnesium sensitive promoter, lane 8: +ve control]]<br />
<br />
*Normal PCR settings used, annealing temperature 57 &deg;C, elongation step 90s long.<br />
<br />
*Lane 5 accidentally loaded with a DNA ladder instead of loading dye.<br />
<br />
*Expected fragment sizes:<br />
<br />
:*Lane 2-5: 3kbp<br />
<br />
:*Lane 6-7: 300bp<br />
<br />
*After electrophoresis, found vector products had, for the most part, worked. Promoter elements were not amplified - no band of the expected size was observed.<br />
<br />
*Positive control also failed, although this has ceased to work for several days, potentially due to DNA degradation.<br />
<br />
===Tuesday (07/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of magnesium riboswitch]]'''<br />
<br />
----<br />
<br />
*NAD+ added to '''isothermal buffer'''*5 mix<br />
<br />
*Gel slices from yesterday (of vector fragment B) purified.<br />
<br />
*DNA added as follows:<br />
<br />
:*Without 8 codon substitution:<br />
<br />
::*Reaction 1: Tube 2 (07/08/12) (fragment B), Tube 1 (05/08/12) (fragment A), Tube 28 (29/08/12) (riboswitch DNA).<br />
<br />
::*Reaction 2: Tube 3 (07/08/12) (fragment B), Tube 2 (05/08/12) (fragment A), Tube 29 (29/08/12) (riboswitch DNA).<br />
<br />
:*With 8 codon substitution:<br />
<br />
::*Reaction 3: Tube 4 (07/08/12) (fragment B), Tube 1 (05/08/12) (fragment A), Tube 2 (18/07/12) (riboswitch DNA).<br />
<br />
===Wednesday (08/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/ElectricalTransformation|Electrical transformation of competent e.coli with Gibson products]]'''<br />
<br />
----<br />
<br />
*Gibson constructs from yesterday (fluorescent and magnesium riboswitch) transformed into e.coli produced yesterday.<br />
<br />
*Cells plated out onto 50 &mu;g/ml ampicillin plates. Put in incubator overnight.<br />
<br />
===Friday (10/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay|Characterization of fluoride riboswitch sensitivity with &beta;-galactosidase]]'''<br />
<br />
----<br />
<br />
*X-Gal made up to a concentration of 400 &mu;g/ml with water.<br />
<br />
*Fluoride of concentrations 0.5 - 30 mM mixed with bacterial culture (Yale construct containing) grown up overnight.<br />
<br />
===Saturday (11/08/12)===<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/RestrictionDigest|Restriction digest of Yale plasmid]]'''<br />
<br />
----<br />
<br />
*Cells from electroporation of e.coli with plasmid from Yale (08/08/12) [[Team:Cambridge/Protocols/MiniPrep|miniprepped]] to extract plasmid DNA.<br />
<br />
*DNA digested with XhoI and SalI, expected fragment sizes 5580, 3139, 1437<br />
<br />
*Gel run, results not shown as gel was very 'messy'. Gel had probably already begun to set when poured and so had many artefacts when imaged. As a result each lane required different brightness and contrast settings to visualise and so the full gel was not clearly visible on the printout. However, all of the bands could be identified on the screen and were exactly as expected and very clear and pure.<br />
<br />
*Bands in correct places, indicating that expected plasmid was present in the cells. This indicates that, although they work at a very low efficiency, our electro-competent cells still work. It may be valuable to use these when trying to grow up plasmids that we already have at high concentration. <br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of e.coli with Magnesium riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Gibson products from 07/08/12 transformed into chemically competent cells.<br />
<br />
*Transformants plated out on 100 &mu;g/ml ampicillin plates<br />
<br />
==Week 8==<br />
<br />
===Wednesday (15/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay| Characterization of fluoride riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Strain of ''bacillus'' lacking fluoride transporter system tested. Concentrations used:<br />
<br />
:*0mM - 0.5mM - 1mM - 2.5mM - 5mM - 10mM - 20mM - 30mM<br />
<br />
===Thursday (16/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay| Characterization of fluoride riboswitch construct]]'''<br />
<br />
----<br />
<br />
[[File:fluoridegradient.jpg|250px|right|thumb|The results of our fluoride assay.]]<br />
<br />
* Eppindorfs containing the ''bacillus'' with the fluoride riboswitch removed from incubator and imaged.<br />
<br />
* Now this definitely works, we will try quantifying this riboswitch with an ONPG assay and the plate reader.<br />
<br />
===Saturday (18/08/12)===<br />
<br />
'''Colonies picked in preparation for Miller assay'''<br />
<br />
----<br />
<br />
*2 ''E. coli'' colonies transformed with the purified plasmid were picked and inoculated in LB with 50&mu;g/ml Amp<br />
<br />
*2 colonies each from the 168 strain and crcB knockout ''B. subtilis'' containing the fluoride riboswitch were picked and inoculated in LB with 5&mu;g/ml Chlor<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Fluoride biobrick format]]'''<br />
<br />
----<br />
<br />
[[File:FluorideBB1gel.jpg|right|250px|thumb|Gels from PCR of Fluoride BB and PJS130 fragments. Top: Lanes 2-4: Gibson compatable Fluoride biobrick fragment. Lanes 5-7: Ligation compatable Fluoride biobrick fragment. Lane 8: PJS130 fragment A. Bottom: Lanes 1-2: PJS130 fragment A. Lanes 3-5: PJS 130 fragment B. Lane 6: Positive control. Lane 7: Negative control.]]<br />
<br />
*Two sets of primers used: one to allow insertion into backbone by ligation, and one to allow insertion by Gibson assembly.<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 100 seconds<br />
<br />
*Products run on gel. Fragments produced of correct size, however they overlapped with the primer dimer band due to the small size of the fragments.<br />
<br />
*DNA extracted and purified.<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg2+ riboswitch construct vector]]'''<br />
<br />
----<br />
<br />
*Separate reactions for<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 100 seconds <br />
<br />
*Products run on gel. No fragments produced. Positive control worked however, so master mix clearly works.<br />
<br />
*Given this PCR has worked in the past, will try to re-run with the same settings and hope for success in the future.<br />
<br />
===Sunday (19/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/MillerAssay|Miller Assay of Fluoride construct]]'''<br />
<br />
----<br />
<br />
* Colonies picked from overnight and Miller assay run as directed on protocols page<br />
<br />
* Lack of filters meant that only A450 data recorderd<br />
<br />
==Week 9==<br />
<br />
==Week 10==<br />
<br />
==Week 11==<br />
<br />
==Week 12==<br />
<br />
==Week 13==<br />
<br />
==Week 14==<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Ribosense/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Ribosense/LabbookTeam:Cambridge/Ribosense/Labbook2012-10-27T03:20:08Z<p>Olijme: /* Week 8 */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Labbook");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= General Labbook =<br />
<br />
==Week 4 ==<br />
<br />
===Tuesday (17/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of MGRS vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 58 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 180secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain 168 used as template for this experiment.<br />
<br />
* Primers used:<br />
<br />
:* Forward: cggagggagacgattttgTGTTCCGTAATTGTGATGTAAG<br />
<br />
:* Reverse: acaccggcatactctgcgacGTCATAGGTCATGTTTTGAACC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Wednesday (18/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:Mg2+ Gel PCR 1.jpg|250px|right|thumb|Results of gel electrophoresis of PCR fragments from yesterday. 550bp fragments in lanes 2+3 were removed before the image was taken]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2 + 3: Riboswitch DNA from genome (replicates) - 550bp fragment expected.<br />
<br />
:*Lane 4 + 5: Vector DNA from pJS130 (replicates)- Chloramphenicol resistance marker - 9.0kbp fragment expected<br />
<br />
:*Lane 6: Postitive control - 1.9kbp fragment expected<br />
<br />
*Riboswitch DNA was successfully amplified. However, vector DNA was not. Given that the postive control was also successful, it seems likely that something went wrong with some stage before the PCR amplification. We will try to rectify the problem tomorrow.<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of riboswitch DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful riboswitch DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
===Thursday (19/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 55 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 240secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
*Settings changed - Annealing temperature and elongation time - attempting to debug PCR.<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:PCR Gel Mg2+ 2.jpg|right|250px|thumb|PCR products from today. Note the unusual band in the negative control and the vector lanes]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2, 3 + 4: Vector DNA from pJS130 (replicates) - 9.0kbp fragment expected<br />
<br />
:*Lane 5: Postitive control - 1.9kbp fragment expected<br />
<br />
:*Lane 6: Negative control - no fragments expected<br />
<br />
*Once more, the PCR appears to have failed. We will try to redesign the primers tomorrow to make them functional.<br />
<br />
==Week 5==<br />
<br />
===Thursday (26/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome and Lux genes from e.coli genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain pJS130 used as template for riboswitch, colony of previously transformed e.coli used as template for lux operon.<br />
<br />
:*M2+ RS<br />
<br />
::*Forward: cggagggagacgattttg|TGTTCCGTAATTGTGATGTAAG<br />
<br />
::*Reverse: tataacgttactggtttcat|CGGGACTCGTACCTCC<br />
<br />
:*Lux operon<br />
<br />
::*Forward: gctgtacaag|GGAGGAGGAGGAAGTGGAGGAGGAGGAAGT|atgaagtttggaaatatttgtttttc<br />
<br />
::*Reverse: cctcgcccttgctcaccat|ACTCTATTCCTTTTTGGTGATTC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Friday (27/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
{|cellspacing="20"<br />
|[[File:CAM_120727_1_edited.jpg|200px|left|thumb|Vector amplification gel. Lanes 2-4 Lux containing vector. Lanes 5-7 Fluorescent construct vector. No products from this gel were amplified.]]<br />
|[[File:CAM_120727_2_edited.jpg|200px|left|thumb|Various. Lanes 3-5 mOrange amplification. Lanes 6-8 eCFP (E0020) amplification. mOrange amplification did not work.]]<br />
|[[File:CAM_120727_3_edited.jpg|200px|left|thumb|Small products for fluorescent construct. Lanes 1-3 Terminator (B0015). Lanes 4-6 Promotor pVEG + SpoVG (K143053).]]<br />
|-<br />
|[[File:CAM_120727_4_edited.jpg|200px|left|thumb|Various. Lanes 2-4 eYFP (E0030) amplification. Lanes 5-7 Mg2+ vector +8 codons. Lane 8 Mg2+ vector -8 codons. Lane 8 amplification did not work.]]<br />
|[[File:CAM_120727_5_edited.jpg|200px|left|thumb|Mg2+ riboswitch gel. Lanes 6+7 positive and negative controls respectively for entire run. Lanes 3-5 genomic riboswitch amplification -8 codons. Lanes 2+3 vector -8 codons.]]<br />
|}<br />
<br />
*PCR fragments for Mg2+ riboswitch, luxA/mOrange fusion and fluorescent construct from yesterday separated on gels. 90mins at 100V.<br />
<br />
*Mostly successful, but will need to repeat four runs: Three vectors (fluorescent, fusion (lux) and Mg2+ riboswitch (-8 codons) and mOrange gene.<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of successfully amplified DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful CFP, YFP, B0015, Pveg + SpoVG (K143053), riboswitch and vector DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
==Week 6==<br />
<br />
===Monday (30/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vectors and mOrange]]'''<br />
<br />
----<br />
<br />
[[File:mOrangegel.jpg|250px|thumb|mOrange PCR run at multiple temperatures, every two lanes increacing the temperature of the annealing step by 2 &deg;C. No lanes worked.]]<br />
<br />
[[File:vectorgel1.jpg|250px|thumb|Top: Fusion, lux containing vector gel. Lanes 2-4, Vector DNA. Lane 5, +ve control. Lane 6, -ve control. Bottom: Vector gel. Lanes 1-3, Fluorescent construct vector DNA. Lanes 4-6, Riboswitch construct vector DNA.]]<br />
<br />
*Not all products were obtained during Friday's PCR. Most of these missing products were large vector backbones. They are being run again, with a much longer extension time of 300s. If that fails, primers will be ordered to split the vectors into manageable chunks, and the PCR reattempted when they arrive.<br />
<br />
*PCR cycle x35: <br />
<br />
:* 15s Denaturing at 95 C<br />
:* 45s Annealing at 60 C<br />
:* 300s Extension at 72 C<br />
<br />
*Remaining stray product had a slightly tricky secondary structure at the 3' end. It will be run at a series of annealing temperatures in a PCR machine capable of a temperature gradient.<br />
<br />
*mOrange PCR run at many different temperatures, from 62 &deg;C to 76 &deg;C. However this doesn't seem to solve our problem (refer to Gel photos). It seems likely that it is a primer design problem.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Construction of riboswitch plasmid with Gibson Assembly]]'''<br />
<br />
----<br />
<br />
*DNA from lanes 27+28, 27+29, 27+30 from gels run on Friday fused together with Gibson assembly to produce riboswitch construct. This does not have replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
*DNA from lanes 22,23 and 24 fused with riboswitch DNA produced two weeks ago to produce riboswitch construct. This has replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
===Tuesday (01/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of TOP10 E.coli with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into TOP10 e.coli cells and transformants plated out on 100&mu;g/ml ampicillin plates.<br />
<br />
===Wednesday (01/08/12)===<br />
<br />
'''Mg2+ Riboswitch'''<br />
<br />
----<br />
<br />
*Successful colonies produced from transformations two days ago streaked out onto chloramphenicol (5 &mu;g/ml) containing plates.<br />
<br />
*Colonies also grown up in 10ml of medium A for use with plate reader later.<br />
<br />
===Friday (03/08/12)<br />
<br />
''' [[Team:Cambridge/Protocols/PCRProtocol|PCR of split Mg2+ vector]]'''<br />
<br />
----<br />
<br />
[[File:split Mg2+ 1.jpg|left|250px|thumb|results of split magnesium vector PCR. None of the products worked]]<br />
<br />
*PCR of magnesium riboswitch vector repeated with primers to split plasmid.<br />
<br />
*Lanes 2 + 3: Fragment A (center - cut site (promotor side))<br />
<br />
*Lanes 4 + 5: Fragment B (without 8 codon substitution) (cut site (lac I side) - center)<br />
<br />
*Lanes 6 + 7: Fragment B (with 8 codon substitution) (cut stie (lac I side) - center)<br />
<br />
*Gels run, found PCR was unsuccessful.<br />
<br />
===Sunday (05/08/12)===<br />
<br />
'''Ribosense: [[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg Riboswitch vector fragments]]'''<br />
<br />
----<br />
<br />
*2nd attempt since the PCR on Friday did not work, possibly due to mastermix problems<br />
<br />
*PCR Programme:<br />
<br />
*Results: Fragment A was successfully PCR-ed (lanes 3-4); Fragment B did not come out, with or without the 8 codons (lanes 5-6 (-8); lanes 7-8 (+8))<br />
<br />
==Week 7==<br />
<br />
===Monday (06/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Magnesium riboswitch vector fragment B and Magnesium promoter]]'''<br />
<br />
----<br />
<br />
[[File:MgRS vector frag. B.jpg|right|250px|thumb|Riboswitch and promoter gel. Lanes 2+3: Fragment B without 8 codon substitution, lanes 4+5: Fragment B with 8 codon substitution, lanes 6+7: magnesium sensitive promoter, lane 8: +ve control]]<br />
<br />
*Normal PCR settings used, annealing temperature 57 &deg;C, elongation step 90s long.<br />
<br />
*Lane 5 accidentally loaded with a DNA ladder instead of loading dye.<br />
<br />
*Expected fragment sizes:<br />
<br />
:*Lane 2-5: 3kbp<br />
<br />
:*Lane 6-7: 300bp<br />
<br />
*After electrophoresis, found vector products had, for the most part, worked. Promoter elements were not amplified - no band of the expected size was observed.<br />
<br />
*Positive control also failed, although this has ceased to work for several days, potentially due to DNA degradation.<br />
<br />
===Tuesday (07/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of magnesium riboswitch]]'''<br />
<br />
----<br />
<br />
*NAD+ added to '''isothermal buffer'''*5 mix<br />
<br />
*Gel slices from yesterday (of vector fragment B) purified.<br />
<br />
*DNA added as follows:<br />
<br />
:*Without 8 codon substitution:<br />
<br />
::*Reaction 1: Tube 2 (07/08/12) (fragment B), Tube 1 (05/08/12) (fragment A), Tube 28 (29/08/12) (riboswitch DNA).<br />
<br />
::*Reaction 2: Tube 3 (07/08/12) (fragment B), Tube 2 (05/08/12) (fragment A), Tube 29 (29/08/12) (riboswitch DNA).<br />
<br />
:*With 8 codon substitution:<br />
<br />
::*Reaction 3: Tube 4 (07/08/12) (fragment B), Tube 1 (05/08/12) (fragment A), Tube 2 (18/07/12) (riboswitch DNA).<br />
<br />
===Wednesday (08/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/ElectricalTransformation|Electrical transformation of competent e.coli with Gibson products]]'''<br />
<br />
----<br />
<br />
*Gibson constructs from yesterday (fluorescent and magnesium riboswitch) transformed into e.coli produced yesterday.<br />
<br />
*Cells plated out onto 50 &mu;g/ml ampicillin plates. Put in incubator overnight.<br />
<br />
===Friday (10/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay|Characterization of fluoride riboswitch sensitivity with &beta;-galactosidase]]'''<br />
<br />
----<br />
<br />
*X-Gal made up to a concentration of 400 &mu;g/ml with water.<br />
<br />
*Fluoride of concentrations 0.5 - 30 mM mixed with bacterial culture (Yale construct containing) grown up overnight.<br />
<br />
