http://2012.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=50&target=Erik.quandt2012.igem.org - User contributions [en]2024-03-28T08:00:03ZFrom 2012.igem.orgMediaWiki 1.16.0http://2012.igem.org/IGEM_PublicationsIGEM Publications2013-05-01T12:43:12Z<p>Erik.quandt: </p>
<hr />
<div>We encourage iGEM teams to consider publishing and presenting their projects through any of the following:<br />
* [http://www.jbioleng.org/ Journal of Biological Engineering]<br />
* [http://www.theiet.org/ Institution of Engineering and Technology]<br />
<br />
<br />
Please add any publications that have come out of your iGEM team project on this page. Be sure to include your team name, the article title and journal (with details on which edition, etc.), and a link to the article (pdf, or online source).<br />
<br />
Example:<br />
<br />
*'''Journal''': ''Title'' Date [link]<br />
<br />
iGEM publications :<br />
<br />
*'''JBE''': [https://2012.igem.org/Team:Wageningen_UR Team Wageningen UR 2012]; ''The Constructor: a web application optimizing cloning strategies based on modules from the registry of standard biological parts'' 4 September 2012 [http://www.jbioleng.org/content/6/1/14/abstract]<br />
*'''PLoS ONE''': [https://2011.igem.org/Team:Wageningen_UR Team Wageningen UR 2011]; ''A Multi-Platform Flow Device for Microbial (Co-) Cultivation and Microscopic Analysis'' May 14, 2012 [http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0036982]<br />
*'''ACS Synthetic Biology''': [https://2011.igem.org/Team:Peking_R Peking]; ''Automated Design of Genetic Toggle Switch with Predetermined Bistability'' May 4, 2012 [http://pubs.acs.org/doi/abs/10.1021/sb300027y]<br />
*'''ACS Synthetic Biology''': [https://2011.igem.org/Team:Washington/Alkanes/Background Washington 2011]; ''Expanding the Product Profile of a Microbial Alkane Biosynthetic Pathway'' September 12, 2012 [http://pubs.acs.org/doi/full/10.1021/sb300061x]<br />
*'''Molecular Systems Biology''': [http://openwetware.org/wiki/IGEM:Peking/2007 Peking]; ''Synthesizing a novel genetic sequential logic circuit: a push-on push-off switch'' March 9, 2010 [http://www.nature.com/msb/journal/v6/n1/full/msb20102.html]<br />
*'''World Scientific Lecture Notes in Complex Systems''': [https://2010.igem.org/Team:Peking Peking]; ''Network Reverse Engineering Approach in Synthetic Biology'' Feb, 2013 [http://www.worldscientific.com/worldscibooks/10.1142/8400]<br />
*'''Journal of Visualized Experiments''': [https://2011.igem.org/Team:Lyon-INSA-ENS Lyon-INSA-ENS 2011] ''Engineering Adherent Bacteria by Creating a Single Synthetic Curli Operon'' , Nov 2012 [http://www.jove.com/video/4176/]<br />
*'''ACS Synthetic Biology''': [https://2012.igem.org/Team:Austin_Texas UT Austin 2012]; ''Decaffeination and Measurement of Caffeine Content by Addicted Escherichia coli with a Refactored N-Demethylation Operon from Pseudomonas putida CBB5'', March 2013 [http://pubs.acs.org/doi/abs/10.1021/sb4000146]</div>Erik.quandthttp://2012.igem.org/IGEM_PublicationsIGEM Publications2013-05-01T12:42:55Z<p>Erik.quandt: </p>
<hr />
<div>We encourage iGEM teams to consider publishing and presenting their projects through any of the following:<br />
* [http://www.jbioleng.org/ Journal of Biological Engineering]<br />
* [http://www.theiet.org/ Institution of Engineering and Technology]<br />
<br />
<br />
Please add any publications that have come out of your iGEM team project on this page. Be sure to include your team name, the article title and journal (with details on which edition, etc.), and a link to the article (pdf, or online source).<br />
<br />
Example:<br />
<br />
*'''Journal''': ''Title'' Date [link]<br />
<br />
iGEM publications :<br />
<br />
*'''JBE''': [https://2012.igem.org/Team:Wageningen_UR Team Wageningen UR 2012]; ''The Constructor: a web application optimizing cloning strategies based on modules from the registry of standard biological parts'' 4 September 2012 [http://www.jbioleng.org/content/6/1/14/abstract]<br />
*'''PLoS ONE''': [https://2011.igem.org/Team:Wageningen_UR Team Wageningen UR 2011]; ''A Multi-Platform Flow Device for Microbial (Co-) Cultivation and Microscopic Analysis'' May 14, 2012 [http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0036982]<br />
*'''ACS Synthetic Biology''': [https://2011.igem.org/Team:Peking_R Peking]; ''Automated Design of Genetic Toggle Switch with Predetermined Bistability'' May 4, 2012 [http://pubs.acs.org/doi/abs/10.1021/sb300027y]<br />
*'''ACS Synthetic Biology''': [https://2011.igem.org/Team:Washington/Alkanes/Background Washington 2011]; ''Expanding the Product Profile of a Microbial Alkane Biosynthetic Pathway'' September 12, 2012 [http://pubs.acs.org/doi/full/10.1021/sb300061x]<br />
*'''Molecular Systems Biology''': [http://openwetware.org/wiki/IGEM:Peking/2007 Peking]; ''Synthesizing a novel genetic sequential logic circuit: a push-on push-off switch'' March 9, 2010 [http://www.nature.com/msb/journal/v6/n1/full/msb20102.html]<br />
*'''World Scientific Lecture Notes in Complex Systems''': [https://2010.igem.org/Team:Peking Peking]; ''Network Reverse Engineering Approach in Synthetic Biology'' Feb, 2013 [http://www.worldscientific.com/worldscibooks/10.1142/8400]<br />
*'''Journal of Visualized Experiments''': [https://2011.igem.org/Team:Lyon-INSA-ENS Lyon-INSA-ENS 2011] ''Engineering Adherent Bacteria by Creating a Single Synthetic Curli Operon'' , Nov 2012 [http://www.jove.com/video/4176/]<br />
*'''ACS Synthetic Biology''': [https://2012.igem.org/Team:Austin_Texas UT Austin 2012] ''Decaffeination and Measurement of Caffeine Content by Addicted Escherichia coli with a Refactored N-Demethylation Operon from Pseudomonas putida CBB5'', March 2013 [http://pubs.acs.org/doi/abs/10.1021/sb4000146]</div>Erik.quandthttp://2012.igem.org/IGEM_PublicationsIGEM Publications2013-05-01T12:42:19Z<p>Erik.quandt: </p>
<hr />
<div>We encourage iGEM teams to consider publishing and presenting their projects through any of the following:<br />
* [http://www.jbioleng.org/ Journal of Biological Engineering]<br />
* [http://www.theiet.org/ Institution of Engineering and Technology]<br />
<br />
<br />
Please add any publications that have come out of your iGEM team project on this page. Be sure to include your team name, the article title and journal (with details on which edition, etc.), and a link to the article (pdf, or online source).<br />
<br />
Example:<br />
<br />
*'''Journal''': ''Title'' Date [link]<br />
<br />
iGEM publications :<br />
<br />
*'''JBE''': [https://2012.igem.org/Team:Wageningen_UR Team Wageningen UR 2012]; ''The Constructor: a web application optimizing cloning strategies based on modules from the registry of standard biological parts'' 4 September 2012 [http://www.jbioleng.org/content/6/1/14/abstract]<br />
*'''PLoS ONE''': [https://2011.igem.org/Team:Wageningen_UR Team Wageningen UR 2011]; ''A Multi-Platform Flow Device for Microbial (Co-) Cultivation and Microscopic Analysis'' May 14, 2012 [http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0036982]<br />
*'''ACS Synthetic Biology''': [https://2011.igem.org/Team:Peking_R Peking]; ''Automated Design of Genetic Toggle Switch with Predetermined Bistability'' May 4, 2012 [http://pubs.acs.org/doi/abs/10.1021/sb300027y]<br />
*'''ACS Synthetic Biology''': [https://2011.igem.org/Team:Washington/Alkanes/Background Washington 2011]; ''Expanding the Product Profile of a Microbial Alkane Biosynthetic Pathway'' September 12, 2012 [http://pubs.acs.org/doi/full/10.1021/sb300061x]<br />
*'''Molecular Systems Biology''': [http://openwetware.org/wiki/IGEM:Peking/2007 Peking]; ''Synthesizing a novel genetic sequential logic circuit: a push-on push-off switch'' March 9, 2010 [http://www.nature.com/msb/journal/v6/n1/full/msb20102.html]<br />
*'''World Scientific Lecture Notes in Complex Systems''': [https://2010.igem.org/Team:Peking Peking]; ''Network Reverse Engineering Approach in Synthetic Biology'' Feb, 2013 [http://www.worldscientific.com/worldscibooks/10.1142/8400]<br />
*'''Journal of Visualized Experiments''': [https://2011.igem.org/Team:Lyon-INSA-ENS Lyon-INSA-ENS 2011] ''Engineering Adherent Bacteria by Creating a Single Synthetic Curli Operon'' , Nov 2012 [http://www.jove.com/video/4176/]<br />
*'''ACS Synthetic Biology''': [https://2012.igem.org/Team:Austin_Texas UT Austin 2012] ''Decaffeination and Measurement of Caffeine Content by Addicted Escherichia coli with a Refactored N-Demethylation Operon from Pseudomonas putida CBB5'' March 2013 [http://pubs.acs.org/doi/abs/10.1021/sb4000146]</div>Erik.quandthttp://2012.igem.org/File:UtAustin2012DecaffeinationOperon.jpgFile:UtAustin2012DecaffeinationOperon.jpg2012-10-27T00:00:33Z<p>Erik.quandt: uploaded a new version of &quot;File:UtAustin2012DecaffeinationOperon.jpg&quot;: Reverted to version as of 19:57, 23 October 2012</p>
<hr />
<div>UT Austin 2012 iGEM team work showing E. coli requiring our refactored decaffienation operon in order to grow.</div>Erik.quandthttp://2012.igem.org/File:UtAustin2012DecaffeinationOperon.jpgFile:UtAustin2012DecaffeinationOperon.jpg2012-10-26T23:59:34Z<p>Erik.quandt: uploaded a new version of &quot;File:UtAustin2012DecaffeinationOperon.jpg&quot;</p>
<hr />
<div>UT Austin 2012 iGEM team work showing E. coli requiring our refactored decaffienation operon in order to grow.</div>Erik.quandthttp://2012.igem.org/Team:Austin_Texas/Caffeinated_coliTeam:Austin Texas/Caffeinated coli2012-10-26T23:51:03Z<p>Erik.quandt: /* Decaffeination operon (+ gst9) enables growth of GuaB knockout */</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli" class="selected"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
<br />
<br />
= '''<center><div style="font-size:150%">Project: Caffeinated coli</div>''' =<br />
<br />
[[File:Caffeinated_Bacteria.jpg|375px|center]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Introduction'''</div> ==<br />
<br />
<html><br />
<a href="http://www.geog.ucsb.edu/events/department-news/1072/if-you-thought-fish-were-sleepless-in-seattle-check-out-the-ones-off-the-coast-of-oregon/"><img src="https://static.igem.org/mediawiki/2012/5/58/FishCoffee.png" alt="UT Austin CNS logo" width="240px"; height="240px"; style="float:right; padding:3px; clear:left;"/></a></html><br />
<br />
Caffeine is commonly used in foods and beverages such as coffee and chocolate and in pharmaceuticals as a cardiac and respiratory stimulant. As a result of the wide use of caffeine, it has become widely present in human waste and as a pollutant in the environment. Bacteria capable of degrading caffeine have been found naturally and could be used for bioremediation. We seek to port caffeine degradation functionality into ''Escherichia coli'' to produce strains that are better suited to degrade caffeine in an industrial setting. <br />
<br />
''Pseudomonas putida'' CBB5, discovered by Ryan Summers and Mani Subramanian at the University of Iowa, can live on caffeine as the sole carbon and nitrogen source. CBB5 uses a nitrogen demethylation pathway to convert caffeine to xanthine with formaldehyde side products. The xanthine and formaldehyde are then used as the nitrogen and carbon sources respectively.<br />
<br />
The N-demethylation pathway consists of four demethylation genes: ''ndmA'', ''ndmB'', ''ndmC'', and ''ndmD''. NdmA, NdmB, and NdmC remove the methyl groups from the N-1, N-3, and N-7 respectively. This is done with the help of a reductase, NdmD.<br />
<br />
[[File:Ndm diagram.JPG|center|650px]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Strategy'''</div> ==<br />
<br />
=== Refactoring Decaffeination Operon ===<br />
<br />
The first goal of this project involves refactoring the caffeine operon from the caffeine utilization pathway from ''Psuedomonas putida'' CBB5, first characterized by Summers et al. in early 2012. The operon, shown below, will be incorporated into the well characterized bacterium, ''Escherichia coli'' [3]. <br />
<br />
[[File:CBB5_Operon.png|center|650px]]<br />
<br />
Directly importing the operon into ''E. coli'' was determined to be impractical, as the strength and regulation of the ribosome binding sites (RBSs) and operon-controlled promoters in the CBB5 operon may not be optimized for function in ''E. coli''. Additionally, the use in CBB5 of GTG start codons conflicts with ''E. coli’s'' preference for ATG – leading to problems in translation initiation.<br />
<br />
We therefore decided to separate out open reading frames for the genes of interest in the CBB5 operon and put them under controlled regulation in a refactored caffeine utilization operon for import into ''E. coli''. The operon's design, shown below and submitted as [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 BBa_K734000], aims to optimize its functionality in its new host. <br />
<br />
[[File:Austin_Texas_Decaffeination_design.png|center]]<br />
<br />
This includes the genes that code for the N-demethylase proteins NdmA, NdmB, and NdmC, and the gene that codes for the putative assisting protein NdmD. Also included is the glutathione S-transferase gene from ''Janthinobacterium'' sp. strain Marseille, necessary for functionality of NdmC. Constitutive expression occurs with a strong, well-characterized promoter ([http://partsregistry.org/wiki/index.php/Part:BBa_J23100 BBa_J23100]) and a strong, well-characterized RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]). Finally, all GTG start codons have been replaced with ATG.<br />
<br />
Sources of parts used in our synthetic decaffeination circuit:<br />
<br />
[[File:Austin_Texas_Part_sources.png|center]]<br />
<br />
==== Assembly ====<br />
<br />
Our operon was assembled via a one-step, six-piece Gibson assembly. Briefly, genes to be stitched together were PCR amplified with overhangs homologous to adjacent genes (or homologous to the vector backbone in the case of the 5' end of the promoter and the 3' end of ''gst9''). The forward primers also contained our chosen RBS and ATG. In a one-pot reaction, a 5'-exonuclease chewed back on the homologous overhangs, allowing adjacent fragments to base pair, and a DNA ligase stitched them together. An overview is shown here.<br />
<br />
[[File:Austin_Texas_Decaffeination_assembly.png|center]]<br />
<br />
=== Operon Testing and Optimization ===<br />
<br />
We employed two different assays for operon functionality: growth on caffeine as a sole carbon source, and a genetic selection for caffeine demethylation to xanthine. To evaluate the ability to use caffeine as a sole carbon source we will transform TOP 10 ''E. coli'' electrocompetent cells with the refactored caffeine utilization operon, grow transformed cells in rich media to saturation and then dilute 1:100 into M9 mineral media. Varying levels of caffeine concentrations will be used to determine the degree of caffeine utilization, and the optimal limit for growth.<br />
<br />
Since the cell has an extremely large requirement for carbon, the energy derived from demethylation may not be enough to support growth. For this reason a second assay for caffeine demethylation based on guanine auxotrophy has been devised. ''E. coli'' synthesizes the nucleotide guanine de novo via a pathway that involves xanthosine-5’-phosphate (XMP) as an essential intermediate. The enzyme responsible for the formation of XMP (from inosine-5’-phosphate, IMP) is IMP dehydrogenase, which is encoded by the ''guaB'' gene. If ''guaB'' is knocked out, the cell is unable to synthesize guanine and is therefore unable to grow on media lacking guanine. We plan to take advantage of this engineered auxotrophy and use it as a way to select for cells that are able to demethylate caffeine to xanthine which can then be converted to XMP by xanthine-guanine phosphoribotransferase (gpt) and thereby relieve the metabolic block and restore guanine synthesis allowing for cell growth.<br />
<br />
[[File:guaB_selection_1.jpg|center|650px]]<br />
<br />
Finally, after construction and preliminary testing of the caffeine degradation operon in''E. coli'', we will attempt to grow our cells in the presence of various commercial caffeinated beverages.<br />
<br />
=== Characterizing Inducible Promoters ===<br />
<br />
In Summers et al (2012)., the two open reading frames ''orf1'' and ''orf4'' are thought to be putative regulators of the caffeine degradation operon's N-demethylase proteins due to sequence homology to other known protein regulators (AraC and gntR family). They are hypothesized to bind to operator sequences in the intergenic regions between genes in the operon, which may serve as promoters for the various demethylases of the operon. <br />
<br />
Analysis of the sizes of the intergenic regions of the CBB5 caffeine utilization operon shows that the regions upstream of the ''ndm'' genes are all greater than 150bp. The large size of these intergenic regions and the fact that they precede the catabolic enzyme gene leads us to hypothesize that there are caffeine (or other methylxanthine) regulatory elements in these sequences.<br />
<br />
We will clone these open reading frames into the reporter plasmid pRA301. pRA301 contains a promoterless ''lacZ'' gene, preceded by a multiple cloning site (MCS). DNA fragments hypothesized to contain promoter elements can be cloned into the MCS and assayed for ''lacZ'' expression by [http://openwetware.org/wiki/Beta-Galactosidase_Assay_%28A_better_Miller%29 Miller Assay]. Using this method, we can determine the regulatory functionality of each open reading frame by examining varying fluorescence levels.<br />
<br />
=== CBB5 Genome sequencing ===<br />
<br />
Since only a partial sequence (13.1kb) of the ''P. putida'' CBB5 decaffeination operon is available (Summers 2012), we are submitting genomic DNA for whole genome sequencing. The genome will be sequenced using Illumina next-gen sequencing by UT [[https://wikis.utexas.edu/display/GSAF/Home+Page GSAF]]. The assembled genome will be deposited to Genbank.<br />
<br />
==<div style="font-size:130%;text-align:center">'''Results</div>==<br />
<br />
===Decaffeination operon (+ gst9) enables growth of GuaB knockout===<br />
<br />
Our initial refactored operon consisted of CBB5 genes ''ndmABCD''. We found that this operon was able to support growth of the ''guaB'' knockout on theophylline but not caffeine. This indicated that the demethylase responsible for removing the 7-methyl group (NdmC) was not functional. Of note, Summers et. al (2012) also could not detect NdmC activity when expressed in ''E. coli''. We reasoned that there could be a missing protein required for NdmC activity. Summers et al. (2012) showed that an uncharacterized protein (coded by ''orf8'') co-purified in CBB5 protein fractions assayed for NdmC activity. We reasoned that this protein could be essential for NdmC function. Unfortunately, the complete DNA sequence of ''orf8'' was not available; only a partial sequence of the ORF was contained in the known operon sequence. <br />
<br />
<br />
[[File:Orf8_partial.png|center|650px]]<br />
<br />
<br />
A protein homology search was performed using the available sequence to find potential homologs that might be able to substitute function of the missing ORF. The search revealed that an uncharacterized gene, ''gst9'', from ''Janthinobacterium'' sp. strain marseille shared a modest degree of sequence homology (66%). We decided to synthesize the ''gst9'' gene from the available sequence and clone it into our decaffeination operon to see if it would enable NdmC activity and allow for complete demethylation of caffeine. <br />
<br />
<br />
Despite the relatively low level of homology, we found our hypothesis to be true: adding ''gst9'' to our refactored operon [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 (Bba_K734000)] did indeed enable growth of the ''guaB'' knockout on m9 mineral media:<br />
<br />
<br />
[[File:UtAustin2012DecaffeinationOperon.jpg|center|750px]]<br />
<br />
From this figure, we see that our decaffeination operon enables the GuaB knockout to grow in the absence of guanine or xanthine supplementation by instead demethylating the available caffeine to produce xanthine. This not only confirms the functionality of our refactored decaffeination operon, but also validates our genetic selection for caffeine demethylation through engineered guanine auxotrophy.<br />
<br />
After sequencing the ''P. putida'' CBB5 genome, an alignment of its putative GST (''orf8'') against the ''gst9'' of ''Janthinobacterium'' sp. (strain Marseille) showed less homology (63.5% homology at the nucleotide level) than that of the originally available partial sequence:<br />
<br />
<br />
[[File:Austin_Texas_GST_alignment.png|center|650px]]<br />
<br />
<br />
To more accurately determine the utilization of caffeine by our operon, we tested the growth of our ''E. coli'' cells containing refactored operon and the knocked out ''guaB'' gene under multiple caffeine concentration conditions. We found that our cells were able to grow at conditions as low as 10uM of caffeine, and peaked at a caffeine concentration between 200uM and 250uM. Cells were grown in concentrations as high as 5000uM, at which point cells began to die (presumably from caffeine toxicity). <br />
<br />
<br />
[[File:AustiniGEM2012GrowthCurve.jpg|center|650px]]<br />
<br />
From these growth conditions, we plated dilutions of up to 10<sup>7</sup> the concentration of original solution. This was used to determine individual cell growth based on caffeine. We discovered that approximately 7.6 +/- 0.8 pg of caffeine were utilized per cell. The graph above also shows a method by which we can convert directly from optical densities (an easily measured solution condition) to the caffeine concentration of the growth media. This is viable for cultures that contain cells with our refactored operon, and caffeine concentrations between 0 and approximately 250 uM.<br />
<br />
=== Engineered ''E. coli'' stoichiometrically convert caffeine to guanine for cell replication ===<br />
<br />
As caffeine appears to limit cell growth under these conditions, we were curious about how much of the provided caffeine was being utilized to create DNA and RNA for cellular replication. The genome of ''E. coli'' is roughly 4.6 Mb. Since this is double-stranded DNA and approximately 50% consists of G-C base pairs, there are about 2.3x10<sup>6</sup> guanines needed per cell to replicate its DNA. The dry weight of a typical ''E. coli'' cell is approximately 280 femtograms and 20% of this is RNA ([http://bionumbers.hms.harvard.edu Bionumbers]). Given the molecular weight of a typical RNA nucleotide is roughly 330 g/mol, and that 1/4 of these bases are guanine, this means that there are about 2.55x10<sup>10</sup> guanines needed per cell to replicate its RNA. So, overall the number of guanine molecules in RNA is roughly 10,000x the amount in DNA.<br />
<br />
We found that 7.6 +/- 0.8 pg of caffeine was utilized per cell. Given the molecular weight of 194.19 g/mol, this translates into 2.4x10<sup>10</sup> molecules of caffeine per cell. This is in amazing agreement with the number of molecules of guanine that we have calculated that is required to replicate a cell!<br />
<br />
<div style="font-size:130%;text-align:center"><br />
{| class="wikitable" style="text-align:center"<br />
|-<br />
! !!Molecules per cell<br />
|-<br />
| Caffeine molecules consumed (Calculated) || 2.40x10<sup>10</sup><br />
|-<br />
| Guanine molecules required (Theoretical) || 2.55x10<sup>10</sup><br />
|-<br />
|}<br />
</div><br />
<br />
===Growth in Caffeinated Beverages ===<br />
In order to make our results more palpable, we experimented with growth of our ''E. coli'' strain in various caffeinated beverages. Experiments were first performed on cells with only the ''guaB'' knockout modification, in order to prove that growth in these beverages was even possible. Initial results, shown below, indicate that growth is in fact possible for a wide variety of beverages, including Coca-Cola, 5-Hour Energy, Lipton Tea, and Starbucks Espresso.<br />
<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthInitial.png|center|650px]]<br />
<br />
<br />
The graph above shows that the auxotrophic selection of cells using xanthine derivatives again functions as expected – without xanthine, cells were unable to grow under most conditions. The noticeable optical densities for 50% Coca-Cola and 50% Espresso are due to the strong background color of the culture and not actual cell growth. 50% 5-Hour Energy and Espresso were both shown to be toxic to our cells. Finally, tea was shown to contain enough natural xanthines to allow for partial cell growth, and was excluded from further experiments.<br />
<br />
We then attempted to grow our cell strain containing both the ''guaB'' knockout gene and the refactored decaffeination operon. The results of this experiment are shown below.<br />
<br />
[[File:Caffeinated Beverages Growth Graph.jpg|center|650px]]<br />
<br />
It is important to note that these cells were grown in m9 minimal media containing 0.2% casein as a carbon source. The cells were required to scavenge and convert the available caffeine in the beverage to xanthine in order to synthesize guanine and support cell growth. Our ''E. coli'' was able to utilize the caffeine inherent to each caffeinated beverage. However, without our refactored decaffeination operon, the cells were unable to grow under any conditions. The media contains the appropriate amount of each beverage to have about a 50 micromolar concentration of caffeine. <br />
<br />
Utilizing the previous experiment in which we calculated the growth of our cells per caffeine molecule, we are able to estimate the total concentration of caffeine in each of the original caffeinated beverages. This is done by fitting the created equation that converts OD into predicted caffeine concentration. From caffeine concentration and the known dilution of caffeinated beverage added to each of the cultures, we can estimate the caffeine weight per beverage volume.<br />
<br />
These results are summarized below, and are very close to the values determined by the beverage manufacturers themselves. This serves as further reinforcement that our decaffeination operon works as intended, and even suggests a possible use in measuring the caffeine value of beverages. <br />
<br />
<br />
[[File:Caffeine_Measurement_Chart2.jpg|center]]<br />
<br />
<br />
Finally, we took pictures of our cells grown in caffeinated beverages cultures, as shown below. Cells in the left tubes do not contain the decaffeination operon, while cells in the right tubes do contain the decaffeination operon. Both contain the ''guaB'' gene knocked out, and require xanthine or xanthine derived from caffeine in order to survive. As shown below, Coca-Cola, Diet Coke and Coffee, all of which contain caffeine, feature strong growth of the ''guaB'' knockouts with the decaffeination operon. However, Caffeine Free Diet Coke shows no growth even with the operon, as there is no caffeine to be used as a xanthine source.<br />
<br />
<br />
[[File:UTAustin2012iGEMCaffeinatedBeverages.jpg|border|center|950px]]<br />
<br />
<br />
[[File:Energy_growth_compiled.jpg|border|center|600px]]<br />
<br />
===Transcriptional Regulators===<br />
As described earlier, we hypothesize that the large intergenic regions upstream of various genes in the CBB5 decaffeination operon, particularly upstream of ''ndmA'', may contain methylxanthine regulated promoters. We propose that ''orf1'' and ''orf4'', which were annotated as putative regulators based on sequence homology, act as repressors for the promoters contained in the operon. <br />
<br />
To test these hypotheses, we cloned the intergenic region upstream of the ''ndmA'' gene into a promoterless ''lacZ'' reporter plasmid, pRA301. This vector enabled quantitative measurement of promoter strength using the β-galactosidase [https://2010.igem.org/Team:BCCS-Bristol/Wetlab/BetaGalactosidaseAssays Miller assay]. Additionally, we created compatible biobrick plasmids of each putative repressor, ''orf1'' and ''orf4'', in order to assay their effect on ''ndmA'' promoter strength in the presence or absence of methylxanthine supplementation.<br />
<br />
We transformed these plasmids into the Top10 ''E. coli'' strain to create three strains: one containing only the ''ndmA-lacZ'' reporter plasmid, and co-transformants containing both the ''ndmA-lacZ'' plasmid and either ''orf1'' or ''orf4'' BioBrick plasmids. All three ''E. coli'' strains were grown in m9 minimal media + .2% casein (+ appropriate supplement) at 30<sup>o</sup>C for 48 hrs, after which time Miller Assays were performed. The results, summarized in the figure below, provide strong evidence that expression of ''orf4'' leads to inhibited ''ndmA'' promoter functionality, while ''orf1'' expression provides negligible influence on the ''ndmA'' promoter. <br />
<br />
[[File:Austin2012ndmARepression.jpg|center|650px]]<br />
<br />
A higher Miller Unit correlates to a higher level of ''lacZ'' production, effectively quantifying the degree of gene expression. As the Miller Unit of the strain co-expressed ''ndmA'' promoter with ''orf4'' is lower by a factor of roughly 4, it can be inferred that the protein encoded by ''orf4'' regulates the degree to which the ''ndmA'' promoter is expressed during transcription.<br />
<br />
It should be noted that while expression of ''ndmA'' drops significantly in this experiment, this does not imply that ''orf4'' only inhibits the expression of ''ndmA''. This is discussed in the next section.<br />
<br />
===Inducible Promoters===<br />
As shown above, it appears that ''orf4'' acts as a transcriptional regulator of ''ndmA'' expression. One would expect a transcriptional regulator to regulate transcription in a way that is beneficial to the overall fitness of the organism. In certain situations in which a protein is necessary for survival, the transcriptional factor should up-regulate the production of said gene. Likewise, when a protein is not necessary, the transcriptional factor should down-regulate its production.<br />
<br />
We hypothesize that this is the way in which ''orf4'' regulates transcription of ''ndmA''. In situations of high caffeine and related xanthine concentrations, the protein encoded by ''orf4'' up-regulates the expression of ''ndmA''. In the experiment listed [[Team:Austin_Texas/Caffeinated_coli#Transcriptional_Regulators|above]], in which no xanthine derivative was added to the media, expression from the ''ndmA'' promoter is inhibited (as shown).<br />
<br />
In order to test this hypothesis, we subjected a strain of Top10 ''E. coli'' cells containing the orf4 gene and the ''ndmA'' promoter containing the ''lacZ'' gene to varying supplements of caffeine, theobromine, theophylline, and xanthine. Xanthine was shown to be insoluble at high concentrations, and was therefore removed from the experiment. The results of exposure to varying concentration levels is shown below.<br />
<br />
[[File:UTAustin2012InductionbySubstrate.jpg|center|650px]]<br />
<br />
As predicted, the expression of ''ndmA'' appears to rise at higher caffeine concentrations. This implies that the protein encoded by orf4 relieves the repression of the ndmA promoter region as caffeine concentrations rise. This would allow for greater demethylation functionality of the decaffeination operon as more caffeine is provided to the cells, optimizing the operon's gene expression under varying substrate conditions. <br />
<br />
From these experiments we conclude that the ''ndmA'' intergenic region contains a promoter that is negatively-regulated by the protein coded by ''orf4'' in the absence of methylxanthines. Upon exposure to methylxanthines, it appears that ''orf4''-mediated repression is relieved, leading to induction.<br />
<br />
===Results Summary===<br />
The main accomplishments we achieved this summer include the following:<br />
<br />
*Refactoring of decaffeination operon from ''P. putida'' into ''E. coli''<br />
*Construction of an auxotrophic selection method using our refactored operon, "addicting" ''E. coli'' to caffeine<br />
*Growth of auxtrophic cells on common caffeinated beverages<br />
*Discovery of a methyxanthine inducible promoter (''ndmA'') in the CBB5 operon<br />
*Characterization of an open reading frame (''orf4'') in the CBB5 operon that acts as a transcription regulator<br />
<br />
==References==<br />
<br />
Summers RM, Louie TM, Yu CL, Gakhar L, Louie KC, Subramanian M, "Novel, highly specific N-demethylases enable bacteria to live on caffeine and related purine alkaloids." Journal of Bacteriology, 2012, vol 194, no 8, pg 2041-2049.<br />
<br />
Rodriguez del Rey Z, Granek EF, Sylvester S, "Occurrence and concentration of caffeine in Oregon coastal waters." Marine Pollution Bulletin, 2012, vol 64, no 8, Pages 1417-1424.<br />
<br />
<html><br />
<div id="footer" /><br />
</html></div>Erik.quandthttp://2012.igem.org/Team:Austin_Texas/Caffeinated_coliTeam:Austin Texas/Caffeinated coli2012-10-26T23:49:55Z<p>Erik.quandt: /* Decaffeination operon (+ gst9) enables growth of GuaB knockout */</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli" class="selected"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
<br />
<br />
= '''<center><div style="font-size:150%">Project: Caffeinated coli</div>''' =<br />
<br />
[[File:Caffeinated_Bacteria.jpg|375px|center]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Introduction'''</div> ==<br />
<br />
<html><br />
<a href="http://www.geog.ucsb.edu/events/department-news/1072/if-you-thought-fish-were-sleepless-in-seattle-check-out-the-ones-off-the-coast-of-oregon/"><img src="https://static.igem.org/mediawiki/2012/5/58/FishCoffee.png" alt="UT Austin CNS logo" width="240px"; height="240px"; style="float:right; padding:3px; clear:left;"/></a></html><br />
<br />
Caffeine is commonly used in foods and beverages such as coffee and chocolate and in pharmaceuticals as a cardiac and respiratory stimulant. As a result of the wide use of caffeine, it has become widely present in human waste and as a pollutant in the environment. Bacteria capable of degrading caffeine have been found naturally and could be used for bioremediation. We seek to port caffeine degradation functionality into ''Escherichia coli'' to produce strains that are better suited to degrade caffeine in an industrial setting. <br />
<br />
''Pseudomonas putida'' CBB5, discovered by Ryan Summers and Mani Subramanian at the University of Iowa, can live on caffeine as the sole carbon and nitrogen source. CBB5 uses a nitrogen demethylation pathway to convert caffeine to xanthine with formaldehyde side products. The xanthine and formaldehyde are then used as the nitrogen and carbon sources respectively.<br />
<br />
The N-demethylation pathway consists of four demethylation genes: ''ndmA'', ''ndmB'', ''ndmC'', and ''ndmD''. NdmA, NdmB, and NdmC remove the methyl groups from the N-1, N-3, and N-7 respectively. This is done with the help of a reductase, NdmD.<br />
<br />
[[File:Ndm diagram.JPG|center|650px]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Strategy'''</div> ==<br />
<br />
=== Refactoring Decaffeination Operon ===<br />
<br />
The first goal of this project involves refactoring the caffeine operon from the caffeine utilization pathway from ''Psuedomonas putida'' CBB5, first characterized by Summers et al. in early 2012. The operon, shown below, will be incorporated into the well characterized bacterium, ''Escherichia coli'' [3]. <br />
<br />
[[File:CBB5_Operon.png|center|650px]]<br />
<br />
Directly importing the operon into ''E. coli'' was determined to be impractical, as the strength and regulation of the ribosome binding sites (RBSs) and operon-controlled promoters in the CBB5 operon may not be optimized for function in ''E. coli''. Additionally, the use in CBB5 of GTG start codons conflicts with ''E. coli’s'' preference for ATG – leading to problems in translation initiation.<br />
<br />
We therefore decided to separate out open reading frames for the genes of interest in the CBB5 operon and put them under controlled regulation in a refactored caffeine utilization operon for import into ''E. coli''. The operon's design, shown below and submitted as [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 BBa_K734000], aims to optimize its functionality in its new host. <br />
<br />
[[File:Austin_Texas_Decaffeination_design.png|center]]<br />
<br />
This includes the genes that code for the N-demethylase proteins NdmA, NdmB, and NdmC, and the gene that codes for the putative assisting protein NdmD. Also included is the glutathione S-transferase gene from ''Janthinobacterium'' sp. strain Marseille, necessary for functionality of NdmC. Constitutive expression occurs with a strong, well-characterized promoter ([http://partsregistry.org/wiki/index.php/Part:BBa_J23100 BBa_J23100]) and a strong, well-characterized RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]). Finally, all GTG start codons have been replaced with ATG.<br />
<br />
Sources of parts used in our synthetic decaffeination circuit:<br />
<br />
[[File:Austin_Texas_Part_sources.png|center]]<br />
<br />
==== Assembly ====<br />
<br />
Our operon was assembled via a one-step, six-piece Gibson assembly. Briefly, genes to be stitched together were PCR amplified with overhangs homologous to adjacent genes (or homologous to the vector backbone in the case of the 5' end of the promoter and the 3' end of ''gst9''). The forward primers also contained our chosen RBS and ATG. In a one-pot reaction, a 5'-exonuclease chewed back on the homologous overhangs, allowing adjacent fragments to base pair, and a DNA ligase stitched them together. An overview is shown here.<br />
<br />
[[File:Austin_Texas_Decaffeination_assembly.png|center]]<br />
<br />
=== Operon Testing and Optimization ===<br />
<br />
We employed two different assays for operon functionality: growth on caffeine as a sole carbon source, and a genetic selection for caffeine demethylation to xanthine. To evaluate the ability to use caffeine as a sole carbon source we will transform TOP 10 ''E. coli'' electrocompetent cells with the refactored caffeine utilization operon, grow transformed cells in rich media to saturation and then dilute 1:100 into M9 mineral media. Varying levels of caffeine concentrations will be used to determine the degree of caffeine utilization, and the optimal limit for growth.<br />
<br />
Since the cell has an extremely large requirement for carbon, the energy derived from demethylation may not be enough to support growth. For this reason a second assay for caffeine demethylation based on guanine auxotrophy has been devised. ''E. coli'' synthesizes the nucleotide guanine de novo via a pathway that involves xanthosine-5’-phosphate (XMP) as an essential intermediate. The enzyme responsible for the formation of XMP (from inosine-5’-phosphate, IMP) is IMP dehydrogenase, which is encoded by the ''guaB'' gene. If ''guaB'' is knocked out, the cell is unable to synthesize guanine and is therefore unable to grow on media lacking guanine. We plan to take advantage of this engineered auxotrophy and use it as a way to select for cells that are able to demethylate caffeine to xanthine which can then be converted to XMP by xanthine-guanine phosphoribotransferase (gpt) and thereby relieve the metabolic block and restore guanine synthesis allowing for cell growth.<br />
<br />
[[File:guaB_selection_1.jpg|center|650px]]<br />
<br />
Finally, after construction and preliminary testing of the caffeine degradation operon in''E. coli'', we will attempt to grow our cells in the presence of various commercial caffeinated beverages.<br />
<br />
=== Characterizing Inducible Promoters ===<br />
<br />
In Summers et al (2012)., the two open reading frames ''orf1'' and ''orf4'' are thought to be putative regulators of the caffeine degradation operon's N-demethylase proteins due to sequence homology to other known protein regulators (AraC and gntR family). They are hypothesized to bind to operator sequences in the intergenic regions between genes in the operon, which may serve as promoters for the various demethylases of the operon. <br />
<br />
Analysis of the sizes of the intergenic regions of the CBB5 caffeine utilization operon shows that the regions upstream of the ''ndm'' genes are all greater than 150bp. The large size of these intergenic regions and the fact that they precede the catabolic enzyme gene leads us to hypothesize that there are caffeine (or other methylxanthine) regulatory elements in these sequences.<br />
<br />
We will clone these open reading frames into the reporter plasmid pRA301. pRA301 contains a promoterless ''lacZ'' gene, preceded by a multiple cloning site (MCS). DNA fragments hypothesized to contain promoter elements can be cloned into the MCS and assayed for ''lacZ'' expression by [http://openwetware.org/wiki/Beta-Galactosidase_Assay_%28A_better_Miller%29 Miller Assay]. Using this method, we can determine the regulatory functionality of each open reading frame by examining varying fluorescence levels.<br />
<br />
=== CBB5 Genome sequencing ===<br />
<br />
Since only a partial sequence (13.1kb) of the ''P. putida'' CBB5 decaffeination operon is available (Summers 2012), we are submitting genomic DNA for whole genome sequencing. The genome will be sequenced using Illumina next-gen sequencing by UT [[https://wikis.utexas.edu/display/GSAF/Home+Page GSAF]]. The assembled genome will be deposited to Genbank.<br />
<br />
==<div style="font-size:130%;text-align:center">'''Results</div>==<br />
<br />
===Decaffeination operon (+ gst9) enables growth of GuaB knockout===<br />
<br />
Our initial refactored operon consisted of CBB5 genes ''ndmABCD''. We found that this operon was able to support growth of the ''guaB'' knockout on theophylline but not caffeine. This indicated that the demethylase responsible for removing the 7-methyl group (NdmC) was not functional. Of note, Summers et. al (2012) also could not detect NdmC activity when expressed in ''E. coli''. We reasoned that there could be a missing protein required for NdmC activity. Summers et al. (2012) showed that an uncharacterized protein (coded by ''orf8'') co-purified in CBB5 protein fractions assayed for NdmC activity. We reasoned that this protein could be essential for NdmC function. Unfortunately, the complete DNA sequence of ''orf8'' was not available; only a partial sequence of the ORF was contained in the known operon sequence. <br />
<br />
<br />
[[File:Orf8_partial.png|center|650px]]<br />
<br />
<br />
A protein homology search was performed using the available sequence to find potential homologs that might be able to substitute function of the missing ORF. The search revealed that an uncharacterized gene, ''gst9'', from ''Janthinobacterium'' sp. strain marseille shared a modest degree of sequence homology (66%). We decided to synthesize the ''gst9'' gene from the available sequence and clone it into our decaffeination operon to see if it would enable NdmC activity and allow for complete demethylation of caffeine. <br />
<br />
<br />
Despite the relatively low level of homology, we found our hypothesis to be true: adding ''gst9'' to our refactored operon [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 (Bba_K734000)] did indeed enable growth of the ''guaB'' knockout on m9 mineral media:<br />
<br />
<br />
[[File:UtAustin2012DecaffeinationOperon.jpg|center|700px]]<br />
<br />
From this figure, we see that our decaffeination operon enables the GuaB knockout to grow in the absence of guanine or xanthine supplementation by instead demethylating the available caffeine to produce xanthine. This not only confirms the functionality of our refactored decaffeination operon, but also validates our genetic selection for caffeine demethylation through engineered guanine auxotrophy.<br />
<br />
After sequencing the ''P. putida'' CBB5 genome, an alignment of its putative GST (''orf8'') against the ''gst9'' of ''Janthinobacterium'' sp. (strain Marseille) showed less homology (63.5% homology at the nucleotide level) than that of the originally available partial sequence:<br />
<br />
<br />
[[File:Austin_Texas_GST_alignment.png|center|650px]]<br />
<br />
<br />
To more accurately determine the utilization of caffeine by our operon, we tested the growth of our ''E. coli'' cells containing refactored operon and the knocked out ''guaB'' gene under multiple caffeine concentration conditions. We found that our cells were able to grow at conditions as low as 10uM of caffeine, and peaked at a caffeine concentration between 200uM and 250uM. Cells were grown in concentrations as high as 5000uM, at which point cells began to die (presumably from caffeine toxicity). <br />
<br />
<br />
[[File:AustiniGEM2012GrowthCurve.jpg|center|650px]]<br />
<br />
From these growth conditions, we plated dilutions of up to 10<sup>7</sup> the concentration of original solution. This was used to determine individual cell growth based on caffeine. We discovered that approximately 7.6 +/- 0.8 pg of caffeine were utilized per cell. The graph above also shows a method by which we can convert directly from optical densities (an easily measured solution condition) to the caffeine concentration of the growth media. This is viable for cultures that contain cells with our refactored operon, and caffeine concentrations between 0 and approximately 250 uM.<br />
<br />
=== Engineered ''E. coli'' stoichiometrically convert caffeine to guanine for cell replication ===<br />
<br />
As caffeine appears to limit cell growth under these conditions, we were curious about how much of the provided caffeine was being utilized to create DNA and RNA for cellular replication. The genome of ''E. coli'' is roughly 4.6 Mb. Since this is double-stranded DNA and approximately 50% consists of G-C base pairs, there are about 2.3x10<sup>6</sup> guanines needed per cell to replicate its DNA. The dry weight of a typical ''E. coli'' cell is approximately 280 femtograms and 20% of this is RNA ([http://bionumbers.hms.harvard.edu Bionumbers]). Given the molecular weight of a typical RNA nucleotide is roughly 330 g/mol, and that 1/4 of these bases are guanine, this means that there are about 2.55x10<sup>10</sup> guanines needed per cell to replicate its RNA. So, overall the number of guanine molecules in RNA is roughly 10,000x the amount in DNA.<br />
<br />
We found that 7.6 +/- 0.8 pg of caffeine was utilized per cell. Given the molecular weight of 194.19 g/mol, this translates into 2.4x10<sup>10</sup> molecules of caffeine per cell. This is in amazing agreement with the number of molecules of guanine that we have calculated that is required to replicate a cell!<br />
<br />
<div style="font-size:130%;text-align:center"><br />
{| class="wikitable" style="text-align:center"<br />
|-<br />
! !!Molecules per cell<br />
|-<br />
| Caffeine molecules consumed (Calculated) || 2.40x10<sup>10</sup><br />
|-<br />
| Guanine molecules required (Theoretical) || 2.55x10<sup>10</sup><br />
|-<br />
|}<br />
</div><br />
<br />
===Growth in Caffeinated Beverages ===<br />
In order to make our results more palpable, we experimented with growth of our ''E. coli'' strain in various caffeinated beverages. Experiments were first performed on cells with only the ''guaB'' knockout modification, in order to prove that growth in these beverages was even possible. Initial results, shown below, indicate that growth is in fact possible for a wide variety of beverages, including Coca-Cola, 5-Hour Energy, Lipton Tea, and Starbucks Espresso.<br />
<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthInitial.png|center|650px]]<br />
<br />
<br />
The graph above shows that the auxotrophic selection of cells using xanthine derivatives again functions as expected – without xanthine, cells were unable to grow under most conditions. The noticeable optical densities for 50% Coca-Cola and 50% Espresso are due to the strong background color of the culture and not actual cell growth. 50% 5-Hour Energy and Espresso were both shown to be toxic to our cells. Finally, tea was shown to contain enough natural xanthines to allow for partial cell growth, and was excluded from further experiments.<br />
<br />
We then attempted to grow our cell strain containing both the ''guaB'' knockout gene and the refactored decaffeination operon. The results of this experiment are shown below.<br />
<br />
[[File:Caffeinated Beverages Growth Graph.jpg|center|650px]]<br />
<br />
It is important to note that these cells were grown in m9 minimal media containing 0.2% casein as a carbon source. The cells were required to scavenge and convert the available caffeine in the beverage to xanthine in order to synthesize guanine and support cell growth. Our ''E. coli'' was able to utilize the caffeine inherent to each caffeinated beverage. However, without our refactored decaffeination operon, the cells were unable to grow under any conditions. The media contains the appropriate amount of each beverage to have about a 50 micromolar concentration of caffeine. <br />
<br />
Utilizing the previous experiment in which we calculated the growth of our cells per caffeine molecule, we are able to estimate the total concentration of caffeine in each of the original caffeinated beverages. This is done by fitting the created equation that converts OD into predicted caffeine concentration. From caffeine concentration and the known dilution of caffeinated beverage added to each of the cultures, we can estimate the caffeine weight per beverage volume.<br />
<br />
These results are summarized below, and are very close to the values determined by the beverage manufacturers themselves. This serves as further reinforcement that our decaffeination operon works as intended, and even suggests a possible use in measuring the caffeine value of beverages. <br />
<br />
<br />
[[File:Caffeine_Measurement_Chart2.jpg|center]]<br />
<br />
<br />
Finally, we took pictures of our cells grown in caffeinated beverages cultures, as shown below. Cells in the left tubes do not contain the decaffeination operon, while cells in the right tubes do contain the decaffeination operon. Both contain the ''guaB'' gene knocked out, and require xanthine or xanthine derived from caffeine in order to survive. As shown below, Coca-Cola, Diet Coke and Coffee, all of which contain caffeine, feature strong growth of the ''guaB'' knockouts with the decaffeination operon. However, Caffeine Free Diet Coke shows no growth even with the operon, as there is no caffeine to be used as a xanthine source.<br />
<br />
<br />
[[File:UTAustin2012iGEMCaffeinatedBeverages.jpg|border|center|950px]]<br />
<br />
<br />
[[File:Energy_growth_compiled.jpg|border|center|600px]]<br />
<br />
===Transcriptional Regulators===<br />
As described earlier, we hypothesize that the large intergenic regions upstream of various genes in the CBB5 decaffeination operon, particularly upstream of ''ndmA'', may contain methylxanthine regulated promoters. We propose that ''orf1'' and ''orf4'', which were annotated as putative regulators based on sequence homology, act as repressors for the promoters contained in the operon. <br />
<br />
To test these hypotheses, we cloned the intergenic region upstream of the ''ndmA'' gene into a promoterless ''lacZ'' reporter plasmid, pRA301. This vector enabled quantitative measurement of promoter strength using the β-galactosidase [https://2010.igem.org/Team:BCCS-Bristol/Wetlab/BetaGalactosidaseAssays Miller assay]. Additionally, we created compatible biobrick plasmids of each putative repressor, ''orf1'' and ''orf4'', in order to assay their effect on ''ndmA'' promoter strength in the presence or absence of methylxanthine supplementation.<br />
<br />
We transformed these plasmids into the Top10 ''E. coli'' strain to create three strains: one containing only the ''ndmA-lacZ'' reporter plasmid, and co-transformants containing both the ''ndmA-lacZ'' plasmid and either ''orf1'' or ''orf4'' BioBrick plasmids. All three ''E. coli'' strains were grown in m9 minimal media + .2% casein (+ appropriate supplement) at 30<sup>o</sup>C for 48 hrs, after which time Miller Assays were performed. The results, summarized in the figure below, provide strong evidence that expression of ''orf4'' leads to inhibited ''ndmA'' promoter functionality, while ''orf1'' expression provides negligible influence on the ''ndmA'' promoter. <br />
<br />
[[File:Austin2012ndmARepression.jpg|center|650px]]<br />
<br />
A higher Miller Unit correlates to a higher level of ''lacZ'' production, effectively quantifying the degree of gene expression. As the Miller Unit of the strain co-expressed ''ndmA'' promoter with ''orf4'' is lower by a factor of roughly 4, it can be inferred that the protein encoded by ''orf4'' regulates the degree to which the ''ndmA'' promoter is expressed during transcription.<br />
<br />
It should be noted that while expression of ''ndmA'' drops significantly in this experiment, this does not imply that ''orf4'' only inhibits the expression of ''ndmA''. This is discussed in the next section.<br />
<br />
===Inducible Promoters===<br />
As shown above, it appears that ''orf4'' acts as a transcriptional regulator of ''ndmA'' expression. One would expect a transcriptional regulator to regulate transcription in a way that is beneficial to the overall fitness of the organism. In certain situations in which a protein is necessary for survival, the transcriptional factor should up-regulate the production of said gene. Likewise, when a protein is not necessary, the transcriptional factor should down-regulate its production.<br />
<br />
We hypothesize that this is the way in which ''orf4'' regulates transcription of ''ndmA''. In situations of high caffeine and related xanthine concentrations, the protein encoded by ''orf4'' up-regulates the expression of ''ndmA''. In the experiment listed [[Team:Austin_Texas/Caffeinated_coli#Transcriptional_Regulators|above]], in which no xanthine derivative was added to the media, expression from the ''ndmA'' promoter is inhibited (as shown).<br />
<br />
In order to test this hypothesis, we subjected a strain of Top10 ''E. coli'' cells containing the orf4 gene and the ''ndmA'' promoter containing the ''lacZ'' gene to varying supplements of caffeine, theobromine, theophylline, and xanthine. Xanthine was shown to be insoluble at high concentrations, and was therefore removed from the experiment. The results of exposure to varying concentration levels is shown below.<br />
<br />
[[File:UTAustin2012InductionbySubstrate.jpg|center|650px]]<br />
<br />
As predicted, the expression of ''ndmA'' appears to rise at higher caffeine concentrations. This implies that the protein encoded by orf4 relieves the repression of the ndmA promoter region as caffeine concentrations rise. This would allow for greater demethylation functionality of the decaffeination operon as more caffeine is provided to the cells, optimizing the operon's gene expression under varying substrate conditions. <br />
<br />
From these experiments we conclude that the ''ndmA'' intergenic region contains a promoter that is negatively-regulated by the protein coded by ''orf4'' in the absence of methylxanthines. Upon exposure to methylxanthines, it appears that ''orf4''-mediated repression is relieved, leading to induction.<br />
<br />
===Results Summary===<br />
The main accomplishments we achieved this summer include the following:<br />
<br />
*Refactoring of decaffeination operon from ''P. putida'' into ''E. coli''<br />
*Construction of an auxotrophic selection method using our refactored operon, "addicting" ''E. coli'' to caffeine<br />
*Growth of auxtrophic cells on common caffeinated beverages<br />
*Discovery of a methyxanthine inducible promoter (''ndmA'') in the CBB5 operon<br />
*Characterization of an open reading frame (''orf4'') in the CBB5 operon that acts as a transcription regulator<br />
<br />
==References==<br />
<br />
Summers RM, Louie TM, Yu CL, Gakhar L, Louie KC, Subramanian M, "Novel, highly specific N-demethylases enable bacteria to live on caffeine and related purine alkaloids." Journal of Bacteriology, 2012, vol 194, no 8, pg 2041-2049.<br />
<br />
Rodriguez del Rey Z, Granek EF, Sylvester S, "Occurrence and concentration of caffeine in Oregon coastal waters." Marine Pollution Bulletin, 2012, vol 64, no 8, Pages 1417-1424.<br />
<br />
<html><br />
<div id="footer" /><br />
</html></div>Erik.quandthttp://2012.igem.org/Team:Austin_Texas/Caffeinated_coliTeam:Austin Texas/Caffeinated coli2012-10-26T23:48:42Z<p>Erik.quandt: /* Decaffeination operon (+ gst9) enables growth of GuaB knockout */</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli" class="selected"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
<br />
<br />
= '''<center><div style="font-size:150%">Project: Caffeinated coli</div>''' =<br />
<br />
[[File:Caffeinated_Bacteria.jpg|375px|center]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Introduction'''</div> ==<br />
<br />
<html><br />
<a href="http://www.geog.ucsb.edu/events/department-news/1072/if-you-thought-fish-were-sleepless-in-seattle-check-out-the-ones-off-the-coast-of-oregon/"><img src="https://static.igem.org/mediawiki/2012/5/58/FishCoffee.png" alt="UT Austin CNS logo" width="240px"; height="240px"; style="float:right; padding:3px; clear:left;"/></a></html><br />
<br />
Caffeine is commonly used in foods and beverages such as coffee and chocolate and in pharmaceuticals as a cardiac and respiratory stimulant. As a result of the wide use of caffeine, it has become widely present in human waste and as a pollutant in the environment. Bacteria capable of degrading caffeine have been found naturally and could be used for bioremediation. We seek to port caffeine degradation functionality into ''Escherichia coli'' to produce strains that are better suited to degrade caffeine in an industrial setting. <br />
<br />
''Pseudomonas putida'' CBB5, discovered by Ryan Summers and Mani Subramanian at the University of Iowa, can live on caffeine as the sole carbon and nitrogen source. CBB5 uses a nitrogen demethylation pathway to convert caffeine to xanthine with formaldehyde side products. The xanthine and formaldehyde are then used as the nitrogen and carbon sources respectively.<br />
<br />
The N-demethylation pathway consists of four demethylation genes: ''ndmA'', ''ndmB'', ''ndmC'', and ''ndmD''. NdmA, NdmB, and NdmC remove the methyl groups from the N-1, N-3, and N-7 respectively. This is done with the help of a reductase, NdmD.<br />
<br />
[[File:Ndm diagram.JPG|center|650px]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Strategy'''</div> ==<br />
<br />
=== Refactoring Decaffeination Operon ===<br />
<br />
The first goal of this project involves refactoring the caffeine operon from the caffeine utilization pathway from ''Psuedomonas putida'' CBB5, first characterized by Summers et al. in early 2012. The operon, shown below, will be incorporated into the well characterized bacterium, ''Escherichia coli'' [3]. <br />
<br />
[[File:CBB5_Operon.png|center|650px]]<br />
<br />
Directly importing the operon into ''E. coli'' was determined to be impractical, as the strength and regulation of the ribosome binding sites (RBSs) and operon-controlled promoters in the CBB5 operon may not be optimized for function in ''E. coli''. Additionally, the use in CBB5 of GTG start codons conflicts with ''E. coli’s'' preference for ATG – leading to problems in translation initiation.<br />
<br />
We therefore decided to separate out open reading frames for the genes of interest in the CBB5 operon and put them under controlled regulation in a refactored caffeine utilization operon for import into ''E. coli''. The operon's design, shown below and submitted as [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 BBa_K734000], aims to optimize its functionality in its new host. <br />
<br />
[[File:Austin_Texas_Decaffeination_design.png|center]]<br />
<br />
This includes the genes that code for the N-demethylase proteins NdmA, NdmB, and NdmC, and the gene that codes for the putative assisting protein NdmD. Also included is the glutathione S-transferase gene from ''Janthinobacterium'' sp. strain Marseille, necessary for functionality of NdmC. Constitutive expression occurs with a strong, well-characterized promoter ([http://partsregistry.org/wiki/index.php/Part:BBa_J23100 BBa_J23100]) and a strong, well-characterized RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]). Finally, all GTG start codons have been replaced with ATG.<br />
<br />
Sources of parts used in our synthetic decaffeination circuit:<br />
<br />
[[File:Austin_Texas_Part_sources.png|center]]<br />
<br />
==== Assembly ====<br />
<br />
Our operon was assembled via a one-step, six-piece Gibson assembly. Briefly, genes to be stitched together were PCR amplified with overhangs homologous to adjacent genes (or homologous to the vector backbone in the case of the 5' end of the promoter and the 3' end of ''gst9''). The forward primers also contained our chosen RBS and ATG. In a one-pot reaction, a 5'-exonuclease chewed back on the homologous overhangs, allowing adjacent fragments to base pair, and a DNA ligase stitched them together. An overview is shown here.<br />
<br />
[[File:Austin_Texas_Decaffeination_assembly.png|center]]<br />
<br />
=== Operon Testing and Optimization ===<br />
<br />
We employed two different assays for operon functionality: growth on caffeine as a sole carbon source, and a genetic selection for caffeine demethylation to xanthine. To evaluate the ability to use caffeine as a sole carbon source we will transform TOP 10 ''E. coli'' electrocompetent cells with the refactored caffeine utilization operon, grow transformed cells in rich media to saturation and then dilute 1:100 into M9 mineral media. Varying levels of caffeine concentrations will be used to determine the degree of caffeine utilization, and the optimal limit for growth.<br />
<br />
Since the cell has an extremely large requirement for carbon, the energy derived from demethylation may not be enough to support growth. For this reason a second assay for caffeine demethylation based on guanine auxotrophy has been devised. ''E. coli'' synthesizes the nucleotide guanine de novo via a pathway that involves xanthosine-5’-phosphate (XMP) as an essential intermediate. The enzyme responsible for the formation of XMP (from inosine-5’-phosphate, IMP) is IMP dehydrogenase, which is encoded by the ''guaB'' gene. If ''guaB'' is knocked out, the cell is unable to synthesize guanine and is therefore unable to grow on media lacking guanine. We plan to take advantage of this engineered auxotrophy and use it as a way to select for cells that are able to demethylate caffeine to xanthine which can then be converted to XMP by xanthine-guanine phosphoribotransferase (gpt) and thereby relieve the metabolic block and restore guanine synthesis allowing for cell growth.<br />
<br />
[[File:guaB_selection_1.jpg|center|650px]]<br />
<br />
Finally, after construction and preliminary testing of the caffeine degradation operon in''E. coli'', we will attempt to grow our cells in the presence of various commercial caffeinated beverages.<br />
<br />
=== Characterizing Inducible Promoters ===<br />
<br />
In Summers et al (2012)., the two open reading frames ''orf1'' and ''orf4'' are thought to be putative regulators of the caffeine degradation operon's N-demethylase proteins due to sequence homology to other known protein regulators (AraC and gntR family). They are hypothesized to bind to operator sequences in the intergenic regions between genes in the operon, which may serve as promoters for the various demethylases of the operon. <br />
<br />
Analysis of the sizes of the intergenic regions of the CBB5 caffeine utilization operon shows that the regions upstream of the ''ndm'' genes are all greater than 150bp. The large size of these intergenic regions and the fact that they precede the catabolic enzyme gene leads us to hypothesize that there are caffeine (or other methylxanthine) regulatory elements in these sequences.<br />
<br />
We will clone these open reading frames into the reporter plasmid pRA301. pRA301 contains a promoterless ''lacZ'' gene, preceded by a multiple cloning site (MCS). DNA fragments hypothesized to contain promoter elements can be cloned into the MCS and assayed for ''lacZ'' expression by [http://openwetware.org/wiki/Beta-Galactosidase_Assay_%28A_better_Miller%29 Miller Assay]. Using this method, we can determine the regulatory functionality of each open reading frame by examining varying fluorescence levels.<br />
<br />
=== CBB5 Genome sequencing ===<br />
<br />
Since only a partial sequence (13.1kb) of the ''P. putida'' CBB5 decaffeination operon is available (Summers 2012), we are submitting genomic DNA for whole genome sequencing. The genome will be sequenced using Illumina next-gen sequencing by UT [[https://wikis.utexas.edu/display/GSAF/Home+Page GSAF]]. The assembled genome will be deposited to Genbank.<br />
<br />
==<div style="font-size:130%;text-align:center">'''Results</div>==<br />
<br />
===Decaffeination operon (+ gst9) enables growth of GuaB knockout===<br />
<br />
Our initial refactored operon consisted of CBB5 genes ''ndmABCD''. We found that this operon was able to support growth of the ''guaB'' knockout on theophylline but not caffeine. This indicated that the demethylase responsible for removing the 7-methyl group (NdmC) was not functional. Of note, Summers et. al (2012) also could not detect NdmC activity when expressed in ''E. coli''. We reasoned that there could be a missing protein required for NdmC activity. Summers et al. (2012) showed that an uncharacterized protein (coded by ''orf8'') co-purified in CBB5 protein fractions assayed for NdmC activity. We reasoned that this protein could be essential for NdmC function. Unfortunately, the complete DNA sequence of ''orf8'' was not available; only a partial sequence of the ORF was contained in the known operon sequence. <br />
<br />
<br />
[[File:Orf8_partial.png|center|650px]]<br />
<br />
<br />
A protein homology search was performed using the available sequence to find potential homologs that might be able to substitute function of the missing ORF. The search revealed that an uncharacterized gene, ''gst9'', from ''Janthinobacterium'' sp. strain marseille shared a modest degree of sequence homology (66%). We decided to synthesize the ''gst9'' gene from the available sequence and clone it into our decaffeination operon to see if it would enable NdmC activity and allow for complete demethylation of caffeine. <br />
<br />
<br />
Despite the relatively low level of homology, we found our hypothesis to be true: adding ''gst9'' to our refactored operon [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 (Bba_K734000)] did indeed enable growth of the ''guaB'' knockout on m9 mineral media:<br />
<br />
<br />
[[File:UtAustin2012DecaffeinationOperon.jpg|center|650px]]<br />
<br />
From this figure, we see that our decaffeination operon enables the GuaB knockout to grow in the absence of guanine or xanthine supplementation by instead demethylating the available caffeine to produce xanthine. This not only confirms the functionality of our refactored decaffeination operon, but also validates our genetic selection for caffeine demethylation through engineered guanine auxotrophy.<br />
<br />
After sequencing the ''P. putida'' CBB5 genome, an alignment of its putative GST (''orf8'') against the ''gst9'' of ''Janthinobacterium'' sp. (strain Marseille) showed less homology (63.5% homology at the nucleotide level) than that of the originally available partial sequence:<br />
<br />
<br />
[[File:Austin_Texas_GST_alignment.png|center|650px]]<br />
<br />
<br />
To more accurately determine the utilization of caffeine by our operon, we tested the growth of our ''E. coli'' cells containing refactored operon and the knocked out ''guaB'' gene under multiple caffeine concentration conditions. We found that our cells were able to grow at conditions as low as 10uM of caffeine, and peaked at a caffeine concentration between 200uM and 250uM. Cells were grown in concentrations as high as 5000uM, at which point cells began to die (presumably from caffeine toxicity). <br />
<br />
<br />
[[File:AustiniGEM2012GrowthCurve.jpg|center|650px]]<br />
<br />
From these growth conditions, we plated dilutions of up to 10<sup>7</sup> the concentration of original solution. This was used to determine individual cell growth based on caffeine. We discovered that approximately 7.6 +/- 0.8 pg of caffeine were utilized per cell. The graph above also shows a method by which we can convert directly from optical densities (an easily measured solution condition) to the caffeine concentration of the growth media. This is viable for cultures that contain cells with our refactored operon, and caffeine concentrations between 0 and approximately 250 uM.<br />
<br />
=== Engineered ''E. coli'' stoichiometrically convert caffeine to guanine for cell replication ===<br />
<br />
As caffeine appears to limit cell growth under these conditions, we were curious about how much of the provided caffeine was being utilized to create DNA and RNA for cellular replication. The genome of ''E. coli'' is roughly 4.6 Mb. Since this is double-stranded DNA and approximately 50% consists of G-C base pairs, there are about 2.3x10<sup>6</sup> guanines needed per cell to replicate its DNA. The dry weight of a typical ''E. coli'' cell is approximately 280 femtograms and 20% of this is RNA ([http://bionumbers.hms.harvard.edu Bionumbers]). Given the molecular weight of a typical RNA nucleotide is roughly 330 g/mol, and that 1/4 of these bases are guanine, this means that there are about 2.55x10<sup>10</sup> guanines needed per cell to replicate its RNA. So, overall the number of guanine molecules in RNA is roughly 10,000x the amount in DNA.<br />