===Saturday (11/08/12)===<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/RestrictionDigest|Restriction digest of Yale plasmid]]'''<br />
<br />
----<br />
<br />
*Cells from electroporation of e.coli with plasmid from Yale (08/08/12) [[Team:Cambridge/Protocols/MiniPrep|miniprepped]] to extract plasmid DNA.<br />
<br />
*DNA digested with XhoI and SalI, expected fragment sizes 5580, 3139, 1437<br />
<br />
*Gel run, results not shown as gel was very 'messy'. Gel had probably already begun to set when poured and so had many artefacts when imaged. As a result each lane required different brightness and contrast settings to visualise and so the full gel was not clearly visible on the printout. However, all of the bands could be identified on the screen and were exactly as expected and very clear and pure.<br />
<br />
*Bands in correct places, indicating that expected plasmid was present in the cells. This indicates that, although they work at a very low efficiency, our electro-competent cells still work. It may be valuable to use these when trying to grow up plasmids that we already have at high concentration. <br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of e.coli with Magnesium riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Gibson products from 07/08/12 transformed into chemically competent cells.<br />
<br />
*Transformants plated out on 100 &mu;g/ml ampicillin plates<br />
<br />
==Week 8==<br />
<br />
===Wednesday (15/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay| Characterization of fluoride riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Strain of ''bacillus'' lacking fluoride transporter system tested. Concentrations used:<br />
<br />
:*0mM - 0.5mM - 1mM - 2.5mM - 5mM - 10mM - 20mM - 30mM<br />
<br />
===Thursday (16/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay| Characterization of fluoride riboswitch construct]]'''<br />
<br />
----<br />
<br />
[[File:fluoridegradient.jpg|250px|right|thumb|The results of our fluoride assay.]]<br />
<br />
* Eppindorfs containing the ''bacillus'' with the fluoride riboswitch removed from incubator and imaged.<br />
<br />
* Now this definitely works, we will try quantifying this riboswitch with an ONPG assay and the plate reader.<br />
<br />
===Saturday (18/08/12)===<br />
<br />
'''Colonies picked in preparation for Miller assay'''<br />
<br />
----<br />
<br />
*2 ''E. coli'' colonies transformed with the purified plasmid were picked and inoculated in LB with 50&mu;g/ml Amp<br />
<br />
*2 colonies each from the 168 strain and crcB knockout ''B. subtilis'' containing the fluoride riboswitch were picked and inoculated in LB with 5&mu;g/ml Chlor<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Fluoride biobrick format]]'''<br />
<br />
----<br />
<br />
[[File:FluorideBB1gel.jpg|right|250px|thumb|Gels from PCR of Fluoride BB and PJS130 fragments. Top: Lanes 2-4: Gibson compatable Fluoride biobrick fragment. Lanes 5-7: Ligation compatable Fluoride biobrick fragment. Lane 8: PJS130 fragment A. Bottom: Lanes 1-2: PJS130 fragment A. Lanes 3-5: PJS 130 fragment B. Lane 6: Positive control. Lane 7: Negative control.]]<br />
<br />
*Two sets of primers used: one to allow insertion into backbone by ligation, and one to allow insertion by Gibson assembly.<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 100 seconds<br />
<br />
*Products run on gel. Fragments produced of correct size, however they overlapped with the primer dimer band due to the small size of the fragments.<br />
<br />
*DNA extracted and purified.<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg2+ riboswitch construct vector]]'''<br />
<br />
----<br />
<br />
*Separate reactions for<br />
<br />
*Cycle settings:<br />
<br />
:*Melting - 98 &deg;C - 10 seconds<br />
<br />
:*Annealing - 58 &deg;C - 30 seconds<br />
<br />
:*Elongation - 72 &deg;C - 100 seconds <br />
<br />
*Products run on gel. No fragments produced. Positive control worked however, so master mix clearly works.<br />
<br />
*Given this PCR has worked in the past, will try to re-run with the same settings and hope for success in the future.<br />
<br />
==Week 9==<br />
<br />
==Week 10==<br />
<br />
==Week 11==<br />
<br />
==Week 12==<br />
<br />
==Week 13==<br />
<br />
==Week 14==<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Ribosense/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Ribosense/LabbookTeam:Cambridge/Ribosense/Labbook2012-10-27T03:16:41Z<p>Olijme: /* Week 7 */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Labbook");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= General Labbook =<br />
<br />
==Week 4 ==<br />
<br />
===Tuesday (17/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of MGRS vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 58 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 180secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain 168 used as template for this experiment.<br />
<br />
* Primers used:<br />
<br />
:* Forward: cggagggagacgattttgTGTTCCGTAATTGTGATGTAAG<br />
<br />
:* Reverse: acaccggcatactctgcgacGTCATAGGTCATGTTTTGAACC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Wednesday (18/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:Mg2+ Gel PCR 1.jpg|250px|right|thumb|Results of gel electrophoresis of PCR fragments from yesterday. 550bp fragments in lanes 2+3 were removed before the image was taken]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2 + 3: Riboswitch DNA from genome (replicates) - 550bp fragment expected.<br />
<br />
:*Lane 4 + 5: Vector DNA from pJS130 (replicates)- Chloramphenicol resistance marker - 9.0kbp fragment expected<br />
<br />
:*Lane 6: Postitive control - 1.9kbp fragment expected<br />
<br />
*Riboswitch DNA was successfully amplified. However, vector DNA was not. Given that the postive control was also successful, it seems likely that something went wrong with some stage before the PCR amplification. We will try to rectify the problem tomorrow.<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of riboswitch DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful riboswitch DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
===Thursday (19/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 55 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 240secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
*Settings changed - Annealing temperature and elongation time - attempting to debug PCR.<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:PCR Gel Mg2+ 2.jpg|right|250px|thumb|PCR products from today. Note the unusual band in the negative control and the vector lanes]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2, 3 + 4: Vector DNA from pJS130 (replicates) - 9.0kbp fragment expected<br />
<br />
:*Lane 5: Postitive control - 1.9kbp fragment expected<br />
<br />
:*Lane 6: Negative control - no fragments expected<br />
<br />
*Once more, the PCR appears to have failed. We will try to redesign the primers tomorrow to make them functional.<br />
<br />
==Week 5==<br />
<br />
===Thursday (26/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome and Lux genes from e.coli genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain pJS130 used as template for riboswitch, colony of previously transformed e.coli used as template for lux operon.<br />
<br />
:*M2+ RS<br />
<br />
::*Forward: cggagggagacgattttg|TGTTCCGTAATTGTGATGTAAG<br />
<br />
::*Reverse: tataacgttactggtttcat|CGGGACTCGTACCTCC<br />
<br />
:*Lux operon<br />
<br />
::*Forward: gctgtacaag|GGAGGAGGAGGAAGTGGAGGAGGAGGAAGT|atgaagtttggaaatatttgtttttc<br />
<br />
::*Reverse: cctcgcccttgctcaccat|ACTCTATTCCTTTTTGGTGATTC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Friday (27/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
{|cellspacing="20"<br />
|[[File:CAM_120727_1_edited.jpg|200px|left|thumb|Vector amplification gel. Lanes 2-4 Lux containing vector. Lanes 5-7 Fluorescent construct vector. No products from this gel were amplified.]]<br />
|[[File:CAM_120727_2_edited.jpg|200px|left|thumb|Various. Lanes 3-5 mOrange amplification. Lanes 6-8 eCFP (E0020) amplification. mOrange amplification did not work.]]<br />
|[[File:CAM_120727_3_edited.jpg|200px|left|thumb|Small products for fluorescent construct. Lanes 1-3 Terminator (B0015). Lanes 4-6 Promotor pVEG + SpoVG (K143053).]]<br />
|-<br />
|[[File:CAM_120727_4_edited.jpg|200px|left|thumb|Various. Lanes 2-4 eYFP (E0030) amplification. Lanes 5-7 Mg2+ vector +8 codons. Lane 8 Mg2+ vector -8 codons. Lane 8 amplification did not work.]]<br />
|[[File:CAM_120727_5_edited.jpg|200px|left|thumb|Mg2+ riboswitch gel. Lanes 6+7 positive and negative controls respectively for entire run. Lanes 3-5 genomic riboswitch amplification -8 codons. Lanes 2+3 vector -8 codons.]]<br />
|}<br />
<br />
*PCR fragments for Mg2+ riboswitch, luxA/mOrange fusion and fluorescent construct from yesterday separated on gels. 90mins at 100V.<br />
<br />
*Mostly successful, but will need to repeat four runs: Three vectors (fluorescent, fusion (lux) and Mg2+ riboswitch (-8 codons) and mOrange gene.<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of successfully amplified DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful CFP, YFP, B0015, Pveg + SpoVG (K143053), riboswitch and vector DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
==Week 6==<br />
<br />
===Monday (30/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vectors and mOrange]]'''<br />
<br />
----<br />
<br />
[[File:mOrangegel.jpg|250px|thumb|mOrange PCR run at multiple temperatures, every two lanes increacing the temperature of the annealing step by 2 &deg;C. No lanes worked.]]<br />
<br />
[[File:vectorgel1.jpg|250px|thumb|Top: Fusion, lux containing vector gel. Lanes 2-4, Vector DNA. Lane 5, +ve control. Lane 6, -ve control. Bottom: Vector gel. Lanes 1-3, Fluorescent construct vector DNA. Lanes 4-6, Riboswitch construct vector DNA.]]<br />
<br />
*Not all products were obtained during Friday's PCR. Most of these missing products were large vector backbones. They are being run again, with a much longer extension time of 300s. If that fails, primers will be ordered to split the vectors into manageable chunks, and the PCR reattempted when they arrive.<br />
<br />
*PCR cycle x35: <br />
<br />
:* 15s Denaturing at 95 C<br />
:* 45s Annealing at 60 C<br />
:* 300s Extension at 72 C<br />
<br />
*Remaining stray product had a slightly tricky secondary structure at the 3' end. It will be run at a series of annealing temperatures in a PCR machine capable of a temperature gradient.<br />
<br />
*mOrange PCR run at many different temperatures, from 62 &deg;C to 76 &deg;C. However this doesn't seem to solve our problem (refer to Gel photos). It seems likely that it is a primer design problem.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Construction of riboswitch plasmid with Gibson Assembly]]'''<br />
<br />
----<br />
<br />
*DNA from lanes 27+28, 27+29, 27+30 from gels run on Friday fused together with Gibson assembly to produce riboswitch construct. This does not have replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
*DNA from lanes 22,23 and 24 fused with riboswitch DNA produced two weeks ago to produce riboswitch construct. This has replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
===Tuesday (01/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of TOP10 E.coli with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into TOP10 e.coli cells and transformants plated out on 100&mu;g/ml ampicillin plates.<br />
<br />
===Wednesday (01/08/12)===<br />
<br />
'''Mg2+ Riboswitch'''<br />
<br />
----<br />
<br />
*Successful colonies produced from transformations two days ago streaked out onto chloramphenicol (5 &mu;g/ml) containing plates.<br />
<br />
*Colonies also grown up in 10ml of medium A for use with plate reader later.<br />
<br />
===Friday (03/08/12)<br />
<br />
''' [[Team:Cambridge/Protocols/PCRProtocol|PCR of split Mg2+ vector]]'''<br />
<br />
----<br />
<br />
[[File:split Mg2+ 1.jpg|left|250px|thumb|results of split magnesium vector PCR. None of the products worked]]<br />
<br />
*PCR of magnesium riboswitch vector repeated with primers to split plasmid.<br />
<br />
*Lanes 2 + 3: Fragment A (center - cut site (promotor side))<br />
<br />
*Lanes 4 + 5: Fragment B (without 8 codon substitution) (cut site (lac I side) - center)<br />
<br />
*Lanes 6 + 7: Fragment B (with 8 codon substitution) (cut stie (lac I side) - center)<br />
<br />
*Gels run, found PCR was unsuccessful.<br />
<br />
===Sunday (05/08/12)===<br />
<br />
'''Ribosense: [[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg Riboswitch vector fragments]]'''<br />
<br />
----<br />
<br />
*2nd attempt since the PCR on Friday did not work, possibly due to mastermix problems<br />
<br />
*PCR Programme:<br />
<br />
*Results: Fragment A was successfully PCR-ed (lanes 3-4); Fragment B did not come out, with or without the 8 codons (lanes 5-6 (-8); lanes 7-8 (+8))<br />
<br />
==Week 7==<br />
<br />
===Monday (06/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Magnesium riboswitch vector fragment B and Magnesium promoter]]'''<br />
<br />
----<br />
<br />
[[File:MgRS vector frag. B.jpg|right|250px|thumb|Riboswitch and promoter gel. Lanes 2+3: Fragment B without 8 codon substitution, lanes 4+5: Fragment B with 8 codon substitution, lanes 6+7: magnesium sensitive promoter, lane 8: +ve control]]<br />
<br />
*Normal PCR settings used, annealing temperature 57 &deg;C, elongation step 90s long.<br />
<br />
*Lane 5 accidentally loaded with a DNA ladder instead of loading dye.<br />
<br />
*Expected fragment sizes:<br />
<br />
:*Lane 2-5: 3kbp<br />
<br />
:*Lane 6-7: 300bp<br />
<br />
*After electrophoresis, found vector products had, for the most part, worked. Promoter elements were not amplified - no band of the expected size was observed.<br />
<br />
*Positive control also failed, although this has ceased to work for several days, potentially due to DNA degradation.<br />
<br />
===Tuesday (07/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of magnesium riboswitch]]'''<br />
<br />
----<br />
<br />
*NAD+ added to '''isothermal buffer'''*5 mix<br />
<br />
*Gel slices from yesterday (of vector fragment B) purified.<br />
<br />
*DNA added as follows:<br />
<br />
:*Without 8 codon substitution:<br />
<br />
::*Reaction 1: Tube 2 (07/08/12) (fragment B), Tube 1 (05/08/12) (fragment A), Tube 28 (29/08/12) (riboswitch DNA).<br />
<br />
::*Reaction 2: Tube 3 (07/08/12) (fragment B), Tube 2 (05/08/12) (fragment A), Tube 29 (29/08/12) (riboswitch DNA).<br />
<br />
:*With 8 codon substitution:<br />
<br />
::*Reaction 3: Tube 4 (07/08/12) (fragment B), Tube 1 (05/08/12) (fragment A), Tube 2 (18/07/12) (riboswitch DNA).<br />
<br />
===Wednesday (08/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/ElectricalTransformation|Electrical transformation of competent e.coli with Gibson products]]'''<br />
<br />
----<br />
<br />
*Gibson constructs from yesterday (fluorescent and magnesium riboswitch) transformed into e.coli produced yesterday.<br />
<br />
*Cells plated out onto 50 &mu;g/ml ampicillin plates. Put in incubator overnight.<br />
<br />
===Friday (10/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay|Characterization of fluoride riboswitch sensitivity with &beta;-galactosidase]]'''<br />
<br />
----<br />
<br />
*X-Gal made up to a concentration of 400 &mu;g/ml with water.<br />
<br />
*Fluoride of concentrations 0.5 - 30 mM mixed with bacterial culture (Yale construct containing) grown up overnight.<br />
<br />
===Saturday (11/08/12)===<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/RestrictionDigest|Restriction digest of Yale plasmid]]'''<br />
<br />
----<br />
<br />
*Cells from electroporation of e.coli with plasmid from Yale (08/08/12) [[Team:Cambridge/Protocols/MiniPrep|miniprepped]] to extract plasmid DNA.<br />
<br />
*DNA digested with XhoI and SalI, expected fragment sizes 5580, 3139, 1437<br />
<br />
*Gel run, results not shown as gel was very 'messy'. Gel had probably already begun to set when poured and so had many artefacts when imaged. As a result each lane required different brightness and contrast settings to visualise and so the full gel was not clearly visible on the printout. However, all of the bands could be identified on the screen and were exactly as expected and very clear and pure.<br />
<br />
*Bands in correct places, indicating that expected plasmid was present in the cells. This indicates that, although they work at a very low efficiency, our electro-competent cells still work. It may be valuable to use these when trying to grow up plasmids that we already have at high concentration. <br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of e.coli with Magnesium riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Gibson products from 07/08/12 transformed into chemically competent cells.<br />
<br />
*Transformants plated out on 100 &mu;g/ml ampicillin plates<br />
<br />
==Week 8==<br />
<br />
==Week 9==<br />
<br />
==Week 10==<br />
<br />
==Week 11==<br />
<br />
==Week 12==<br />
<br />
==Week 13==<br />
<br />
==Week 14==<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Ribosense/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Ribosense/LabbookTeam:Cambridge/Ribosense/Labbook2012-10-27T03:15:21Z<p>Olijme: /* Week 7 */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Labbook");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= General Labbook =<br />
<br />
==Week 4 ==<br />
<br />
===Tuesday (17/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of MGRS vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 58 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 180secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain 168 used as template for this experiment.<br />
<br />
* Primers used:<br />
<br />
:* Forward: cggagggagacgattttgTGTTCCGTAATTGTGATGTAAG<br />
<br />
:* Reverse: acaccggcatactctgcgacGTCATAGGTCATGTTTTGAACC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Wednesday (18/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:Mg2+ Gel PCR 1.jpg|250px|right|thumb|Results of gel electrophoresis of PCR fragments from yesterday. 550bp fragments in lanes 2+3 were removed before the image was taken]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2 + 3: Riboswitch DNA from genome (replicates) - 550bp fragment expected.<br />
<br />
:*Lane 4 + 5: Vector DNA from pJS130 (replicates)- Chloramphenicol resistance marker - 9.0kbp fragment expected<br />
<br />
:*Lane 6: Postitive control - 1.9kbp fragment expected<br />
<br />
*Riboswitch DNA was successfully amplified. However, vector DNA was not. Given that the postive control was also successful, it seems likely that something went wrong with some stage before the PCR amplification. We will try to rectify the problem tomorrow.<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of riboswitch DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful riboswitch DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
===Thursday (19/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 55 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 240secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
*Settings changed - Annealing temperature and elongation time - attempting to debug PCR.<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:PCR Gel Mg2+ 2.jpg|right|250px|thumb|PCR products from today. Note the unusual band in the negative control and the vector lanes]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2, 3 + 4: Vector DNA from pJS130 (replicates) - 9.0kbp fragment expected<br />
<br />
:*Lane 5: Postitive control - 1.9kbp fragment expected<br />
<br />
:*Lane 6: Negative control - no fragments expected<br />
<br />
*Once more, the PCR appears to have failed. We will try to redesign the primers tomorrow to make them functional.<br />
<br />
==Week 5==<br />
<br />
===Thursday (26/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome and Lux genes from e.coli genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain pJS130 used as template for riboswitch, colony of previously transformed e.coli used as template for lux operon.<br />
<br />
:*M2+ RS<br />
<br />
::*Forward: cggagggagacgattttg|TGTTCCGTAATTGTGATGTAAG<br />
<br />
::*Reverse: tataacgttactggtttcat|CGGGACTCGTACCTCC<br />
<br />
:*Lux operon<br />
<br />
::*Forward: gctgtacaag|GGAGGAGGAGGAAGTGGAGGAGGAGGAAGT|atgaagtttggaaatatttgtttttc<br />
<br />
::*Reverse: cctcgcccttgctcaccat|ACTCTATTCCTTTTTGGTGATTC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Friday (27/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
{|cellspacing="20"<br />
|[[File:CAM_120727_1_edited.jpg|200px|left|thumb|Vector amplification gel. Lanes 2-4 Lux containing vector. Lanes 5-7 Fluorescent construct vector. No products from this gel were amplified.]]<br />
|[[File:CAM_120727_2_edited.jpg|200px|left|thumb|Various. Lanes 3-5 mOrange amplification. Lanes 6-8 eCFP (E0020) amplification. mOrange amplification did not work.]]<br />
|[[File:CAM_120727_3_edited.jpg|200px|left|thumb|Small products for fluorescent construct. Lanes 1-3 Terminator (B0015). Lanes 4-6 Promotor pVEG + SpoVG (K143053).]]<br />
|-<br />
|[[File:CAM_120727_4_edited.jpg|200px|left|thumb|Various. Lanes 2-4 eYFP (E0030) amplification. Lanes 5-7 Mg2+ vector +8 codons. Lane 8 Mg2+ vector -8 codons. Lane 8 amplification did not work.]]<br />
|[[File:CAM_120727_5_edited.jpg|200px|left|thumb|Mg2+ riboswitch gel. Lanes 6+7 positive and negative controls respectively for entire run. Lanes 3-5 genomic riboswitch amplification -8 codons. Lanes 2+3 vector -8 codons.]]<br />
|}<br />
<br />
*PCR fragments for Mg2+ riboswitch, luxA/mOrange fusion and fluorescent construct from yesterday separated on gels. 90mins at 100V.<br />
<br />
*Mostly successful, but will need to repeat four runs: Three vectors (fluorescent, fusion (lux) and Mg2+ riboswitch (-8 codons) and mOrange gene.<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of successfully amplified DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful CFP, YFP, B0015, Pveg + SpoVG (K143053), riboswitch and vector DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
==Week 6==<br />
<br />
===Monday (30/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vectors and mOrange]]'''<br />
<br />
----<br />
<br />
[[File:mOrangegel.jpg|250px|thumb|mOrange PCR run at multiple temperatures, every two lanes increacing the temperature of the annealing step by 2 &deg;C. No lanes worked.]]<br />
<br />
[[File:vectorgel1.jpg|250px|thumb|Top: Fusion, lux containing vector gel. Lanes 2-4, Vector DNA. Lane 5, +ve control. Lane 6, -ve control. Bottom: Vector gel. Lanes 1-3, Fluorescent construct vector DNA. Lanes 4-6, Riboswitch construct vector DNA.]]<br />
<br />
*Not all products were obtained during Friday's PCR. Most of these missing products were large vector backbones. They are being run again, with a much longer extension time of 300s. If that fails, primers will be ordered to split the vectors into manageable chunks, and the PCR reattempted when they arrive.<br />
<br />
*PCR cycle x35: <br />
<br />
:* 15s Denaturing at 95 C<br />
:* 45s Annealing at 60 C<br />
:* 300s Extension at 72 C<br />
<br />
*Remaining stray product had a slightly tricky secondary structure at the 3' end. It will be run at a series of annealing temperatures in a PCR machine capable of a temperature gradient.<br />
<br />
*mOrange PCR run at many different temperatures, from 62 &deg;C to 76 &deg;C. However this doesn't seem to solve our problem (refer to Gel photos). It seems likely that it is a primer design problem.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Construction of riboswitch plasmid with Gibson Assembly]]'''<br />
<br />
----<br />
<br />
*DNA from lanes 27+28, 27+29, 27+30 from gels run on Friday fused together with Gibson assembly to produce riboswitch construct. This does not have replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
*DNA from lanes 22,23 and 24 fused with riboswitch DNA produced two weeks ago to produce riboswitch construct. This has replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
===Tuesday (01/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of TOP10 E.coli with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into TOP10 e.coli cells and transformants plated out on 100&mu;g/ml ampicillin plates.<br />
<br />
===Wednesday (01/08/12)===<br />
<br />
'''Mg2+ Riboswitch'''<br />
<br />
----<br />
<br />
*Successful colonies produced from transformations two days ago streaked out onto chloramphenicol (5 &mu;g/ml) containing plates.<br />
<br />
*Colonies also grown up in 10ml of medium A for use with plate reader later.<br />
<br />
===Friday (03/08/12)<br />
<br />
''' [[Team:Cambridge/Protocols/PCRProtocol|PCR of split Mg2+ vector]]'''<br />
<br />
----<br />
<br />
[[File:split Mg2+ 1.jpg|left|250px|thumb|results of split magnesium vector PCR. None of the products worked]]<br />
<br />
*PCR of magnesium riboswitch vector repeated with primers to split plasmid.<br />
<br />
*Lanes 2 + 3: Fragment A (center - cut site (promotor side))<br />
<br />
*Lanes 4 + 5: Fragment B (without 8 codon substitution) (cut site (lac I side) - center)<br />
<br />
*Lanes 6 + 7: Fragment B (with 8 codon substitution) (cut stie (lac I side) - center)<br />
<br />
*Gels run, found PCR was unsuccessful.<br />
<br />
===Sunday (05/08/12)===<br />
<br />
'''Ribosense: [[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg Riboswitch vector fragments]]'''<br />
<br />
----<br />
<br />
*2nd attempt since the PCR on Friday did not work, possibly due to mastermix problems<br />
<br />
*PCR Programme:<br />
<br />
*Results: Fragment A was successfully PCR-ed (lanes 3-4); Fragment B did not come out, with or without the 8 codons (lanes 5-6 (-8); lanes 7-8 (+8))<br />
<br />
==Week 7==<br />
<br />
===Monday (06/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of Magnesium riboswitch vector fragment B and Magnesium promoter]]'''<br />
<br />
----<br />
<br />
[[File:MgRS vector frag. B.jpg|right|250px|thumb|Riboswitch and promoter gel. Lanes 2+3: Fragment B without 8 codon substitution, lanes 4+5: Fragment B with 8 codon substitution, lanes 6+7: magnesium sensitive promoter, lane 8: +ve control]]<br />
<br />
*Normal PCR settings used, annealing temperature 57 &deg;C, elongation step 90s long.<br />
<br />
*Lane 5 accidentally loaded with a DNA ladder instead of loading dye.<br />
<br />
*Expected fragment sizes:<br />
<br />
:*Lane 2-5: 3kbp<br />
<br />
:*Lane 6-7: 300bp<br />
<br />
*After electrophoresis, found vector products had, for the most part, worked. Promoter elements were not amplified - no band of the expected size was observed.<br />
<br />
*Positive control also failed, although this has ceased to work for several days, potentially due to DNA degradation.<br />
<br />
===Tuesday (07/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of magnesium riboswitch]]'''<br />
<br />
----<br />
<br />
*NAD+ added to '''isothermal buffer'''*5 mix<br />
<br />
*Gel slices from yesterday (of vector fragment B) purified.<br />
<br />
*DNA added as follows:<br />
<br />
:*Without 8 codon substitution:<br />
<br />
::*Reaction 1: Tube 2 (07/08/12) (fragment B), Tube 1 (05/08/12) (fragment A), Tube 28 (29/08/12) (riboswitch DNA).<br />
<br />
::*Reaction 2: Tube 3 (07/08/12) (fragment B), Tube 2 (05/08/12) (fragment A), Tube 29 (29/08/12) (riboswitch DNA).<br />
<br />
:*With 8 codon substitution:<br />
<br />
::*Reaction 3: Tube 4 (07/08/12) (fragment B), Tube 1 (05/08/12) (fragment A), Tube 2 (18/07/12) (riboswitch DNA).<br />
<br />
===Wednesday (08/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/ElectricalTransformation|Electrical transformation of competent e.coli with Gibson products]]'''<br />
<br />
----<br />
<br />
*Gibson constructs from yesterday (fluorescent and magnesium riboswitch) transformed into e.coli produced yesterday.<br />
<br />
*Cells plated out onto 50 &mu;g/ml ampicillin plates. Put in incubator overnight.<br />
<br />
===Friday (10/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/beta-galactosidaseassay|Characterization of fluoride riboswitch sensitivity with &beta;-galactosidase]]'''<br />
<br />
----<br />
<br />
*X-Gal made up to a concentration of 400 &mu;g/ml with water.<br />
<br />
*Fluoride of concentrations 0.5 - 30 mM mixed with bacterial culture (Yale construct containing) grown up overnight.<br />
<br />
==Week 8==<br />
<br />
==Week 9==<br />
<br />
==Week 10==<br />
<br />
==Week 11==<br />
<br />
==Week 12==<br />
<br />
==Week 13==<br />
<br />
==Week 14==<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Ribosense/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Ribosense/LabbookTeam:Cambridge/Ribosense/Labbook2012-10-27T03:10:17Z<p>Olijme: /* Week 6 */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Labbook");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= General Labbook =<br />
<br />
==Week 4 ==<br />
<br />
===Tuesday (17/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of MGRS vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 58 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 180secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain 168 used as template for this experiment.<br />
<br />
* Primers used:<br />
<br />
:* Forward: cggagggagacgattttgTGTTCCGTAATTGTGATGTAAG<br />
<br />
:* Reverse: acaccggcatactctgcgacGTCATAGGTCATGTTTTGAACC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Wednesday (18/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:Mg2+ Gel PCR 1.jpg|250px|right|thumb|Results of gel electrophoresis of PCR fragments from yesterday. 550bp fragments in lanes 2+3 were removed before the image was taken]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2 + 3: Riboswitch DNA from genome (replicates) - 550bp fragment expected.<br />
<br />
:*Lane 4 + 5: Vector DNA from pJS130 (replicates)- Chloramphenicol resistance marker - 9.0kbp fragment expected<br />
<br />
:*Lane 6: Postitive control - 1.9kbp fragment expected<br />
<br />
*Riboswitch DNA was successfully amplified. However, vector DNA was not. Given that the postive control was also successful, it seems likely that something went wrong with some stage before the PCR amplification. We will try to rectify the problem tomorrow.<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of riboswitch DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful riboswitch DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
===Thursday (19/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 55 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 240secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
*Settings changed - Annealing temperature and elongation time - attempting to debug PCR.<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:PCR Gel Mg2+ 2.jpg|right|250px|thumb|PCR products from today. Note the unusual band in the negative control and the vector lanes]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2, 3 + 4: Vector DNA from pJS130 (replicates) - 9.0kbp fragment expected<br />
<br />
:*Lane 5: Postitive control - 1.9kbp fragment expected<br />
<br />
:*Lane 6: Negative control - no fragments expected<br />
<br />
*Once more, the PCR appears to have failed. We will try to redesign the primers tomorrow to make them functional.<br />
<br />
==Week 5==<br />
<br />
===Thursday (26/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome and Lux genes from e.coli genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain pJS130 used as template for riboswitch, colony of previously transformed e.coli used as template for lux operon.<br />
<br />
:*M2+ RS<br />
<br />
::*Forward: cggagggagacgattttg|TGTTCCGTAATTGTGATGTAAG<br />
<br />
::*Reverse: tataacgttactggtttcat|CGGGACTCGTACCTCC<br />
<br />
:*Lux operon<br />
<br />
::*Forward: gctgtacaag|GGAGGAGGAGGAAGTGGAGGAGGAGGAAGT|atgaagtttggaaatatttgtttttc<br />
<br />
::*Reverse: cctcgcccttgctcaccat|ACTCTATTCCTTTTTGGTGATTC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Friday (27/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
{|cellspacing="20"<br />
|[[File:CAM_120727_1_edited.jpg|200px|left|thumb|Vector amplification gel. Lanes 2-4 Lux containing vector. Lanes 5-7 Fluorescent construct vector. No products from this gel were amplified.]]<br />
|[[File:CAM_120727_2_edited.jpg|200px|left|thumb|Various. Lanes 3-5 mOrange amplification. Lanes 6-8 eCFP (E0020) amplification. mOrange amplification did not work.]]<br />
|[[File:CAM_120727_3_edited.jpg|200px|left|thumb|Small products for fluorescent construct. Lanes 1-3 Terminator (B0015). Lanes 4-6 Promotor pVEG + SpoVG (K143053).]]<br />
|-<br />
|[[File:CAM_120727_4_edited.jpg|200px|left|thumb|Various. Lanes 2-4 eYFP (E0030) amplification. Lanes 5-7 Mg2+ vector +8 codons. Lane 8 Mg2+ vector -8 codons. Lane 8 amplification did not work.]]<br />
|[[File:CAM_120727_5_edited.jpg|200px|left|thumb|Mg2+ riboswitch gel. Lanes 6+7 positive and negative controls respectively for entire run. Lanes 3-5 genomic riboswitch amplification -8 codons. Lanes 2+3 vector -8 codons.]]<br />
|}<br />
<br />
*PCR fragments for Mg2+ riboswitch, luxA/mOrange fusion and fluorescent construct from yesterday separated on gels. 90mins at 100V.<br />
<br />
*Mostly successful, but will need to repeat four runs: Three vectors (fluorescent, fusion (lux) and Mg2+ riboswitch (-8 codons) and mOrange gene.<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of successfully amplified DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful CFP, YFP, B0015, Pveg + SpoVG (K143053), riboswitch and vector DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
==Week 6==<br />
<br />
===Monday (30/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vectors and mOrange]]'''<br />
<br />
----<br />
<br />
[[File:mOrangegel.jpg|250px|thumb|mOrange PCR run at multiple temperatures, every two lanes increacing the temperature of the annealing step by 2 &deg;C. No lanes worked.]]<br />
<br />
[[File:vectorgel1.jpg|250px|thumb|Top: Fusion, lux containing vector gel. Lanes 2-4, Vector DNA. Lane 5, +ve control. Lane 6, -ve control. Bottom: Vector gel. Lanes 1-3, Fluorescent construct vector DNA. Lanes 4-6, Riboswitch construct vector DNA.]]<br />
<br />
*Not all products were obtained during Friday's PCR. Most of these missing products were large vector backbones. They are being run again, with a much longer extension time of 300s. If that fails, primers will be ordered to split the vectors into manageable chunks, and the PCR reattempted when they arrive.<br />
<br />
*PCR cycle x35: <br />
<br />
:* 15s Denaturing at 95 C<br />
:* 45s Annealing at 60 C<br />
:* 300s Extension at 72 C<br />
<br />
*Remaining stray product had a slightly tricky secondary structure at the 3' end. It will be run at a series of annealing temperatures in a PCR machine capable of a temperature gradient.<br />
<br />
*mOrange PCR run at many different temperatures, from 62 &deg;C to 76 &deg;C. However this doesn't seem to solve our problem (refer to Gel photos). It seems likely that it is a primer design problem.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Construction of riboswitch plasmid with Gibson Assembly]]'''<br />
<br />
----<br />
<br />
*DNA from lanes 27+28, 27+29, 27+30 from gels run on Friday fused together with Gibson assembly to produce riboswitch construct. This does not have replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
*DNA from lanes 22,23 and 24 fused with riboswitch DNA produced two weeks ago to produce riboswitch construct. This has replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
===Tuesday (01/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of TOP10 E.coli with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into TOP10 e.coli cells and transformants plated out on 100&mu;g/ml ampicillin plates.<br />
<br />
===Wednesday (01/08/12)===<br />
<br />
'''Mg2+ Riboswitch'''<br />
<br />
----<br />
<br />
*Successful colonies produced from transformations two days ago streaked out onto chloramphenicol (5 &mu;g/ml) containing plates.<br />