<br />
We found that 7.6 +/- 0.8 pg of caffeine was utilized per cell. Given the molecular weight of 194.19 g/mol, this translates into 2.4x10<sup>10</sup> molecules of caffeine per cell. This is in amazing agreement with the number of molecules of guanine that we have calculated that is required to replicate a cell!<br />
<br />
<div style="font-size:130%;text-align:center"><br />
{| class="wikitable" style="text-align:center"<br />
|-<br />
! !!Molecules per cell<br />
|-<br />
| Caffeine molecules consumed (Calculated) || 2.40x10<sup>10</sup><br />
|-<br />
| Guanine molecules required (Theoretical) || 2.55x10<sup>10</sup><br />
|-<br />
|}<br />
</div><br />
<br />
===Growth in Caffeinated Beverages ===<br />
In order to make our results more palpable, we experimented with growth of our ''E. coli'' strain in various caffeinated beverages. Experiments were first performed on cells with only the ''guaB'' knockout modification, in order to prove that growth in these beverages was even possible. Initial results, shown below, indicate that growth is in fact possible for a wide variety of beverages, including Coca-Cola, 5-Hour Energy, Lipton Tea, and Starbucks Espresso.<br />
<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthInitial.png|center|650px]]<br />
<br />
<br />
The graph above shows that the auxotrophic selection of cells using xanthine derivatives again functions as expected – without xanthine, cells were unable to grow under most conditions. The noticeable optical densities for 50% Coca-Cola and 50% Espresso are due to the strong background color of the culture and not actual cell growth. 50% 5-Hour Energy and Espresso were both shown to be toxic to our cells. Finally, tea was shown to contain enough natural xanthines to allow for partial cell growth, and was excluded from further experiments.<br />
<br />
We then attempted to grow our cell strain containing both the ''guaB'' knockout gene and the refactored decaffeination operon. The results of this experiment are shown below.<br />
<br />
[[File:Caffeinated Beverages Growth Graph.jpg|center|650px]]<br />
<br />
It is important to note that these cells were grown in m9 minimal media containing 0.2% casein as a carbon source. The cells were required to scavenge and convert the available caffeine in the beverage to xanthine in order to synthesize guanine and support cell growth. Our ''E. coli'' was able to utilize the caffeine inherent to each caffeinated beverage. However, without our refactored decaffeination operon, the cells were unable to grow under any conditions. The media contains the appropriate amount of each beverage to have about a 50 micromolar concentration of caffeine. <br />
<br />
Utilizing the previous experiment in which we calculated the growth of our cells per caffeine molecule, we are able to estimate the total concentration of caffeine in each of the original caffeinated beverages. This is done by fitting the created equation that converts OD into predicted caffeine concentration. From caffeine concentration and the known dilution of caffeinated beverage added to each of the cultures, we can estimate the caffeine weight per beverage volume.<br />
<br />
These results are summarized below, and are very close to the values determined by the beverage manufacturers themselves. This serves as further reinforcement that our decaffeination operon works as intended, and even suggests a possible use in measuring the caffeine value of beverages. <br />
<br />
<br />
[[File:Caffeine_Measurement_Chart2.jpg|center]]<br />
<br />
<br />
Finally, we took pictures of our cells grown in caffeinated beverages cultures, as shown below. Cells in the left tubes do not contain the decaffeination operon, while cells in the right tubes do contain the decaffeination operon. Both contain the ''guaB'' gene knocked out, and require xanthine or xanthine derived from caffeine in order to survive. As shown below, Coca-Cola, Diet Coke and Coffee, all of which contain caffeine, feature strong growth of the ''guaB'' knockouts with the decaffeination operon. However, Caffeine Free Diet Coke shows no growth even with the operon, as there is no caffeine to be used as a xanthine source.<br />
<br />
<br />
[[File:UTAustin2012iGEMCaffeinatedBeverages.jpg|border|center|950px]]<br />
<br />
<br />
[[File:Energy_growth_compiled.jpg|border|center|600px]]<br />
<br />
===Transcriptional Regulators===<br />
As described earlier, we hypothesize that the large intergenic regions upstream of various genes in the CBB5 decaffeination operon, particularly upstream of ''ndmA'', may contain methylxanthine regulated promoters. We propose that ''orf1'' and ''orf4'', which were annotated as putative regulators based on sequence homology, act as repressors for the promoters contained in the operon. <br />
<br />
To test these hypotheses, we cloned the intergenic region upstream of the ''ndmA'' gene into a promoterless ''lacZ'' reporter plasmid, pRA301. This vector enabled quantitative measurement of promoter strength using the β-galactosidase [https://2010.igem.org/Team:BCCS-Bristol/Wetlab/BetaGalactosidaseAssays Miller assay]. Additionally, we created compatible biobrick plasmids of each putative repressor, ''orf1'' and ''orf4'', in order to assay their effect on ''ndmA'' promoter strength in the presence or absence of methylxanthine supplementation.<br />
<br />
We transformed these plasmids into the Top10 ''E. coli'' strain to create three strains: one containing only the ''ndmA-lacZ'' reporter plasmid, and co-transformants containing both the ''ndmA-lacZ'' plasmid and either ''orf1'' or ''orf4'' BioBrick plasmids. All three ''E. coli'' strains were grown in m9 minimal media + .2% casein (+ appropriate supplement) at 30<sup>o</sup>C for 48 hrs, after which time Miller Assays were performed. The results, summarized in the figure below, provide strong evidence that expression of ''orf4'' leads to inhibited ''ndmA'' promoter functionality, while ''orf1'' expression provides negligible influence on the ''ndmA'' promoter. <br />
<br />
[[File:Austin2012ndmARepression.jpg|center|650px]]<br />
<br />
A higher Miller Unit correlates to a higher level of ''lacZ'' production, effectively quantifying the degree of gene expression. As the Miller Unit of the strain co-expressed ''ndmA'' promoter with ''orf4'' is lower by a factor of roughly 4, it can be inferred that the protein encoded by ''orf4'' regulates the degree to which the ''ndmA'' promoter is expressed during transcription.<br />
<br />
It should be noted that while expression of ''ndmA'' drops significantly in this experiment, this does not imply that ''orf4'' only inhibits the expression of ''ndmA''. This is discussed in the next section.<br />
<br />
===Inducible Promoters===<br />
As shown above, it appears that ''orf4'' acts as a transcriptional regulator of ''ndmA'' expression. One would expect a transcriptional regulator to regulate transcription in a way that is beneficial to the overall fitness of the organism. In certain situations in which a protein is necessary for survival, the transcriptional factor should up-regulate the production of said gene. Likewise, when a protein is not necessary, the transcriptional factor should down-regulate its production.<br />
<br />
We hypothesize that this is the way in which ''orf4'' regulates transcription of ''ndmA''. In situations of high caffeine and related xanthine concentrations, the protein encoded by ''orf4'' up-regulates the expression of ''ndmA''. In the experiment listed [[Team:Austin_Texas/Caffeinated_coli#Transcriptional_Regulators|above]], in which no xanthine derivative was added to the media, expression from the ''ndmA'' promoter is inhibited (as shown).<br />
<br />
In order to test this hypothesis, we subjected a strain of Top10 ''E. coli'' cells containing the orf4 gene and the ''ndmA'' promoter containing the ''lacZ'' gene to varying supplements of caffeine, theobromine, theophylline, and xanthine. Xanthine was shown to be insoluble at high concentrations, and was therefore removed from the experiment. The results of exposure to varying concentration levels is shown below.<br />
<br />
[[File:UTAustin2012InductionbySubstrate.jpg|center|650px]]<br />
<br />
As predicted, the expression of ''ndmA'' appears to rise at higher caffeine concentrations. This implies that the protein encoded by orf4 relieves the repression of the ndmA promoter region as caffeine concentrations rise. This would allow for greater demethylation functionality of the decaffeination operon as more caffeine is provided to the cells, optimizing the operon's gene expression under varying substrate conditions. <br />
<br />
From these experiments we conclude that the ''ndmA'' intergenic region contains a promoter that is negatively-regulated by the protein coded by ''orf4'' in the absence of methylxanthines. Upon exposure to methylxanthines, it appears that ''orf4''-mediated repression is relieved, leading to induction.<br />
<br />
===Results Summary===<br />
The main accomplishments we achieved this summer include the following:<br />
<br />
*Refactoring of decaffeination operon from ''P. putida'' into ''E. coli''<br />
*Construction of an auxotrophic selection method using our refactored operon, "addicting" ''E. coli'' to caffeine<br />
*Growth of auxtrophic cells on common caffeinated beverages<br />
*Discovery of a methyxanthine inducible promoter (''ndmA'') in the CBB5 operon<br />
*Characterization of an open reading frame (''orf4'') in the CBB5 operon that acts as a transcription regulator<br />
<br />
==References==<br />
<br />
Summers RM, Louie TM, Yu CL, Gakhar L, Louie KC, Subramanian M, "Novel, highly specific N-demethylases enable bacteria to live on caffeine and related purine alkaloids." Journal of Bacteriology, 2012, vol 194, no 8, pg 2041-2049.<br />
<br />
Rodriguez del Rey Z, Granek EF, Sylvester S, "Occurrence and concentration of caffeine in Oregon coastal waters." Marine Pollution Bulletin, 2012, vol 64, no 8, Pages 1417-1424.<br />
<br />
<html><br />
<div id="footer" /><br />
</html></div>Erik.quandthttp://2012.igem.org/Team:Austin_Texas/Caffeinated_coliTeam:Austin Texas/Caffeinated coli2012-10-26T23:46:40Z<p>Erik.quandt: /* Growth in Caffeinated Beverages */</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli" class="selected"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
<br />
<br />
= '''<center><div style="font-size:150%">Project: Caffeinated coli</div>''' =<br />
<br />
[[File:Caffeinated_Bacteria.jpg|375px|center]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Introduction'''</div> ==<br />
<br />
<html><br />
<a href="http://www.geog.ucsb.edu/events/department-news/1072/if-you-thought-fish-were-sleepless-in-seattle-check-out-the-ones-off-the-coast-of-oregon/"><img src="https://static.igem.org/mediawiki/2012/5/58/FishCoffee.png" alt="UT Austin CNS logo" width="240px"; height="240px"; style="float:right; padding:3px; clear:left;"/></a></html><br />
<br />
Caffeine is commonly used in foods and beverages such as coffee and chocolate and in pharmaceuticals as a cardiac and respiratory stimulant. As a result of the wide use of caffeine, it has become widely present in human waste and as a pollutant in the environment. Bacteria capable of degrading caffeine have been found naturally and could be used for bioremediation. We seek to port caffeine degradation functionality into ''Escherichia coli'' to produce strains that are better suited to degrade caffeine in an industrial setting. <br />
<br />
''Pseudomonas putida'' CBB5, discovered by Ryan Summers and Mani Subramanian at the University of Iowa, can live on caffeine as the sole carbon and nitrogen source. CBB5 uses a nitrogen demethylation pathway to convert caffeine to xanthine with formaldehyde side products. The xanthine and formaldehyde are then used as the nitrogen and carbon sources respectively.<br />
<br />
The N-demethylation pathway consists of four demethylation genes: ''ndmA'', ''ndmB'', ''ndmC'', and ''ndmD''. NdmA, NdmB, and NdmC remove the methyl groups from the N-1, N-3, and N-7 respectively. This is done with the help of a reductase, NdmD.<br />
<br />
[[File:Ndm diagram.JPG|center|650px]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Strategy'''</div> ==<br />
<br />
=== Refactoring Decaffeination Operon ===<br />
<br />
The first goal of this project involves refactoring the caffeine operon from the caffeine utilization pathway from ''Psuedomonas putida'' CBB5, first characterized by Summers et al. in early 2012. The operon, shown below, will be incorporated into the well characterized bacterium, ''Escherichia coli'' [3]. <br />
<br />
[[File:CBB5_Operon.png|center|650px]]<br />
<br />
Directly importing the operon into ''E. coli'' was determined to be impractical, as the strength and regulation of the ribosome binding sites (RBSs) and operon-controlled promoters in the CBB5 operon may not be optimized for function in ''E. coli''. Additionally, the use in CBB5 of GTG start codons conflicts with ''E. coli’s'' preference for ATG – leading to problems in translation initiation.<br />
<br />
We therefore decided to separate out open reading frames for the genes of interest in the CBB5 operon and put them under controlled regulation in a refactored caffeine utilization operon for import into ''E. coli''. The operon's design, shown below and submitted as [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 BBa_K734000], aims to optimize its functionality in its new host. <br />
<br />
[[File:Austin_Texas_Decaffeination_design.png|center]]<br />
<br />
This includes the genes that code for the N-demethylase proteins NdmA, NdmB, and NdmC, and the gene that codes for the putative assisting protein NdmD. Also included is the glutathione S-transferase gene from ''Janthinobacterium'' sp. strain Marseille, necessary for functionality of NdmC. Constitutive expression occurs with a strong, well-characterized promoter ([http://partsregistry.org/wiki/index.php/Part:BBa_J23100 BBa_J23100]) and a strong, well-characterized RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]). Finally, all GTG start codons have been replaced with ATG.<br />
<br />
Sources of parts used in our synthetic decaffeination circuit:<br />
<br />
[[File:Austin_Texas_Part_sources.png|center]]<br />
<br />
==== Assembly ====<br />
<br />
Our operon was assembled via a one-step, six-piece Gibson assembly. Briefly, genes to be stitched together were PCR amplified with overhangs homologous to adjacent genes (or homologous to the vector backbone in the case of the 5' end of the promoter and the 3' end of ''gst9''). The forward primers also contained our chosen RBS and ATG. In a one-pot reaction, a 5'-exonuclease chewed back on the homologous overhangs, allowing adjacent fragments to base pair, and a DNA ligase stitched them together. An overview is shown here.<br />
<br />
[[File:Austin_Texas_Decaffeination_assembly.png|center]]<br />
<br />
=== Operon Testing and Optimization ===<br />
<br />
We employed two different assays for operon functionality: growth on caffeine as a sole carbon source, and a genetic selection for caffeine demethylation to xanthine. To evaluate the ability to use caffeine as a sole carbon source we will transform TOP 10 ''E. coli'' electrocompetent cells with the refactored caffeine utilization operon, grow transformed cells in rich media to saturation and then dilute 1:100 into M9 mineral media. Varying levels of caffeine concentrations will be used to determine the degree of caffeine utilization, and the optimal limit for growth.<br />
<br />
Since the cell has an extremely large requirement for carbon, the energy derived from demethylation may not be enough to support growth. For this reason a second assay for caffeine demethylation based on guanine auxotrophy has been devised. ''E. coli'' synthesizes the nucleotide guanine de novo via a pathway that involves xanthosine-5’-phosphate (XMP) as an essential intermediate. The enzyme responsible for the formation of XMP (from inosine-5’-phosphate, IMP) is IMP dehydrogenase, which is encoded by the ''guaB'' gene. If ''guaB'' is knocked out, the cell is unable to synthesize guanine and is therefore unable to grow on media lacking guanine. We plan to take advantage of this engineered auxotrophy and use it as a way to select for cells that are able to demethylate caffeine to xanthine which can then be converted to XMP by xanthine-guanine phosphoribotransferase (gpt) and thereby relieve the metabolic block and restore guanine synthesis allowing for cell growth.<br />
<br />
[[File:guaB_selection_1.jpg|center|650px]]<br />
<br />
Finally, after construction and preliminary testing of the caffeine degradation operon in''E. coli'', we will attempt to grow our cells in the presence of various commercial caffeinated beverages.<br />
<br />
=== Characterizing Inducible Promoters ===<br />
<br />
In Summers et al (2012)., the two open reading frames ''orf1'' and ''orf4'' are thought to be putative regulators of the caffeine degradation operon's N-demethylase proteins due to sequence homology to other known protein regulators (AraC and gntR family). They are hypothesized to bind to operator sequences in the intergenic regions between genes in the operon, which may serve as promoters for the various demethylases of the operon. <br />
<br />
Analysis of the sizes of the intergenic regions of the CBB5 caffeine utilization operon shows that the regions upstream of the ''ndm'' genes are all greater than 150bp. The large size of these intergenic regions and the fact that they precede the catabolic enzyme gene leads us to hypothesize that there are caffeine (or other methylxanthine) regulatory elements in these sequences.<br />
<br />
We will clone these open reading frames into the reporter plasmid pRA301. pRA301 contains a promoterless ''lacZ'' gene, preceded by a multiple cloning site (MCS). DNA fragments hypothesized to contain promoter elements can be cloned into the MCS and assayed for ''lacZ'' expression by [http://openwetware.org/wiki/Beta-Galactosidase_Assay_%28A_better_Miller%29 Miller Assay]. Using this method, we can determine the regulatory functionality of each open reading frame by examining varying fluorescence levels.<br />
<br />
=== CBB5 Genome sequencing ===<br />
<br />
Since only a partial sequence (13.1kb) of the ''P. putida'' CBB5 decaffeination operon is available (Summers 2012), we are submitting genomic DNA for whole genome sequencing. The genome will be sequenced using Illumina next-gen sequencing by UT [[https://wikis.utexas.edu/display/GSAF/Home+Page GSAF]]. The assembled genome will be deposited to Genbank.<br />
<br />
==<div style="font-size:130%;text-align:center">'''Results</div>==<br />
<br />
===Decaffeination operon (+ gst9) enables growth of GuaB knockout===<br />
<br />
Our initial refactored operon consisted of CBB5 genes ''ndmABCD''. We found that this operon was able to support growth of the ''guaB'' knockout on theophylline but not caffeine. This indicated that the demethylase responsible for removing the 7-methyl group (NdmC) was not functional. Of note, Summers et. al (2012) also could not detect NdmC activity when expressed in ''E. coli''. We reasoned that there could be a missing protein required for NdmC activity. Summers et al. (2012) showed that an uncharacterized protein (coded by ''orf8'') co-purified in CBB5 protein fractions assayed for NdmC activity. We reasoned that this protein could be essential for NdmC function. Unfortunately, the complete DNA sequence of ''orf8'' was not available; only a partial sequence of the ORF was contained in the known operon sequence. <br />
<br />
<br />
[[File:Orf8_partial.png|center|650px]]<br />
<br />
<br />
A protein homology search was performed using the available sequence to find potential homologs that might be able to substitute function of the missing ORF. The search revealed that an uncharacterized gene, ''gst9'', from ''Janthinobacterium'' sp. strain marseille shared a high degree of sequence homology (66%). We decided to synthesize the ''gst9'' gene from the available sequence and clone it into our decaffeination operon to see if it would enable NdmC activity and allow for complete demethylation of caffeine. <br />
<br />
<br />
Despite the relatively low level of homology, we found our hypothesis to be true: adding ''gst9'' to our refactored operon [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 (Bba_K734000)] did indeed enable growth of the ''guaB'' knockout on m9 mineral media:<br />
<br />
<br />
[[File:UtAustin2012DecaffeinationOperon.jpg|center|650px]]<br />
<br />
From this figure, we see that our decaffeination operon enables the GuaB knockout to grow in the absence of guanine or xanthine supplementation by instead demethylating the available caffeine to produce xanthine. This not only confirms the functionality of our refactored decaffeination operon, but also validates our genetic selection for caffeine demethylation through engineered guanine auxotrophy.<br />
<br />
After sequencing the ''P. putida'' CBB5 genome, an alignment of its putative GST (''orf8'') against the ''gst9'' of ''Janthinobacterium'' sp. (strain Marseille) showed less homology (63.5% homology at the nucleotide level) than that of the originally available partial sequence:<br />
<br />
<br />
[[File:Austin_Texas_GST_alignment.png|center|650px]]<br />
<br />
<br />
To more accurately determine the utilization of caffeine by our operon, we tested the growth of our ''E. coli'' cells containing refactored operon and the knocked out ''guaB'' gene under multiple caffeine concentration conditions. We found that our cells were able to grow at conditions as low as 10uM of caffeine, and peaked at a caffeine concentration between 200uM and 250uM. Cells were grown in concentrations as high as 5000uM, at which point cells began to die (presumably from caffeine toxicity). <br />
<br />
<br />
[[File:AustiniGEM2012GrowthCurve.jpg|center|650px]]<br />
<br />
From these growth conditions, we plated dilutions of up to 10<sup>7</sup> the concentration of original solution. This was used to determine individual cell growth based on caffeine. We discovered that approximately 7.6 +/- 0.8 pg of caffeine were utilized per cell. The graph above also shows a method by which we can convert directly from optical densities (an easily measured solution condition) to the caffeine concentration of the growth media. This is viable for cultures that contain cells with our refactored operon, and caffeine concentrations between 0 and approximately 250 uM.<br />
<br />
=== Engineered ''E. coli'' stoichiometrically convert caffeine to guanine for cell replication ===<br />
<br />
As caffeine appears to limit cell growth under these conditions, we were curious about how much of the provided caffeine was being utilized to create DNA and RNA for cellular replication. The genome of ''E. coli'' is roughly 4.6 Mb. Since this is double-stranded DNA and approximately 50% consists of G-C base pairs, there are about 2.3x10<sup>6</sup> guanines needed per cell to replicate its DNA. The dry weight of a typical ''E. coli'' cell is approximately 280 femtograms and 20% of this is RNA ([http://bionumbers.hms.harvard.edu Bionumbers]). Given the molecular weight of a typical RNA nucleotide is roughly 330 g/mol, and that 1/4 of these bases are guanine, this means that there are about 2.55x10<sup>10</sup> guanines needed per cell to replicate its RNA. So, overall the number of guanine molecules in RNA is roughly 10,000x the amount in DNA.<br />
<br />
We found that 7.6 +/- 0.8 pg of caffeine was utilized per cell. Given the molecular weight of 194.19 g/mol, this translates into 2.4x10<sup>10</sup> molecules of caffeine per cell. This is in amazing agreement with the number of molecules of guanine that we have calculated that is required to replicate a cell!<br />
<br />
<div style="font-size:130%;text-align:center"><br />
{| class="wikitable" style="text-align:center"<br />
|-<br />
! !!Molecules per cell<br />
|-<br />
| Caffeine molecules consumed (Calculated) || 2.40x10<sup>10</sup><br />
|-<br />
| Guanine molecules required (Theoretical) || 2.55x10<sup>10</sup><br />
|-<br />
|}<br />
</div><br />
<br />
===Growth in Caffeinated Beverages ===<br />
In order to make our results more palpable, we experimented with growth of our ''E. coli'' strain in various caffeinated beverages. Experiments were first performed on cells with only the ''guaB'' knockout modification, in order to prove that growth in these beverages was even possible. Initial results, shown below, indicate that growth is in fact possible for a wide variety of beverages, including Coca-Cola, 5-Hour Energy, Lipton Tea, and Starbucks Espresso.<br />
<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthInitial.png|center|650px]]<br />
<br />
<br />
The graph above shows that the auxotrophic selection of cells using xanthine derivatives again functions as expected – without xanthine, cells were unable to grow under most conditions. The noticeable optical densities for 50% Coca-Cola and 50% Espresso are due to the strong background color of the culture and not actual cell growth. 50% 5-Hour Energy and Espresso were both shown to be toxic to our cells. Finally, tea was shown to contain enough natural xanthines to allow for partial cell growth, and was excluded from further experiments.<br />
<br />
We then attempted to grow our cell strain containing both the ''guaB'' knockout gene and the refactored decaffeination operon. The results of this experiment are shown below.<br />
<br />
[[File:Caffeinated Beverages Growth Graph.jpg|center|650px]]<br />
<br />
It is important to note that these cells were grown in m9 minimal media containing 0.2% casein as a carbon source. The cells were required to scavenge and convert the available caffeine in the beverage to xanthine in order to synthesize guanine and support cell growth. Our ''E. coli'' was able to utilize the caffeine inherent to each caffeinated beverage. However, without our refactored decaffeination operon, the cells were unable to grow under any conditions. The media contains the appropriate amount of each beverage to have about a 50 micromolar concentration of caffeine. <br />
<br />
Utilizing the previous experiment in which we calculated the growth of our cells per caffeine molecule, we are able to estimate the total concentration of caffeine in each of the original caffeinated beverages. This is done by fitting the created equation that converts OD into predicted caffeine concentration. From caffeine concentration and the known dilution of caffeinated beverage added to each of the cultures, we can estimate the caffeine weight per beverage volume.<br />
<br />
These results are summarized below, and are very close to the values determined by the beverage manufacturers themselves. This serves as further reinforcement that our decaffeination operon works as intended, and even suggests a possible use in measuring the caffeine value of beverages. <br />
<br />
<br />
[[File:Caffeine_Measurement_Chart2.jpg|center]]<br />
<br />
<br />
Finally, we took pictures of our cells grown in caffeinated beverages cultures, as shown below. Cells in the left tubes do not contain the decaffeination operon, while cells in the right tubes do contain the decaffeination operon. Both contain the ''guaB'' gene knocked out, and require xanthine or xanthine derived from caffeine in order to survive. As shown below, Coca-Cola, Diet Coke and Coffee, all of which contain caffeine, feature strong growth of the ''guaB'' knockouts with the decaffeination operon. However, Caffeine Free Diet Coke shows no growth even with the operon, as there is no caffeine to be used as a xanthine source.<br />
<br />
<br />
[[File:UTAustin2012iGEMCaffeinatedBeverages.jpg|border|center|950px]]<br />
<br />
<br />
[[File:Energy_growth_compiled.jpg|border|center|600px]]<br />
<br />
===Transcriptional Regulators===<br />
As described earlier, we hypothesize that the large intergenic regions upstream of various genes in the CBB5 decaffeination operon, particularly upstream of ''ndmA'', may contain methylxanthine regulated promoters. We propose that ''orf1'' and ''orf4'', which were annotated as putative regulators based on sequence homology, act as repressors for the promoters contained in the operon. <br />
<br />
To test these hypotheses, we cloned the intergenic region upstream of the ''ndmA'' gene into a promoterless ''lacZ'' reporter plasmid, pRA301. This vector enabled quantitative measurement of promoter strength using the β-galactosidase [https://2010.igem.org/Team:BCCS-Bristol/Wetlab/BetaGalactosidaseAssays Miller assay]. Additionally, we created compatible biobrick plasmids of each putative repressor, ''orf1'' and ''orf4'', in order to assay their effect on ''ndmA'' promoter strength in the presence or absence of methylxanthine supplementation.<br />
<br />
We transformed these plasmids into the Top10 ''E. coli'' strain to create three strains: one containing only the ''ndmA-lacZ'' reporter plasmid, and co-transformants containing both the ''ndmA-lacZ'' plasmid and either ''orf1'' or ''orf4'' BioBrick plasmids. All three ''E. coli'' strains were grown in m9 minimal media + .2% casein (+ appropriate supplement) at 30<sup>o</sup>C for 48 hrs, after which time Miller Assays were performed. The results, summarized in the figure below, provide strong evidence that expression of ''orf4'' leads to inhibited ''ndmA'' promoter functionality, while ''orf1'' expression provides negligible influence on the ''ndmA'' promoter. <br />
<br />
[[File:Austin2012ndmARepression.jpg|center|650px]]<br />
<br />
A higher Miller Unit correlates to a higher level of ''lacZ'' production, effectively quantifying the degree of gene expression. As the Miller Unit of the strain co-expressed ''ndmA'' promoter with ''orf4'' is lower by a factor of roughly 4, it can be inferred that the protein encoded by ''orf4'' regulates the degree to which the ''ndmA'' promoter is expressed during transcription.<br />
<br />
It should be noted that while expression of ''ndmA'' drops significantly in this experiment, this does not imply that ''orf4'' only inhibits the expression of ''ndmA''. This is discussed in the next section.<br />
<br />
===Inducible Promoters===<br />
As shown above, it appears that ''orf4'' acts as a transcriptional regulator of ''ndmA'' expression. One would expect a transcriptional regulator to regulate transcription in a way that is beneficial to the overall fitness of the organism. In certain situations in which a protein is necessary for survival, the transcriptional factor should up-regulate the production of said gene. Likewise, when a protein is not necessary, the transcriptional factor should down-regulate its production.<br />
<br />
We hypothesize that this is the way in which ''orf4'' regulates transcription of ''ndmA''. In situations of high caffeine and related xanthine concentrations, the protein encoded by ''orf4'' up-regulates the expression of ''ndmA''. In the experiment listed [[Team:Austin_Texas/Caffeinated_coli#Transcriptional_Regulators|above]], in which no xanthine derivative was added to the media, expression from the ''ndmA'' promoter is inhibited (as shown).<br />
<br />
In order to test this hypothesis, we subjected a strain of Top10 ''E. coli'' cells containing the orf4 gene and the ''ndmA'' promoter containing the ''lacZ'' gene to varying supplements of caffeine, theobromine, theophylline, and xanthine. Xanthine was shown to be insoluble at high concentrations, and was therefore removed from the experiment. The results of exposure to varying concentration levels is shown below.<br />
<br />
[[File:UTAustin2012InductionbySubstrate.jpg|center|650px]]<br />
<br />
As predicted, the expression of ''ndmA'' appears to rise at higher caffeine concentrations. This implies that the protein encoded by orf4 relieves the repression of the ndmA promoter region as caffeine concentrations rise. This would allow for greater demethylation functionality of the decaffeination operon as more caffeine is provided to the cells, optimizing the operon's gene expression under varying substrate conditions. <br />
<br />
From these experiments we conclude that the ''ndmA'' intergenic region contains a promoter that is negatively-regulated by the protein coded by ''orf4'' in the absence of methylxanthines. Upon exposure to methylxanthines, it appears that ''orf4''-mediated repression is relieved, leading to induction.<br />
<br />
===Results Summary===<br />
The main accomplishments we achieved this summer include the following:<br />
<br />
*Refactoring of decaffeination operon from ''P. putida'' into ''E. coli''<br />
*Construction of an auxotrophic selection method using our refactored operon, "addicting" ''E. coli'' to caffeine<br />
*Growth of auxtrophic cells on common caffeinated beverages<br />
*Discovery of a methyxanthine inducible promoter (''ndmA'') in the CBB5 operon<br />
*Characterization of an open reading frame (''orf4'') in the CBB5 operon that acts as a transcription regulator<br />
<br />
==References==<br />
<br />
Summers RM, Louie TM, Yu CL, Gakhar L, Louie KC, Subramanian M, "Novel, highly specific N-demethylases enable bacteria to live on caffeine and related purine alkaloids." Journal of Bacteriology, 2012, vol 194, no 8, pg 2041-2049.<br />
<br />
Rodriguez del Rey Z, Granek EF, Sylvester S, "Occurrence and concentration of caffeine in Oregon coastal waters." Marine Pollution Bulletin, 2012, vol 64, no 8, Pages 1417-1424.<br />
<br />
<html><br />
<div id="footer" /><br />
</html></div>Erik.quandthttp://2012.igem.org/Team:Austin_Texas/Caffeinated_coliTeam:Austin Texas/Caffeinated coli2012-10-26T23:43:03Z<p>Erik.quandt: /* Decaffeination operon (+ gst9) enables growth of GuaB knockout */</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli" class="selected"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
<br />
<br />
= '''<center><div style="font-size:150%">Project: Caffeinated coli</div>''' =<br />
<br />
[[File:Caffeinated_Bacteria.jpg|375px|center]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Introduction'''</div> ==<br />
<br />
<html><br />
<a href="http://www.geog.ucsb.edu/events/department-news/1072/if-you-thought-fish-were-sleepless-in-seattle-check-out-the-ones-off-the-coast-of-oregon/"><img src="https://static.igem.org/mediawiki/2012/5/58/FishCoffee.png" alt="UT Austin CNS logo" width="240px"; height="240px"; style="float:right; padding:3px; clear:left;"/></a></html><br />