<br />
*Colonies also grown up in 10ml of medium A for use with plate reader later.<br />
<br />
===Friday (03/08/12)<br />
<br />
''' [[Team:Cambridge/Protocols/PCRProtocol|PCR of split Mg2+ vector]]'''<br />
<br />
----<br />
<br />
[[File:split Mg2+ 1.jpg|left|250px|thumb|results of split magnesium vector PCR. None of the products worked]]<br />
<br />
*PCR of magnesium riboswitch vector repeated with primers to split plasmid.<br />
<br />
*Lanes 2 + 3: Fragment A (center - cut site (promotor side))<br />
<br />
*Lanes 4 + 5: Fragment B (without 8 codon substitution) (cut site (lac I side) - center)<br />
<br />
*Lanes 6 + 7: Fragment B (with 8 codon substitution) (cut stie (lac I side) - center)<br />
<br />
*Gels run, found PCR was unsuccessful.<br />
<br />
===Sunday (05/08/12)===<br />
<br />
'''Ribosense: [[Team:Cambridge/Protocols/PCRProtocol|PCR of Mg Riboswitch vector fragments]]'''<br />
<br />
----<br />
<br />
*2nd attempt since the PCR on Friday did not work, possibly due to mastermix problems<br />
<br />
*PCR Programme:<br />
<br />
*Results: Fragment A was successfully PCR-ed (lanes 3-4); Fragment B did not come out, with or without the 8 codons (lanes 5-6 (-8); lanes 7-8 (+8))<br />
<br />
==Week 7==<br />
<br />
==Week 8==<br />
<br />
==Week 9==<br />
<br />
==Week 10==<br />
<br />
==Week 11==<br />
<br />
==Week 12==<br />
<br />
==Week 13==<br />
<br />
==Week 14==<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Ribosense/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Ribosense/LabbookTeam:Cambridge/Ribosense/Labbook2012-10-27T03:07:41Z<p>Olijme: /* Wednesday (01/08/12) */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Labbook");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= General Labbook =<br />
<br />
==Week 4 ==<br />
<br />
===Tuesday (17/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of MGRS vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 58 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 180secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain 168 used as template for this experiment.<br />
<br />
* Primers used:<br />
<br />
:* Forward: cggagggagacgattttgTGTTCCGTAATTGTGATGTAAG<br />
<br />
:* Reverse: acaccggcatactctgcgacGTCATAGGTCATGTTTTGAACC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Wednesday (18/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:Mg2+ Gel PCR 1.jpg|250px|right|thumb|Results of gel electrophoresis of PCR fragments from yesterday. 550bp fragments in lanes 2+3 were removed before the image was taken]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2 + 3: Riboswitch DNA from genome (replicates) - 550bp fragment expected.<br />
<br />
:*Lane 4 + 5: Vector DNA from pJS130 (replicates)- Chloramphenicol resistance marker - 9.0kbp fragment expected<br />
<br />
:*Lane 6: Postitive control - 1.9kbp fragment expected<br />
<br />
*Riboswitch DNA was successfully amplified. However, vector DNA was not. Given that the postive control was also successful, it seems likely that something went wrong with some stage before the PCR amplification. We will try to rectify the problem tomorrow.<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of riboswitch DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful riboswitch DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
===Thursday (19/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 55 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 240secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
*Settings changed - Annealing temperature and elongation time - attempting to debug PCR.<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:PCR Gel Mg2+ 2.jpg|right|250px|thumb|PCR products from today. Note the unusual band in the negative control and the vector lanes]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2, 3 + 4: Vector DNA from pJS130 (replicates) - 9.0kbp fragment expected<br />
<br />
:*Lane 5: Postitive control - 1.9kbp fragment expected<br />
<br />
:*Lane 6: Negative control - no fragments expected<br />
<br />
*Once more, the PCR appears to have failed. We will try to redesign the primers tomorrow to make them functional.<br />
<br />
==Week 5==<br />
<br />
===Thursday (26/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome and Lux genes from e.coli genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain pJS130 used as template for riboswitch, colony of previously transformed e.coli used as template for lux operon.<br />
<br />
:*M2+ RS<br />
<br />
::*Forward: cggagggagacgattttg|TGTTCCGTAATTGTGATGTAAG<br />
<br />
::*Reverse: tataacgttactggtttcat|CGGGACTCGTACCTCC<br />
<br />
:*Lux operon<br />
<br />
::*Forward: gctgtacaag|GGAGGAGGAGGAAGTGGAGGAGGAGGAAGT|atgaagtttggaaatatttgtttttc<br />
<br />
::*Reverse: cctcgcccttgctcaccat|ACTCTATTCCTTTTTGGTGATTC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Friday (27/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
{|cellspacing="20"<br />
|[[File:CAM_120727_1_edited.jpg|200px|left|thumb|Vector amplification gel. Lanes 2-4 Lux containing vector. Lanes 5-7 Fluorescent construct vector. No products from this gel were amplified.]]<br />
|[[File:CAM_120727_2_edited.jpg|200px|left|thumb|Various. Lanes 3-5 mOrange amplification. Lanes 6-8 eCFP (E0020) amplification. mOrange amplification did not work.]]<br />
|[[File:CAM_120727_3_edited.jpg|200px|left|thumb|Small products for fluorescent construct. Lanes 1-3 Terminator (B0015). Lanes 4-6 Promotor pVEG + SpoVG (K143053).]]<br />
|-<br />
|[[File:CAM_120727_4_edited.jpg|200px|left|thumb|Various. Lanes 2-4 eYFP (E0030) amplification. Lanes 5-7 Mg2+ vector +8 codons. Lane 8 Mg2+ vector -8 codons. Lane 8 amplification did not work.]]<br />
|[[File:CAM_120727_5_edited.jpg|200px|left|thumb|Mg2+ riboswitch gel. Lanes 6+7 positive and negative controls respectively for entire run. Lanes 3-5 genomic riboswitch amplification -8 codons. Lanes 2+3 vector -8 codons.]]<br />
|}<br />
<br />
*PCR fragments for Mg2+ riboswitch, luxA/mOrange fusion and fluorescent construct from yesterday separated on gels. 90mins at 100V.<br />
<br />
*Mostly successful, but will need to repeat four runs: Three vectors (fluorescent, fusion (lux) and Mg2+ riboswitch (-8 codons) and mOrange gene.<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of successfully amplified DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful CFP, YFP, B0015, Pveg + SpoVG (K143053), riboswitch and vector DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
==Week 6==<br />
<br />
===Monday (30/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vectors and mOrange]]'''<br />
<br />
----<br />
<br />
[[File:mOrangegel.jpg|250px|thumb|mOrange PCR run at multiple temperatures, every two lanes increacing the temperature of the annealing step by 2 &deg;C. No lanes worked.]]<br />
<br />
[[File:vectorgel1.jpg|250px|thumb|Top: Fusion, lux containing vector gel. Lanes 2-4, Vector DNA. Lane 5, +ve control. Lane 6, -ve control. Bottom: Vector gel. Lanes 1-3, Fluorescent construct vector DNA. Lanes 4-6, Riboswitch construct vector DNA.]]<br />
<br />
*Not all products were obtained during Friday's PCR. Most of these missing products were large vector backbones. They are being run again, with a much longer extension time of 300s. If that fails, primers will be ordered to split the vectors into manageable chunks, and the PCR reattempted when they arrive.<br />
<br />
*PCR cycle x35: <br />
<br />
:* 15s Denaturing at 95 C<br />
:* 45s Annealing at 60 C<br />
:* 300s Extension at 72 C<br />
<br />
*Remaining stray product had a slightly tricky secondary structure at the 3' end. It will be run at a series of annealing temperatures in a PCR machine capable of a temperature gradient.<br />
<br />
*mOrange PCR run at many different temperatures, from 62 &deg;C to 76 &deg;C. However this doesn't seem to solve our problem (refer to Gel photos). It seems likely that it is a primer design problem.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Construction of riboswitch plasmid with Gibson Assembly]]'''<br />
<br />
----<br />
<br />
*DNA from lanes 27+28, 27+29, 27+30 from gels run on Friday fused together with Gibson assembly to produce riboswitch construct. This does not have replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
*DNA from lanes 22,23 and 24 fused with riboswitch DNA produced two weeks ago to produce riboswitch construct. This has replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
===Tuesday (01/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of TOP10 E.coli with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into TOP10 e.coli cells and transformants plated out on 100&mu;g/ml ampicillin plates.<br />
<br />
===Wednesday (01/08/12)===<br />
<br />
'''Mg2+ Riboswitch'''<br />
<br />
----<br />
<br />
*Successful colonies produced from transformations two days ago streaked out onto chloramphenicol (5 &mu;g/ml) containing plates.<br />
<br />
*Colonies also grown up in 10ml of medium A for use with plate reader later.<br />
<br />
==Week 7==<br />
<br />
==Week 8==<br />
<br />
==Week 9==<br />
<br />
==Week 10==<br />
<br />
==Week 11==<br />
<br />
==Week 12==<br />
<br />
==Week 13==<br />
<br />
==Week 14==<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Ribosense/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Ribosense/LabbookTeam:Cambridge/Ribosense/Labbook2012-10-27T03:07:25Z<p>Olijme: /* Week 6 */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Labbook");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= General Labbook =<br />
<br />
==Week 4 ==<br />
<br />
===Tuesday (17/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of MGRS vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 58 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 180secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain 168 used as template for this experiment.<br />
<br />
* Primers used:<br />
<br />
:* Forward: cggagggagacgattttgTGTTCCGTAATTGTGATGTAAG<br />
<br />
:* Reverse: acaccggcatactctgcgacGTCATAGGTCATGTTTTGAACC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Wednesday (18/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:Mg2+ Gel PCR 1.jpg|250px|right|thumb|Results of gel electrophoresis of PCR fragments from yesterday. 550bp fragments in lanes 2+3 were removed before the image was taken]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2 + 3: Riboswitch DNA from genome (replicates) - 550bp fragment expected.<br />
<br />
:*Lane 4 + 5: Vector DNA from pJS130 (replicates)- Chloramphenicol resistance marker - 9.0kbp fragment expected<br />
<br />
:*Lane 6: Postitive control - 1.9kbp fragment expected<br />
<br />
*Riboswitch DNA was successfully amplified. However, vector DNA was not. Given that the postive control was also successful, it seems likely that something went wrong with some stage before the PCR amplification. We will try to rectify the problem tomorrow.<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of riboswitch DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful riboswitch DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
===Thursday (19/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 55 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 240secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
*Settings changed - Annealing temperature and elongation time - attempting to debug PCR.<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:PCR Gel Mg2+ 2.jpg|right|250px|thumb|PCR products from today. Note the unusual band in the negative control and the vector lanes]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2, 3 + 4: Vector DNA from pJS130 (replicates) - 9.0kbp fragment expected<br />
<br />
:*Lane 5: Postitive control - 1.9kbp fragment expected<br />
<br />
:*Lane 6: Negative control - no fragments expected<br />
<br />
*Once more, the PCR appears to have failed. We will try to redesign the primers tomorrow to make them functional.<br />
<br />
==Week 5==<br />
<br />
===Thursday (26/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome and Lux genes from e.coli genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain pJS130 used as template for riboswitch, colony of previously transformed e.coli used as template for lux operon.<br />
<br />
:*M2+ RS<br />
<br />
::*Forward: cggagggagacgattttg|TGTTCCGTAATTGTGATGTAAG<br />
<br />
::*Reverse: tataacgttactggtttcat|CGGGACTCGTACCTCC<br />
<br />
:*Lux operon<br />
<br />
::*Forward: gctgtacaag|GGAGGAGGAGGAAGTGGAGGAGGAGGAAGT|atgaagtttggaaatatttgtttttc<br />
<br />
::*Reverse: cctcgcccttgctcaccat|ACTCTATTCCTTTTTGGTGATTC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Friday (27/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
{|cellspacing="20"<br />
|[[File:CAM_120727_1_edited.jpg|200px|left|thumb|Vector amplification gel. Lanes 2-4 Lux containing vector. Lanes 5-7 Fluorescent construct vector. No products from this gel were amplified.]]<br />
|[[File:CAM_120727_2_edited.jpg|200px|left|thumb|Various. Lanes 3-5 mOrange amplification. Lanes 6-8 eCFP (E0020) amplification. mOrange amplification did not work.]]<br />
|[[File:CAM_120727_3_edited.jpg|200px|left|thumb|Small products for fluorescent construct. Lanes 1-3 Terminator (B0015). Lanes 4-6 Promotor pVEG + SpoVG (K143053).]]<br />
|-<br />
|[[File:CAM_120727_4_edited.jpg|200px|left|thumb|Various. Lanes 2-4 eYFP (E0030) amplification. Lanes 5-7 Mg2+ vector +8 codons. Lane 8 Mg2+ vector -8 codons. Lane 8 amplification did not work.]]<br />
|[[File:CAM_120727_5_edited.jpg|200px|left|thumb|Mg2+ riboswitch gel. Lanes 6+7 positive and negative controls respectively for entire run. Lanes 3-5 genomic riboswitch amplification -8 codons. Lanes 2+3 vector -8 codons.]]<br />
|}<br />
<br />
*PCR fragments for Mg2+ riboswitch, luxA/mOrange fusion and fluorescent construct from yesterday separated on gels. 90mins at 100V.<br />
<br />
*Mostly successful, but will need to repeat four runs: Three vectors (fluorescent, fusion (lux) and Mg2+ riboswitch (-8 codons) and mOrange gene.<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of successfully amplified DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful CFP, YFP, B0015, Pveg + SpoVG (K143053), riboswitch and vector DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
==Week 6==<br />
<br />
===Monday (30/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vectors and mOrange]]'''<br />
<br />
----<br />
<br />
[[File:mOrangegel.jpg|250px|thumb|mOrange PCR run at multiple temperatures, every two lanes increacing the temperature of the annealing step by 2 &deg;C. No lanes worked.]]<br />
<br />
[[File:vectorgel1.jpg|250px|thumb|Top: Fusion, lux containing vector gel. Lanes 2-4, Vector DNA. Lane 5, +ve control. Lane 6, -ve control. Bottom: Vector gel. Lanes 1-3, Fluorescent construct vector DNA. Lanes 4-6, Riboswitch construct vector DNA.]]<br />
<br />
*Not all products were obtained during Friday's PCR. Most of these missing products were large vector backbones. They are being run again, with a much longer extension time of 300s. If that fails, primers will be ordered to split the vectors into manageable chunks, and the PCR reattempted when they arrive.<br />
<br />
*PCR cycle x35: <br />
<br />
:* 15s Denaturing at 95 C<br />
:* 45s Annealing at 60 C<br />
:* 300s Extension at 72 C<br />
<br />
*Remaining stray product had a slightly tricky secondary structure at the 3' end. It will be run at a series of annealing temperatures in a PCR machine capable of a temperature gradient.<br />
<br />
*mOrange PCR run at many different temperatures, from 62 &deg;C to 76 &deg;C. However this doesn't seem to solve our problem (refer to Gel photos). It seems likely that it is a primer design problem.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Construction of riboswitch plasmid with Gibson Assembly]]'''<br />
<br />
----<br />
<br />
*DNA from lanes 27+28, 27+29, 27+30 from gels run on Friday fused together with Gibson assembly to produce riboswitch construct. This does not have replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
*DNA from lanes 22,23 and 24 fused with riboswitch DNA produced two weeks ago to produce riboswitch construct. This has replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
===Tuesday (01/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of TOP10 E.coli with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into TOP10 e.coli cells and transformants plated out on 100&mu;g/ml ampicillin plates.<br />
<br />
===Wednesday (01/08/12)===<br />
<br />
'''Ribosense: Mg2+ Riboswitch'''<br />
<br />
----<br />
<br />
*Successful colonies produced from transformations two days ago streaked out onto chloramphenicol (5 &mu;g/ml) containing plates.<br />
<br />
*Colonies also grown up in 10ml of medium A for use with plate reader later.<br />
<br />
==Week 7==<br />
<br />
==Week 8==<br />
<br />
==Week 9==<br />
<br />
==Week 10==<br />
<br />
==Week 11==<br />
<br />
==Week 12==<br />
<br />
==Week 13==<br />
<br />
==Week 14==<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Ribosense/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Ribosense/LabbookTeam:Cambridge/Ribosense/Labbook2012-10-27T03:06:01Z<p>Olijme: /* Week 6 */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Labbook");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= General Labbook =<br />
<br />
==Week 4 ==<br />
<br />
===Tuesday (17/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of MGRS vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 58 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 180secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain 168 used as template for this experiment.<br />
<br />
* Primers used:<br />
<br />
:* Forward: cggagggagacgattttgTGTTCCGTAATTGTGATGTAAG<br />
<br />
:* Reverse: acaccggcatactctgcgacGTCATAGGTCATGTTTTGAACC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Wednesday (18/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:Mg2+ Gel PCR 1.jpg|250px|right|thumb|Results of gel electrophoresis of PCR fragments from yesterday. 550bp fragments in lanes 2+3 were removed before the image was taken]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2 + 3: Riboswitch DNA from genome (replicates) - 550bp fragment expected.<br />
<br />
:*Lane 4 + 5: Vector DNA from pJS130 (replicates)- Chloramphenicol resistance marker - 9.0kbp fragment expected<br />
<br />
:*Lane 6: Postitive control - 1.9kbp fragment expected<br />
<br />
*Riboswitch DNA was successfully amplified. However, vector DNA was not. Given that the postive control was also successful, it seems likely that something went wrong with some stage before the PCR amplification. We will try to rectify the problem tomorrow.<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of riboswitch DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful riboswitch DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
===Thursday (19/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 55 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 240secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
*Settings changed - Annealing temperature and elongation time - attempting to debug PCR.<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:PCR Gel Mg2+ 2.jpg|right|250px|thumb|PCR products from today. Note the unusual band in the negative control and the vector lanes]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2, 3 + 4: Vector DNA from pJS130 (replicates) - 9.0kbp fragment expected<br />
<br />
:*Lane 5: Postitive control - 1.9kbp fragment expected<br />
<br />
:*Lane 6: Negative control - no fragments expected<br />
<br />
*Once more, the PCR appears to have failed. We will try to redesign the primers tomorrow to make them functional.<br />
<br />
==Week 5==<br />
<br />
===Thursday (26/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome and Lux genes from e.coli genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain pJS130 used as template for riboswitch, colony of previously transformed e.coli used as template for lux operon.<br />
<br />
:*M2+ RS<br />
<br />
::*Forward: cggagggagacgattttg|TGTTCCGTAATTGTGATGTAAG<br />
<br />
::*Reverse: tataacgttactggtttcat|CGGGACTCGTACCTCC<br />
<br />
:*Lux operon<br />
<br />
::*Forward: gctgtacaag|GGAGGAGGAGGAAGTGGAGGAGGAGGAAGT|atgaagtttggaaatatttgtttttc<br />
<br />
::*Reverse: cctcgcccttgctcaccat|ACTCTATTCCTTTTTGGTGATTC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Friday (27/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
{|cellspacing="20"<br />
|[[File:CAM_120727_1_edited.jpg|200px|left|thumb|Vector amplification gel. Lanes 2-4 Lux containing vector. Lanes 5-7 Fluorescent construct vector. No products from this gel were amplified.]]<br />
|[[File:CAM_120727_2_edited.jpg|200px|left|thumb|Various. Lanes 3-5 mOrange amplification. Lanes 6-8 eCFP (E0020) amplification. mOrange amplification did not work.]]<br />
|[[File:CAM_120727_3_edited.jpg|200px|left|thumb|Small products for fluorescent construct. Lanes 1-3 Terminator (B0015). Lanes 4-6 Promotor pVEG + SpoVG (K143053).]]<br />
|-<br />
|[[File:CAM_120727_4_edited.jpg|200px|left|thumb|Various. Lanes 2-4 eYFP (E0030) amplification. Lanes 5-7 Mg2+ vector +8 codons. Lane 8 Mg2+ vector -8 codons. Lane 8 amplification did not work.]]<br />
|[[File:CAM_120727_5_edited.jpg|200px|left|thumb|Mg2+ riboswitch gel. Lanes 6+7 positive and negative controls respectively for entire run. Lanes 3-5 genomic riboswitch amplification -8 codons. Lanes 2+3 vector -8 codons.]]<br />
|}<br />
<br />
*PCR fragments for Mg2+ riboswitch, luxA/mOrange fusion and fluorescent construct from yesterday separated on gels. 90mins at 100V.<br />
<br />
*Mostly successful, but will need to repeat four runs: Three vectors (fluorescent, fusion (lux) and Mg2+ riboswitch (-8 codons) and mOrange gene.<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of successfully amplified DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful CFP, YFP, B0015, Pveg + SpoVG (K143053), riboswitch and vector DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
==Week 6==<br />
<br />
===Monday (30/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vectors and mOrange]]'''<br />
<br />
----<br />
<br />
[[File:mOrangegel.jpg|250px|thumb|mOrange PCR run at multiple temperatures, every two lanes increacing the temperature of the annealing step by 2 &deg;C. No lanes worked.]]<br />
<br />
[[File:vectorgel1.jpg|250px|thumb|Top: Fusion, lux containing vector gel. Lanes 2-4, Vector DNA. Lane 5, +ve control. Lane 6, -ve control. Bottom: Vector gel. Lanes 1-3, Fluorescent construct vector DNA. Lanes 4-6, Riboswitch construct vector DNA.]]<br />
<br />
*Not all products were obtained during Friday's PCR. Most of these missing products were large vector backbones. They are being run again, with a much longer extension time of 300s. If that fails, primers will be ordered to split the vectors into manageable chunks, and the PCR reattempted when they arrive.<br />
<br />
*PCR cycle x35: <br />
<br />
:* 15s Denaturing at 95 C<br />
:* 45s Annealing at 60 C<br />
:* 300s Extension at 72 C<br />
<br />
*Remaining stray product had a slightly tricky secondary structure at the 3' end. It will be run at a series of annealing temperatures in a PCR machine capable of a temperature gradient.<br />
<br />
*mOrange PCR run at many different temperatures, from 62 &deg;C to 76 &deg;C. However this doesn't seem to solve our problem (refer to Gel photos). It seems likely that it is a primer design problem.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Construction of riboswitch plasmid with Gibson Assembly]]'''<br />
<br />
----<br />
<br />
*DNA from lanes 27+28, 27+29, 27+30 from gels run on Friday fused together with Gibson assembly to produce riboswitch construct. This does not have replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
*DNA from lanes 22,23 and 24 fused with riboswitch DNA produced two weeks ago to produce riboswitch construct. This has replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
===Tuesday (01/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of TOP10 E.coli with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into TOP10 e.coli cells and transformants plated out on 100&mu;g/ml ampicillin plates.<br />
<br />
==Week 7==<br />
<br />
==Week 8==<br />
<br />
==Week 9==<br />
<br />
==Week 10==<br />
<br />
==Week 11==<br />
<br />
==Week 12==<br />
<br />
==Week 13==<br />
<br />
==Week 14==<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Ribosense/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Ribosense/LabbookTeam:Cambridge/Ribosense/Labbook2012-10-27T03:04:13Z<p>Olijme: /* Week 6 */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Labbook");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= General Labbook =<br />
<br />
==Week 4 ==<br />
<br />
===Tuesday (17/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of MGRS vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 58 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 180secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain 168 used as template for this experiment.<br />
<br />
* Primers used:<br />
<br />
:* Forward: cggagggagacgattttgTGTTCCGTAATTGTGATGTAAG<br />
<br />
:* Reverse: acaccggcatactctgcgacGTCATAGGTCATGTTTTGAACC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Wednesday (18/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:Mg2+ Gel PCR 1.jpg|250px|right|thumb|Results of gel electrophoresis of PCR fragments from yesterday. 550bp fragments in lanes 2+3 were removed before the image was taken]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2 + 3: Riboswitch DNA from genome (replicates) - 550bp fragment expected.<br />
<br />
:*Lane 4 + 5: Vector DNA from pJS130 (replicates)- Chloramphenicol resistance marker - 9.0kbp fragment expected<br />
<br />
:*Lane 6: Postitive control - 1.9kbp fragment expected<br />
<br />
*Riboswitch DNA was successfully amplified. However, vector DNA was not. Given that the postive control was also successful, it seems likely that something went wrong with some stage before the PCR amplification. We will try to rectify the problem tomorrow.<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of riboswitch DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful riboswitch DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
===Thursday (19/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 55 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 240secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
*Settings changed - Annealing temperature and elongation time - attempting to debug PCR.<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:PCR Gel Mg2+ 2.jpg|right|250px|thumb|PCR products from today. Note the unusual band in the negative control and the vector lanes]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2, 3 + 4: Vector DNA from pJS130 (replicates) - 9.0kbp fragment expected<br />
<br />
:*Lane 5: Postitive control - 1.9kbp fragment expected<br />
<br />
:*Lane 6: Negative control - no fragments expected<br />
<br />
*Once more, the PCR appears to have failed. We will try to redesign the primers tomorrow to make them functional.<br />
<br />
==Week 5==<br />
<br />
===Thursday (26/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome and Lux genes from e.coli genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain pJS130 used as template for riboswitch, colony of previously transformed e.coli used as template for lux operon.<br />
<br />
:*M2+ RS<br />
<br />
::*Forward: cggagggagacgattttg|TGTTCCGTAATTGTGATGTAAG<br />
<br />
::*Reverse: tataacgttactggtttcat|CGGGACTCGTACCTCC<br />
<br />
:*Lux operon<br />
<br />
::*Forward: gctgtacaag|GGAGGAGGAGGAAGTGGAGGAGGAGGAAGT|atgaagtttggaaatatttgtttttc<br />
<br />
::*Reverse: cctcgcccttgctcaccat|ACTCTATTCCTTTTTGGTGATTC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Friday (27/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
{|cellspacing="20"<br />
|[[File:CAM_120727_1_edited.jpg|200px|left|thumb|Vector amplification gel. Lanes 2-4 Lux containing vector. Lanes 5-7 Fluorescent construct vector. No products from this gel were amplified.]]<br />
|[[File:CAM_120727_2_edited.jpg|200px|left|thumb|Various. Lanes 3-5 mOrange amplification. Lanes 6-8 eCFP (E0020) amplification. mOrange amplification did not work.]]<br />
|[[File:CAM_120727_3_edited.jpg|200px|left|thumb|Small products for fluorescent construct. Lanes 1-3 Terminator (B0015). Lanes 4-6 Promotor pVEG + SpoVG (K143053).]]<br />
|-<br />
|[[File:CAM_120727_4_edited.jpg|200px|left|thumb|Various. Lanes 2-4 eYFP (E0030) amplification. Lanes 5-7 Mg2+ vector +8 codons. Lane 8 Mg2+ vector -8 codons. Lane 8 amplification did not work.]]<br />
|[[File:CAM_120727_5_edited.jpg|200px|left|thumb|Mg2+ riboswitch gel. Lanes 6+7 positive and negative controls respectively for entire run. Lanes 3-5 genomic riboswitch amplification -8 codons. Lanes 2+3 vector -8 codons.]]<br />
|}<br />
<br />
*PCR fragments for Mg2+ riboswitch, luxA/mOrange fusion and fluorescent construct from yesterday separated on gels. 90mins at 100V.<br />
<br />
*Mostly successful, but will need to repeat four runs: Three vectors (fluorescent, fusion (lux) and Mg2+ riboswitch (-8 codons) and mOrange gene.<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of successfully amplified DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful CFP, YFP, B0015, Pveg + SpoVG (K143053), riboswitch and vector DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
==Week 6==<br />
<br />
===Monday (30/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vectors and mOrange]]'''<br />
<br />
----<br />
<br />
[[File:mOrangegel.jpg|250px|thumb|mOrange PCR run at multiple temperatures, every two lanes increacing the temperature of the annealing step by 2 &deg;C. No lanes worked.]]<br />
<br />
[[File:vectorgel1.jpg|250px|thumb|Top: Fusion, lux containing vector gel. Lanes 2-4, Vector DNA. Lane 5, +ve control. Lane 6, -ve control. Bottom: Vector gel. Lanes 1-3, Fluorescent construct vector DNA. Lanes 4-6, Riboswitch construct vector DNA.]]<br />
<br />
*Not all products were obtained during Friday's PCR. Most of these missing products were large vector backbones. They are being run again, with a much longer extension time of 300s. If that fails, primers will be ordered to split the vectors into manageable chunks, and the PCR reattempted when they arrive.<br />
<br />
*PCR cycle x35: <br />
<br />
:* 15s Denaturing at 95 C<br />
:* 45s Annealing at 60 C<br />
:* 300s Extension at 72 C<br />
<br />
*Remaining stray product had a slightly tricky secondary structure at the 3' end. It will be run at a series of annealing temperatures in a PCR machine capable of a temperature gradient.<br />
<br />
*mOrange PCR run at many different temperatures, from 62 &deg;C to 76 &deg;C. However this doesn't seem to solve our problem (refer to Gel photos). It seems likely that it is a primer design problem.<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Construction of riboswitch plasmid with Gibson Assembly]]'''<br />
<br />
----<br />
<br />
*DNA from lanes 27+28, 27+29, 27+30 from gels run on Friday fused together with Gibson assembly to produce riboswitch construct. This does not have replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
*DNA from lanes 22,23 and 24 fused with riboswitch DNA produced two weeks ago to produce riboswitch construct. This has replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''Bacillus'' with riboswitch construct]]'''<br />
<br />
----<br />
<br />
*Plasmids made by Gibson transformed into ''bacillus'' cells made two weeks ago and transformants plated out on 5&mu;g/ml chloramphenicol plates.<br />
<br />
==Week 7==<br />
<br />
==Week 8==<br />
<br />
==Week 9==<br />
<br />
==Week 10==<br />
<br />
==Week 11==<br />
<br />
==Week 12==<br />
<br />
==Week 13==<br />
<br />
==Week 14==<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Ribosense/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Ribosense/LabbookTeam:Cambridge/Ribosense/Labbook2012-10-27T03:00:50Z<p>Olijme: /* Week 5 */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Labbook");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= General Labbook =<br />
<br />
==Week 4 ==<br />
<br />
===Tuesday (17/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of MGRS vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 58 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 180secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain 168 used as template for this experiment.<br />
<br />
* Primers used:<br />
<br />
:* Forward: cggagggagacgattttgTGTTCCGTAATTGTGATGTAAG<br />
<br />
:* Reverse: acaccggcatactctgcgacGTCATAGGTCATGTTTTGAACC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Wednesday (18/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:Mg2+ Gel PCR 1.jpg|250px|right|thumb|Results of gel electrophoresis of PCR fragments from yesterday. 550bp fragments in lanes 2+3 were removed before the image was taken]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2 + 3: Riboswitch DNA from genome (replicates) - 550bp fragment expected.<br />
<br />
:*Lane 4 + 5: Vector DNA from pJS130 (replicates)- Chloramphenicol resistance marker - 9.0kbp fragment expected<br />
<br />
:*Lane 6: Postitive control - 1.9kbp fragment expected<br />
<br />
*Riboswitch DNA was successfully amplified. However, vector DNA was not. Given that the postive control was also successful, it seems likely that something went wrong with some stage before the PCR amplification. We will try to rectify the problem tomorrow.<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of riboswitch DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful riboswitch DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
===Thursday (19/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 55 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 240secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
*Settings changed - Annealing temperature and elongation time - attempting to debug PCR.<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:PCR Gel Mg2+ 2.jpg|right|250px|thumb|PCR products from today. Note the unusual band in the negative control and the vector lanes]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2, 3 + 4: Vector DNA from pJS130 (replicates) - 9.0kbp fragment expected<br />
<br />
:*Lane 5: Postitive control - 1.9kbp fragment expected<br />
<br />
:*Lane 6: Negative control - no fragments expected<br />
<br />
*Once more, the PCR appears to have failed. We will try to redesign the primers tomorrow to make them functional.<br />
<br />
==Week 5==<br />
<br />
===Thursday (26/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome and Lux genes from e.coli genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain pJS130 used as template for riboswitch, colony of previously transformed e.coli used as template for lux operon.<br />
<br />
:*M2+ RS<br />
<br />
::*Forward: cggagggagacgattttg|TGTTCCGTAATTGTGATGTAAG<br />
<br />
::*Reverse: tataacgttactggtttcat|CGGGACTCGTACCTCC<br />
<br />
:*Lux operon<br />
<br />
::*Forward: gctgtacaag|GGAGGAGGAGGAAGTGGAGGAGGAGGAAGT|atgaagtttggaaatatttgtttttc<br />
<br />
::*Reverse: cctcgcccttgctcaccat|ACTCTATTCCTTTTTGGTGATTC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Friday (27/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
{|cellspacing="20"<br />
|[[File:CAM_120727_1_edited.jpg|200px|left|thumb|Vector amplification gel. Lanes 2-4 Lux containing vector. Lanes 5-7 Fluorescent construct vector. No products from this gel were amplified.]]<br />
|[[File:CAM_120727_2_edited.jpg|200px|left|thumb|Various. Lanes 3-5 mOrange amplification. Lanes 6-8 eCFP (E0020) amplification. mOrange amplification did not work.]]<br />
|[[File:CAM_120727_3_edited.jpg|200px|left|thumb|Small products for fluorescent construct. Lanes 1-3 Terminator (B0015). Lanes 4-6 Promotor pVEG + SpoVG (K143053).]]<br />
|-<br />