<br />
Caffeine is commonly used in foods and beverages such as coffee and chocolate and in pharmaceuticals as a cardiac and respiratory stimulant. As a result of the wide use of caffeine, it has become widely present in human waste and as a pollutant in the environment. Bacteria capable of degrading caffeine have been found naturally and could be used for bioremediation. We seek to port caffeine degradation functionality into ''Escherichia coli'' to produce strains that are better suited to degrade caffeine in an industrial setting. <br />
<br />
''Pseudomonas putida'' CBB5, discovered by Ryan Summers and Mani Subramanian at the University of Iowa, can live on caffeine as the sole carbon and nitrogen source. CBB5 uses a nitrogen demethylation pathway to convert caffeine to xanthine with formaldehyde side products. The xanthine and formaldehyde are then used as the nitrogen and carbon sources respectively.<br />
<br />
The N-demethylation pathway consists of four demethylation genes: ''ndmA'', ''ndmB'', ''ndmC'', and ''ndmD''. NdmA, NdmB, and NdmC remove the methyl groups from the N-1, N-3, and N-7 respectively. This is done with the help of a reductase, NdmD.<br />
<br />
[[File:Ndm diagram.JPG|center|650px]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Strategy'''</div> ==<br />
<br />
=== Refactoring Decaffeination Operon ===<br />
<br />
The first goal of this project involves refactoring the caffeine operon from the caffeine utilization pathway from ''Psuedomonas putida'' CBB5, first characterized by Summers et al. in early 2012. The operon, shown below, will be incorporated into the well characterized bacterium, ''Escherichia coli'' [3]. <br />
<br />
[[File:CBB5_Operon.png|center|650px]]<br />
<br />
Directly importing the operon into ''E. coli'' was determined to be impractical, as the strength and regulation of the ribosome binding sites (RBSs) and operon-controlled promoters in the CBB5 operon may not be optimized for function in ''E. coli''. Additionally, the use in CBB5 of GTG start codons conflicts with ''E. coli’s'' preference for ATG – leading to problems in translation initiation.<br />
<br />
We therefore decided to separate out open reading frames for the genes of interest in the CBB5 operon and put them under controlled regulation in a refactored caffeine utilization operon for import into ''E. coli''. The operon's design, shown below and submitted as [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 BBa_K734000], aims to optimize its functionality in its new host. <br />
<br />
[[File:Austin_Texas_Decaffeination_design.png|center]]<br />
<br />
This includes the genes that code for the N-demethylase proteins NdmA, NdmB, and NdmC, and the gene that codes for the putative assisting protein NdmD. Also included is the glutathione S-transferase gene from ''Janthinobacterium'' sp. strain Marseille, necessary for functionality of NdmC. Constitutive expression occurs with a strong, well-characterized promoter ([http://partsregistry.org/wiki/index.php/Part:BBa_J23100 BBa_J23100]) and a strong, well-characterized RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]). Finally, all GTG start codons have been replaced with ATG.<br />
<br />
Sources of parts used in our synthetic decaffeination circuit:<br />
<br />
[[File:Austin_Texas_Part_sources.png|center]]<br />
<br />
==== Assembly ====<br />
<br />
Our operon was assembled via a one-step, six-piece Gibson assembly. Briefly, genes to be stitched together were PCR amplified with overhangs homologous to adjacent genes (or homologous to the vector backbone in the case of the 5' end of the promoter and the 3' end of ''gst9''). The forward primers also contained our chosen RBS and ATG. In a one-pot reaction, a 5'-exonuclease chewed back on the homologous overhangs, allowing adjacent fragments to base pair, and a DNA ligase stitched them together. An overview is shown here.<br />
<br />
[[File:Austin_Texas_Decaffeination_assembly.png|center]]<br />
<br />
=== Operon Testing and Optimization ===<br />
<br />
We employed two different assays for operon functionality: growth on caffeine as a sole carbon source, and a genetic selection for caffeine demethylation to xanthine. To evaluate the ability to use caffeine as a sole carbon source we will transform TOP 10 ''E. coli'' electrocompetent cells with the refactored caffeine utilization operon, grow transformed cells in rich media to saturation and then dilute 1:100 into M9 mineral media. Varying levels of caffeine concentrations will be used to determine the degree of caffeine utilization, and the optimal limit for growth.<br />
<br />
Since the cell has an extremely large requirement for carbon, the energy derived from demethylation may not be enough to support growth. For this reason a second assay for caffeine demethylation based on guanine auxotrophy has been devised. ''E. coli'' synthesizes the nucleotide guanine de novo via a pathway that involves xanthosine-5’-phosphate (XMP) as an essential intermediate. The enzyme responsible for the formation of XMP (from inosine-5’-phosphate, IMP) is IMP dehydrogenase, which is encoded by the ''guaB'' gene. If ''guaB'' is knocked out, the cell is unable to synthesize guanine and is therefore unable to grow on media lacking guanine. We plan to take advantage of this engineered auxotrophy and use it as a way to select for cells that are able to demethylate caffeine to xanthine which can then be converted to XMP by xanthine-guanine phosphoribotransferase (gpt) and thereby relieve the metabolic block and restore guanine synthesis allowing for cell growth.<br />
<br />
[[File:guaB_selection_1.jpg|center|650px]]<br />
<br />
Finally, after construction and preliminary testing of the caffeine degradation operon in''E. coli'', we will attempt to grow our cells in the presence of various commercial caffeinated beverages.<br />
<br />
=== Characterizing Inducible Promoters ===<br />
<br />
In Summers et al (2012)., the two open reading frames ''orf1'' and ''orf4'' are thought to be putative regulators of the caffeine degradation operon's N-demethylase proteins due to sequence homology to other known protein regulators (AraC and gntR family). They are hypothesized to bind to operator sequences in the intergenic regions between genes in the operon, which may serve as promoters for the various demethylases of the operon. <br />
<br />
Analysis of the sizes of the intergenic regions of the CBB5 caffeine utilization operon shows that the regions upstream of the ''ndm'' genes are all greater than 150bp. The large size of these intergenic regions and the fact that they precede the catabolic enzyme gene leads us to hypothesize that there are caffeine (or other methylxanthine) regulatory elements in these sequences.<br />
<br />
We will clone these open reading frames into the reporter plasmid pRA301. pRA301 contains a promoterless ''lacZ'' gene, preceded by a multiple cloning site (MCS). DNA fragments hypothesized to contain promoter elements can be cloned into the MCS and assayed for ''lacZ'' expression by [http://openwetware.org/wiki/Beta-Galactosidase_Assay_%28A_better_Miller%29 Miller Assay]. Using this method, we can determine the regulatory functionality of each open reading frame by examining varying fluorescence levels.<br />
<br />
=== CBB5 Genome sequencing ===<br />
<br />
Since only a partial sequence (13.1kb) of the ''P. putida'' CBB5 decaffeination operon is available (Summers 2012), we are submitting genomic DNA for whole genome sequencing. The genome will be sequenced using Illumina next-gen sequencing by UT [[https://wikis.utexas.edu/display/GSAF/Home+Page GSAF]]. The assembled genome will be deposited to Genbank.<br />
<br />
==<div style="font-size:130%;text-align:center">'''Results</div>==<br />
<br />
===Decaffeination operon (+ gst9) enables growth of GuaB knockout===<br />
<br />
Our initial refactored operon consisted of CBB5 genes ''ndmABCD''. We found that this operon was able to support growth of the ''guaB'' knockout on theophylline but not caffeine. This indicated that the demethylase responsible for removing the 7-methyl group (NdmC) was not functional. Of note, Summers et. al (2012) also could not detect NdmC activity when expressed in ''E. coli''. We reasoned that there could be a missing protein required for NdmC activity. Summers et al. (2012) showed that an uncharacterized protein (coded by ''orf8'') co-purified in CBB5 protein fractions assayed for NdmC activity. We reasoned that this protein could be essential for NdmC function. Unfortunately, the complete DNA sequence of ''orf8'' was not available; only a partial sequence of the ORF was contained in the known operon sequence. <br />
<br />
<br />
[[File:Orf8_partial.png|center|650px]]<br />
<br />
<br />
A protein homology search was performed using the available sequence to find potential homologs that might be able to substitute function of the missing ORF. The search revealed that an uncharacterized gene, ''gst9'', from ''Janthinobacterium'' sp. strain marseille shared a high degree of sequence homology (66%). We decided to synthesize the ''gst9'' gene from the available sequence and clone it into our decaffeination operon to see if it would enable NdmC activity and allow for complete demethylation of caffeine. <br />
<br />
<br />
Despite the relatively low level of homology, we found our hypothesis to be true: adding ''gst9'' to our refactored operon [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 (Bba_K734000)] did indeed enable growth of the ''guaB'' knockout on m9 mineral media:<br />
<br />
<br />
[[File:UtAustin2012DecaffeinationOperon.jpg|center|650px]]<br />
<br />
From this figure, we see that our decaffeination operon enables the GuaB knockout to grow in the absence of guanine or xanthine supplementation by instead demethylating the available caffeine to produce xanthine. This not only confirms the functionality of our refactored decaffeination operon, but also validates our genetic selection for caffeine demethylation through engineered guanine auxotrophy.<br />
<br />
After sequencing the ''P. putida'' CBB5 genome, an alignment of its putative GST (''orf8'') against the ''gst9'' of ''Janthinobacterium'' sp. (strain Marseille) showed less homology (63.5% homology at the nucleotide level) than that of the originally available partial sequence:<br />
<br />
<br />
[[File:Austin_Texas_GST_alignment.png|center|650px]]<br />
<br />
<br />
To more accurately determine the utilization of caffeine by our operon, we tested the growth of our ''E. coli'' cells containing refactored operon and the knocked out ''guaB'' gene under multiple caffeine concentration conditions. We found that our cells were able to grow at conditions as low as 10uM of caffeine, and peaked at a caffeine concentration between 200uM and 250uM. Cells were grown in concentrations as high as 5000uM, at which point cells began to die (presumably from caffeine toxicity). <br />
<br />
<br />
[[File:AustiniGEM2012GrowthCurve.jpg|center|650px]]<br />
<br />
From these growth conditions, we plated dilutions of up to 10<sup>7</sup> the concentration of original solution. This was used to determine individual cell growth based on caffeine. We discovered that approximately 7.6 +/- 0.8 pg of caffeine were utilized per cell. The graph above also shows a method by which we can convert directly from optical densities (an easily measured solution condition) to the caffeine concentration of the growth media. This is viable for cultures that contain cells with our refactored operon, and caffeine concentrations between 0 and approximately 250 uM.<br />
<br />
=== Engineered ''E. coli'' stoichiometrically convert caffeine to guanine for cell replication ===<br />
<br />
As caffeine appears to limit cell growth under these conditions, we were curious about how much of the provided caffeine was being utilized to create DNA and RNA for cellular replication. The genome of ''E. coli'' is roughly 4.6 Mb. Since this is double-stranded DNA and approximately 50% consists of G-C base pairs, there are about 2.3x10<sup>6</sup> guanines needed per cell to replicate its DNA. The dry weight of a typical ''E. coli'' cell is approximately 280 femtograms and 20% of this is RNA ([http://bionumbers.hms.harvard.edu Bionumbers]). Given the molecular weight of a typical RNA nucleotide is roughly 330 g/mol, and that 1/4 of these bases are guanine, this means that there are about 2.55x10<sup>10</sup> guanines needed per cell to replicate its RNA. So, overall the number of guanine molecules in RNA is roughly 10,000x the amount in DNA.<br />
<br />
We found that 7.6 +/- 0.8 pg of caffeine was utilized per cell. Given the molecular weight of 194.19 g/mol, this translates into 2.4x10<sup>10</sup> molecules of caffeine per cell. This is in amazing agreement with the number of molecules of guanine that we have calculated that is required to replicate a cell!<br />
<br />
<div style="font-size:130%;text-align:center"><br />
{| class="wikitable" style="text-align:center"<br />
|-<br />
! !!Molecules per cell<br />
|-<br />
| Caffeine molecules consumed (Calculated) || 2.40x10<sup>10</sup><br />
|-<br />
| Guanine molecules required (Theoretical) || 2.55x10<sup>10</sup><br />
|-<br />
|}<br />
</div><br />
<br />
===Growth in Caffeinated Beverages ===<br />
In order to make our results more palpable, we experimented with growth of our ''E. coli'' strain in various caffeinated beverages. Experiments were first performed on cells with only the ''guaB'' knockout modification, in order to prove that growth in these beverages was even possible. Initial results, shown below, indicate that growth is in fact possible for a wide variety of beverages, including Coca-Cola, 5-Hour Energy, Lipton Tea, and Starbucks Espresso.<br />
<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthInitial.png|center|650px]]<br />
<br />
<br />
The graph above shows that the auxotrophic selection of cells using xanthine derivatives again functions as expected – without xanthine, cells were unable to grow under most conditions. The noticeable optical densities for 50% Coca-Cola and 50% Espresso are due to the strong background color of the culture and not actual cell growth. 50% 5-Hour Energy and Espresso were both shown to be toxic to our cells. Finally, tea was shown to contain enough natural xanthines to allow for partial cell growth, and was excluded from further experiments.<br />
<br />
We then attempted to grow our cell strain containing both the ''guaB'' knockout gene and the refactored decaffeination operon. The results of this experiment are shown below.<br />
<br />
[[File:Caffeinated Beverages Growth Graph.jpg|center|650px]]<br />
<br />
It is important to note that these cells were grown in m9 minimal media containing 0.2% casein as a carbon source. The cells were required to scavenge and convert the available caffeine in the beverage to xanthine in order to synthesize guanine and support cell growth. Our ''E. coli'' was able to utilize the caffeine inherent to each caffeinated beverage. However, without our refactored decaffeination operon, the cells were unable to grow under any conditions. The media contains the appropriate amount of each beverage to have about a 50 micromolar concentration of caffeine. <br />
<br />
Utilizing the previous experiment in which we calculated the growth of our cells per caffeine molecule, we are able to estimate the total concentration of caffeine in each of the original caffeinated beverages. This is done by fitting the created equation that converts OD into predicted caffeine concentration. From caffeine concentration and the known dilution of caffeinated beverage added to each of the cultures, we can estimate the caffeine weight per beverage volume.<br />
<br />
These results are summarized below, and are very close to the values determined by the beverage manufacturers themselves. This serves as further reinforcement that our decaffeination operon works as intended, and even suggests a possible use in measuring the caffeine value of beverages. <br />
<br />
[[File:Caffeine_Measurement_Chart2.jpg|center]]<br />
<br />
Finally, we took pictures of our cells grown in caffeinated beverages cultures, as shown below. Cells in the left tubes do not contain the decaffeination operon, while cells in the right tubes do contain the decaffeination operon. Both contain the ''guaB'' gene knocked out, and require xanthine or xanthine derived from caffeine in order to survive. As shown below, Coca-Cola, Diet Coke and Coffee, all of which contain caffeine, feature strong growth of the ''guaB'' knockouts with the decaffeination operon. However, Caffeine Free Diet Coke shows no growth even with the operon, as there is no caffeine to be used as a xanthine source.<br />
<br />
[[File:UTAustin2012iGEMCaffeinatedBeverages.jpg|border|center|950px]]<br />
<br />
<br />
[[File:Energy_growth_compiled.jpg|border|center|600px]]<br />
<br />
===Transcriptional Regulators===<br />
As described earlier, we hypothesize that the large intergenic regions upstream of various genes in the CBB5 decaffeination operon, particularly upstream of ''ndmA'', may contain methylxanthine regulated promoters. We propose that ''orf1'' and ''orf4'', which were annotated as putative regulators based on sequence homology, act as repressors for the promoters contained in the operon. <br />
<br />
To test these hypotheses, we cloned the intergenic region upstream of the ''ndmA'' gene into a promoterless ''lacZ'' reporter plasmid, pRA301. This vector enabled quantitative measurement of promoter strength using the β-galactosidase [https://2010.igem.org/Team:BCCS-Bristol/Wetlab/BetaGalactosidaseAssays Miller assay]. Additionally, we created compatible biobrick plasmids of each putative repressor, ''orf1'' and ''orf4'', in order to assay their effect on ''ndmA'' promoter strength in the presence or absence of methylxanthine supplementation.<br />
<br />
We transformed these plasmids into the Top10 ''E. coli'' strain to create three strains: one containing only the ''ndmA-lacZ'' reporter plasmid, and co-transformants containing both the ''ndmA-lacZ'' plasmid and either ''orf1'' or ''orf4'' BioBrick plasmids. All three ''E. coli'' strains were grown in m9 minimal media + .2% casein (+ appropriate supplement) at 30<sup>o</sup>C for 48 hrs, after which time Miller Assays were performed. The results, summarized in the figure below, provide strong evidence that expression of ''orf4'' leads to inhibited ''ndmA'' promoter functionality, while ''orf1'' expression provides negligible influence on the ''ndmA'' promoter. <br />
<br />
[[File:Austin2012ndmARepression.jpg|center|650px]]<br />
<br />
A higher Miller Unit correlates to a higher level of ''lacZ'' production, effectively quantifying the degree of gene expression. As the Miller Unit of the strain co-expressed ''ndmA'' promoter with ''orf4'' is lower by a factor of roughly 4, it can be inferred that the protein encoded by ''orf4'' regulates the degree to which the ''ndmA'' promoter is expressed during transcription.<br />
<br />
It should be noted that while expression of ''ndmA'' drops significantly in this experiment, this does not imply that ''orf4'' only inhibits the expression of ''ndmA''. This is discussed in the next section.<br />
<br />
===Inducible Promoters===<br />
As shown above, it appears that ''orf4'' acts as a transcriptional regulator of ''ndmA'' expression. One would expect a transcriptional regulator to regulate transcription in a way that is beneficial to the overall fitness of the organism. In certain situations in which a protein is necessary for survival, the transcriptional factor should up-regulate the production of said gene. Likewise, when a protein is not necessary, the transcriptional factor should down-regulate its production.<br />
<br />
We hypothesize that this is the way in which ''orf4'' regulates transcription of ''ndmA''. In situations of high caffeine and related xanthine concentrations, the protein encoded by ''orf4'' up-regulates the expression of ''ndmA''. In the experiment listed [[Team:Austin_Texas/Caffeinated_coli#Transcriptional_Regulators|above]], in which no xanthine derivative was added to the media, expression from the ''ndmA'' promoter is inhibited (as shown).<br />
<br />
In order to test this hypothesis, we subjected a strain of Top10 ''E. coli'' cells containing the orf4 gene and the ''ndmA'' promoter containing the ''lacZ'' gene to varying supplements of caffeine, theobromine, theophylline, and xanthine. Xanthine was shown to be insoluble at high concentrations, and was therefore removed from the experiment. The results of exposure to varying concentration levels is shown below.<br />
<br />
[[File:UTAustin2012InductionbySubstrate.jpg|center|650px]]<br />
<br />
As predicted, the expression of ''ndmA'' appears to rise at higher caffeine concentrations. This implies that the protein encoded by orf4 relieves the repression of the ndmA promoter region as caffeine concentrations rise. This would allow for greater demethylation functionality of the decaffeination operon as more caffeine is provided to the cells, optimizing the operon's gene expression under varying substrate conditions. <br />
<br />
From these experiments we conclude that the ''ndmA'' intergenic region contains a promoter that is negatively-regulated by the protein coded by ''orf4'' in the absence of methylxanthines. Upon exposure to methylxanthines, it appears that ''orf4''-mediated repression is relieved, leading to induction.<br />
<br />
===Results Summary===<br />
The main accomplishments we achieved this summer include the following:<br />
<br />
*Refactoring of decaffeination operon from ''P. putida'' into ''E. coli''<br />
*Construction of an auxotrophic selection method using our refactored operon, "addicting" ''E. coli'' to caffeine<br />
*Growth of auxtrophic cells on common caffeinated beverages<br />
*Discovery of a methyxanthine inducible promoter (''ndmA'') in the CBB5 operon<br />
*Characterization of an open reading frame (''orf4'') in the CBB5 operon that acts as a transcription regulator<br />
<br />
==References==<br />
<br />
Summers RM, Louie TM, Yu CL, Gakhar L, Louie KC, Subramanian M, "Novel, highly specific N-demethylases enable bacteria to live on caffeine and related purine alkaloids." Journal of Bacteriology, 2012, vol 194, no 8, pg 2041-2049.<br />
<br />
Rodriguez del Rey Z, Granek EF, Sylvester S, "Occurrence and concentration of caffeine in Oregon coastal waters." Marine Pollution Bulletin, 2012, vol 64, no 8, Pages 1417-1424.<br />
<br />
<html><br />
<div id="footer" /><br />
</html></div>Erik.quandthttp://2012.igem.org/Team:Austin_Texas/Caffeinated_coliTeam:Austin Texas/Caffeinated coli2012-10-26T23:39:11Z<p>Erik.quandt: /* Decaffeination operon (+ gst9) enables growth of GuaB knockout */</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli" class="selected"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
<br />
<br />
= '''<center><div style="font-size:150%">Project: Caffeinated coli</div>''' =<br />
<br />
[[File:Caffeinated_Bacteria.jpg|375px|center]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Introduction'''</div> ==<br />
<br />
<html><br />
<a href="http://www.geog.ucsb.edu/events/department-news/1072/if-you-thought-fish-were-sleepless-in-seattle-check-out-the-ones-off-the-coast-of-oregon/"><img src="https://static.igem.org/mediawiki/2012/5/58/FishCoffee.png" alt="UT Austin CNS logo" width="240px"; height="240px"; style="float:right; padding:3px; clear:left;"/></a></html><br />
<br />
Caffeine is commonly used in foods and beverages such as coffee and chocolate and in pharmaceuticals as a cardiac and respiratory stimulant. As a result of the wide use of caffeine, it has become widely present in human waste and as a pollutant in the environment. Bacteria capable of degrading caffeine have been found naturally and could be used for bioremediation. We seek to port caffeine degradation functionality into ''Escherichia coli'' to produce strains that are better suited to degrade caffeine in an industrial setting. <br />
<br />
''Pseudomonas putida'' CBB5, discovered by Ryan Summers and Mani Subramanian at the University of Iowa, can live on caffeine as the sole carbon and nitrogen source. CBB5 uses a nitrogen demethylation pathway to convert caffeine to xanthine with formaldehyde side products. The xanthine and formaldehyde are then used as the nitrogen and carbon sources respectively.<br />
<br />
The N-demethylation pathway consists of four demethylation genes: ''ndmA'', ''ndmB'', ''ndmC'', and ''ndmD''. NdmA, NdmB, and NdmC remove the methyl groups from the N-1, N-3, and N-7 respectively. This is done with the help of a reductase, NdmD.<br />
<br />
[[File:Ndm diagram.JPG|center|650px]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Strategy'''</div> ==<br />
<br />
=== Refactoring Decaffeination Operon ===<br />
<br />
The first goal of this project involves refactoring the caffeine operon from the caffeine utilization pathway from ''Psuedomonas putida'' CBB5, first characterized by Summers et al. in early 2012. The operon, shown below, will be incorporated into the well characterized bacterium, ''Escherichia coli'' [3]. <br />
<br />
[[File:CBB5_Operon.png|center|650px]]<br />
<br />
Directly importing the operon into ''E. coli'' was determined to be impractical, as the strength and regulation of the ribosome binding sites (RBSs) and operon-controlled promoters in the CBB5 operon may not be optimized for function in ''E. coli''. Additionally, the use in CBB5 of GTG start codons conflicts with ''E. coli’s'' preference for ATG – leading to problems in translation initiation.<br />
<br />
We therefore decided to separate out open reading frames for the genes of interest in the CBB5 operon and put them under controlled regulation in a refactored caffeine utilization operon for import into ''E. coli''. The operon's design, shown below and submitted as [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 BBa_K734000], aims to optimize its functionality in its new host. <br />
<br />
[[File:Austin_Texas_Decaffeination_design.png|center]]<br />
<br />
This includes the genes that code for the N-demethylase proteins NdmA, NdmB, and NdmC, and the gene that codes for the putative assisting protein NdmD. Also included is the glutathione S-transferase gene from ''Janthinobacterium'' sp. strain Marseille, necessary for functionality of NdmC. Constitutive expression occurs with a strong, well-characterized promoter ([http://partsregistry.org/wiki/index.php/Part:BBa_J23100 BBa_J23100]) and a strong, well-characterized RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]). Finally, all GTG start codons have been replaced with ATG.<br />
<br />
Sources of parts used in our synthetic decaffeination circuit:<br />
<br />
[[File:Austin_Texas_Part_sources.png|center]]<br />
<br />
==== Assembly ====<br />
<br />
Our operon was assembled via a one-step, six-piece Gibson assembly. Briefly, genes to be stitched together were PCR amplified with overhangs homologous to adjacent genes (or homologous to the vector backbone in the case of the 5' end of the promoter and the 3' end of ''gst9''). The forward primers also contained our chosen RBS and ATG. In a one-pot reaction, a 5'-exonuclease chewed back on the homologous overhangs, allowing adjacent fragments to base pair, and a DNA ligase stitched them together. An overview is shown here.<br />
<br />
[[File:Austin_Texas_Decaffeination_assembly.png|center]]<br />
<br />
=== Operon Testing and Optimization ===<br />
<br />
We employed two different assays for operon functionality: growth on caffeine as a sole carbon source, and a genetic selection for caffeine demethylation to xanthine. To evaluate the ability to use caffeine as a sole carbon source we will transform TOP 10 ''E. coli'' electrocompetent cells with the refactored caffeine utilization operon, grow transformed cells in rich media to saturation and then dilute 1:100 into M9 mineral media. Varying levels of caffeine concentrations will be used to determine the degree of caffeine utilization, and the optimal limit for growth.<br />
<br />
Since the cell has an extremely large requirement for carbon, the energy derived from demethylation may not be enough to support growth. For this reason a second assay for caffeine demethylation based on guanine auxotrophy has been devised. ''E. coli'' synthesizes the nucleotide guanine de novo via a pathway that involves xanthosine-5’-phosphate (XMP) as an essential intermediate. The enzyme responsible for the formation of XMP (from inosine-5’-phosphate, IMP) is IMP dehydrogenase, which is encoded by the ''guaB'' gene. If ''guaB'' is knocked out, the cell is unable to synthesize guanine and is therefore unable to grow on media lacking guanine. We plan to take advantage of this engineered auxotrophy and use it as a way to select for cells that are able to demethylate caffeine to xanthine which can then be converted to XMP by xanthine-guanine phosphoribotransferase (gpt) and thereby relieve the metabolic block and restore guanine synthesis allowing for cell growth.<br />
<br />
[[File:guaB_selection_1.jpg|center|650px]]<br />
<br />
Finally, after construction and preliminary testing of the caffeine degradation operon in''E. coli'', we will attempt to grow our cells in the presence of various commercial caffeinated beverages.<br />
<br />
=== Characterizing Inducible Promoters ===<br />
<br />
In Summers et al (2012)., the two open reading frames ''orf1'' and ''orf4'' are thought to be putative regulators of the caffeine degradation operon's N-demethylase proteins due to sequence homology to other known protein regulators (AraC and gntR family). They are hypothesized to bind to operator sequences in the intergenic regions between genes in the operon, which may serve as promoters for the various demethylases of the operon. <br />
<br />
Analysis of the sizes of the intergenic regions of the CBB5 caffeine utilization operon shows that the regions upstream of the ''ndm'' genes are all greater than 150bp. The large size of these intergenic regions and the fact that they precede the catabolic enzyme gene leads us to hypothesize that there are caffeine (or other methylxanthine) regulatory elements in these sequences.<br />
<br />
We will clone these open reading frames into the reporter plasmid pRA301. pRA301 contains a promoterless ''lacZ'' gene, preceded by a multiple cloning site (MCS). DNA fragments hypothesized to contain promoter elements can be cloned into the MCS and assayed for ''lacZ'' expression by [http://openwetware.org/wiki/Beta-Galactosidase_Assay_%28A_better_Miller%29 Miller Assay]. Using this method, we can determine the regulatory functionality of each open reading frame by examining varying fluorescence levels.<br />
<br />
=== CBB5 Genome sequencing ===<br />
<br />
Since only a partial sequence (13.1kb) of the ''P. putida'' CBB5 decaffeination operon is available (Summers 2012), we are submitting genomic DNA for whole genome sequencing. The genome will be sequenced using Illumina next-gen sequencing by UT [[https://wikis.utexas.edu/display/GSAF/Home+Page GSAF]]. The assembled genome will be deposited to Genbank.<br />
<br />
==<div style="font-size:130%;text-align:center">'''Results</div>==<br />
<br />
===Decaffeination operon (+ gst9) enables growth of GuaB knockout===<br />
<br />
Our initial refactored operon consisted of CBB5 genes ''ndmABCD''. We found that this operon was able to support growth of the ''guaB'' knockout on theophylline but not caffeine. This indicated that the demethylase responsible for removing the 7-methyl group (NdmC) was not functional. Of note, Summers et. al (2012) also could not detect NdmC activity when expressed in ''E. coli''. We reasoned that there could be a missing protein required for NdmC activity. Summers et al. (2012) showed that an uncharacterized protein (coded by ''orf8'') co-purified in CBB5 protein fractions assayed for NdmC activity. We reasoned that this protein could be essential for NdmC function. Unfortunately, the complete DNA sequence of ''orf8'' was not available; only a partial sequence of the ORF was contained in the known operon sequence. <br />
<br />
<br />
[[File:Orf8_partial.png|center|650px]]<br />
<br />
<br />
A protein homology search was performed using the available sequence to find potential homologs that might be able to substitute function of the missing ORF. The search revealed that an uncharacterized gene, ''gst9'', from ''Janthinobacterium'' sp. strain marseille shared a high degree of sequence homology (66%). We decided to synthesize the ''gst9'' gene from the available sequence and clone it into our decaffeination operon to see if it would enable NdmC activity and allow for complete demethylation of caffeine. <br />
<br />
<br />
Despite the relatively low level of homology, we found our hypothesis to be true: adding ''gst9'' to our refactored operon [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 (Bba_K734000)] did indeed enable growth of the ''guaB'' knockout on m9 mineral media:<br />
<br />
<br />
[[File:UtAustin2012DecaffeinationOperon.jpg|center|650px]]<br />
<br />
From this figure, we see that our decaffeination operon enables the GuaB knockout to grow in the absence of guanine or xanthine supplementation by instead demethylating the available caffeine to produce xanthine. This not only confirms the functionality of our refactored decaffeination operon, but also validates our genetic selection for caffeine demethylation through engineered guanine auxotrophy.<br />
<br />
After sequencing the ''P. putida'' CBB5 genome, an alignment of its putative GST (''orf8'') against the ''gst9'' of ''Janthinobacterium'' sp. (strain Marseille) showed less homology (63.5% homology at the nucleotide level) than that of the originally available partial sequence:<br />
<br />
<br />
[[File:Austin_Texas_GST_alignment.png|center|650px]]<br />
<br />
<br />
To more accurately determine the utilization of caffeine by our operon, we tested the growth of our ''E. coli'' cells containing refactored operon and the knocked out ''guaB'' gene under multiple caffeine concentration conditions. We found that our cells were able to grow at conditions as low as 10uM of caffeine, and peaked at a caffeine concentration between 200uM and 250uM. Cells were grown in concentrations as high as 5000uM, at which point cells began to die (presumably from caffeine toxicity). <br />
<br />
[[File:AustiniGEM2012GrowthCurve.jpg|center|650px]]<br />
<br />