|[[File:CAM_120727_4_edited.jpg|200px|left|thumb|Various. Lanes 2-4 eYFP (E0030) amplification. Lanes 5-7 Mg2+ vector +8 codons. Lane 8 Mg2+ vector -8 codons. Lane 8 amplification did not work.]]<br />
|[[File:CAM_120727_5_edited.jpg|200px|left|thumb|Mg2+ riboswitch gel. Lanes 6+7 positive and negative controls respectively for entire run. Lanes 3-5 genomic riboswitch amplification -8 codons. Lanes 2+3 vector -8 codons.]]<br />
|}<br />
<br />
*PCR fragments for Mg2+ riboswitch, luxA/mOrange fusion and fluorescent construct from yesterday separated on gels. 90mins at 100V.<br />
<br />
*Mostly successful, but will need to repeat four runs: Three vectors (fluorescent, fusion (lux) and Mg2+ riboswitch (-8 codons) and mOrange gene.<br />
<br />
<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of successfully amplified DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful CFP, YFP, B0015, Pveg + SpoVG (K143053), riboswitch and vector DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
==Week 6==<br />
<br />
==Week 7==<br />
<br />
==Week 8==<br />
<br />
==Week 9==<br />
<br />
==Week 10==<br />
<br />
==Week 11==<br />
<br />
==Week 12==<br />
<br />
==Week 13==<br />
<br />
==Week 14==<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Ribosense/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Ribosense/LabbookTeam:Cambridge/Ribosense/Labbook2012-10-27T02:58:25Z<p>Olijme: </p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Labbook");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= General Labbook =<br />
<br />
==Week 4 ==<br />
<br />
===Tuesday (17/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of MGRS vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 58 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 180secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain 168 used as template for this experiment.<br />
<br />
* Primers used:<br />
<br />
:* Forward: cggagggagacgattttgTGTTCCGTAATTGTGATGTAAG<br />
<br />
:* Reverse: acaccggcatactctgcgacGTCATAGGTCATGTTTTGAACC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Wednesday (18/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:Mg2+ Gel PCR 1.jpg|250px|right|thumb|Results of gel electrophoresis of PCR fragments from yesterday. 550bp fragments in lanes 2+3 were removed before the image was taken]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2 + 3: Riboswitch DNA from genome (replicates) - 550bp fragment expected.<br />
<br />
:*Lane 4 + 5: Vector DNA from pJS130 (replicates)- Chloramphenicol resistance marker - 9.0kbp fragment expected<br />
<br />
:*Lane 6: Postitive control - 1.9kbp fragment expected<br />
<br />
*Riboswitch DNA was successfully amplified. However, vector DNA was not. Given that the postive control was also successful, it seems likely that something went wrong with some stage before the PCR amplification. We will try to rectify the problem tomorrow.<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of riboswitch DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful riboswitch DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
===Thursday (19/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 55 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 240secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
*Settings changed - Annealing temperature and elongation time - attempting to debug PCR.<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:PCR Gel Mg2+ 2.jpg|right|250px|thumb|PCR products from today. Note the unusual band in the negative control and the vector lanes]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2, 3 + 4: Vector DNA from pJS130 (replicates) - 9.0kbp fragment expected<br />
<br />
:*Lane 5: Postitive control - 1.9kbp fragment expected<br />
<br />
:*Lane 6: Negative control - no fragments expected<br />
<br />
*Once more, the PCR appears to have failed. We will try to redesign the primers tomorrow to make them functional.<br />
<br />
==Week 5==<br />
<br />
==Week 6==<br />
<br />
==Week 7==<br />
<br />
==Week 8==<br />
<br />
==Week 9==<br />
<br />
==Week 10==<br />
<br />
==Week 11==<br />
<br />
==Week 12==<br />
<br />
==Week 13==<br />
<br />
==Week 14==<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Ribosense/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Ribosense/LabbookTeam:Cambridge/Ribosense/Labbook2012-10-27T02:56:40Z<p>Olijme: /* Week 4 */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Labbook");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= General Labbook =<br />
<br />
==Week 4 ==<br />
<br />
===Tuesday (17/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of MGRS vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 58 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 180secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain 168 used as template for this experiment.<br />
<br />
* Primers used:<br />
<br />
:* Forward: cggagggagacgattttgTGTTCCGTAATTGTGATGTAAG<br />
<br />
:* Reverse: acaccggcatactctgcgacGTCATAGGTCATGTTTTGAACC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Wednesday (18/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:Mg2+ Gel PCR 1.jpg|250px|right|thumb|Results of gel electrophoresis of PCR fragments from yesterday. 550bp fragments in lanes 2+3 were removed before the image was taken]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2 + 3: Riboswitch DNA from genome (replicates) - 550bp fragment expected.<br />
<br />
:*Lane 4 + 5: Vector DNA from pJS130 (replicates)- Chloramphenicol resistance marker - 9.0kbp fragment expected<br />
<br />
:*Lane 6: Postitive control - 1.9kbp fragment expected<br />
<br />
*Riboswitch DNA was successfully amplified. However, vector DNA was not. Given that the postive control was also successful, it seems likely that something went wrong with some stage before the PCR amplification. We will try to rectify the problem tomorrow.<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of riboswitch DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful riboswitch DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
===Thursday (19/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 55 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 240secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
*Settings changed - Annealing temperature and elongation time - attempting to debug PCR.<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:PCR Gel Mg2+ 2.jpg|right|250px|thumb|PCR products from today. Note the unusual band in the negative control and the vector lanes]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2, 3 + 4: Vector DNA from pJS130 (replicates) - 9.0kbp fragment expected<br />
<br />
:*Lane 5: Postitive control - 1.9kbp fragment expected<br />
<br />
:*Lane 6: Negative control - no fragments expected<br />
<br />
*Once more, the PCR appears to have failed. We will try to redesign the primers tomorrow to make them functional.<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Ribosense/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Ribosense/LabbookTeam:Cambridge/Ribosense/Labbook2012-10-27T02:55:32Z<p>Olijme: /* Wednesday (18/07/12) */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Labbook");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= General Labbook =<br />
<br />
==Week 4 ==<br />
<br />
===Tuesday (17/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of MGRS vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 58 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 180secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain 168 used as template for this experiment.<br />
<br />
* Primers used:<br />
<br />
:* Forward: cggagggagacgattttgTGTTCCGTAATTGTGATGTAAG<br />
<br />
:* Reverse: acaccggcatactctgcgacGTCATAGGTCATGTTTTGAACC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Wednesday (18/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:Mg2+ Gel PCR 1.jpg|250px|right|thumb|Results of gel electrophoresis of PCR fragments from yesterday. 550bp fragments in lanes 2+3 were removed before the image was taken]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2 + 3: Riboswitch DNA from genome (replicates) - 550bp fragment expected.<br />
<br />
:*Lane 4 + 5: Vector DNA from pJS130 (replicates)- Chloramphenicol resistance marker - 9.0kbp fragment expected<br />
<br />
:*Lane 6: Postitive control - 1.9kbp fragment expected<br />
<br />
*Riboswitch DNA was successfully amplified. However, vector DNA was not. Given that the postive control was also successful, it seems likely that something went wrong with some stage before the PCR amplification. We will try to rectify the problem tomorrow.<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of riboswitch DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful riboswitch DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Ribosense/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Ribosense/LabbookTeam:Cambridge/Ribosense/Labbook2012-10-27T02:55:01Z<p>Olijme: /* Tuesday (17/07/12) */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Labbook");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= General Labbook =<br />
<br />
==Week 4 ==<br />
<br />
===Tuesday (17/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of MGRS vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 58 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 180secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain 168 used as template for this experiment.<br />
<br />
* Primers used:<br />
<br />
:* Forward: cggagggagacgattttgTGTTCCGTAATTGTGATGTAAG<br />
<br />
:* Reverse: acaccggcatactctgcgacGTCATAGGTCATGTTTTGAACC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
===Wednesday (18/07/12)===<br />
<br />
'''Ribosense: [[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
<br />
*PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.<br />
<br />
[[File:Mg2+ Gel PCR 1.jpg|250px|right|thumb|Results of gel electrophoresis of PCR fragments from yesterday. 550bp fragments in lanes 2+3 were removed before the image was taken]]<br />
<br />
:*Lane 1: Ladder<br />
<br />
:*Lane 2 + 3: Riboswitch DNA from genome (replicates) - 550bp fragment expected.<br />
<br />
:*Lane 4 + 5: Vector DNA from pJS130 (replicates)- Chloramphenicol resistance marker - 9.0kbp fragment expected<br />
<br />
:*Lane 6: Postitive control - 1.9kbp fragment expected<br />
<br />
*Riboswitch DNA was successfully amplified. However, vector DNA was not. Given that the postive control was also successful, it seems likely that something went wrong with some stage before the PCR amplification. We will try to rectify the problem tomorrow.<br />
<br />
'''Ribosense: [[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of riboswitch DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful riboswitch DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Ribosense/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Ribosense/LabbookTeam:Cambridge/Ribosense/Labbook2012-10-27T02:54:07Z<p>Olijme: /* Tuesday (17/07/12) */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Labbook");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= General Labbook =<br />
<br />
==Week 4 ==<br />
<br />
===Tuesday (17/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of MGRS vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 58 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 180secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
'''[[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain 168 used as template for this experiment.<br />
<br />
* Primers used:<br />
<br />
:* Forward: cggagggagacgattttgTGTTCCGTAATTGTGATGTAAG<br />
<br />
:* Reverse: acaccggcatactctgcgacGTCATAGGTCATGTTTTGAACC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Ribosense/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Ribosense/LabbookTeam:Cambridge/Ribosense/Labbook2012-10-27T02:53:26Z<p>Olijme: /* Week 4 */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Labbook");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= General Labbook =<br />
<br />
==Week 4 ==<br />
<br />
===Tuesday (17/07/12)===<br />
<br />
'''Ribosense: [[Team:Cambridge/Protocols/PCRProtocol|PCR of vector]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.<br />
<br />
*Primers:<br />
<br />
:*Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg<br />
<br />
:*Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 58 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 180secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
'''Ribosense: [[Team:Cambridge/Protocols/PCRcolony|PCR of riboswitch DNA from ''bacillus'' genome]]'''<br />
<br />
----<br />
<br />
* Colony of strain 168 used as template for this experiment.<br />
<br />
* Primers used:<br />
<br />
:* Forward: cggagggagacgattttgTGTTCCGTAATTGTGATGTAAG<br />
<br />
:* Reverse: acaccggcatactctgcgacGTCATAGGTCATGTTTTGAACC<br />
<br />
* PCR settings - as above (run in parallel).<br />
<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Ribosense/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Biologger/OverviewTeam:Cambridge/Biologger/Overview2012-10-27T02:50:10Z<p>Olijme: /* Biologger Overview */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Overview");<br />
}<br />
<br />
//down<br />
if (keyCode == 40)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/SD/Overview");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Biologger/DesignProcess");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Overview"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Overview"><br />
<div id="vert_RS" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Overview"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Overview"><br />
<div id="vert_BL_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Overview"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= Biologger Overview =<br />
Instrumentation (Biologger) was a vital aspect of our project in the development of the biosensing kit. The term instrumentation includes all the mechanical, electrical and software components which allow the incorporation of our multiple independent modules into a working and field-ready kit. The design process as well as the first experiments done that enabled the development of this kit can be seen at our <html><u><a href="https://2012.igem.org/Team:Cambridge/Biologger/DesignProcess" style="color:#000066">Design process page.</a></u></html> The Design page also includes further improvements that could be done on our Biologger kit.<br />
The results obtained after the testing of the instrumentation with biological samples as well as videos of our instrumentation in action can be seen in our <html><u><a href="https://2012.igem.org/Team:Cambridge/Biologger/Results" style="color:#000066">Results page.</a></u></html><br />
<br />
=== Mechanical ===<br />
[[File:kit.jpg|200px|thumb|left|Mechanical chassis]]<br />
The mechanical chassis prototype, as can be seen from the image on the left, was made using two materials: foam and aluminium. Foam was chosen due to its easy manipulation and aluminium due to its excellent strength to weight ratio. The prototype includes a rotary mechanism (a central metal axon connected to the cuvette holder cylinder), which can be driven in steps by a DC electric motor (and a suitable code). It should be noted at this point that this is merely one possible implementation of suitable instrumentation and in particular it was one that could be developed as a prototype, always within the constraints of this project. We do not wish to claim that this is an ideal solution!<br />
[[File:Cuvette_holder_function.JPG|200px|thumb|right|Cuvette holder coated with mylar film concentrating light from bio-luminescent E.coli]]<br />
The purpose is that our self-developed sensor, which was made using two light dependent resistors (as can be seen in the design page), an orange and a blue theatrical filter, takes multiple readings from different biosensors, each found in a different cuvette. It should be noted that each cuvette holder is coated on the inside with highly reflective mylar film (image on the right). In this way, most of the light produced by the bacteria is concentrated for more accurate sensor measurements.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
== Electrical ==<br />
[[File:bluetooth.jpg|100px|thumb|left|Blusmirf Gold Bluetooth Modem]]<br />
[[File:arduino.jpg|200px|thumb|left|Arduino circuitry]]<br />
The hardware/software electronic interface was realised using an Arduino microcontroller. The arduino circuitry, as illustrated on the left, is made up of our sensor, the motor, and a PCB or a breadboard (both were during our project). In cases where the motor to be used has too strong a starting torque a second transistor is required. The Bluetooth modem (Bluesmirf Gold) is an extra to be used when communication with mobile devices (e.g. with Android operating system) is required. The LDRs of our sensor sit in a biased potential divider circuit allowing for a direct ratiometric output without further calculations needed to be made in the software (more information, including testing data for our sensor can be found in the design page as well). <br />
<br />
The circuitry is incorporated into the mechanical chassis for an attractive, ergonomic overall design. The functionality of the system, including the sensitivity of our manually-made sensor setup orientated correctly using our manually-made cuvette holders was tested with success! The results can be seen in our [https://2012.igem.org/Team:Cambridge/Biologger/Results<u><span style="color:#000066">Results page.</span></u>]<br />
The code of the pre-set C++ program for driving the arduino can be found and downloaded in our [https://www.dropbox.com/sh/ol8727rn5o5ir0a/i5-6udXisJ<u><span style="color:#000066">Arduino Code download page.</span></u>]Note that there are two different programs: one for PCs and one for android devices.<br />
<br />
Below the schematic circuit diagram of the sensor can be seen together with the mathematical equation relating LDR resistances and sensor readings.<br />
<br />