From these growth conditions, we plated dilutions of up to 10<sup>7</sup> the concentration of original solution. This was used to determine individual cell growth based on caffeine. We discovered that approximately 7.6 +/- 0.8 pg of caffeine were utilized per cell. The graph above also shows a method by which we can convert directly from optical densities (an easily measured solution condition) to the caffeine concentration of the growth media. This is viable for cultures that contain cells with our refactored operon, and caffeine concentrations between 0 and approximately 250 uM.<br />
<br />
=== Engineered ''E. coli'' stoichiometrically convert caffeine to guanine for cell replication ===<br />
<br />
As caffeine appears to limit cell growth under these conditions, we were curious about how much of the provided caffeine was being utilized to create DNA and RNA for cellular replication. The genome of ''E. coli'' is roughly 4.6 Mb. Since this is double-stranded DNA and approximately 50% consists of G-C base pairs, there are about 2.3x10<sup>6</sup> guanines needed per cell to replicate its DNA. The dry weight of a typical ''E. coli'' cell is approximately 280 femtograms and 20% of this is RNA ([http://bionumbers.hms.harvard.edu Bionumbers]). Given the molecular weight of a typical RNA nucleotide is roughly 330 g/mol, and that 1/4 of these bases are guanine, this means that there are about 2.55x10<sup>10</sup> guanines needed per cell to replicate its RNA. So, overall the number of guanine molecules in RNA is roughly 10,000x the amount in DNA.<br />
<br />
We found that 7.6 +/- 0.8 pg of caffeine was utilized per cell. Given the molecular weight of 194.19 g/mol, this translates into 2.4x10<sup>10</sup> molecules of caffeine per cell. This is in amazing agreement with the number of molecules of guanine that we have calculated that is required to replicate a cell!<br />
<br />
<div style="font-size:130%;text-align:center"><br />
{| class="wikitable" style="text-align:center"<br />
|-<br />
! !!Molecules per cell<br />
|-<br />
| Caffeine molecules consumed (Calculated) || 2.40x10<sup>10</sup><br />
|-<br />
| Guanine molecules required (Theoretical) || 2.55x10<sup>10</sup><br />
|-<br />
|}<br />
</div><br />
<br />
===Growth in Caffeinated Beverages ===<br />
In order to make our results more palpable, we experimented with growth of our ''E. coli'' strain in various caffeinated beverages. Experiments were first performed on cells with only the ''guaB'' knockout modification, in order to prove that growth in these beverages was even possible. Initial results, shown below, indicate that growth is in fact possible for a wide variety of beverages, including Coca-Cola, 5-Hour Energy, Lipton Tea, and Starbucks Espresso.<br />
<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthInitial.png|center|650px]]<br />
<br />
<br />
The graph above shows that the auxotrophic selection of cells using xanthine derivatives again functions as expected – without xanthine, cells were unable to grow under most conditions. The noticeable optical densities for 50% Coca-Cola and 50% Espresso are due to the strong background color of the culture and not actual cell growth. 50% 5-Hour Energy and Espresso were both shown to be toxic to our cells. Finally, tea was shown to contain enough natural xanthines to allow for partial cell growth, and was excluded from further experiments.<br />
<br />
We then attempted to grow our cell strain containing both the ''guaB'' knockout gene and the refactored decaffeination operon. The results of this experiment are shown below.<br />
<br />
[[File:Caffeinated Beverages Growth Graph.jpg|center|650px]]<br />
<br />
It is important to note that these cells were grown in m9 minimal media containing 0.2% casein as a carbon source. The cells were required to scavenge and convert the available caffeine in the beverage to xanthine in order to synthesize guanine and support cell growth. Our ''E. coli'' was able to utilize the caffeine inherent to each caffeinated beverage. However, without our refactored decaffeination operon, the cells were unable to grow under any conditions. The media contains the appropriate amount of each beverage to have about a 50 micromolar concentration of caffeine. <br />
<br />
Utilizing the previous experiment in which we calculated the growth of our cells per caffeine molecule, we are able to estimate the total concentration of caffeine in each of the original caffeinated beverages. This is done by fitting the created equation that converts OD into predicted caffeine concentration. From caffeine concentration and the known dilution of caffeinated beverage added to each of the cultures, we can estimate the caffeine weight per beverage volume.<br />
<br />
These results are summarized below, and are very close to the values determined by the beverage manufacturers themselves. This serves as further reinforcement that our decaffeination operon works as intended, and even suggests a possible use in measuring the caffeine value of beverages. <br />
<br />
[[File:Caffeine_Measurement_Chart2.jpg|center]]<br />
<br />
Finally, we took pictures of our cells grown in caffeinated beverages cultures, as shown below. Cells in the left tubes do not contain the decaffeination operon, while cells in the right tubes do contain the decaffeination operon. Both contain the ''guaB'' gene knocked out, and require xanthine or xanthine derived from caffeine in order to survive. As shown below, Coca-Cola, Diet Coke and Coffee, all of which contain caffeine, feature strong growth of the ''guaB'' knockouts with the decaffeination operon. However, Caffeine Free Diet Coke shows no growth even with the operon, as there is no caffeine to be used as a xanthine source.<br />
<br />
[[File:UTAustin2012iGEMCaffeinatedBeverages.jpg|border|center|950px]]<br />
<br />
<br />
[[File:Energy_growth_compiled.jpg|border|center|600px]]<br />
<br />
===Transcriptional Regulators===<br />
As described earlier, we hypothesize that the large intergenic regions upstream of various genes in the CBB5 decaffeination operon, particularly upstream of ''ndmA'', may contain methylxanthine regulated promoters. We propose that ''orf1'' and ''orf4'', which were annotated as putative regulators based on sequence homology, act as repressors for the promoters contained in the operon. <br />
<br />
To test these hypotheses, we cloned the intergenic region upstream of the ''ndmA'' gene into a promoterless ''lacZ'' reporter plasmid, pRA301. This vector enabled quantitative measurement of promoter strength using the β-galactosidase [https://2010.igem.org/Team:BCCS-Bristol/Wetlab/BetaGalactosidaseAssays Miller assay]. Additionally, we created compatible biobrick plasmids of each putative repressor, ''orf1'' and ''orf4'', in order to assay their effect on ''ndmA'' promoter strength in the presence or absence of methylxanthine supplementation.<br />
<br />
We transformed these plasmids into the Top10 ''E. coli'' strain to create three strains: one containing only the ''ndmA-lacZ'' reporter plasmid, and co-transformants containing both the ''ndmA-lacZ'' plasmid and either ''orf1'' or ''orf4'' BioBrick plasmids. All three ''E. coli'' strains were grown in m9 minimal media + .2% casein (+ appropriate supplement) at 30<sup>o</sup>C for 48 hrs, after which time Miller Assays were performed. The results, summarized in the figure below, provide strong evidence that expression of ''orf4'' leads to inhibited ''ndmA'' promoter functionality, while ''orf1'' expression provides negligible influence on the ''ndmA'' promoter. <br />
<br />
[[File:Austin2012ndmARepression.jpg|center|650px]]<br />
<br />
A higher Miller Unit correlates to a higher level of ''lacZ'' production, effectively quantifying the degree of gene expression. As the Miller Unit of the strain co-expressed ''ndmA'' promoter with ''orf4'' is lower by a factor of roughly 4, it can be inferred that the protein encoded by ''orf4'' regulates the degree to which the ''ndmA'' promoter is expressed during transcription.<br />
<br />
It should be noted that while expression of ''ndmA'' drops significantly in this experiment, this does not imply that ''orf4'' only inhibits the expression of ''ndmA''. This is discussed in the next section.<br />
<br />
===Inducible Promoters===<br />
As shown above, it appears that ''orf4'' acts as a transcriptional regulator of ''ndmA'' expression. One would expect a transcriptional regulator to regulate transcription in a way that is beneficial to the overall fitness of the organism. In certain situations in which a protein is necessary for survival, the transcriptional factor should up-regulate the production of said gene. Likewise, when a protein is not necessary, the transcriptional factor should down-regulate its production.<br />
<br />
We hypothesize that this is the way in which ''orf4'' regulates transcription of ''ndmA''. In situations of high caffeine and related xanthine concentrations, the protein encoded by ''orf4'' up-regulates the expression of ''ndmA''. In the experiment listed [[Team:Austin_Texas/Caffeinated_coli#Transcriptional_Regulators|above]], in which no xanthine derivative was added to the media, expression from the ''ndmA'' promoter is inhibited (as shown).<br />
<br />
In order to test this hypothesis, we subjected a strain of Top10 ''E. coli'' cells containing the orf4 gene and the ''ndmA'' promoter containing the ''lacZ'' gene to varying supplements of caffeine, theobromine, theophylline, and xanthine. Xanthine was shown to be insoluble at high concentrations, and was therefore removed from the experiment. The results of exposure to varying concentration levels is shown below.<br />
<br />
[[File:UTAustin2012InductionbySubstrate.jpg|center|650px]]<br />
<br />
As predicted, the expression of ''ndmA'' appears to rise at higher caffeine concentrations. This implies that the protein encoded by orf4 relieves the repression of the ndmA promoter region as caffeine concentrations rise. This would allow for greater demethylation functionality of the decaffeination operon as more caffeine is provided to the cells, optimizing the operon's gene expression under varying substrate conditions. <br />
<br />
From these experiments we conclude that the ''ndmA'' intergenic region contains a promoter that is negatively-regulated by the protein coded by ''orf4'' in the absence of methylxanthines. Upon exposure to methylxanthines, it appears that ''orf4''-mediated repression is relieved, leading to induction.<br />
<br />
===Results Summary===<br />
The main accomplishments we achieved this summer include the following:<br />
<br />
*Refactoring of decaffeination operon from ''P. putida'' into ''E. coli''<br />
*Construction of an auxotrophic selection method using our refactored operon, "addicting" ''E. coli'' to caffeine<br />
*Growth of auxtrophic cells on common caffeinated beverages<br />
*Discovery of a methyxanthine inducible promoter (''ndmA'') in the CBB5 operon<br />
*Characterization of an open reading frame (''orf4'') in the CBB5 operon that acts as a transcription regulator<br />
<br />
==References==<br />
<br />
Summers RM, Louie TM, Yu CL, Gakhar L, Louie KC, Subramanian M, "Novel, highly specific N-demethylases enable bacteria to live on caffeine and related purine alkaloids." Journal of Bacteriology, 2012, vol 194, no 8, pg 2041-2049.<br />
<br />
Rodriguez del Rey Z, Granek EF, Sylvester S, "Occurrence and concentration of caffeine in Oregon coastal waters." Marine Pollution Bulletin, 2012, vol 64, no 8, Pages 1417-1424.<br />
<br />
<html><br />
<div id="footer" /><br />
</html></div>Erik.quandthttp://2012.igem.org/Team:Austin_Texas/Caffeinated_coliTeam:Austin Texas/Caffeinated coli2012-10-26T22:39:20Z<p>Erik.quandt: /* Growth in Caffeinated Beverages */</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli" class="selected"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
<br />
<br />
= '''<center><div style="font-size:150%">Project: Caffeinated coli</div>''' =<br />
<br />
[[File:Caffeinated_Bacteria.jpg|375px|center]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Introduction'''</div> ==<br />
<br />
<html><br />
<a href="http://www.geog.ucsb.edu/events/department-news/1072/if-you-thought-fish-were-sleepless-in-seattle-check-out-the-ones-off-the-coast-of-oregon/"><img src="https://static.igem.org/mediawiki/2012/5/58/FishCoffee.png" alt="UT Austin CNS logo" width="240px"; height="240px"; style="float:right; padding:3px; clear:left;"/></a></html><br />
<br />
Caffeine is commonly used in foods and beverages such as coffee and chocolate and in pharmaceuticals as a cardiac and respiratory stimulant. As a result of the wide use of caffeine, it has become widely present in human waste and as a pollutant in the environment. Bacteria capable of degrading caffeine have been found naturally and could be used for bioremediation. We seek to port caffeine degradation functionality into ''Escherichia coli'' to produce strains that are better suited to degrade caffeine in an industrial setting. <br />
<br />
''Pseudomonas putida'' CBB5, discovered by Ryan Summers and Mani Subramanian at the University of Iowa, can live on caffeine as the sole carbon and nitrogen source. CBB5 uses a nitrogen demethylation pathway to convert caffeine to xanthine with formaldehyde side products. The xanthine and formaldehyde are then used as the nitrogen and carbon sources respectively.<br />
<br />
The N-demethylation pathway consists of four demethylation genes: ''ndmA'', ''ndmB'', ''ndmC'', and ''ndmD''. NdmA, NdmB, and NdmC remove the methyl groups from the N-1, N-3, and N-7 respectively. This is done with the help of a reductase, NdmD.<br />
<br />
[[File:Ndm diagram.JPG|center|650px]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Strategy'''</div> ==<br />
<br />
=== Refactoring Decaffeination Operon ===<br />
<br />
The first goal of this project involves refactoring the caffeine operon from the caffeine utilization pathway from ''Psuedomonas putida'' CBB5, first characterized by Summers et al. in early 2012. The operon, shown below, will be incorporated into the well characterized bacterium, ''Escherichia coli'' [3]. <br />
<br />
[[File:CBB5_Operon.png|center|650px]]<br />
<br />
Directly importing the operon into ''E. coli'' was determined to be impractical, as the strength and regulation of the ribosome binding sites (RBSs) and operon-controlled promoters in the CBB5 operon may not be optimized for function in ''E. coli''. Additionally, the use in CBB5 of GTG start codons conflicts with ''E. coli’s'' preference for ATG – leading to problems in translation initiation.<br />
<br />
We therefore decided to separate out open reading frames for the genes of interest in the CBB5 operon and put them under controlled regulation in a refactored caffeine utilization operon for import into ''E. coli''. The operon's design, shown below and submitted as [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 BBa_K734000], aims to optimize its functionality in its new host. <br />
<br />
[[File:Austin_Texas_Decaffeination_design.png|center]]<br />
<br />
This includes the genes that code for the N-demethylase proteins NdmA, NdmB, and NdmC, and the gene that codes for the putative assisting protein NdmD. Also included is the glutathione S-transferase gene from ''Janthinobacterium'' sp. strain Marseille, necessary for functionality of NdmC. Constitutive expression occurs with a strong, well-characterized promoter ([http://partsregistry.org/wiki/index.php/Part:BBa_J23100 BBa_J23100]) and a strong, well-characterized RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]). Finally, all GTG start codons have been replaced with ATG.<br />
<br />
Sources of parts used in our synthetic decaffeination circuit:<br />
<br />
[[File:Austin_Texas_Part_sources.png|center]]<br />
<br />
==== Assembly ====<br />
<br />
Our operon was assembled via a one-step, six-piece Gibson assembly. Briefly, genes to be stitched together were PCR amplified with overhangs homologous to adjacent genes (or homologous to the vector backbone in the case of the 5' end of the promoter and the 3' end of ''gst9''). The forward primers also contained our chosen RBS and ATG. In a one-pot reaction, a 5'-exonuclease chewed back on the homologous overhangs, allowing adjacent fragments to base pair, and a DNA ligase stitched them together. An overview is shown here.<br />
<br />
[[File:Austin_Texas_Decaffeination_assembly.png|center]]<br />
<br />
=== Operon Testing and Optimization ===<br />
<br />
We employed two different assays for operon functionality: growth on caffeine as a sole carbon source, and a genetic selection for caffeine demethylation to xanthine. To evaluate the ability to use caffeine as a sole carbon source we will transform TOP 10 ''E. coli'' electrocompetent cells with the refactored caffeine utilization operon, grow transformed cells in rich media to saturation and then dilute 1:100 into M9 mineral media. Varying levels of caffeine concentrations will be used to determine the degree of caffeine utilization, and the optimal limit for growth.<br />
<br />
Since the cell has an extremely large requirement for carbon, the energy derived from demethylation may not be enough to support growth. For this reason a second assay for caffeine demethylation based on guanine auxotrophy has been devised. ''E. coli'' synthesizes the nucleotide guanine de novo via a pathway that involves xanthosine-5’-phosphate (XMP) as an essential intermediate. The enzyme responsible for the formation of XMP (from inosine-5’-phosphate, IMP) is IMP dehydrogenase, which is encoded by the ''guaB'' gene. If ''guaB'' is knocked out, the cell is unable to synthesize guanine and is therefore unable to grow on media lacking guanine. We plan to take advantage of this engineered auxotrophy and use it as a way to select for cells that are able to demethylate caffeine to xanthine which can then be converted to XMP by xanthine-guanine phosphoribotransferase (gpt) and thereby relieve the metabolic block and restore guanine synthesis allowing for cell growth.<br />
<br />
[[File:guaB_selection_1.jpg|center|650px]]<br />
<br />
Finally, after construction and preliminary testing of the caffeine degradation operon in''E. coli'', we will attempt to grow our cells in the presence of various commercial caffeinated beverages.<br />
<br />
=== Characterizing Inducible Promoters ===<br />
<br />
In Summers et al (2012)., the two open reading frames ''orf1'' and ''orf4'' are thought to be putative regulators of the caffeine degradation operon's N-demethylase proteins due to sequence homology to other known protein regulators (AraC and gntR family). They are hypothesized to bind to operator sequences in the intergenic regions between genes in the operon, which may serve as promoters for the various demethylases of the operon. <br />
<br />
Analysis of the sizes of the intergenic regions of the CBB5 caffeine utilization operon shows that the regions upstream of the ''ndm'' genes are all greater than 150bp. The large size of these intergenic regions and the fact that they precede the catabolic enzyme gene leads us to hypothesize that there are caffeine (or other methylxanthine) regulatory elements in these sequences.<br />
<br />
We will clone these open reading frames into the reporter plasmid pRA301. pRA301 contains a promoterless ''lacZ'' gene, preceded by a multiple cloning site (MCS). DNA fragments hypothesized to contain promoter elements can be cloned into the MCS and assayed for ''lacZ'' expression by [http://openwetware.org/wiki/Beta-Galactosidase_Assay_%28A_better_Miller%29 Miller Assay]. Using this method, we can determine the regulatory functionality of each open reading frame by examining varying fluorescence levels.<br />
<br />
=== CBB5 Genome sequencing ===<br />
<br />
Since only a partial sequence (13.1kb) of the ''P. putida'' CBB5 decaffeination operon is available (Summers 2012), we are submitting genomic DNA for whole genome sequencing. The genome will be sequenced using Illumina next-gen sequencing by UT [[https://wikis.utexas.edu/display/GSAF/Home+Page GSAF]]. The assembled genome will be deposited to Genbank.<br />
<br />
==<div style="font-size:130%;text-align:center">'''Results</div>==<br />
<br />
===Decaffeination operon (+ gst9) enables growth of GuaB knockout===<br />
<br />
Our initial refactored operon consisted of CBB5 genes ''ndmABCD''. We found that this operon was able to support growth of the ''guaB'' knockout on theophylline but not caffeine. This indicated that the demethylase responsible for removing the 7-methyl group (NdmC) was not functional. Of note, Summers et. al (2012) also could not detect NdmC activity when expressed in ''E. coli''. We reasoned that there could be a missing protein required for NdmC activity. Summers et al. (2012) showed that an uncharacterized protein (coded by ''orf8'') co-purified in CBB5 protein fractions assayed for NdmC activity. We reasoned that this protein could be essential for NdmC function. Unfortunately, the complete DNA sequence of ''orf8'' was not available; only a partial sequence of the ORF was contained in the known operon sequence. <br />
<br />
<br />
[[File:Orf8_partial.png|center|650px]]<br />
<br />
<br />
A protein homology search was performed using the available sequence to find potential homologs that might be able to substitute function of the missing ORF. The search revealed that an uncharacterized gene, ''gst9'', from ''Janthinobacterium'' sp. strain marseille shared a high degree of sequence homology (70%). We decided to synthesize the ''gst9'' gene from the available sequence and clone it into our decaffeination operon to see if it would enable NdmC activity and allow for complete demethylation of caffeine. We found our hyphothesis to be true: adding ''gst9'' to our refactored operon [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 (Bba_K734000)] did indeed enable growth of the ''guaB'' knockout on m9 mineral media:<br />
<br />
<br />
[[File:UtAustin2012DecaffeinationOperon.jpg|center|650px]]<br />
<br />
From this figure, we see that our decaffeination operon enables the GuaB knockout to grow in the absence of guanine or xanthine supplementation by instead demethylating the available caffeine to produce xanthine. This not only confirms the functionality of our refactored decaffeination operon, but proves a method by which we can use it to auxotrophically select for cells.<br />
<br />
To more accurately determine the utilization of caffeine by our operon, we tested the growth of our ''E. coli'' cells containing refactored operon and the knocked out ''guaB'' gene under multiple caffeine concentration conditions. We found that our cells were able to grow at conditions as low as 10uM of caffeine, and peaked at a caffeine concentration between 200uM and 250uM. Cells were grown in concentrations as high as 5000uM, at which point cells began to die (presumably from caffeine toxicity). <br />
<br />
[[File:AustiniGEM2012GrowthCurve.jpg|center|650px]]<br />
<br />
From these growth conditions, we plated dilutions of up to 10<sup>7</sup> the concentration of original solution. This was used to determine individual cell growth based on caffeine. We discovered that approximately 7.6 +/- 0.8 pg of caffeine were utilized per cell. The graph above also shows a method by which we can convert directly from optical densities (an easily measured solution condition) to the caffeine concentration of the growth media. This is viable for cultures that contain cells with our refactored operon, and caffeine concentrations between 0 and approximately 250 uM.<br />
<br />
=== Engineered ''E. coli'' stoichiometrically convert caffeine to guanine for cell replication ===<br />
<br />
As caffeine appears to limit cell growth under these conditions, we were curious about how much of the provided caffeine was being utilized to create DNA and RNA for cellular replication. The genome of ''E. coli'' is roughly 4.6 Mb. Since this is double-stranded DNA and approximately 50% consists of G-C base pairs, there are about 2.3x10<sup>6</sup> guanines needed per cell to replicate its DNA. The dry weight of a typical ''E. coli'' cell is approximately 280 femtograms and 20% of this is RNA ([http://bionumbers.hms.harvard.edu Bionumbers]). Given the molecular weight of a typical RNA nucleotide is roughly 330 g/mol, and that 1/4 of these bases are guanine, this means that there are about 2.55x10<sup>10</sup> guanines needed per cell to replicate its RNA. So, overall the number of guanine molecules in RNA is roughly 10,000x the amount in DNA.<br />
<br />
We found that 7.6 +/- 0.8 pg of caffeine was utilized per cell. Given the molecular weight of 194.19 g/mol, this translates into 2.4x10<sup>10</sup> molecules of caffeine per cell. This is in amazing agreement with the number of molecules of guanine that we have calculated that is required to replicate a cell!<br />
<br />
<div style="font-size:130%;text-align:center"><br />
{| class="wikitable" style="text-align:center"<br />
|-<br />
! !!Molecules per cell<br />
|-<br />
| Caffeine molecules consumed (Calculated) || 2.40x10<sup>10</sup><br />
|-<br />
| Guanine molecules required (Theoretical) || 2.55x10<sup>10</sup><br />
|-<br />
|}<br />
</div><br />
<br />
===Growth in Caffeinated Beverages ===<br />
In order to make our results more palpable, we experimented with growth of our ''E. coli'' strain in various caffeinated beverages. Experiments were first performed on cells with only the ''guaB'' knockout modification, in order to prove that growth in these beverages was even possible. Initial results, shown below, indicate that growth is in fact possible for a wide variety of beverages, including Coca-Cola, 5-Hour Energy, Lipton Tea, and Starbucks Espresso.<br />
<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthInitial.png|center|650px]]<br />
<br />
<br />
The graph above shows that the auxotrophic selection of cells using xanthine derivatives again functions as expected – without xanthine, cells were unable to grow under most conditions. The noticeable optical densities for 50% Coca-Cola and 50% Espresso are due to the strong background color of the culture and not actual cell growth. 50% 5-Hour Energy and Espresso were both shown to be toxic to our cells. Finally, tea was shown to contain enough natural xanthines to allow for partial cell growth, and was excluded from further experiments.<br />
<br />
We then attempted to grow our cell strain containing both the ''guaB'' knockout gene and the refactored decaffeination operon. The results of this experiment are shown below.<br />
<br />
[[File:Caffeinated Beverages Growth Graph.jpg|center|650px]]<br />
<br />
It is important to note that these cells were grown in m9 minimal media containing 0.2% casein as a carbon source. The cells were required to scavenge and convert the available caffeine in the beverage to xanthine in order to synthesize guanine and support cell growth. Our ''E. coli'' was able to utilize the caffeine inherent to each caffeinated beverage. However, without our refactored decaffeination operon, the cells were unable to grow under any conditions. The media contains the appropriate amount of each beverage to have about a 50 micromolar concentration of caffeine. <br />
<br />
Utilizing the previous experiment in which we calculated the growth of our cells per caffeine molecule, we are able to estimate the total concentration of caffeine in each of the original caffeinated beverages. This is done by fitting the created equation that converts OD into predicted caffeine concentration. From caffeine concentration and the known dilution of caffeinated beverage added to each of the cultures, we can estimate the caffeine weight per beverage volume.<br />
<br />
These results are summarized below, and are very close to the values determined by the beverage manufacturers themselves. This serves as further reinforcement that our decaffeination operon works as intended, and even suggests a possible use in measuring the caffeine value of beverages. <br />
<br />
[[File:Caffeine_Measurement_Chart2.jpg|center]]<br />
<br />
Finally, we took pictures of our cells grown in caffeinated beverages cultures, as shown below. Cells in the left tubes do not contain the decaffeination operon, while cells in the right tubes do contain the decaffeination operon. Both contain the ''guaB'' gene knocked out, and require xanthine or xanthine derived from caffeine in order to survive. As shown below, Coca-Cola, Diet Coke and Coffee, all of which contain caffeine, feature strong growth of the ''guaB'' knockouts with the decaffeination operon. However, Caffeine Free Diet Coke shows no growth even with the operon, as there is no caffeine to be used as a xanthine source.<br />
<br />
[[File:UTAustin2012iGEMCaffeinatedBeverages.jpg|border|center|950px]]<br />
<br />
<br />
[[File:Energy_growth_compiled.jpg|border|center|600px]]<br />
<br />
===Transcriptional Regulators===<br />
As described earlier, we hypothesize that the large intergenic regions upstream of various genes in the CBB5 decaffeination operon, particularly upstream of ''ndmA'', may contain methylxanthine regulated promoters. We propose that ''orf1'' and ''orf4'', which were annotated as putative regulators based on sequence homology, act as repressors for the promoters contained in the operon. <br />
<br />
To test these hypotheses, we cloned the intergenic region upstream of the ''ndmA'' gene into a promoterless ''lacZ'' reporter plasmid, pRA301. This vector enabled quantitative measurement of promoter strength using the β-galactosidase [https://2010.igem.org/Team:BCCS-Bristol/Wetlab/BetaGalactosidaseAssays Miller assay]. Additionally, we created compatible biobrick plasmids of each putative repressor, ''orf1'' and ''orf4'', in order to assay their effect on ''ndmA'' promoter strength in the presence or absence of methylxanthine supplementation.<br />
<br />
We transformed these plasmids into the Top10 ''E. coli'' strain to create three strains: one containing only the ''ndmA-lacZ'' reporter plasmid, and co-transformants containing both the ''ndmA-lacZ'' plasmid and either ''orf1'' or ''orf4'' BioBrick plasmids. All three ''E. coli'' strains were grown in m9 minimal media + .2% casein (+ appropriate supplement) at 30<sup>o</sup>C for 48 hrs, after which time Miller Assays were performed. The results, summarized in the figure below, provide strong evidence that expression of ''orf4'' leads to inhibited ''ndmA'' promoter functionality, while ''orf1'' expression provides negligible influence on the ''ndmA'' promoter. <br />
<br />
[[File:Austin2012ndmARepression.jpg|center|650px]]<br />
<br />
A higher Miller Unit correlates to a higher level of ''lacZ'' production, effectively quantifying the degree of gene expression. As the Miller Unit of the strain co-expressed ''ndmA'' promoter with ''orf4'' is lower by a factor of roughly 4, it can be inferred that the protein encoded by ''orf4'' regulates the degree to which the ''ndmA'' promoter is expressed during transcription.<br />
<br />
It should be noted that while expression of ''ndmA'' drops significantly in this experiment, this does not imply that ''orf4'' only inhibits the expression of ''ndmA''. This is discussed in the next section.<br />
<br />
===Inducible Promoters===<br />
As shown above, it appears that ''orf4'' acts as a transcriptional regulator of ''ndmA'' expression. One would expect a transcriptional regulator to regulate transcription in a way that is beneficial to the overall fitness of the organism. In certain situations in which a protein is necessary for survival, the transcriptional factor should up-regulate the production of said gene. Likewise, when a protein is not necessary, the transcriptional factor should down-regulate its production.<br />
<br />
We hypothesize that this is the way in which ''orf4'' regulates transcription of ''ndmA''. In situations of high caffeine and related xanthine concentrations, the protein encoded by ''orf4'' up-regulates the expression of ''ndmA''. In the experiment listed [[Team:Austin_Texas/Caffeinated_coli#Transcriptional_Regulators|above]], in which no xanthine derivative was added to the media, expression from the ''ndmA'' promoter is inhibited (as shown).<br />
<br />
In order to test this hypothesis, we subjected a strain of Top10 ''E. coli'' cells containing the orf4 gene and the ''ndmA'' promoter containing the ''lacZ'' gene to varying supplements of caffeine, theobromine, theophylline, and xanthine. Xanthine was shown to be insoluble at high concentrations, and was therefore removed from the experiment. The results of exposure to varying concentration levels is shown below.<br />
<br />
[[File:UTAustin2012InductionbySubstrate.jpg|center|650px]]<br />
<br />
As predicted, the expression of ''ndmA'' appears to rise at higher caffeine concentrations. This implies that the protein encoded by orf4 relieves the repression of the ndmA promoter region as caffeine concentrations rise. This would allow for greater demethylation functionality of the decaffeination operon as more caffeine is provided to the cells, optimizing the operon's gene expression under varying substrate conditions. <br />
<br />
From these experiments we conclude that the ''ndmA'' intergenic region contains a promoter that is negatively-regulated by the protein coded by ''orf4'' in the absence of methylxanthines. Upon exposure to methylxanthines, it appears that ''orf4''-mediated repression is relieved, leading to induction.<br />
<br />
===Results Summary===<br />
The main accomplishments we achieved this summer include the following:<br />
<br />
*Refactoring of decaffeination operon from ''P. putida'' into ''E. coli''<br />
*Construction of an auxotrophic selection method using our refactored operon, "addicting" ''E. coli'' to caffeine<br />
*Growth of auxtrophic cells on common caffeinated beverages<br />
*Discovery of a methyxanthine inducible promoter (''ndmA'') in the CBB5 operon<br />
*Characterization of an open reading frame (''orf4'') in the CBB5 operon that acts as a transcription regulator<br />
<br />
==References==<br />
<br />
Summers RM, Louie TM, Yu CL, Gakhar L, Louie KC, Subramanian M, "Novel, highly specific N-demethylases enable bacteria to live on caffeine and related purine alkaloids." Journal of Bacteriology, 2012, vol 194, no 8, pg 2041-2049.<br />
<br />
Rodriguez del Rey Z, Granek EF, Sylvester S, "Occurrence and concentration of caffeine in Oregon coastal waters." Marine Pollution Bulletin, 2012, vol 64, no 8, Pages 1417-1424.<br />
<br />
<html><br />
<div id="footer" /><br />
</html></div>Erik.quandthttp://2012.igem.org/Team:Austin_TexasTeam:Austin Texas2012-10-24T16:58:20Z<p>Erik.quandt: </p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" class="selected" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