[[File:Circuit_diagram.png|250px|thumb|center|Schematic circuit diagram of the sensor - Potential difference is taken across the blue filtered LDR]]<br />
<br />
[[File:Equation_cam.png|600px|thumb|center|Equation relating LDR resistances to sensor output]]<br />
<br />
== Software==<br />
<br />
Software applications were developed, as mentioned before, for both PCs and android devices. This was done in order to provide extra flexibility as the potential use of our kit is field work. The computer software is written in the free open-source language python with cross-platform wxWidgets used to implement a GUI. The idea was to develop a fully functional GUI for collecting sensor data from all six inputs and display these as line graphs and in a final bar chart. <br />
<br />
The image below on the right is a screengrab of the GUI under development and testing its ratiometric ability. The higher values are when one LDR is covered, the lower for the other and no change is observed when both are illuminated equally. By controlling the illumination, we managed to make our application write iGEM in morse code (image on the right)! The android GUI was made in Java using Eclipse editing mostly [http://www.amarino-toolkit.net/index.php/home.html<u><span style="color:#000066">Amarino</span></u>]<br />
projects' open-source code (General Public License). The first screen (image below on the left) asks for the address of the Bluetooth modem connected to Arduino. B.Subtilights was the first logo of our team, and as we decided not to abandon it completely, it is the logo included in this application. This application is also functional as it can successfully connect, read real-time data and plot them on any Android phone/tablet.<br />
<br />
The code (for programmers) as well as a ready application to be downloaded (for non-programmers this is the Bio_Logger.apk file) can be found in our [https://www.dropbox.com/sh/eg8u2epwkhr2zfh/H3bf-wN1d_<u><span style="color:#000066">Android application download page.</span></u>]<br />
The code for the Pyhton program can also be found and be downloaded in our [https://www.dropbox.com/sh/z9h542jeulkplfq/lKnvzEXydB<u><span style="color:#000066">Python software download page.</span></u>] <br />
<br />
It should be noted that amarino_2.apk, found in the link above must also be downloaded on the android device for our application (Bio_Logger) to be perfectly functional, as it requires one of the amarino libraries. <br />
<br />
[[File:androidapp.jpg|320px|thumb|left|Android application start page]]<br />
[[File:python.jpg|225px|thumb|left|Python program for PC]]<br />
<br />
<br />
<br />
<html><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
</html><br />
<br />
== Cost ==<br />
<br />
One of the most important motives for the development of our project was that it offers a low-cost solution. Therefore, below there is an analysis of the biologger cost. <br />
<br />
*Arduino Experimentation Kit <br />
$25.00<br />
<br />
*Light - dependent resistors 70kΩ/200kΩ <br />
$2.00<br />
<br />
*Colored Gel Filters <br />
$2.00<br />
<br />
*Materials for mechanical chassis <br />
$6.00<br />
<br />
'''Total $35.00'''<br />
<br />
Optional: Bluesmirf Gold Bluetooth Modem <br />
$50.00<br />
<br />
Total: $35/$85<br />
<br />
<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
<a href="/Team:Cambridge/Biologger/Overview"><br />
<div id="hor_overview_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="hor_labbook" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Biologger/DesignProcess"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Diary/TheFinalMonthTeam:Cambridge/Diary/TheFinalMonth2012-10-27T02:47:18Z<p>Olijme: /* Our final month of work on Sporduino */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<div id="template_content_wide" style="position: absolute; top: 200px; left: 40px; height: 620px; width: 1110px; overflow: auto; overflow-y: scroll;"><br />
<br />
</html><br />
{|align="center"<br />
!align="center"|Week:<br />
!align="center"|[[Team:Cambridge/Diary/Week 1|1]] <br />
!align="center"|[[Team:Cambridge/Diary/Week 2|2]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 3|3]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 4|4]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 5|5]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 6|6]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 7|7]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 8|8]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 9|9]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 10|10]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 11|11]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 12|12]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 13|13]]<br />
!align="center"|[[Team:Cambridge/Diary/Week 14|14]]<br />
!align="center"|[[Team:Cambridge/Diary/TheFinalMonth|The Final Month]]<br />
|}<br />
<br />
=Our final month of work on Sporduino=<br />
<br />
So, unsurprisingly, given that we have been lauched into term time at the same time as finishing off our project, not as much work has been done as would necessarilly be desired. Alas, it's tough to juggle the approximately forty journals worth of reading ''and'' two projects. But we have made some progress.<br />
<br />
Two more biobricks (the fluoride riboswitch and ratiometrica) have successfully been produced, and will hopefully be submitted to the registry ASAP. On the subject of ratiometrica, we have attempted some more plate reader assays - alas No. 2: M9 fails to grow cells with any competency. Or else we are just incompetent at making M9. In any case, the data that we had before the European jamboree remains our most useful. Attempts to insert the fluoride riboswitch into ratiometrica have also failed, possibly due to the tiny size of the riboswitch insert.<br />
<br />
We have, however, managed to get some data regarding our luciferase construct from DNA2.0. Matthew Hawkeye from the nanophotonics department of the University has kindly helped Tom to determine the emission spectrum of the construct, both induced and uninduced. Alas No. 3, we were unable to replicate the results of the original paper which demonstrated a spectral shift upon the addition of mOrange. Toxicity appears to have increased in the presence of IPTG, which could be stretched to a positive finding (it would appear to indicate that we are producing considerably greater quantities of the LUXA - mOrange fusion than under normal conditions, which puts the metabolism of the cell under considerable strain). We would be hard pressed to consider this an optimal result, however.<br />
<br />
Interestingly, <html><u><a href="https://2012.igem.org/Team:Cambridge/HumanPractices/Interview" style="color:#000066">Konrad Seigfried</a></u></html> got back in touch with us. He was hoping to form a collaborative effort in producing an EU project proposal involving the use of biosensors in general - and with our fluoride biosensor prototype in particular! Unfortunately, we were unable help in any but the most superficial way - we sent him our data concerning the various characterization experiments that we had performed. Alas No. 4, there simply wasn't the time (or the lab based resources) to collaborate any further.<br />
<br />
Stewart has been collaborating with the Gronegen team<br />
<br />
<html><br />
</div><br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/Overview/DesignProcessTeam:Cambridge/Overview/DesignProcess2012-10-27T02:31:24Z<p>Olijme: /* Market Research */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/HumanPractices/MarketResearch");<br />
}<br />
<br />
//down<br />
if (keyCode == 40)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/DesignProcess");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Parts");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Overview");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/MarketResearch"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/DesignProcess"><br />
<div id="vert_OV_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="vert_RS" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/DesignProcess"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/DesignProcess"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/DesignProcess"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= Design Process =<br />
We approached our project through a typical design process, working from our initial project aim and objectives, through market research, investigations, to our implementation and solution. This page contains a more detailed account of our project throughout the summer.<br />
<br />
==Aim==<br />
Every good design process must have a clear aim. Ours was to take a step towards realising the full potential of a group of well characterised parts, the biosensors available within the registry, by developing a prototype kit which could be used effectively and practically in real-world applications. In other words, we aimed to engineer an easy to use product, centred around biobricks, and aimed at the end user. Our team has realised this potential and have developed a kit which has real world uses now, as well as potential applications in the future.<br />
<br />
==Market Research==<br />
<br />
Having decided that the primary aim of our project was the design of a practical useful product, the first thing we needed was to find its potential use as well as a possible market. The ideal market would fulfill at least three requirements: <br />
*Face a real problem which could be solved by our product. <br />
*Have the financial capacity to obtain/create our product. <br />
*Be currently in the state where access to similar equipment is limited, and therefore the impact of our solution would be maximised<br />
<br />
We aimed to tackle issues concerning the welfare and standard of living of people, in particular those who might lack the resources to tackle them themselves. <br />
<br />
To help inform the overall shape of our project, as well as the specifics of our design, we talked to <html><u><a href="https://2012.igem.org/Team:Cambridge/HumanPractices/Interview" style="color:#000066">Konrad Seigfried</a></u></html>, a scientist who has already had the chance to test a bioreporter construct in the field.<br />
<br />
More details about our market research can be found on our <br />
[[Team:Cambridge/HumanPractices/MarketResearch|human practices page.]]<br />
<br />
==Objectives==<br />
<br />
As stated in our project aims, and justified by the market reasearch above, we wanted to develop a standard for biosensors that is reliable, affordable, portable, open-source, accessible and relevant. These different targets required further condensation before a formal design process can begin. The formal design goals for our project were, therefore, the development of:<br />
<br />
*an output that is reliable, reproducible, and quantitative.<br />
<br />
*a robust, standard platform for biosensing inputs.<br />
<br />
*a system for the storage and distribution of biosensors for straightforward use in multiple applications.<br />
<br />
*a system that is rooted in real world applications that can bring about a positive change in the world<br />
<br />
==Design considerations==<br />
<br />
===Inputs===<br />
<br />
It's common sense that without a reliable input system, output systems, however robust, cannot be trusted to give meaningful results. It is therefore important that the response to a given input from a biosensor is well characterised (with response curves) under different conditions. However, to truly revolutionise biosensing we would also require a standard platform which could sense a multitude of analytes. This would allow for better characterisation and all additional information about a sensor's function under different conditions to be acquired with one fewer parameter which would need to be changed. We would also like the response curves to be relatively linear across a wide range such that different toxicity thresholds are detectable using the same system. Ideally, we would also like a system that could be designed "from scratch" in the future such that there would be no need for an existing response mechanism in an organism to be found before implementation as a biosensor could take place. This goal is a very long way off, but we would like to consider platforms with the potential for it. The input must therefore have the following attributes:<br />
<br />
*A decoupling between the sensing mechanism and its interface with the output system.<br />
*Highly specific analyte discrimination.<br />
*An output response which is highly proportional to the concentration of analyte present.<br />
*The potential for rational redesign, possibly through the use of software tools.<br />
<br />
===Processing===<br />
<br />
All biosensors currently in the registry only use a single output to relay information about the concentration of an analyte. Because there is great potential for differences in culture homogeneity, and because the productivity of cultures is proportional to their cell density, this often leads to poorly reproducible and unreliable results. We therefore desire some processing to be performed (without specifying where in the whole system, yet) which factors in these variables and allows for a much more accurate readout. With accuracy also comes the ability to provide more quantified readouts, assuming the system is capable of the linear response required for such readings. We also want to be able to tune the linear response range based on the end users' desired implementation, in order to further improve usefulness. The processing system must therefore have the following attributes:<br />
<br />
*The ability to compensate for culture variability between assays<br />
*The ability to make calculations over a wide range of concentrations with similar, high levels of precision across this range.<br />
<br />
===Outputs===<br />
<br />
In order for a project that fits our goals to be commercially successful, it is absolutely vital that a quantitative, numerical, robust, and flexible output exists to relay information to a user that is an accurate representation of the processed input. Outputs fitting this description are commonplace in nearly all other scientific fields where the ability to collect and process data has not only eased interpretation of experiments but also allowed a much faster development of understanding, and ultimately technology, in those fields. In biology however, due to the complexity and inherent variability of the systems under scrutiny, it has been difficult to design such outputs. Additionally, the outputs which exist are either crude, or expensive to produce or interpret. We therefore desire an output with the following characteristics:<br />
<br />
*Provides reproducible, quantitative data under many environmental conditions with small error margins. <br />
*Displays data to a user in an intuitive manner that is easy to interpret.<br />
*Be flexible enough to support use in multiple environments<br />
*Does not require specific environmental domains to produce an undistorted post-processing signal.<br />
*Easy to interface with data processing tools<br />
*Capable of supporting multiple readouts from different assays.<br />
*Cheap<br />
<br />
===Sporage & Distribution===<br />
Design considerations must be in place such that our biosensing platform can be distributed and stored easily and cheaply, whether it be for laboratory testing purposes or field applications in places lacking appropriate facilities (for example, areas which cannot keep cultures frozen, or even provide electrical power for a sensor). This relates particularly well to our human practices where we learnt that a major problem to tackle in developing countries is a lack of the conventional biolab infrastructure which most, current technologies rely on. <br />
<br />
The design criteria for this aspect of the product are thus as follows:<br />
<br />
*Deliverable worldwide <br />
*Can be stored long term without appreciable loss of quality<br />
*Both of the above without requirement for high powered or high tech infrastructure<br />
<html><h3><span class="mw-headline" id="Ribosens"></span></h3></html><br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<a href="/Team:Cambridge/Overview/Overview"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Overview/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/DesignProcess"><br />
<div id="hor_designprocess_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="hor_labbook" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Overview/Parts"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/HumanPractices/MarketResearchTeam:Cambridge/HumanPractices/MarketResearch2012-10-27T02:30:43Z<p>Olijme: </p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//down<br />
if (keyCode == 40)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/DesignProcess");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/HumanPractices/OutreachCollaboration");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/HumanPractices/Overview");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/MarketResearch"><br />
<div id="vert_HP_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/DesignProcess"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="vert_RS" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/DesignProcess"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/DesignProcess"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/DesignProcess"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
=Human Practices – Groundwater contamination in rural India=<br />
<br />
Below is a summary of our research into the suitability of our system for use in the field. <br />
<br />
===Finding a Market===<br />
<br />
The potential use of our system in this context first came to light when we became aware of WaterLifeIndia Ltd who won an award for inclusive business models at the G20 conference earlier this year for their work in providing clean, safe water in response to groundwater contamination for B.O.P. (economic base of the pyramid) customers in India.<br />