[[File:CokeGrowth.png|335px|left]]<br />
[[File:DietCokeGrowth.png|350px|right]]<br />
[[File:UTAustinTower.jpg|x355px|center]]<br />
<br />
<br />
= Project Caffeinated coli =<br />
<br />
<html><a href="/Team:Austin_Texas/Caffeinated_coli"><img src="https://static.igem.org/mediawiki/2012/d/d1/Caffeinated_Coli.jpeg"; alt="Caffeinated Coli"; width="170px"; height="250px"; style="float:left; padding:3px; clear:right;"/></a></html><br />
<br />
<br />
<br />
The widespread use of caffeine (1,3,7–trimethylxanthine) and other methylxanthines in beverages and pharmaceuticals has led to significant environmental pollution. We have developed a novel detection and bioremediation strategy for caffeine contamination by refactoring the methylxanthine degradation operon native to ''Pseudomonas putida'' CBB5. ''Escherichia coli'' cells with this synthetic operon degrade caffeine by N-demethylation to the guanine precursor, xanthine. Cells deficient in guanine biosynthesis and containing our refactored operon were addicted to caffeine; their growth density was limited by the availability of caffeine. Remarkably, they were able to sense the caffeine content of several common beverages. Characterization of nearby genes in the ''P. putida'' operon revealed a potential methylxanthine regulatory system for use in biological circuit design. The synthetic N-demethylation operon could be useful for cheaply producing pharmaceuticals or precursor molecules and for detoxifying waste so that it can be recycled into animal feed and biofuels. <br />
<br />
<br /><br /><br /><br /><br /><br />
<br />
= Project ZombiE.coli =<br />
<br />
<br />
<html><a href="/Team:Austin_Texas/ZombiE_coli"><img src="https://static.igem.org/mediawiki/2012/a/a9/Austin_Texas_logo.png"; alt="ZombiE.coli"; width="170px"; height="250px"; style="float:left; padding:3px; clear:right;"/></a></html><br />
<br />
<br />
<br />
UT’s ZombiE.coli project aims to a develop a tightly regulated genetic switch that is triggered by bacterial quorum signaling and leads to feed-forward propagation of the genetic output in the form of red or green fluorescence as well as amplification of quorum signaling. The switch relies on simple one-way Cre/loxP recombination combined with native quorum signaling to provide us with a system that models transmissible disease spread between populations. We have likened this to an airborne zombie epidemic, in which an “infected” zombie cell is capable of restructuring the genes of a normal cell, turning it into a flesh-hungry counterpart. This system will be useful not only as a simple disease outbreak model for intermediate-level biology education, but also, could provide new insights to how bacterial populations communicate in three dimensions and under different genetic backgrounds. <br />
<br />
<br /><br /><br /><br /><br /><br />
<br />
= Project PopeyE.coli =<br />
<br />
<html><a href="/Team:Austin_Texas/Spinach_reporter"><img src="https://static.igem.org/mediawiki/2012/8/85/Spinach_icon.png"; alt="PopeyEcoli"; width="170px"; style="float:left; padding:3px; clear:right;"/></a></html><br />
<br />
<br />
<br />
In an effort to improve the efficiency, ease, and quality of promoter and RBS strength measurements, we focused on developing a dual fluorescence reporter for simultaneous monitoring both transcription and translation. To measure both processes separately, two fluorescent reporters, the Spinach aptamer and mCherry red fluorescent protein, were assembled into a single construct. The Spinach-mCherry dual reporter is a unique concept; Spinach is a short RNA aptamer that binds to its ligand, DFHBI, and allows it to emit green fluorescence similar to GFP. This gives insight into the direct production of the mCherry-encoding mRNA without the need to wait for protein folding and maturation of the fluorophore. This technique attempted to expand upon current efforts to measure promoter strength relative to a reference standard used by the iGEM community.<br />
<br />
<html><br />
<br /><br /><br /><br /><br />
<center><br />
<a href="http://www.geneious.com/"><img src="https://static.igem.org/mediawiki/2012/d/db/Geneious.png" alt="Geneious logo" width="150px" height="62px" /></a><br />
<a href="http://www.neb.com"><img src="https://static.igem.org/mediawiki/2012/d/d6/Austin_Texas_NEB_logo.jpeg" alt="NEB logo" width="150px" height="58px" /></a><br />
<a href="http://www.epochlifescience.com"><img src="https://static.igem.org/mediawiki/2012/c/c6/Austin_Texas_Epoch_logo.jpg" alt="Epoch logo" width="150px" height="65px" /></a><br />
<a href="http://cssb.utexas.edu"><img src="https://static.igem.org/mediawiki/2012/4/43/UT_Austin_CSSB.jpg" alt="UT Austin CSSB logo" width="150px" height="65px" /></a><br />
<a href="http://cns.utexas.edu"><img src="https://static.igem.org/mediawiki/2012/e/ec/UT_Austin_CNS.png" alt="UT Austin CNS logo" width="150px" height="65px" /></a><br />
<br />
</center><br />
<br />
<div id="footer" /><br />
</html><br />
<br />
<!-- this is commented out<br />
<br />
{|align="justify"<br />
|You can write a background of your team here. Give us a background of your team, the members, etc. Or tell us more about something of your choosing.<br />
|<br />
|-<br />
|<br />
''Tell us more about your project. Give us background. Use this as the abstract of your project. Be descriptive but concise (1-2 paragraphs)''<br />
|[[Image:Austin_Texas_team.png|right|frame|Your team picture]]<br />
|-<br />
|<br />
|<br />
|}<br />
<br />
--></div>Erik.quandthttp://2012.igem.org/File:DietCokeGrowth.pngFile:DietCokeGrowth.png2012-10-24T16:56:47Z<p>Erik.quandt: uploaded a new version of &quot;File:DietCokeGrowth.png&quot;</p>
<hr />
<div></div>Erik.quandthttp://2012.igem.org/File:CokeGrowth.pngFile:CokeGrowth.png2012-10-24T16:56:16Z<p>Erik.quandt: uploaded a new version of &quot;File:CokeGrowth.png&quot;</p>
<hr />
<div></div>Erik.quandthttp://2012.igem.org/Team:Austin_Texas/Caffeinated_coliTeam:Austin Texas/Caffeinated coli2012-10-24T16:47:18Z<p>Erik.quandt: /* Growth in Caffeinated Beverages */</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli" class="selected"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
<br />
<br />
= '''<center><div style="font-size:150%">Project: Caffeinated coli</div>''' =<br />
<br />
[[File:Caffeinated_Bacteria.jpg|375px|center]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Introduction'''</div> ==<br />
<br />
<html><br />
<a href="http://www.geog.ucsb.edu/events/department-news/1072/if-you-thought-fish-were-sleepless-in-seattle-check-out-the-ones-off-the-coast-of-oregon/"><img src="https://static.igem.org/mediawiki/2012/5/58/FishCoffee.png" alt="UT Austin CNS logo" width="240px"; height="240px"; style="float:right; padding:3px; clear:left;"/></a></html><br />
<br />
Caffeine is commonly used in foods and beverages such as coffee and chocolate and in pharmaceuticals as a cardiac and respiratory stimulant. As a result of the wide use of caffeine, it has become widely present in human waste and as a pollutant in the environment. Bacteria capable of degrading caffeine have been found naturally and could be used for bioremediation. We seek to port caffeine degradation functionality into ''Escherichia coli'' to produce strains that are better suited to degrade caffeine in an industrial setting. <br />
<br />
''Pseudomonas putida'' CBB5, discovered by Ryan Summers and Mani Subramanian at the University of Iowa, can live on caffeine as the sole carbon and nitrogen source. CBB5 uses a nitrogen demethylation pathway to convert caffeine to xanthine with formaldehyde side products. The xanthine and formaldehyde are then used as the nitrogen and carbon sources respectively.<br />
<br />
The N-demethylation pathway consists of four demethylation genes: ''ndmA'', ''ndmB'', ''ndmC'', and ''ndmD''. NdmA, NdmB, and NdmC remove the methyl groups from the N-1, N-3, and N-7 respectively. This is done with the help of a reductase, NdmD.<br />
<br />
[[File:Ndm diagram.JPG|center|650px]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Strategy'''</div> ==<br />
<br />
=== Refactoring Decaffeination Operon ===<br />
<br />
The first goal of this project involves refactoring the caffeine operon from the caffeine utilization pathway from ''Psuedomonas putida'' CBB5, first characterized by Summers et al. in early 2012. The operon, shown below, will be incorporated into the well characterized bacterium, ''Escherichia coli'' [3]. <br />
<br />
[[File:CBB5_Operon.png|center|650px]]<br />
<br />
Directly importing the operon into ''E. coli'' was determined to be impractical, as the strength and regulation of the ribosome binding sites (RBSs) and operon-controlled promoters in the CBB5 operon may not be optimized for function in ''E. coli''. Additionally, the use in CBB5 of GTG start codons conflicts with ''E. coli’s'' preference for ATG – leading to problems in translation initiation.<br />
<br />
We therefore decided to separate out open reading frames for the genes of interest in the CBB5 operon and put them under controlled regulation in a refactored caffeine utilization operon for import into ''E. coli''. The operon's design, shown below and submitted as [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 BBa_K734000], aims to optimize its functionality in its new host. <br />
<br />
[[File:Austin_Texas_Decaffeination_design.png|center]]<br />
<br />
This includes the genes that code for the N-demethylase proteins NdmA, NdmB, and NdmC, and the gene that codes for the putative assisting protein NdmD. Also included is the glutathione S-transferase gene from ''Janthinobacterium'' sp. strain Marseille, necessary for functionality of NdmC. Constitutive expression occurs with a strong, well-characterized promoter ([http://partsregistry.org/wiki/index.php/Part:BBa_J23100 BBa_J23100]) and a strong, well-characterized RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]). Finally, all GTG start codons have been replaced with ATG.<br />
<br />
Sources of parts used in our synthetic decaffeination circuit:<br />
<br />
[[File:Austin_Texas_Part_sources.png|center]]<br />
<br />
==== Assembly ====<br />
<br />
Our operon was assembled via a one-step, six-piece Gibson assembly. Briefly, genes to be stitched together were PCR amplified with overhangs homologous to adjacent genes (or homologous to the vector backbone in the case of the 5' end of the promoter and the 3' end of ''gst9''). The forward primers also contained our chosen RBS and ATG. In a one-pot reaction, a 5'-exonuclease chewed back on the homologous overhangs, allowing adjacent fragments to base pair, and a DNA ligase stitched them together. An overview is shown here.<br />
<br />
[[File:Austin_Texas_Decaffeination_assembly.png|center]]<br />
<br />
=== Operon Testing and Optimization ===<br />
<br />
We employed two different assays for operon functionality: growth on caffeine as a sole carbon source, and a genetic selection for caffeine demethylation to xanthine. To evaluate the ability to use caffeine as a sole carbon source we will transform TOP 10 ''E. coli'' electrocompetent cells with the refactored caffeine utilization operon, grow transformed cells in rich media to saturation and then dilute 1:100 into M9 mineral media. Varying levels of caffeine concentrations will be used to determine the degree of caffeine utilization, and the optimal limit for growth.<br />
<br />
Since the cell has an extremely large requirement for carbon, the energy derived from demethylation may not be enough to support growth. For this reason a second assay for caffeine demethylation based on guanine auxotrophy has been devised. ''E. coli'' synthesizes the nucleotide guanine de novo via a pathway that involves xanthosine-5’-phosphate (XMP) as an essential intermediate. The enzyme responsible for the formation of XMP (from inosine-5’-phosphate, IMP) is IMP dehydrogenase, which is encoded by the ''guaB'' gene. If ''guaB'' is knocked out, the cell is unable to synthesize guanine and is therefore unable to grow on media lacking guanine. We plan to take advantage of this engineered auxotrophy and use it as a way to select for cells that are able to demethylate caffeine to xanthine which can then be converted to XMP by xanthine-guanine phosphoribotransferase (gpt) and thereby relieve the metabolic block and restore guanine synthesis allowing for cell growth.<br />
<br />
[[File:guaB_selection_1.jpg|center|650px]]<br />
<br />
Finally, after construction and preliminary testing of the caffeine degradation operon in''E. coli'', we will attempt to grow our cells in the presence of various commercial caffeinated beverages.<br />
<br />
=== Characterizing Inducible Promoters ===<br />
<br />
In Summers et al (2012)., the two open reading frames ''orf1'' and ''orf4'' are thought to be putative regulators of the caffeine degradation operon's N-demethylase proteins due to sequence homology to other known protein regulators (AraC and gntR family). They are hypothesized to bind to operator sequences in the intergenic regions between genes in the operon, which may serve as promoters for the various demethylases of the operon. <br />
<br />
Analysis of the sizes of the intergenic regions of the CBB5 caffeine utilization operon shows that the regions upstream of the ''ndm'' genes are all greater than 150bp. The large size of these intergenic regions and the fact that they precede the catabolic enzyme gene leads us to hypothesize that there are caffeine (or other methylxanthine) regulatory elements in these sequences.<br />
<br />
We will clone these open reading frames into the reporter plasmid pRA301. pRA301 contains a promoterless ''lacZ'' gene, preceded by a multiple cloning site (MCS). DNA fragments hypothesized to contain promoter elements can be cloned into the MCS and assayed for ''lacZ'' expression by [http://openwetware.org/wiki/Beta-Galactosidase_Assay_%28A_better_Miller%29 Miller Assay]. Using this method, we can determine the regulatory functionality of each open reading frame by examining varying fluorescence levels.<br />
<br />
=== CBB5 Genome sequencing ===<br />
<br />
Since only a partial sequence (13.1kb) of the ''P. putida'' CBB5 decaffeination operon is available (Summers 2012), we are submitting genomic DNA for whole genome sequencing. The genome will be sequenced using Illumina next-gen sequencing by UT [[https://wikis.utexas.edu/display/GSAF/Home+Page GSAF]]. The assembled genome will be deposited to Genbank.<br />
<br />
==<div style="font-size:130%;text-align:center">'''Results</div>==<br />
<br />
===Decaffeination operon (+ gst9) enables growth of GuaB knockout===<br />
<br />
Our initial refactored operon consisted of CBB5 genes ''ndmABCD''. We found that this operon was able to support growth of the ''guaB'' knockout on theophylline but not caffeine. This indicated that the demethylase responsible for removing the 7-methyl group (NdmC) was not functional. Of note, Summers et. al (2012) also could not detect NdmC activity when expressed in ''E. coli''. We reasoned that there could be a missing protein required for NdmC activity. Summers et al. (2012) showed that an uncharacterized protein (coded by ''orf8'') co-purified in CBB5 protein fractions assayed for NdmC activity. We reasoned that this protein could be essential for NdmC function. Unfortunately, the complete DNA sequence of ''orf8'' was not available; only a partial sequence of the ORF was contained in the known operon sequence. <br />
<br />
<br />
[[File:Orf8_partial.png|center|650px]]<br />
<br />
<br />
A protein homology search was performed using the available sequence to find potential homologs that might be able to substitute function of the missing ORF. The search revealed that an uncharacterized gene, ''gst9'', from ''Janthinobacterium'' sp. strain marseille shared a high degree of sequence homology (70%). We decided to synthesize the ''gst9'' gene from the available sequence and clone it into our decaffeination operon to see if it would enable NdmC activity and allow for complete demethylation of caffeine. We found our hyphothesis to be true: adding ''gst9'' to our refactored operon [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 (Bba_K734000)] did indeed enable growth of the ''guaB'' knockout on m9 mineral media:<br />
<br />
<br />
[[File:UtAustin2012DecaffeinationOperon.jpg|center|650px]]<br />
<br />
From this figure, we see that our decaffeination operon enables the GuaB knockout to grow in the absence of guanine or xanthine supplementation by instead demethylating the available caffeine to produce xanthine. This not only confirms the functionality of our refactored decaffeination operon, but proves a method by which we can use it to auxotrophically select for cells.<br />
<br />
To more accurately determine the utilization of caffeine by our operon, we tested the growth of our ''E. coli'' cells containing refactored operon and the knocked out ''guaB'' gene under multiple caffeine concentration conditions. We found that our cells were able to grow at conditions as low as 10uM of caffeine, and peaked at a caffeine concentration of approximately 250uM. Cells were grown in concentrations as high as 5000uM, at which point cells began to die (presumably from caffeine toxicity). <br />
<br />
[[File:AustiniGEM2012GrowthCurve.jpg|center|650px]]<br />
<br />
From these growth conditions, we plated dilutions of up to 10<sup>7</sup> the concentration of original solution. This was used to determine individual cell growth based on caffeine. We discovered that approximately 7.6 +/- 0.8 pg of caffeine were utilized per cell. The graph above also shows a method by which we can convert directly from optical densities (an easily measured solution condition) to the caffeine concentration of the growth media. This is viable for cultures that contain cells with our refactored operon, and caffeine concentrations between 0 and approximately 250 uM.<br />
<br />
=== Engineered ''E. coli'' stoichiometrically convert caffeine to guanine for cell replication ===<br />
<br />
As caffeine appears to limit cell growth under these conditions, we were curious about how much of the provided caffeine was being utilized to create DNA and RNA for cellular replication. The genome of ''E. coli'' is roughly 4.6 Mb. Since this is double-stranded DNA and approximately 50% consists of G-C base pairs, there are about 2.3x10<sup>6</sup> guanines needed per cell to replicate its DNA. The dry weight of a typical ''E. coli'' cell is approximately 280 femtograms and 20% of this is RNA ([http://bionumbers.hms.harvard.edu Bionumbers]). Given the molecular weight of a typical RNA nucleotide is roughly 330 g/mol, and that 1/4 of these bases are guanine, this means that there are about 2.55x10<sup>10</sup> guanines needed per cell to replicate its RNA. So, overall the number of guanine molecules in RNA is roughly 10,000x the amount in DNA.<br />
<br />
We found that 7.6 +/- 0.8 pg of caffeine was utilized per cell. Given the molecular weight of 194.19 g/mol, this translates into 2.4x10<sup>10</sup> molecules of caffeine per cell. This is in amazing agreement with the number of molecules of guanine that we have calculated that is required to replicate a cell!<br />
<br />
<div style="font-size:130%;text-align:center"><br />
{| class="wikitable" style="text-align:center"<br />
|-<br />
! !!Molecules per cell<br />
|-<br />
| Caffeine molecules consumed (Calculated) || 2.40x10<sup>10</sup><br />
|-<br />
| Guanine molecules required (Theoretical) || 2.55x10<sup>10</sup><br />
|-<br />
|}<br />
</div><br />
<br />
===Growth in Caffeinated Beverages ===<br />
In order to make our results more palpable, we experimented with growth of our ''E. coli'' strain in various caffeinated beverages. Experiments were first performed on cells with only the ''guaB'' knockout modification, in order to prove that growth in these beverages was even possible. Initial results, shown below, indicate that growth is in fact possible for a wide variety of beverages, including Coca-Cola, 5-Hour Energy, Lipton Tea, and Starbucks Espresso.<br />
<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthInitial.png|center|650px]]<br />
<br />
The graph above shows that the auxotrophic selection of cells using xanthine derivatives again functions as expected – without xanthine, cells were unable to grow under most conditions. The noticeable optical densities for 50% Coca-Cola and 50% Espresso are due to the strong background color of the culture and not actual cell growth. 50% 5-Hour Energy and Espresso were both shown to be toxic to our cells. Finally, tea was shown to contain enough natural xanthines to allow for partial cell growth, and was excluded from further experiments.<br />
<br />
We then attempted to grow our cell strain containing both the ''guaB'' knockout gene and the refactored decaffeination operon. The results of this experiment are shown below.<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthFinal.jpg|center|720px]]<br />
It is important to note that these cells were grown in m9 minimal media containing only 0.2% casein as a natural carbon source. The cells were required to scavenge virtually all of their carbon required for guanine synthesis from the caffeine supplied to the system, or die. Our ''E. coli'' was able to utilize the caffeine inherent to Coca-Cola, Starbucks Espresso and 5-Hour Energy, as well as caffeine in caffeine. However, without our refactored decaffeination operon, the cells were unable to grow under any conditions. The two small bars that appear above in 50% Coca-Cola and 10% Espresso are simply due to the high background color of the cultures. It is also worth note that the 10% 5-Hour Energy growth conditions proved marginally toxic to our ''E. coli'', as the cells were unable to reach maximum optical densities.<br />
<br />
Utilizing the previous experiment in which we calculated the growth of our cells per caffeine molecule, we are able to estimate the total concentration of caffeine in each of the original caffeinated beverages. This is done by fitting the created equation that converts OD into predicted caffeine concentration. From caffeine concentration and the known dilution of caffeinated beverage added to each of the cultures, we can estimate the caffeine weight per beverage volume.<br />
<br />
These results are summarized below, and are very close to the values determined by the beverage manufacturers themselves. This serves as further reinforcement that our decaffeination operon works as intended, and even suggests a possible use in measuring the caffeine value of beverages. <br />
<br />
<div style="font-size:130%;text-align:center"><br />
{| class="wikitable" style="text-align:center"<br />
|-<br />
! !! Caffeine Content we Calculated (mg/L) !! Caffeine Content Manufacturer Calculated (mg/L)<br />
|-<br />
| Coca-Cola || 99.1 || 98.6<br />
|-<br />
| Starbucks Espresso|| 44.7 || 39.5<br />
|-<br />
| 5-Hour Energy || 4259.8 &dagger; || 2333.2<br />
|}<br />
</div><br />
&dagger; Note that the cells in 5-Hour Energy appeared to be in exponential growth phase, weakening the strength of the equation's fit to reality.<br />
<br />
Finally, we took pictures of our cells grown in caffeinated beverages cultures, as shown below. Cells in the left tubes do not contain the decaffeination operon, while cells in the right tubes do contain the decaffeination operon. Both contain the ''guaB'' gene knocked out, and require xanthine or xanthine derived from caffeine in order to survive. As shown below, Coca-Cola, Diet Coke and Coffee, all of which contain caffeine, feature strong growth of the ''guaB'' knockouts with the decaffeination operon. However, Caffeine Free Diet Coke shows no growth even with the operon, as there is no caffeine to be used as a xanthine source.<br />
<br />
[[File:UTAustin2012iGEMCaffeinatedBeverages.jpg|border|center|950px]]<br />
<br />
<br />
[[File:Energy_growth_compiled.jpg|border|center|600px]]<br />
<br />
===Transcriptional Regulators===<br />
As described earlier, we hypothesize that the large intergenic regions upstream of various genes in the CBB5 decaffeination operon, particularly upstream of ''ndmA'', may contain methylxanthine regulated promoters. We propose that ''orf1'' and ''orf4'', which were annotated as putative regulators based on sequence homology, act as repressors for the promoters contained in the operon. <br />
<br />
To test these hypotheses, we cloned the intergenic region upstream of the ''ndmA'' gene into a promoterless ''lacZ'' reporter plasmid, pRA301. This vector enabled quantitative measurement of promoter strength using the β-galactosidase [https://2010.igem.org/Team:BCCS-Bristol/Wetlab/BetaGalactosidaseAssays Miller assay]. Additionally, we created compatible biobrick plasmids of each putative repressor, ''orf1'' and ''orf4'', in order to assay their effect on ''ndmA'' promoter strength in the presence or absence of methylxanthine supplementation.<br />
<br />
We transformed these plasmids into the Top10 ''E. coli'' strain to create three strains: one containing only the ''ndmA-lacZ'' reporter plasmid, and co-transformants containing both the ''ndmA-lacZ'' plasmid and either ''orf1'' or ''orf4'' BioBrick plasmids. All three ''E. coli'' strains were grown in m9 minimal media + .2% casein (+ appropriate supplement) at 30<sup>o</sup>C for 48 hrs, after which time Miller Assays were performed. The results, summarized in the figure below, provide strong evidence that expression of ''orf4'' leads to inhibited ''ndmA'' promoter functionality, while ''orf1'' expression provides negligible influence on the ''ndmA'' promoter. <br />
<br />
[[File:Austin2012ndmARepression.jpg|center|650px]]<br />
<br />
A higher Miller Unit correlates to a higher level of ''lacZ'' production, effectively quantifying the degree of gene expression. As the Miller Unit of the strain co-expressed ''ndmA'' promoter with ''orf4'' is lower by a factor of roughly 4, it can be inferred that the protein encoded by ''orf4'' regulates the degree to which the ''ndmA'' promoter is expressed during transcription.<br />
<br />
It should be noted that while expression of ''ndmA'' drops significantly in this experiment, this does not imply that ''orf4'' only inhibits the expression of ''ndmA''. This is discussed in the next section.<br />
<br />
===Inducible Promoters===<br />
As shown above, it appears that ''orf4'' acts as a transcriptional regulator of ''ndmA'' expression. One would expect a transcriptional regulator to regulate transcription in a way that is beneficial to the overall fitness of the organism. In certain situations in which a protein is necessary for survival, the transcriptional factor should up-regulate the production of said gene. Likewise, when a protein is not necessary, the transcriptional factor should down-regulate its production.<br />
<br />
We hypothesize that this is the way in which ''orf4'' regulates transcription of ''ndmA''. In situations of high caffeine and related xanthine concentrations, the protein encoded by ''orf4'' up-regulates the expression of ''ndmA''. In the experiment listed [[Team:Austin_Texas/Caffeinated_coli#Transcriptional_Regulators|above]], in which no xanthine derivative was added to the media, expression from the ''ndmA'' promoter is inhibited (as shown).<br />
<br />
In order to test this hypothesis, we subjected a strain of Top10 ''E. coli'' cells containing the orf4 gene and the ''ndmA'' promoter containing the ''lacZ'' gene to varying supplements of caffeine, theobromine, theophylline, and xanthine. Xanthine was shown to be insoluble at high concentrations, and was therefore removed from the experiment. The results of exposure to varying concentration levels is shown below.<br />
<br />
[[File:UTAustin2012InductionbySubstrate.jpg|center|650px]]<br />
<br />
As predicted, the expression of ''ndmA'' appears to rise at higher caffeine concentrations. Similarly, higher concentrations of theobromine and theophylline also appear to increase the expression of ''ndmA''. <br />
<br />
From these experiments we conclude that the ''ndmA'' intergenic region contains a promoter that is negatively-regulated by the protein coded by ''orf4'' in the absence of methylxanthines. Upon exposure to methylxanthines, it appears that ''orf4''-mediated repression is relieved, leading to induction.<br />
<br />
===Results Summary===<br />
The main accomplishments we achieved this summer include the following:<br />
<br />
*Refactoring of decaffeination operon from ''P. putida'' into ''E. coli''<br />
*Construction of an auxotrophic selection method using our refactored operon, "addicting" ''E. coli'' to caffeine<br />
*Growth of auxtrophic cells on common caffeinated beverages<br />
*Discovery of a methyxanthine inducible promoter (''ndmA'') in the CBB5 operon<br />
*Characterization of an open reading frame (''orf4'') in the CBB5 operon that acts as a transcription regulator<br />
<br />
==References==<br />
<br />
Summers RM, Louie TM, Yu CL, Gakhar L, Louie KC, Subramanian M, "Novel, highly specific N-demethylases enable bacteria to live on caffeine and related purine alkaloids." Journal of Bacteriology, 2012, vol 194, no 8, pg 2041-2049.<br />
<br />
Rodriguez del Rey Z, Granek EF, Sylvester S, "Occurrence and concentration of caffeine in Oregon coastal waters." Marine Pollution Bulletin, 2012, vol 64, no 8, Pages 1417-1424.<br />
<br />
<html><br />
<div id="footer" /><br />
</html></div>Erik.quandthttp://2012.igem.org/Team:Austin_Texas/Caffeinated_coliTeam:Austin Texas/Caffeinated coli2012-10-24T16:46:44Z<p>Erik.quandt: /* Growth in Caffeinated Beverages */</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli" class="selected"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
<br />
<br />
= '''<center><div style="font-size:150%">Project: Caffeinated coli</div>''' =<br />
<br />
[[File:Caffeinated_Bacteria.jpg|375px|center]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Introduction'''</div> ==<br />
<br />
<html><br />
<a href="http://www.geog.ucsb.edu/events/department-news/1072/if-you-thought-fish-were-sleepless-in-seattle-check-out-the-ones-off-the-coast-of-oregon/"><img src="https://static.igem.org/mediawiki/2012/5/58/FishCoffee.png" alt="UT Austin CNS logo" width="240px"; height="240px"; style="float:right; padding:3px; clear:left;"/></a></html><br />
<br />
Caffeine is commonly used in foods and beverages such as coffee and chocolate and in pharmaceuticals as a cardiac and respiratory stimulant. As a result of the wide use of caffeine, it has become widely present in human waste and as a pollutant in the environment. Bacteria capable of degrading caffeine have been found naturally and could be used for bioremediation. We seek to port caffeine degradation functionality into ''Escherichia coli'' to produce strains that are better suited to degrade caffeine in an industrial setting. <br />
<br />
''Pseudomonas putida'' CBB5, discovered by Ryan Summers and Mani Subramanian at the University of Iowa, can live on caffeine as the sole carbon and nitrogen source. CBB5 uses a nitrogen demethylation pathway to convert caffeine to xanthine with formaldehyde side products. The xanthine and formaldehyde are then used as the nitrogen and carbon sources respectively.<br />
<br />
The N-demethylation pathway consists of four demethylation genes: ''ndmA'', ''ndmB'', ''ndmC'', and ''ndmD''. NdmA, NdmB, and NdmC remove the methyl groups from the N-1, N-3, and N-7 respectively. This is done with the help of a reductase, NdmD.<br />
<br />
[[File:Ndm diagram.JPG|center|650px]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Strategy'''</div> ==<br />
<br />
=== Refactoring Decaffeination Operon ===<br />
<br />
The first goal of this project involves refactoring the caffeine operon from the caffeine utilization pathway from ''Psuedomonas putida'' CBB5, first characterized by Summers et al. in early 2012. The operon, shown below, will be incorporated into the well characterized bacterium, ''Escherichia coli'' [3]. <br />
<br />
[[File:CBB5_Operon.png|center|650px]]<br />
<br />
Directly importing the operon into ''E. coli'' was determined to be impractical, as the strength and regulation of the ribosome binding sites (RBSs) and operon-controlled promoters in the CBB5 operon may not be optimized for function in ''E. coli''. Additionally, the use in CBB5 of GTG start codons conflicts with ''E. coli’s'' preference for ATG – leading to problems in translation initiation.<br />
<br />
We therefore decided to separate out open reading frames for the genes of interest in the CBB5 operon and put them under controlled regulation in a refactored caffeine utilization operon for import into ''E. coli''. The operon's design, shown below and submitted as [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 BBa_K734000], aims to optimize its functionality in its new host. <br />
<br />
[[File:Austin_Texas_Decaffeination_design.png|center]]<br />
<br />
This includes the genes that code for the N-demethylase proteins NdmA, NdmB, and NdmC, and the gene that codes for the putative assisting protein NdmD. Also included is the glutathione S-transferase gene from ''Janthinobacterium'' sp. strain Marseille, necessary for functionality of NdmC. Constitutive expression occurs with a strong, well-characterized promoter ([http://partsregistry.org/wiki/index.php/Part:BBa_J23100 BBa_J23100]) and a strong, well-characterized RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]). Finally, all GTG start codons have been replaced with ATG.<br />
<br />
Sources of parts used in our synthetic decaffeination circuit:<br />
<br />
[[File:Austin_Texas_Part_sources.png|center]]<br />
<br />
==== Assembly ====<br />
<br />
Our operon was assembled via a one-step, six-piece Gibson assembly. Briefly, genes to be stitched together were PCR amplified with overhangs homologous to adjacent genes (or homologous to the vector backbone in the case of the 5' end of the promoter and the 3' end of ''gst9''). The forward primers also contained our chosen RBS and ATG. In a one-pot reaction, a 5'-exonuclease chewed back on the homologous overhangs, allowing adjacent fragments to base pair, and a DNA ligase stitched them together. An overview is shown here.<br />
<br />
[[File:Austin_Texas_Decaffeination_assembly.png|center]]<br />
<br />
=== Operon Testing and Optimization ===<br />
<br />
We employed two different assays for operon functionality: growth on caffeine as a sole carbon source, and a genetic selection for caffeine demethylation to xanthine. To evaluate the ability to use caffeine as a sole carbon source we will transform TOP 10 ''E. coli'' electrocompetent cells with the refactored caffeine utilization operon, grow transformed cells in rich media to saturation and then dilute 1:100 into M9 mineral media. Varying levels of caffeine concentrations will be used to determine the degree of caffeine utilization, and the optimal limit for growth.<br />