<br />
We then contacted the British Red Cross, often the first on the ground when disaster strikes, to ask about the human impact of water contamination. When first arriving, all water must be treated as contaminated until it has been tested and shown not to be. For people living in areas with chronic contamination problems, finding clean water is an incredibly time consuming process which can take many hours out of peoples (predominantly women’s) days. <br />
<br />
Further research showed that the problem is extensive and as of April 2011, Arsenic, Fluoride, Iron, Salinity and Nitrate groundwater contamination continued to be a problem in many states – especially in rural areas. Before these problems can be tackled, the scope of the problem must first be determined, requiring sensitive detection apparatus.<br />
<br />
[[File:FluorosisTeeth.jpg|250px|right|thumb|The consequences of fluoride contamination of ground water. Fluoride has been shown to damage the enamel of teeth in children between the ages of 0-8. This dental fluorosis is often accompanied by skeletal fluorosis, associated with skeletal pain and problems with movement. Excessive fluoride ingestion has also been linked to neurological damage in young children.]]<br />
<br />
<br />
<span style="color:green">'''Who is our market?'''</span><br />
<br />
Groundwater contamination can be caused by a variety of factors ranging from natural disasters to improper disposal of industrial waste. Within the topic of groundwater contamination therefore, there is still substantial variety among potential customers. We anticipate that these customers will be looking at levels of a variety of contaminants in different areas though we anticipate that they will need their testing system to provide reliable, accurate quantitative data about more than one contaminant and that testing will probably involve multiple tests over a prolonged time span. Customers may include researchers, charity workers, public health workers or heavy industries aiming to reduce their environmental impact.<br />
<br />
<br />
<span style="color:green">'''What are the current options available?'''</span><br />
<br />
Because of the rural nature of many of the presumed testing sites, standard laboratory equipment is impractical. A portable system is therefore a necessity.<br />
<br />
Currently, two main types of sensing system are readily available for purchase.<br />
<br />
The first is a strip test system. The great advantages of this system is that it is far cheaper than the alternative and highly portable – the strips are extremely light and can easily be carried in pockets if more than one site within a location is to be tested. It is also quick and easy to acquire. Searching the internet for ‘groundwater testing kit’ brings up dozens of websites from which these systems can be purchased instantly and in the possession of the customer within days.<br />
<br />
The downsides to this system are that:<br />
<br />
# the tests are disposable and suitable for a single use only meaning that many have to be used and the product continuously repurchased if long term testing is going to be considered.<br />
# each strip will only test for one contaminant. Where a groundwater source is contaminated, it is unlikely that only a single potential contaminant will be of interest. For highly focussed research this may be acceptable, but in the case of broader research more than one kind of test strip will almost certainly be needed, and as with the problem of disposability, this will push up the costs.<br />
# These tests are often not highly quantitative – quantitative to the extent of orders of magnitude but without providing precise information about contamination levels which makes them unsuitable for detailed examination of contamination levels at a source, especially if the study involves taking multiple readings over a period of time, when the change could be small.<br />
<br />
[[File:TestkitComparison.jpeg|250px|left|thumb|A comparison of the <html><u><a href="https://2012.igem.org/Team:Cambridge/HumanPractices/Interview" style="color:#000066">ARSOlux kit</a></u></html> (160 assays) (left) - a bioreporter kit - and the Arsonator kit (60 assays) (right) - an electronic water testing system. From Siegfried et al. Environ. Sci. Technol. 2012]]<br />
<br />
The other major option is an electronic water testing system. These have the advantages of being far more quantitative, largely reusable and often considering more than one contaminant within the same system. As with the strip tests however, there are major disadvantages. <br />
<br />
# acquiring these systems is not as easy. Often, instead of prices being offered, a quote must be obtained. A level of customisation is sometimes possible with the technology but it is invariably by far the more expensive of the two options.<br />
# electronic systems tend to be bigger and heavier, with complete systems often coming in bulky cases that would be difficult to transport without a vehicle. These systems act more as a field lab, and as such portability is vastly reduced.<br />
<br />
The major disadvantages to these systems are on one side a lack of quantitative results and reusability and on the other high, often prohibitive, costs.<br />
<br />
<br />
<span style="color:green">'''How our system is different'''</span><br />
<br />
Our system has been designed to be relatively low cost and the prices we have paid in producing the project, while not high, would be dramatically reduced by mass production. The system is light and portable but, between the output system and the implementation system, provides highly quantitative data. While the cuvettes and bacteria are single use, the implementation system is reusable. <br />
<br />
We consider there to be a potential market for a reliable, accurate, precise, quantitative measuring system that without the price tag of current electronic systems. We also feel that our system could fill this niche.<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
<br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="hor_overview" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/HumanPractices/MarketResearch"><br />
<div id="hor_marketresearch_on" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/HumanPractices/OutreachCollaboration"><br />
<div id="hor_outreach" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/HumanPractices/FutureDirections"><br />
<div id="hor_futuredirections" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/HumanPractices/OutreachCollaboration"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/Team:Cambridge/HumanPractices/MarketResearchTeam:Cambridge/HumanPractices/MarketResearch2012-10-27T02:29:09Z<p>Olijme: /* Finding a Market */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//down<br />
if (keyCode == 40)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/DesignProcess");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/HumanPractices/OutreachCollaboration");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/HumanPractices/Overview");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/MarketResearch"><br />
<div id="vert_HP_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/DesignProcess"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="vert_RS" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/DesignProcess"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/DesignProcess"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/DesignProcess"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
=Human Practices – Groundwater contamination in rural India=<br />
<br />
Below is a summary of our research into the suitability of our system for use in the field. <br />
<br />
===Finding a Market===<br />
<br />
The potential use of our system in this context first came to light when we became aware of WaterLifeIndia Ltd who won an award for inclusive business models at the G20 conference earlier this year for their work in providing clean, safe water in response to groundwater contamination for B.O.P. (economic base of the pyramid) customers in India.<br />
<br />
We then contacted the British Red Cross, often the first on the ground when disaster strikes, to ask about the human impact of water contamination. When first arriving, all water must be treated as contaminated until it has been tested and shown not to be. For people living in areas with chronic contamination problems, finding clean water is an incredibly time consuming process which can take many hours out of peoples (predominantly women’s) days. <br />
<br />
Further research showed that the problem is extensive and as of April 2011, Arsenic, Fluoride, Iron, Salinity and Nitrate groundwater contamination continued to be a problem in many states – especially in rural areas. Before these problems can be tackled, the scope of the problem must first be determined, requiring sensitive detection apparatus.<br />
<br />
[[File:FluorosisTeeth.jpg|250px|right|thumb|The consequences of fluoride contamination of ground water. Fluoride has been shown to damage the enamel of teeth in children between the ages of 0-8. This dental fluorosis is often accompanied by skeletal fluorosis, associated with skeletal pain and problems with movement. Excessive fluoride ingestion has also been linked to neurological damage in young children.]]<br />
<br />
<br />
<span style="color:green">'''Who is our market?'''</span><br />
<br />
Groundwater contamination can be caused by a variety of factors ranging from natural disasters to improper disposal of industrial waste. Within the topic of groundwater contamination therefore, there is still substantial variety among potential customers. We anticipate that these customers will be looking at levels of a variety of contaminants in different areas though we anticipate that they will need their testing system to provide reliable, accurate quantitative data about more than one contaminant and that testing will probably involve multiple tests over a prolonged time span. Customers may include researchers, charity workers, public health workers or heavy industries aiming to reduce their environmental impact.<br />
<br />
<br />
<span style="color:green">'''What are the current options available?'''</span><br />
<br />
Because of the rural nature of many of the presumed testing sites, standard laboratory equipment is impractical. A portable system is therefore a necessity.<br />
<br />
Currently, two main types of sensing system are readily available for purchase.<br />
<br />
The first is a strip test system. The great advantages of this system is that it is far cheaper than the alternative and highly portable – the strips are extremely light and can easily be carried in pockets if more than one site within a location is to be tested. It is also quick and easy to acquire. Searching the internet for ‘groundwater testing kit’ brings up dozens of websites from which these systems can be purchased instantly and in the possession of the customer within days.<br />
<br />
The downsides to this system are that:<br />
<br />
# the tests are disposable and suitable for a single use only meaning that many have to be used and the product continuously repurchased if long term testing is going to be considered.<br />
# each strip will only test for one contaminant. Where a groundwater source is contaminated, it is unlikely that only a single potential contaminant will be of interest. For highly focussed research this may be acceptable, but in the case of broader research more than one kind of test strip will almost certainly be needed, and as with the problem of disposability, this will push up the costs.<br />
# These tests are often not highly quantitative – quantitative to the extent of orders of magnitude but without providing precise information about contamination levels which makes them unsuitable for detailed examination of contamination levels at a source, especially if the study involves taking multiple readings over a period of time, when the change could be small.<br />
<br />
[[File:TestkitComparison.jpeg|250px|left|thumb|A comparison of the [[<html><u><a href="https://2012.igem.org/Team:Cambridge/HumanPractices/Interview" style="color:#000066">ARSOlux kit</a></u></html> (160 assays) (left) - a bioreporter kit - and the Arsonator kit (60 assays) (right) - an electronic water testing system. From Siegfried et al. Environ. Sci. Technol. 2012]]<br />
<br />
The other major option is an electronic water testing system. These have the advantages of being far more quantitative, largely reusable and often considering more than one contaminant within the same system. As with the strip tests however, there are major disadvantages. <br />
<br />
# acquiring these systems is not as easy. Often, instead of prices being offered, a quote must be obtained. A level of customisation is sometimes possible with the technology but it is invariably by far the more expensive of the two options.<br />
# electronic systems tend to be bigger and heavier, with complete systems often coming in bulky cases that would be difficult to transport without a vehicle. These systems act more as a field lab, and as such portability is vastly reduced.<br />
<br />
The major disadvantages to these systems are on one side a lack of quantitative results and reusability and on the other high, often prohibitive, costs.<br />
<br />
<br />
<span style="color:green">'''How our system is different'''</span><br />
<br />
Our system has been designed to be relatively low cost and the prices we have paid in producing the project, while not high, would be dramatically reduced by mass production. The system is light and portable but, between the output system and the implementation system, provides highly quantitative data. While the cuvettes and bacteria are single use, the implementation system is reusable. <br />
<br />
We consider there to be a potential market for a reliable, accurate, precise, quantitative measuring system that without the price tag of current electronic systems. We also feel that our system could fill this niche.<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
<br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="hor_overview" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/HumanPractices/MarketResearch"><br />
<div id="hor_marketresearch_on" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/HumanPractices/OutreachCollaboration"><br />
<div id="hor_outreach" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/HumanPractices/FutureDirections"><br />
<div id="hor_futuredirections" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/HumanPractices/OutreachCollaboration"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/File:EngineeringLogo.gifFile:EngineeringLogo.gif2012-10-27T01:58:20Z<p>Olijme: </p>
<hr />
<div></div>Olijmehttp://2012.igem.org/Team:Cambridge/SponsorsTeam:Cambridge/Sponsors2012-10-27T01:58:07Z<p>Olijme: </p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<div id="template_content_wide" style="position: absolute; top: 200px; left: 40px; height: 620px; width: 1110px; overflow: auto; overflow-y: scroll;"><br />
<br />
</html><br />
<br />
= Sponsors =<br />
<br />
<br />
Many thanks to all of the sponsors who have made this project possible. A list of our sponsors is displayed below with links to their webpages.<br />
<br />
{|cellspacing="50"<br />
!align="left"|[[Image:Cambio_logo.jpg|200px|link=http://www.cambio.co.uk]]<br />
!align="center"|[[Image:Wtvm050454.jpg |200px|link=http://www.wellcome.ac.uk ]]<br />
!align="right"|[[Image:CAM_dna20.gif|200px|link=http://www.dna20.com]]<br />
|}<br />
<br />
{|cellspacing="50"<br />
!align="left"|[[Image:Logo_ERASynbio.jpeg|200px|link=http://www.erasynbio.net/]]<br />
!align="center"|[[Image:bioline.jpg|200px|link=http://www.bioline.com]]<br />
!align="right"|[[Image:SL_logo.jpg|200px|link=http://www.starlab.co.uk]]<br />
|}<br />
<br />
{|cellspacing="50"<br />
!align="left"|[[Image:Biomatters_logo_med.png|200px|link=http://www.biomatters.com/]]<br />
!align="center"|[[Image:PlantSci.gif|200px|link=http://http://www.plantsci.cam.ac.uk/]]<br />
!align="right"|[[Image:ZoologyDep.png|200px|link=http://www.zoo.cam.ac.uk/]]<br />
|}<br />
<br />
{|cellspacing="50"<br />
!align="center"|[[Image:EngineeringLogo.gif|200px|link=http://www.eng.cam.ac.uk/]]<br />
|}<br />
<br />
= University of Cambridge =<br />
<br />
We would like to express our gratitude to the following departments for supporting the project and our team members' travelling expenses to Amsterdam and Boston:<br />
<br />
*School of Biological Sciences<br />
*Department of Zoology<br />
*Engineering Department<br />
*Department of Plant Sciences<br />
<br />
= Special Thanks =<br />
<br />
The Cambridge iGEM Team would like to offer our most heartfelt thanks to the following people- without them none of this would have been possible.<br />
<br />
==Haseloff Lab, University of Cambridge==<br />
*James Brown<br />
*Fernan Federici<br />
*Paul Grant<br />
*Nuri Purswani<br />
*PJ Steiner<br />
<br />
==Ajioka Lab, University of Cambridge==<br />
*Orr Yarkoni<br />
<br />
==Breaker Lab, Yale University==<br />
Prof. Ronald Breaker's lab at Yale has kindly provided us with the fluoride riboswitch DNA, transformed cells, and valuable advice.<br />
<br />
*Prof. Ronald Breaker<br />
*Keith Corbino<br />
*Narasimhan Sudarsan<br />
<br />
==Department of Molecular, Microbial and Sttructural Biology, University of connecticut Health Center==<br />
Prof. Setlow's lab provided us with the sequences and strains necessary to complete the Fast Germination BioBrick work.<br />
<br />
*Prof. Peter Setlow<br />
*Dr. Barbara Setlow<br />
<br />
<html><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Olijmehttp://2012.igem.org/File:ZoologyDep.pngFile:ZoologyDep.png2012-10-27T01:52:40Z<p>Olijme: </p>
<hr />
<div></div>Olijme