<br />
Since the cell has an extremely large requirement for carbon, the energy derived from demethylation may not be enough to support growth. For this reason a second assay for caffeine demethylation based on guanine auxotrophy has been devised. ''E. coli'' synthesizes the nucleotide guanine de novo via a pathway that involves xanthosine-5’-phosphate (XMP) as an essential intermediate. The enzyme responsible for the formation of XMP (from inosine-5’-phosphate, IMP) is IMP dehydrogenase, which is encoded by the ''guaB'' gene. If ''guaB'' is knocked out, the cell is unable to synthesize guanine and is therefore unable to grow on media lacking guanine. We plan to take advantage of this engineered auxotrophy and use it as a way to select for cells that are able to demethylate caffeine to xanthine which can then be converted to XMP by xanthine-guanine phosphoribotransferase (gpt) and thereby relieve the metabolic block and restore guanine synthesis allowing for cell growth.<br />
<br />
[[File:guaB_selection_1.jpg|center|650px]]<br />
<br />
Finally, after construction and preliminary testing of the caffeine degradation operon in''E. coli'', we will attempt to grow our cells in the presence of various commercial caffeinated beverages.<br />
<br />
=== Characterizing Inducible Promoters ===<br />
<br />
In Summers et al (2012)., the two open reading frames ''orf1'' and ''orf4'' are thought to be putative regulators of the caffeine degradation operon's N-demethylase proteins due to sequence homology to other known protein regulators (AraC and gntR family). They are hypothesized to bind to operator sequences in the intergenic regions between genes in the operon, which may serve as promoters for the various demethylases of the operon. <br />
<br />
Analysis of the sizes of the intergenic regions of the CBB5 caffeine utilization operon shows that the regions upstream of the ''ndm'' genes are all greater than 150bp. The large size of these intergenic regions and the fact that they precede the catabolic enzyme gene leads us to hypothesize that there are caffeine (or other methylxanthine) regulatory elements in these sequences.<br />
<br />
We will clone these open reading frames into the reporter plasmid pRA301. pRA301 contains a promoterless ''lacZ'' gene, preceded by a multiple cloning site (MCS). DNA fragments hypothesized to contain promoter elements can be cloned into the MCS and assayed for ''lacZ'' expression by [http://openwetware.org/wiki/Beta-Galactosidase_Assay_%28A_better_Miller%29 Miller Assay]. Using this method, we can determine the regulatory functionality of each open reading frame by examining varying fluorescence levels.<br />
<br />
=== CBB5 Genome sequencing ===<br />
<br />
Since only a partial sequence (13.1kb) of the ''P. putida'' CBB5 decaffeination operon is available (Summers 2012), we are submitting genomic DNA for whole genome sequencing. The genome will be sequenced using Illumina next-gen sequencing by UT [[https://wikis.utexas.edu/display/GSAF/Home+Page GSAF]]. The assembled genome will be deposited to Genbank.<br />
<br />
==<div style="font-size:130%;text-align:center">'''Results</div>==<br />
<br />
===Decaffeination operon (+ gst9) enables growth of GuaB knockout===<br />
<br />
Our initial refactored operon consisted of CBB5 genes ''ndmABCD''. We found that this operon was able to support growth of the ''guaB'' knockout on theophylline but not caffeine. This indicated that the demethylase responsible for removing the 7-methyl group (NdmC) was not functional. Of note, Summers et. al (2012) also could not detect NdmC activity when expressed in ''E. coli''. We reasoned that there could be a missing protein required for NdmC activity. Summers et al. (2012) showed that an uncharacterized protein (coded by ''orf8'') co-purified in CBB5 protein fractions assayed for NdmC activity. We reasoned that this protein could be essential for NdmC function. Unfortunately, the complete DNA sequence of ''orf8'' was not available; only a partial sequence of the ORF was contained in the known operon sequence. <br />
<br />
<br />
[[File:Orf8_partial.png|center|650px]]<br />
<br />
<br />
A protein homology search was performed using the available sequence to find potential homologs that might be able to substitute function of the missing ORF. The search revealed that an uncharacterized gene, ''gst9'', from ''Janthinobacterium'' sp. strain marseille shared a high degree of sequence homology (70%). We decided to synthesize the ''gst9'' gene from the available sequence and clone it into our decaffeination operon to see if it would enable NdmC activity and allow for complete demethylation of caffeine. We found our hyphothesis to be true: adding ''gst9'' to our refactored operon [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 (Bba_K734000)] did indeed enable growth of the ''guaB'' knockout on m9 mineral media:<br />
<br />
<br />
[[File:UtAustin2012DecaffeinationOperon.jpg|center|650px]]<br />
<br />
From this figure, we see that our decaffeination operon enables the GuaB knockout to grow in the absence of guanine or xanthine supplementation by instead demethylating the available caffeine to produce xanthine. This not only confirms the functionality of our refactored decaffeination operon, but proves a method by which we can use it to auxotrophically select for cells.<br />
<br />
To more accurately determine the utilization of caffeine by our operon, we tested the growth of our ''E. coli'' cells containing refactored operon and the knocked out ''guaB'' gene under multiple caffeine concentration conditions. We found that our cells were able to grow at conditions as low as 10uM of caffeine, and peaked at a caffeine concentration of approximately 250uM. Cells were grown in concentrations as high as 5000uM, at which point cells began to die (presumably from caffeine toxicity). <br />
<br />
[[File:AustiniGEM2012GrowthCurve.jpg|center|650px]]<br />
<br />
From these growth conditions, we plated dilutions of up to 10<sup>7</sup> the concentration of original solution. This was used to determine individual cell growth based on caffeine. We discovered that approximately 7.6 +/- 0.8 pg of caffeine were utilized per cell. The graph above also shows a method by which we can convert directly from optical densities (an easily measured solution condition) to the caffeine concentration of the growth media. This is viable for cultures that contain cells with our refactored operon, and caffeine concentrations between 0 and approximately 250 uM.<br />
<br />
=== Engineered ''E. coli'' stoichiometrically convert caffeine to guanine for cell replication ===<br />
<br />
As caffeine appears to limit cell growth under these conditions, we were curious about how much of the provided caffeine was being utilized to create DNA and RNA for cellular replication. The genome of ''E. coli'' is roughly 4.6 Mb. Since this is double-stranded DNA and approximately 50% consists of G-C base pairs, there are about 2.3x10<sup>6</sup> guanines needed per cell to replicate its DNA. The dry weight of a typical ''E. coli'' cell is approximately 280 femtograms and 20% of this is RNA ([http://bionumbers.hms.harvard.edu Bionumbers]). Given the molecular weight of a typical RNA nucleotide is roughly 330 g/mol, and that 1/4 of these bases are guanine, this means that there are about 2.55x10<sup>10</sup> guanines needed per cell to replicate its RNA. So, overall the number of guanine molecules in RNA is roughly 10,000x the amount in DNA.<br />
<br />
We found that 7.6 +/- 0.8 pg of caffeine was utilized per cell. Given the molecular weight of 194.19 g/mol, this translates into 2.4x10<sup>10</sup> molecules of caffeine per cell. This is in amazing agreement with the number of molecules of guanine that we have calculated that is required to replicate a cell!<br />
<br />
<div style="font-size:130%;text-align:center"><br />
{| class="wikitable" style="text-align:center"<br />
|-<br />
! !!Molecules per cell<br />
|-<br />
| Caffeine molecules consumed (Calculated) || 2.40x10<sup>10</sup><br />
|-<br />
| Guanine molecules required (Theoretical) || 2.55x10<sup>10</sup><br />
|-<br />
|}<br />
</div><br />
<br />
===Growth in Caffeinated Beverages ===<br />
In order to make our results more palpable, we experimented with growth of our ''E. coli'' strain in various caffeinated beverages. Experiments were first performed on cells with only the ''guaB'' knockout modification, in order to prove that growth in these beverages was even possible. Initial results, shown below, indicate that growth is in fact possible for a wide variety of beverages, including Coca-Cola, 5-Hour Energy, Lipton Tea, and Starbucks Espresso.<br />
<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthInitial.png|center|650px]]<br />
<br />
The graph above shows that the auxotrophic selection of cells using xanthine derivatives again functions as expected – without xanthine, cells were unable to grow under most conditions. The noticeable optical densities for 50% Coca-Cola and 50% Espresso are due to the strong background color of the culture and not actual cell growth. 50% 5-Hour Energy and Espresso were both shown to be toxic to our cells. Finally, tea was shown to contain enough natural xanthines to allow for partial cell growth, and was excluded from further experiments.<br />
<br />
We then attempted to grow our cell strain containing both the ''guaB'' knockout gene and the refactored decaffeination operon. The results of this experiment are shown below.<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthFinal.jpg|center|720px]]<br />
It is important to note that these cells were grown in m9 minimal media containing only 0.2% casein as a natural carbon source. The cells were required to scavenge virtually all of their carbon required for guanine synthesis from the caffeine supplied to the system, or die. Our ''E. coli'' was able to utilize the caffeine inherent to Coca-Cola, Starbucks Espresso and 5-Hour Energy, as well as caffeine in caffeine. However, without our refactored decaffeination operon, the cells were unable to grow under any conditions. The two small bars that appear above in 50% Coca-Cola and 10% Espresso are simply due to the high background color of the cultures. It is also worth note that the 10% 5-Hour Energy growth conditions proved marginally toxic to our ''E. coli'', as the cells were unable to reach maximum optical densities.<br />
<br />
Utilizing the previous experiment in which we calculated the growth of our cells per caffeine molecule, we are able to estimate the total concentration of caffeine in each of the original caffeinated beverages. This is done by fitting the created equation that converts OD into predicted caffeine concentration. From caffeine concentration and the known dilution of caffeinated beverage added to each of the cultures, we can estimate the caffeine weight per beverage volume.<br />
<br />
These results are summarized below, and are very close to the values determined by the beverage manufacturers themselves. This serves as further reinforcement that our decaffeination operon works as intended, and even suggests a possible use in measuring the caffeine value of beverages. <br />
<br />
<div style="font-size:130%;text-align:center"><br />
{| class="wikitable" style="text-align:center"<br />
|-<br />
! !! Caffeine Content we Calculated (mg/L) !! Caffeine Content Manufacturer Calculated (mg/L)<br />
|-<br />
| Coca-Cola || 99.1 || 98.6<br />
|-<br />
| Starbucks Espresso|| 44.7 || 39.5<br />
|-<br />
| 5-Hour Energy || 4259.8 &dagger; || 2333.2<br />
|}<br />
</div><br />
&dagger; Note that the cells in 5-Hour Energy appeared to be in exponential growth phase, weakening the strength of the equation's fit to reality.<br />
<br />
Finally, we took pictures of our cells grown in caffeinated beverages cultures, as shown below. Cells in the left tubes do not contain the decaffeination operon, while cells in the right tubes do contain the decaffeination operon. Both contain the ''guaB'' gene knocked out, and require xanthine or xanthine derived from caffeine in order to survive. As shown below, Coca-Cola, Diet Coke and Coffee, all of which contain caffeine, feature strong growth of the ''guaB'' knockouts with the decaffeination operon. However, Caffeine Free Diet Coke shows no growth even with the operon, as there is no caffeine to be used as a xanthine source.<br />
<br />
[[File:UTAustin2012iGEMCaffeinatedBeverages.jpg|border|center|950px]]<br />
<br />
<br />
[[File:Energy_growth_compiled.jpg|border|center|550px]]<br />
<br />
===Transcriptional Regulators===<br />
As described earlier, we hypothesize that the large intergenic regions upstream of various genes in the CBB5 decaffeination operon, particularly upstream of ''ndmA'', may contain methylxanthine regulated promoters. We propose that ''orf1'' and ''orf4'', which were annotated as putative regulators based on sequence homology, act as repressors for the promoters contained in the operon. <br />
<br />
To test these hypotheses, we cloned the intergenic region upstream of the ''ndmA'' gene into a promoterless ''lacZ'' reporter plasmid, pRA301. This vector enabled quantitative measurement of promoter strength using the β-galactosidase [https://2010.igem.org/Team:BCCS-Bristol/Wetlab/BetaGalactosidaseAssays Miller assay]. Additionally, we created compatible biobrick plasmids of each putative repressor, ''orf1'' and ''orf4'', in order to assay their effect on ''ndmA'' promoter strength in the presence or absence of methylxanthine supplementation.<br />
<br />
We transformed these plasmids into the Top10 ''E. coli'' strain to create three strains: one containing only the ''ndmA-lacZ'' reporter plasmid, and co-transformants containing both the ''ndmA-lacZ'' plasmid and either ''orf1'' or ''orf4'' BioBrick plasmids. All three ''E. coli'' strains were grown in m9 minimal media + .2% casein (+ appropriate supplement) at 30<sup>o</sup>C for 48 hrs, after which time Miller Assays were performed. The results, summarized in the figure below, provide strong evidence that expression of ''orf4'' leads to inhibited ''ndmA'' promoter functionality, while ''orf1'' expression provides negligible influence on the ''ndmA'' promoter. <br />
<br />
[[File:Austin2012ndmARepression.jpg|center|650px]]<br />
<br />
A higher Miller Unit correlates to a higher level of ''lacZ'' production, effectively quantifying the degree of gene expression. As the Miller Unit of the strain co-expressed ''ndmA'' promoter with ''orf4'' is lower by a factor of roughly 4, it can be inferred that the protein encoded by ''orf4'' regulates the degree to which the ''ndmA'' promoter is expressed during transcription.<br />
<br />
It should be noted that while expression of ''ndmA'' drops significantly in this experiment, this does not imply that ''orf4'' only inhibits the expression of ''ndmA''. This is discussed in the next section.<br />
<br />
===Inducible Promoters===<br />
As shown above, it appears that ''orf4'' acts as a transcriptional regulator of ''ndmA'' expression. One would expect a transcriptional regulator to regulate transcription in a way that is beneficial to the overall fitness of the organism. In certain situations in which a protein is necessary for survival, the transcriptional factor should up-regulate the production of said gene. Likewise, when a protein is not necessary, the transcriptional factor should down-regulate its production.<br />
<br />
We hypothesize that this is the way in which ''orf4'' regulates transcription of ''ndmA''. In situations of high caffeine and related xanthine concentrations, the protein encoded by ''orf4'' up-regulates the expression of ''ndmA''. In the experiment listed [[Team:Austin_Texas/Caffeinated_coli#Transcriptional_Regulators|above]], in which no xanthine derivative was added to the media, expression from the ''ndmA'' promoter is inhibited (as shown).<br />
<br />
In order to test this hypothesis, we subjected a strain of Top10 ''E. coli'' cells containing the orf4 gene and the ''ndmA'' promoter containing the ''lacZ'' gene to varying supplements of caffeine, theobromine, theophylline, and xanthine. Xanthine was shown to be insoluble at high concentrations, and was therefore removed from the experiment. The results of exposure to varying concentration levels is shown below.<br />
<br />
[[File:UTAustin2012InductionbySubstrate.jpg|center|650px]]<br />
<br />
As predicted, the expression of ''ndmA'' appears to rise at higher caffeine concentrations. Similarly, higher concentrations of theobromine and theophylline also appear to increase the expression of ''ndmA''. <br />
<br />
From these experiments we conclude that the ''ndmA'' intergenic region contains a promoter that is negatively-regulated by the protein coded by ''orf4'' in the absence of methylxanthines. Upon exposure to methylxanthines, it appears that ''orf4''-mediated repression is relieved, leading to induction.<br />
<br />
===Results Summary===<br />
The main accomplishments we achieved this summer include the following:<br />
<br />
*Refactoring of decaffeination operon from ''P. putida'' into ''E. coli''<br />
*Construction of an auxotrophic selection method using our refactored operon, "addicting" ''E. coli'' to caffeine<br />
*Growth of auxtrophic cells on common caffeinated beverages<br />
*Discovery of a methyxanthine inducible promoter (''ndmA'') in the CBB5 operon<br />
*Characterization of an open reading frame (''orf4'') in the CBB5 operon that acts as a transcription regulator<br />
<br />
==References==<br />
<br />
Summers RM, Louie TM, Yu CL, Gakhar L, Louie KC, Subramanian M, "Novel, highly specific N-demethylases enable bacteria to live on caffeine and related purine alkaloids." Journal of Bacteriology, 2012, vol 194, no 8, pg 2041-2049.<br />
<br />
Rodriguez del Rey Z, Granek EF, Sylvester S, "Occurrence and concentration of caffeine in Oregon coastal waters." Marine Pollution Bulletin, 2012, vol 64, no 8, Pages 1417-1424.<br />
<br />
<html><br />
<div id="footer" /><br />
</html></div>Erik.quandthttp://2012.igem.org/File:Energy_growth_compiled.jpgFile:Energy growth compiled.jpg2012-10-24T16:45:12Z<p>Erik.quandt: </p>
<hr />
<div></div>Erik.quandthttp://2012.igem.org/File:UTAustin2012iGEMCaffeinatedBeverages.jpgFile:UTAustin2012iGEMCaffeinatedBeverages.jpg2012-10-24T16:41:42Z<p>Erik.quandt: uploaded a new version of &quot;File:UTAustin2012iGEMCaffeinatedBeverages.jpg&quot;</p>
<hr />
<div>Various Caffeinated Beverages, in which cells are grown. Cells on the left tubes contain decaffeination operon, and require the caffeine they scavenge from the beverages in order to survive. Cells on the right tubes are unable to survive. From UT Austin 2012 iGEM team.</div>Erik.quandthttp://2012.igem.org/File:UtAustin2012DecaffeinationOperon.jpgFile:UtAustin2012DecaffeinationOperon.jpg2012-10-23T19:57:08Z<p>Erik.quandt: uploaded a new version of &quot;File:UtAustin2012DecaffeinationOperon.jpg&quot;</p>
<hr />
<div>UT Austin 2012 iGEM team work showing E. coli requiring our refactored decaffienation operon in order to grow.</div>Erik.quandthttp://2012.igem.org/File:UtAustin2012DecaffeinationOperon.jpgFile:UtAustin2012DecaffeinationOperon.jpg2012-10-23T19:56:29Z<p>Erik.quandt: uploaded a new version of &quot;File:UtAustin2012DecaffeinationOperon.jpg&quot;</p>
<hr />
<div>UT Austin 2012 iGEM team work showing E. coli requiring our refactored decaffienation operon in order to grow.</div>Erik.quandthttp://2012.igem.org/File:UtAustin2012DecaffeinationOperon.jpgFile:UtAustin2012DecaffeinationOperon.jpg2012-10-23T19:53:30Z<p>Erik.quandt: uploaded a new version of &quot;File:UtAustin2012DecaffeinationOperon.jpg&quot;</p>
<hr />
<div>UT Austin 2012 iGEM team work showing E. coli requiring our refactored decaffienation operon in order to grow.</div>Erik.quandthttp://2012.igem.org/File:Caffeine_growth_curves.pngFile:Caffeine growth curves.png2012-10-23T19:50:19Z<p>Erik.quandt: </p>
<hr />
<div></div>Erik.quandthttp://2012.igem.org/Team:Austin_Texas/Caffeinated_coliTeam:Austin Texas/Caffeinated coli2012-10-04T03:07:39Z<p>Erik.quandt: /* Transcriptional Regulators */</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli" class="selected"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
<br />
<br />
= '''<center><div style="font-size:150%">Project: Caffeinated coli</div>''' =<br />
<br />
[[File:Caffeinated_Bacteria.jpg|375px|center]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Introduction'''</div> ==<br />
<br />
<html><br />
<a href="http://www.geog.ucsb.edu/events/department-news/1072/if-you-thought-fish-were-sleepless-in-seattle-check-out-the-ones-off-the-coast-of-oregon/"><img src="https://static.igem.org/mediawiki/2012/5/58/FishCoffee.png" alt="UT Austin CNS logo" width="240px"; height="240px"; style="float:right; padding:3px; clear:left;"/></a></html><br />
<br />
Caffeine is commonly used in foods and beverages such as coffee and chocolate and in pharmaceuticals as a cardiac and respiratory stimulant. As a result of the wide use of caffeine, it has become widely present in human waste and as a pollutant in the environment. Bacteria capable of degrading caffeine have been found naturally and could be used for bioremediation. We seek to port caffeine degradation functionality into ''Escherichia coli'' to produce strains that are better suited to degrade caffeine in an industrial setting. <br />
<br />
''Pseudomonas putida'' CBB5, discovered by Ryan Summers and Mani Subramanian at the University of Iowa, can live on caffeine as the sole carbon and nitrogen source. CBB5 uses a nitrogen demethylation pathway to convert caffeine to xanthine with formaldehyde side products. The xanthine and formaldehyde are then used as the nitrogen and carbon sources respectively.<br />
<br />
The N-demethylation pathway consists of four demethylation genes: ''ndmA'', ''ndmB'', ''ndmC'', and ''ndmD''. NdmA, NdmB, and NdmC remove the methyl groups from the N-1, N-3, and N-7 respectively. This is done with the help of a reductase, NdmD.<br />
<br />
[[File:Ndm diagram.JPG|center|650px]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Strategy'''</div> ==<br />
<br />
=== Refactoring Decaffeination Operon ===<br />
<br />
The first goal of this project involves refactoring the caffeine operon from the caffeine utilization pathway from ''Psuedomonas putida'' CBB5, first characterized by Summers et al. in early 2012. The operon, shown below, will be incorporated into the well characterized bacterium, ''Escherichia coli'' [3]. <br />
<br />
[[File:CBB5_Operon.png|center|650px]]<br />
<br />
Directly importing the operon into ''E. coli'' was determined to be impractical, as the strength and regulation of the ribosome binding sites (RBSs) and operon-controlled promoters in the CBB5 operon may not be optimized for function in ''E. coli''. Additionally, the use in CBB5 of GTG start codons conflicts with ''E. coli’s'' preference for ATG – leading to problems in translation initiation.<br />
<br />
We therefore decided to separate out open reading frames for the genes of interest in the CBB5 operon and put them under controlled regulation in a refactored caffeine utilization operon for import into ''E. coli''. The operon's design, shown below and submitted as [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 BBa_K734000], aims to optimize its functionality in its new host. <br />
<br />
[[File:Austin_Texas_Decaffeination_design.png|center]]<br />
<br />
This includes the genes that code for the N-demethylase proteins NdmA, NdmB, and NdmC, and the gene that codes for the putative assisting protein NdmD. Also included is the glutathione S-transferase gene from ''Janthinobacterium'' sp. strain Marseille, necessary for functionality of NdmC. Constitutive expression occurs with a strong, well-characterized promoter ([http://partsregistry.org/wiki/index.php/Part:BBa_J23100 BBa_J23100]) and a strong, well-characterized RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]). Finally, all GTG start codons have been replaced with ATG.<br />
<br />
Sources of parts used in our synthetic decaffeination circuit:<br />
<br />
[[File:Austin_Texas_Part_sources.png|center]]<br />
<br />
==== Assembly ====<br />
<br />
Our operon was assembled via a one-step, six-piece Gibson assembly. Briefly, genes to be stitched together were PCR amplified with overhangs homologous to adjacent genes (or homologous to the vector backbone in the case of the 5' end of the promoter and the 3' end of ''gst9''). The forward primers also contained our chosen RBS and ATG. In a one-pot reaction, a 5'-exonuclease chewed back on the homologous overhangs, allowing adjacent fragments to base pair, and a DNA ligase stitched them together. An overview is shown here.<br />
<br />
[[File:Austin_Texas_Decaffeination_assembly.png|center]]<br />
<br />
=== Operon Testing and Optimization ===<br />
<br />
We employed two different assays for operon functionality: growth on caffeine as a sole carbon source, and a genetic selection for caffeine demethylation to xanthine. To evaluate the ability to use caffeine as a sole carbon source we will transform TOP 10 ''E. coli'' electrocompetent cells with the refactored caffeine utilization operon, grow transformed cells in rich media to saturation and then dilute 1:100 into M9 mineral media. Varying levels of caffeine concentrations will be used to determine the degree of caffeine utilization, and the optimal limit for growth.<br />
<br />
Since the cell has an extremely large requirement for carbon, the energy derived from demethylation may not be enough to support growth. For this reason a second assay for caffeine demethylation based on guanine auxotrophy has been devised. ''E. coli'' synthesizes the nucleotide guanine de novo via a pathway that involves xanthosine-5’-phosphate (XMP) as an essential intermediate. The enzyme responsible for the formation of XMP (from inosine-5’-phosphate, IMP) is IMP dehydrogenase, which is encoded by the ''guaB'' gene. If ''guaB'' is knocked out, the cell is unable to synthesize guanine and is therefore unable to grow on media lacking guanine. We plan to take advantage of this engineered auxotrophy and use it as a way to select for cells that are able to demethylate caffeine to xanthine which can then be converted to XMP by xanthine-guanine phosphoribotransferase (gpt) and thereby relieve the metabolic block and restore guanine synthesis allowing for cell growth.<br />
<br />
[[File:guaB_selection_1.jpg|center|650px]]<br />
<br />
Finally, after construction and preliminary testing of the caffeine degradation operon in''E. coli'', we will attempt to grow our cells in the presence of various commercial caffeinated beverages.<br />
<br />
=== Characterizing Inducible Promoters ===<br />
<br />
In Summers et al (2012)., the two open reading frames ''orf1'' and ''orf4'' are thought to be putative regulators of the caffeine degradation operon's N-demethylase proteins due to sequence homology to other known protein regulators (AraC and gntR family). They are hypothesized to bind to operator sequences in the intergenic regions between genes in the operon, which may serve as promoters for the various demethylases of the operon. <br />
<br />
Analysis of the sizes of the intergenic regions of the CBB5 caffeine utilization operon shows that the regions upstream of the ''ndm'' genes are all greater than 150bp. The large size of these intergenic regions and the fact that they precede the catabolic enzyme gene leads us to hypothesize that there are caffeine (or other methylxanthine) regulatory elements in these sequences.<br />
<br />
We will clone these open reading frames into the reporter plasmid pRA301. pRA301 contains a promoterless ''lacZ'' gene, preceded by a multiple cloning site (MCS). DNA fragments hypothesized to contain promoter elements can be cloned into the MCS and assayed for ''lacZ'' expression by [http://openwetware.org/wiki/Beta-Galactosidase_Assay_%28A_better_Miller%29 Miller Assay]. Using this method, we can determine the regulatory functionality of each open reading frame by examining varying fluorescence levels.<br />
<br />
=== CBB5 Genome sequencing ===<br />
<br />
Since only a partial sequence (13.1kb) of the ''P. putida'' CBB5 decaffeination operon is available (Summers 2012), we are submitting genomic DNA for whole genome sequencing. The genome will be sequenced using Illumina next-gen sequencing by UT [[https://wikis.utexas.edu/display/GSAF/Home+Page GSAF]]. The assembled genome will be deposited to Genbank.<br />
<br />
==<div style="font-size:130%;text-align:center">'''Results</div>==<br />
<br />
===Decaffeination operon (+ gst9) enables growth of GuaB knockout===<br />
<br />
Our initial refactored operon consisted of CBB5 genes ''ndmABCD''. We found that this operon was able to support growth of the ''guaB'' knockout on theophylline but not caffeine. This indicated that the demethylase responsible for removing the 7-methyl group (NdmC) was not functional. Of note, Summers et. al (2012) also could not detect NdmC activity when expressed in ''E. coli''. We reasoned that there could be a missing protein required for NdmC activity. Summers et al. (2012) showed that an uncharacterized protein (coded by ''orf8'') co-purified in CBB5 protein fractions assayed for NdmC activity. We reasoned that this protein could be essential for NdmC function. Unfortunately, the complete DNA sequence of ''orf8'' was not available; only a partial sequence of the ORF was contained in the known operon sequence. <br />
<br />
<br />
[[File:Orf8_partial.png|center|650px]]<br />
<br />
<br />
A protein homology search was performed using the available sequence to find potential homologs that might be able to substitute function of the missing ORF. The search revealed that an uncharacterized gene, ''gst9'', from ''Janthinobacterium'' sp. strain marseille shared a high degree of sequence homology (70%). We decided to synthesize the ''gst9'' gene from the available sequence and clone it into our decaffeination operon to see if it would enable NdmC activity and allow for complete demethylation of caffeine. We found our hyphothesis to be true: adding ''gst9'' to our refactored operon [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 (Bba_K734000)] did indeed enable growth of the ''guaB'' knockout on m9 mineral media:<br />
<br />
<br />
[[File:UtAustin2012DecaffeinationOperon.jpg|center|650px]]<br />
<br />
From this figure, we see that our decaffeination operon enables the GuaB knockout to grow in the absence of guanine or xanthine supplementation by instead demethylating the available caffeine to produce xanthine. This not only confirms the functionality of our refactored decaffeination operon, but proves a method by which we can use it to auxotrophically select for cells.<br />
<br />
To more accurately determine the utilization of caffeine by our operon, we tested the growth of our ''E. coli'' cells containing refactored operon and the knocked out ''guaB'' gene under multiple caffeine concentration conditions. We found that our cells were able to grow at conditions as low as 10uM of caffeine, and peaked at a caffeine concentration of approximately 250uM. Cells were grown in concentrations as high as 5000uM, at which point cells began to die (presumably from caffeine toxicity). <br />
<br />
[[File:AustiniGEM2012GrowthCurve.jpg|center|650px]]<br />
<br />
From these growth conditions, we plated dilutions of up to 10<sup>7</sup> the concentration of original solution. This was used to determine individual cell growth based on caffeine. We discovered that approximately 7.6 +/- 0.8 pg of caffeine were utilized per cell. The graph above also shows a method by which we can convert directly from optical densities (an easily measured solution condition) to the caffeine concentration of the growth media. This is viable for cultures that contain cells with our refactored operon, and caffeine concentrations between 0 and approximately 250 uM.<br />
<br />
=== Engineered ''E. coli'' stoichiometrically convert caffeine to guanine for cell replication ===<br />
<br />
As caffeine appears to limit cell growth under these conditions, we were curious about how much of the provided caffeine was being utilized to create DNA and RNA for cellular replication. The genome of ''E. coli'' is roughly 4.6 Mb. Since this is double-stranded DNA and approximately 50% consists of G-C base pairs, there are about 2.3x10<sup>6</sup> guanines needed per cell to replicate its DNA. The dry weight of a typical ''E. coli'' cell is approximately 280 femtograms and 20% of this is RNA ([http://bionumbers.hms.harvard.edu Bionumbers]). Given the molecular weight of a typical RNA nucleotide is roughly 330 g/mol, and that 1/4 of these bases are guanine, this means that there are about 2.55x10<sup>10</sup> guanines needed per cell to replicate its RNA. So, overall the number of guanine molecules in RNA is roughly 10,000x the amount in DNA.<br />
<br />
We found that 7.6 +/- 0.8 pg of caffeine was utilized per cell. Given the molecular weight of 194.19 g/mol, this translates into 2.4x10<sup>10</sup> molecules of caffeine per cell. This is in amazing agreement with the number of molecules of guanine that we have calculated that is required to replicate a cell!<br />
<br />
<div style="font-size:130%;text-align:center"><br />
{| class="wikitable" style="text-align:center"<br />
|-<br />
! !!Molecules per cell<br />
|-<br />
| Caffeine molecules consumed (Calculated) || 2.40x10<sup>10</sup><br />
|-<br />
| Guanine molecules required (Theoretical) || 2.55x10<sup>10</sup><br />
|-<br />
|}<br />
</div><br />
<br />
===Growth in Caffeinated Beverages ===<br />
In order to make our results more palpable, we experimented with growth of our ''E. coli'' strain in various caffeinated beverages. Experiments were first performed on cells with only the ''guaB'' knockout modification, in order to prove that growth in these beverages was even possible. Initial results, shown below, indicate that growth is in fact possible for a wide variety of beverages, including Coca-Cola, 5-Hour Energy, Lipton Tea, and Starbucks Espresso.<br />
<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthInitial.png|center|650px]]<br />
<br />
The graph above shows that the auxotrophic selection of cells using xanthine derivatives again functions as expected – without xanthine, cells were unable to grow under most conditions. The noticeable optical densities for 50% Coca-Cola and 50% Espresso are due to the strong background color of the culture and not actual cell growth. 50% 5-Hour Energy and Espresso were both shown to be toxic to our cells. Finally, tea was shown to contain enough natural xanthines to allow for partial cell growth, and was excluded from further experiments.<br />
<br />
We then attempted to grow our cell strain containing both the ''guaB'' knockout gene and the refactored decaffeination operon. The results of this experiment are shown below.<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthFinal.jpg|center|720px]]<br />
It is important to note that these cells were grown in m9 minimal media containing only 0.2% casein as a natural carbon source. The cells were required to scavenge virtually all of their carbon required for guanine synthesis from the caffeine supplied to the system, or die. Our ''E. coli'' was able to utilize the caffeine inherent to Coca-Cola, Starbucks Espresso and 5-Hour Energy, as well as caffeine in caffeine. However, without our refactored decaffeination operon, the cells were unable to grow under any conditions. The two small bars that appear above in 50% Coca-Cola and 10% Espresso are simply due to the high background color of the cultures. It is also worth note that the 10% 5-Hour Energy growth conditions proved marginally toxic to our ''E. coli'', as the cells were unable to reach maximum optical densities.<br />
<br />
Utilizing the previous experiment in which we calculated the growth of our cells per caffeine molecule, we are able to estimate the total concentration of caffeine in each of the original caffeinated beverages. This is done by fitting the created equation that converts OD into predicted caffeine concentration. From caffeine concentration and the known dilution of caffeinated beverage added to each of the cultures, we can estimate the caffeine weight per beverage volume.<br />
<br />
These results are summarized below, and are very close to the values determined by the beverage manufacturers themselves. This serves as further reinforcement that our decaffeination operon works as intended, and even suggests a possible use in measuring the caffeine value of beverages. Note that the cells in 5-Hour Energy appeared to be in exponential growth phase, weakening the strength of the equation's fit to reality.<br />
<br />
<div style="font-size:130%;text-align:center"><br />
{| class="wikitable" style="text-align:center"<br />
|-<br />
! !! Caffeine Content we Calculated (g/L) !! Caffeine Content Manufacturer Calculated (g/L)<br />
|-<br />
| Coca-Cola || 99.1 || 98.6<br />
|-<br />
| Starbucks Espresso|| 44.7 || 39.5<br />
|-<br />
| 5-Hour Energy || 4259.8 || 2333.2<br />
|}<br />
</div><br />
<br />
Finally, we took pictures of our cells grown in caffeinated beverages cultures, as shown below. Cells in the left tubes do not contain the decaffeination operon, while cells in the right tubes do contain the decaffeination operon. Both contain the ''guaB'' gene knocked out, and require xanthine or xanthine derived from caffeine in order to survive. As shown below, Coca-Cola, Diet Coke and Coffee, all of which contain caffeine, feature strong growth of the ''guaB'' knockouts with the decaffeination operon. However, Caffeine Free Diet Coke shows no growth even with the operon, as there is no caffeine to be used as a xanthine source.<br />
<br />
[[File:UTAustin2012iGEMCaffeinatedBeverages.jpg|border|center|950px]]<br />
<br />
===Transcriptional Regulators===<br />
As described earlier, we hypothesize that the large intergenic regions upstream of various genes in the CBB5 decaffeination operon, particularly upstream of ''ndmA'', may contain methylxanthine regulated promoters. We propose that ''orf1'' and ''orf4'', which were annotated as putative regulators based on sequence homology, act as repressors for the promoters contained in the operon. <br />
<br />
To test these hypotheses, we cloned the intergenic region upstream of the ''ndmA'' gene into a promoterless ''lacZ'' reporter plasmid, pRA301. This vector enabled quantitative measurement of promoter strength using the β-galactosidase [https://2010.igem.org/Team:BCCS-Bristol/Wetlab/BetaGalactosidaseAssays Miller assay]. Additionally, we created compatible biobrick plasmids of each putative repressor, ''orf1'' and ''orf4'', in order to assay their effect on ''ndmA'' promoter strength in the presence or absence of methylxanthine supplementation.<br />
<br />
We transformed these plasmids into the Top10 ''E. coli'' strain to create three strains: one containing only the ''ndmA-lacZ'' reporter plasmid, and co-transformants containing both the ''ndmA-lacZ'' plasmid and either ''orf1'' or ''orf4'' BioBrick plasmids. All three ''E. coli'' strains were grown in m9 minimal media + .2% casein (+ appropriate supplement) at 30<sup>o</sup>C for 48 hrs, after which time Miller Assays were performed. The results, summarized in the figure below, provide strong evidence that expression of ''orf4'' leads to inhibited ''ndmA'' promoter functionality, while ''orf1'' expression provides negligible influence on the ''ndmA'' promoter. <br />
<br />
[[File:Austin2012ndmARepression.jpg|center|650px]]<br />
<br />
A higher Miller Unit correlates to a higher level of ''lacZ'' production, effectively quantifying the degree of gene expression. As the Miller Unit of the strain co-expressed ''ndmA'' promoter with ''orf4'' is lower by a factor of roughly 4, it can be inferred that the protein encoded by ''orf4'' regulates the degree to which the ''ndmA'' promoter is expressed during transcription.<br />
<br />
It should be noted that while expression of ''ndmA'' drops significantly in this experiment, this does not imply that ''orf4'' only inhibits the expression of ''ndmA''. This is discussed in the next section.<br />
<br />
===Inducible Promoters===<br />
As shown above, it appears that ''orf4'' acts as a transcriptional regulator of ''ndmA'' expression. One would expect a transcriptional regulator to regulate transcription in a way that is beneficial to the overall fitness of the organism. In certain situations in which a protein is necessary for survival, the transcriptional factor should up-regulate the production of said gene. Likewise, when a protein is not necessary, the transcriptional factor should down-regulate its production.<br />
<br />
We hypothesize that this is the way in which ''orf4'' regulates transcription of ''ndmA''. In situations of high caffeine and related xanthine concentrations, the protein encoded by ''orf4'' up-regulates the expression of ''ndmA''. In the experiment listed [[Team:Austin_Texas/Caffeinated_coli#Transcriptional_Regulators|above]], in which no xanthine derivative was added to the media, expression from the ''ndmA'' promoter is inhibited (as shown).<br />
<br />
In order to test this hypothesis, we subjected a strain of Top10 ''E. coli'' cells containing the orf4 gene and the ''ndmA'' promoter containing the ''lacZ'' gene to varying supplements of caffeine, theobromine, theophylline, and xanthine. Xanthine was shown to be insoluble at high concentrations, and was therefore removed from the experiment. The results of exposure to varying concentration levels is shown below.<br />
<br />
[[File:UTAustin2012InductionbySubstrate.jpg|center|650px]]<br />
<br />
As predicted, the expression of ''ndmA'' appears to rise at higher caffeine concentrations. Similarly, higher concentrations of theobromine and theophylline also appear to increase the expression of ''ndmA''. <br />
<br />
From these experiments we conclude that the ''ndmA'' intergenic region contains a promoter that is negatively-regulated by the protein coded by ''orf4'' in the absence of methylxanthines. Upon exposure to methylxanthines, it appears that ''orf4''-mediated repression is relieved, leading to induction.<br />
<br />
===Results Summary===<br />
The main accomplishments we achieved this summer include the following:<br />
<br />
*Refactoring of decaffeination operon from ''P. putida'' into ''E. coli''<br />
*Construction of an auxotrophic selection method using our refactored operon, "addicting" ''E. coli'' to caffeine<br />
*Growth of auxtrophic cells on common caffeinated beverages<br />
*Discovery of a methyxanthine inducible promoter (''ndmA'') in the CBB5 operon<br />
*Characterization of an open reading frame (''orf4'') in the CBB5 operon that acts as a transcription regulator<br />
<br />
==References==<br />
<br />
Summers RM, Louie TM, Yu CL, Gakhar L, Louie KC, Subramanian M, "Novel, highly specific N-demethylases enable bacteria to live on caffeine and related purine alkaloids." Journal of Bacteriology, 2012, vol 194, no 8, pg 2041-2049.<br />
<br />
Rodriguez del Rey Z, Granek EF, Sylvester S, "Occurrence and concentration of caffeine in Oregon coastal waters." Marine Pollution Bulletin, 2012, vol 64, no 8, Pages 1417-1424.<br />
<br />
<html><br />
<div id="footer" /><br />
</html></div>Erik.quandthttp://2012.igem.org/Team:Austin_Texas/Caffeinated_coliTeam:Austin Texas/Caffeinated coli2012-10-04T00:48:33Z<p>Erik.quandt: /* Engineered E. coli stoichiometrically convert caffeine to guanine for cell replication */</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli" class="selected"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
<br />
<br />
= '''<center><div style="font-size:150%">Project: Caffeinated coli</div>''' =<br />
<br />
[[File:Caffeinated_Bacteria.jpg|375px|center]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Introduction'''</div> ==<br />
<br />
<html><br />
<a href="http://www.geog.ucsb.edu/events/department-news/1072/if-you-thought-fish-were-sleepless-in-seattle-check-out-the-ones-off-the-coast-of-oregon/"><img src="https://static.igem.org/mediawiki/2012/5/58/FishCoffee.png" alt="UT Austin CNS logo" width="240px"; height="240px"; style="float:right; padding:3px; clear:left;"/></a></html><br />
<br />
Caffeine is commonly used in foods and beverages such as coffee and chocolate and in pharmaceuticals as a cardiac and respiratory stimulant. As a result of the wide use of caffeine, it has become widely present in human waste and as a pollutant in the environment. Bacteria capable of degrading caffeine have been found naturally and could be used for bioremediation. We seek to port caffeine degradation functionality into ''Escherichia coli'' to produce strains that are better suited to degrade caffeine in an industrial setting. <br />
<br />
''Pseudomonas putida'' CBB5, discovered by Ryan Summers and Mani Subramanian at the University of Iowa, can live on caffeine as the sole carbon and nitrogen source. CBB5 uses a nitrogen demethylation pathway to convert caffeine to xanthine with formaldehyde side products. The xanthine and formaldehyde are then used as the nitrogen and carbon sources respectively.<br />
<br />
The N-demethylation pathway consists of four demethylation genes: ''ndmA'', ''ndmB'', ''ndmC'', and ''ndmD''. NdmA, NdmB, and NdmC remove the methyl groups from the N-1, N-3, and N-7 respectively. This is done with the help of a reductase, NdmD.<br />
<br />
[[File:Ndm diagram.JPG|center|650px]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Strategy'''</div> ==<br />
<br />
=== Refactoring Decaffeination Operon ===<br />
<br />
The first goal of this project involves refactoring the caffeine operon from the caffeine utilization pathway from ''Psuedomonas putida'' CBB5, first characterized by Summers et al. in early 2012. The operon, shown below, will be incorporated into the well characterized bacterium, ''Escherichia coli'' [3]. <br />
<br />
[[File:CBB5_Operon.png|center|650px]]<br />
<br />
Directly importing the operon into ''E. coli'' was determined to be impractical, as the strength and regulation of the ribosome binding sites (RBSs) and operon-controlled promoters in the CBB5 operon may not be optimized for function in ''E. coli''. Additionally, the use in CBB5 of GTG start codons conflicts with ''E. coli’s'' preference for ATG – leading to problems in translation initiation.<br />
<br />
We therefore decided to separate out open reading frames for the genes of interest in the CBB5 operon and put them under controlled regulation in a refactored caffeine utilization operon for import into ''E. coli''. The operon's design, shown below and submitted as [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 BBa_K734000], aims to optimize its functionality in its new host. <br />
<br />
[[File:Austin_Texas_Decaffeination_design.png|center]]<br />
<br />
This includes the genes that code for the N-demethylase proteins NdmA, NdmB, and NdmC, and the gene that codes for the putative assisting protein NdmD. Also included is the glutathione S-transferase gene from ''Janthinobacterium'' sp. strain Marseille, necessary for functionality of NdmC. Constitutive expression occurs with a strong, well-characterized promoter ([http://partsregistry.org/wiki/index.php/Part:BBa_J23100 BBa_J23100]) and a strong, well-characterized RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]). Finally, all GTG start codons have been replaced with ATG.<br />
<br />
Sources of parts used in our synthetic decaffeination circuit:<br />
<br />
[[File:Austin_Texas_Part_sources.png|center]]<br />
<br />
==== Assembly ====<br />
<br />
Our operon was assembled via a one-step, six-piece Gibson assembly. Briefly, genes to be stitched together were PCR amplified with overhangs homologous to adjacent genes (or homologous to the vector backbone in the case of the 5' end of the promoter and the 3' end of ''gst9''). The forward primers also contained our chosen RBS and ATG. In a one-pot reaction, a 5'-exonuclease chewed back on the homologous overhangs, allowing adjacent fragments to base pair, and a DNA ligase stitched them together. An overview is shown here.<br />
<br />
[[File:Austin_Texas_Decaffeination_assembly.png|center]]<br />
<br />
=== Operon Testing and Optimization ===<br />
<br />
We employed two different assays for operon functionality: growth on caffeine as a sole carbon source, and a genetic selection for caffeine demethylation to xanthine. To evaluate the ability to use caffeine as a sole carbon source we will transform TOP 10 ''E. coli'' electrocompetent cells with the refactored caffeine utilization operon, grow transformed cells in rich media to saturation and then dilute 1:100 into M9 mineral media. Varying levels of caffeine concentrations will be used to determine the degree of caffeine utilization, and the optimal limit for growth.<br />
<br />
Since the cell has an extremely large requirement for carbon, the energy derived from demethylation may not be enough to support growth. For this reason a second assay for caffeine demethylation based on guanine auxotrophy has been devised. ''E. coli'' synthesizes the nucleotide guanine de novo via a pathway that involves xanthosine-5’-phosphate (XMP) as an essential intermediate. The enzyme responsible for the formation of XMP (from inosine-5’-phosphate, IMP) is IMP dehydrogenase, which is encoded by the ''guaB'' gene. If ''guaB'' is knocked out, the cell is unable to synthesize guanine and is therefore unable to grow on media lacking guanine. We plan to take advantage of this engineered auxotrophy and use it as a way to select for cells that are able to demethylate caffeine to xanthine which can then be converted to XMP by xanthine-guanine phosphoribotransferase (gpt) and thereby relieve the metabolic block and restore guanine synthesis allowing for cell growth.<br />
<br />
[[File:guaB_selection_1.jpg|center|650px]]<br />
<br />
Finally, after construction and preliminary testing of the caffeine degradation operon in''E. coli'', we will attempt to grow our cells in the presence of various commercial caffeinated beverages.<br />
<br />
=== Characterizing Inducible Promoters ===<br />
<br />
In Summers et al (2012)., the two open reading frames ''orf1'' and ''orf4'' are thought to be putative regulators of the caffeine degradation operon's N-demethylase proteins due to sequence homology to other known protein regulators (AraC and gntR family). They are hypothesized to bind to operator sequences in the intergenic regions between genes in the operon, which may serve as promoters for the various demethylases of the operon. <br />
<br />
Analysis of the sizes of the intergenic regions of the CBB5 caffeine utilization operon shows that the regions upstream of the ''ndm'' genes are all greater than 150bp. The large size of these intergenic regions and the fact that they precede the catabolic enzyme gene leads us to hypothesize that there are caffeine (or other methylxanthine) regulatory elements in these sequences.<br />
<br />
We will clone these open reading frames into the reporter plasmid pRA301. pRA301 contains a promoterless ''lacZ'' gene, preceded by a multiple cloning site (MCS). DNA fragments hypothesized to contain promoter elements can be cloned into the MCS and assayed for ''lacZ'' expression by [http://openwetware.org/wiki/Beta-Galactosidase_Assay_%28A_better_Miller%29 Miller Assay]. Using this method, we can determine the regulatory functionality of each open reading frame by examining varying fluorescence levels.<br />
<br />
=== CBB5 Genome sequencing ===<br />
<br />
Since only a partial sequence (13.1kb) of the ''p.putida'' CBB5 decaffeination operon is available (Summers 2012), we are submitting genomic DNA for whole genome sequencing. The genome will be sequenced using Illumina next-gen sequencing by UT [[https://wikis.utexas.edu/display/GSAF/Home+Page GSAF]]. The assembled genome will be deposited to Genbank.<br />
<br />
==<div style="font-size:130%;text-align:center">'''Results</div>==<br />
<br />
===Decaffeination operon (+ gst9) enables growth of GuaB knockout===<br />
<br />
Our initial refactored operon consisted of CBB5 genes ''NdmA,B,C,D''. We found that this operon was able to support growth of the ''GuaB'' knockout on theophylline but not caffeine. This indicated that the demethylase responsible for removing the 7-methyl group (''NdmC'') was not functional. Of note, Summers et. al (2012) also could not detect NdmC activity when expressed in ''E. coli''. We reasoned that there could be a missing protein required for ''NdmC'' activity. Summers et al. (2012) showed that an uncharacterized protein (''orf8'') co-purified in CBB5 protein fractions assayed for ''NdmC'' activity. We reasoned that this protein could be essential for NdmC function. Unfortunately, the complete DNA sequence of ''orf8'' was not available; only a partial sequence of the ''orf'' was contained in the known operon sequence. <br />
<br />
<br />
[[File:Orf8_partial.png|center|650px]]<br />
<br />
<br />
A protein homology search was performed using the available sequence to find potential homologs that might be able to substitute function of the missing ''orf''. The search revealed that an uncharacterized gene, ''gst9'', from ''Janthinobacterium marseille'' shared a high degree of sequence homology (70%). We decided to synthesize the ''gst9'' gene from the available sequence and clone it into our decaffeination operon to see if it would enable ''NdmC'' activity and allow for complete demethylation of caffeine. We found our hyphothesis to be true, adding ''gst9'' to our refactored operon [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 (Bba_K734000)] did indeed enable growth of the ''guaB'' knockout on m9 mineral media:<br />
<br />
<br />
[[File:UtAustin2012DecaffeinationOperon.jpg|center|650px]]<br />
<br />
From this figure, we see that our decaffeination operon enables the GuaB knockout to grow in the absence of guanine or xanthine supplementation by instead demethylating the available caffeine to produce xanthine. This not only confirms the functionality of our refactored decaffeination operon, but proves a method by which we can use it to auxotrophically select for cells.<br />
<br />
To more accurately determine the utilization of caffeine by our operon, we tested the growth of our ''E. coli'' cells containing refactored operon and the knocked out ''guaB'' gene under multiple caffeine concentration conditions. We found that our cells were able to grow at conditions as low as 10uM of caffeine, and peaked at a caffeine concentration of approximately 250uM. Cells were grown in concentrations as high as 5000uM, at which point cells began to die (presumably from caffeine toxicity). <br />
<br />
[[File:AustiniGEM2012GrowthCurve.jpg|center|650px]]<br />
<br />
From these growth conditions, we plated dilutions of up to 10<sup>7</sup> the concentration of original solution. This was used to determine individual cell growth based on caffeine. We discovered that approximately 7.6 +/- 0.8 pg of caffeine were utilized per cell. The graph above also shows a method by which we can convert directly from optical densities (an easily measured solution condition) to the caffeine concentration of the growth media. This is viable for cultures that contain cells with our refactored operon, and caffeine concentrations between 0 and approximately 250 uM.<br />
<br />
=== Engineered ''E. coli'' stoichiometrically convert caffeine to guanine for cell replication ===<br />
<br />
As caffeine appears to limit cell growth under these conditions, we were curious about how much of the provided caffeine was being utilized to create DNA and RNA for cellular replication. The genome of ''E. coli'' is roughly 4.6 Mb. Since this is double-stranded DNA and approximately 50% consists of G-C base pairs, there are about 2.3x10<sup>6</sup> guanines needed per cell to replicate its DNA. The dry weight of a typical ''E. coli'' cell is approximately 280 femtograms and 20% of this is RNA ([http://bionumbers.hms.harvard.edu Bionumbers]). Given the molecular weight of a typical RNA nucleotide is roughly 330 g/mol, and that 1/4 of these bases are guanine, this means that there are about 2.55x10<sup>10</sup> guanines needed per cell to replicate its RNA. So, overall the number of guanine molecules in RNA is roughly 10,000x the amount in DNA.<br />
<br />
We found that 7.6 +/- 0.8 pg of caffeine was utilized per cell. Given the molecular weight of 194.19 g/mol, this translates into 2.4x10<sup>10</sup> molecules of caffeine per cell. This is in amazing agreement with the number of molecules of guanine that we have calculated that is required to replicate a cell!<br />
<br />
<div style="font-size:130%;text-align:center"><br />
{| class="wikitable" style="text-align:center"<br />
|-<br />
! !!Molecules per cell<br />
|-<br />
| Caffeine molecules consumed (Calculated) || 2.40x10<sup>10</sup><br />
|-<br />
| Guanine molecules required (Theoretical) || 2.55x10<sup>10</sup><br />
|-<br />
|}<br />
</div><br />
<br />
===Growth in Caffeinated Beverages ===<br />
In order to make our results more palpable, we experimented with growth of our ''E. coli'' strain in various caffeinated beverages. Experiments were first performed on cells with only the ''guaB'' knockout modification, in order to prove that growth in these beverages was even possible. Initial results, shown below, indicate that growth is in fact possible for a wide variety of beverages, including Coca-Cola, 5-Hour Energy, Lipton Tea, and Startbucks Espresso.<br />
<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthInitial.png|center|650px]]<br />
<br />
The graph above shows that the auxotrophic selection of cells using xanthine derivatives again functions as expected – without xanthine, cells were unable to grow under most conditions. The noticeable optical densities for 50% Coca-Cola and 50% Espresso are due to the strong background color of the culture and not actual cell growth. 50% 5-Hour Energy and Espresso were both shown to be toxic to our cells. Finally, tea was shown to contain enough natural xanthines to allow for partial cell growth, and was excluded from further experiments.<br />
<br />
We then attempted to grow our cell strain containing both the ''guaB'' knockout gene and the refactored decaffeination operon. The results of this experiment are shown below.<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthFinal.jpg|center|720px]]<br />
It is important to note that these cells were grown in m9 minimal media containing only 0.2% casein as a natural carbon source. The cells were required to scavenge virtually all of their carbon required for guanine synthesis from the caffeine supplied to the system, or die. Our ''E. coli'' was able to utilize the caffeine inherent to Coca-Cola, Starbucks Espresso and 5-Hour Energy, as well as caffeine in caffeine. However, without our refactored decaffeination operon, the cells were unable to grow under any conditions. The two small bars that appear above in 50% Coca-Cola and 10% Espresso are simply due to the high background color of the cultures. It is also worth note that the 10% 5-Hour Energy growth conditions proved marginally toxic to our ''E. coli'', as the cells were unable to reach maximum optical densities.<br />
<br />
Utilizing the previous experiment in which we calculated the growth of our cells per caffeine molecule, we are able to estimate the total concentration of caffeine in each of the original caffeinated beverages. This is done by fitting the created equation that converts OD into predicted caffeine concentration. From caffeine concentration and the known dilution of caffeinated beverage added to each of the cultures, we can estimate the caffeine weight per beverage volume.<br />
<br />
These results are summarized below, and are very close to the values determined by the beverage manufacturers themselves. This serves as further reinforcement that our decaffeination operon works as intended, and even suggests a possible use in measuring the caffeine value of beverages. Note that the cells in 5-Hour Energy appeared to be in exponential growth phase, weakening the strength of the equation's fit to reality.<br />
<br />
<div style="font-size:130%;text-align:center"><br />
{| class="wikitable" style="text-align:center"<br />
|-<br />
! !! Caffeine Content we Calculated (g/L) !! Caffeine Content Manufacturer Calculated (g/L)<br />
|-<br />
| Coca-Cola || 99.1 || 98.6<br />
|-<br />
| Starbucks Espresso|| 44.7 || 39.5<br />
|-<br />
| 5-Hour Energy || 4259.8 || 2333.2<br />
|}<br />
</div><br />
<br />
Finally, we took pictures of our cells grown in caffeinated beverages cultures, as shown below. Cells in the left tubes do not contain the decaffeination operon, while cells in the right tubes do contain the decaffeination operon. Both contain the ''guaB'' gene knocked out, and require xanthine or xanthine derived from caffeine in order to survive. As shown below, Coca-Cola, Diet Coke and Coffee, all of which contain caffeine, feature strong growth of the ''guaB'' knockouts with the decaffeination operon. However, Caffeine Free Diet Coke shows no growth even with the operon, as there is no caffeine to be used as a xanthine source.<br />
<br />
[[File:UTAustin2012iGEMCaffeinatedBeverages.jpg|border|center|950px]]<br />
<br />
===Transcriptional Regulators===<br />
As described earlier, we hypothesize that the large intergenic regions upstream of various genes in the CBB5 decaffeination operon, particularly upstream of ''ndmA'', may contain methylxanthine regulated promoters. We propose that ''orf1'' and ''orf4'', which were annotated as putative regulators based on sequence homology, act as repressors for the promoters contained in the operon. <br />
<br />
To test these hypotheses, we cloned the intergenic region upstream of the ''ndmA'' gene into a promoterless ''lacZ'' reporter plasmid, pRA301. This vector enabled quantitative measurement of promoter strength using the β-galactosidase Miller Assay. Additionally, we created compatible biobrick plasmids of each putative repressor, ''orf1'' and ''orf4'', in order to assay their effect on ''ndmA'' promoter strength in the presence or absence of methylxanthine supplementation.<br />
<br />
We transformed these plasmids into the Top10 ''E. coli'' strain to create three strains: one containing only the ''ndmA-lacZ'' reporter plasmid, and co-transformants containing both the ''ndmA-lacZ'' plasmid and either ''orf1'' or ''orf4'' biobrick plasmids. All three ''E. coli'' strains were grown in m9 minimal media + .2% casein (+ appropriate supplement) at 30<sup>o</sup>C for 48 hrs, after which time Miller Assays were performed. The results, summarized in the figure below, provide strong evidence that expression of ''orf4'' leads to inhibited ''ndmA'' promoter functionality, while ''orf1'' expression provides negligible influence on the ''ndmA'' promoter. <br />
<br />
[[File:Austin2012ndmARepression.jpg|center|650px]]<br />
<br />
A higher Miller Unit correlates to a higher level of ''lacZ'' production, effectively quantifying the degree of gene expression. As the Miller Unit of the strain co-expressed ''ndmA'' promoter with ''orf4'' is lower by a factor of roughly 4, it can be inferred that the protein encoded by ''orf4'' regulates the degree to which the ''ndmA'' promoter is expressed during transcription.<br />
<br />
It should be noted that while expression of ''ndmA'' drops significantly in this experiment, this does not imply that ''orf4'' only inhibits the expression of ''ndmA''. This is discussed in the next section.<br />
<br />
===Inducible Promoters===<br />
As shown above, it appears that ''orf4'' acts as a transcriptional regulator of ''ndmA'' expression. One would expect a transcriptional regulator to regulate transcription in a way that is beneficial to the overall fitness of the organism. In certain situations in which a protein is necessary for survival, the transcriptional factor should up-regulate the production of said gene. Likewise, when a protein is not necessary, the transcriptional factor should down-regulate its production.<br />
<br />
We hypothesize that this is the way in which ''orf4'' regulates transcription of ''ndmA''. In situations of high caffeine and related xanthine concentrations, the protein encoded by ''orf4'' up-regulates the expression of ''ndmA''. In the experiment listed [[Team:Austin_Texas/Caffeinated_coli#Transcriptional_Regulators|above]], in which no xanthine derivative was added to the media, expression from the ''ndmA'' promoter is inhibited (as shown).<br />
<br />
In order to test this hypothesis, we subjected a strain of Top10 ''E. coli'' cells containing the orf4 gene and the ''ndmA'' promoter containing the ''lacZ'' gene to varying supplements of caffeine, theobromine, theophylline, and xanthine. Xanthine was shown to be insoluble at high concentrations, and was therefore removed from the experiment. The results of exposure to varying concentration levels is shown below.<br />
<br />
[[File:UTAustin2012InductionbySubstrate.jpg|center|650px]]<br />
<br />
As predicted, the expression of ''ndmA'' appears to rise at higher caffeine concentrations. Similarly, higher concentrations of theobromine and theophylline also appear to increase the expression of ''ndmA''. <br />
<br />
From these experiments we conclude that the ''ndmA'' intergenic region contains a promoter that is negatively-regulated by the protein coded by ''orf4'' in the absence of methylxanthines. Upon exposure to methylxanthines, it appears that ''orf4''-mediated repression is relieved, leading to induction.<br />
<br />
===Results Summary===<br />
The main accomplishments we achieved this Summer include the following:<br />
<br />
*Refactoring of decaffeination operon from ''P. putida'' into ''E. coli''<br />
*Construction of an auxotrophic selection method using our refactored operon, "addicting" ''E. coli'' to caffeine<br />
*Growth of auxtrophic cells on common caffeinated beverages<br />
*Discovery of a methyxanthine inducible promoter (''ndmA'') in the CBB5 operon<br />
*Characterization of an open reading frame (''orf4'') in the CBB5 operon that acts as a transcription regulator<br />
<br />
==References==<br />
<br />
Summers RM, Louie TM, Yu CL, Gakhar L, Louie KC, Subramanian M, "Novel, highly specific N-demethylases enable bacteria to live on caffeine and related purine alkaloids." Journal of Bacteriology, 2012, vol 194, no 8, pg 2041-2049.<br />
<br />
Rodriguez del Rey Z, Granek EF, Sylvester S, "Occurrence and concentration of caffeine in Oregon coastal waters." Marine Pollution Bulletin, 2012, vol 64, no 8, Pages 1417-1424.<br />
<br />
<html><br />
<div id="footer" /><br />
</html></div>Erik.quandthttp://2012.igem.org/File:CBB5_Operon.pngFile:CBB5 Operon.png2012-10-04T00:41:44Z<p>Erik.quandt: uploaded a new version of &quot;File:CBB5 Operon.png&quot;</p>
<hr />
<div>Psuedimonas putida CBB5 caffeine degradation operon, as discovered in Summers et al. "Novel, highly specific N-demethylases enable bacteria to live on caffeine and related purine alkaloids."</div>Erik.quandthttp://2012.igem.org/Team:Austin_Texas/Caffeinated_coliTeam:Austin Texas/Caffeinated coli2012-10-03T22:21:07Z<p>Erik.quandt: /* Results Summary */</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli" class="selected"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
<br />
<br />
= '''<center><div style="font-size:150%">Project: Caffeinated Coli</div>''' =<br />
<br />
[[File:Caffeinated_Bacteria.jpg|375px|center]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Introduction'''</div> ==<br />
<br />
<html><br />
<a href="http://www.geog.ucsb.edu/events/department-news/1072/if-you-thought-fish-were-sleepless-in-seattle-check-out-the-ones-off-the-coast-of-oregon/"><img src="https://static.igem.org/mediawiki/2012/5/58/FishCoffee.png" alt="UT Austin CNS logo" width="240px"; height="240px"; style="float:right; padding:3px; clear:left;"/></a></html><br />
<br />
Caffeine is commonly used in foods and beverages such as coffee and chocolate and in pharmaceuticals as a cardiac and respiratory stimulant. As a result of the wide use of caffeine, it has become widely present in human waste and as a pollutant in the environment. Bacteria capable of degrading caffeine have been found naturally and could be used for bioremediation. We seek to port caffeine degradation functionality into ''Escherichia coli'' to produce strains that are better suited to degrade caffeine in an industrial setting. <br />
<br />
''Pseudomonas putida'' CBB5, discovered by Ryan Summers and Mani Subramanian at the University of Iowa, can live on caffeine as the sole carbon and nitrogen source. CBB5 uses a Nitrogen demethylation pathway to convert caffeine to xanthine with formaldehyde side products. The xanthine and formaldehyde are then used as the nitrogen and carbon sources respectively.<br />
<br />
The N-demethylation pathway consists of four demethylation genes: ''ndmA'', ''ndmB'', ''ndmC'', and ''ndmD''. ''ndmA'', ''ndmB'', and ''ndmC'' remove the methyl groups from the N-1, N-3, and N-7 respectively. This is done with the help of a reductase, ''ndmD''.<br />
<br />
[[File:Ndm diagram.JPG|center|650px]]<br />
<br />
<a href="http://cns.utexas.edu"><br />
<a href="http://www.geog.ucsb.edu/events/department-news/1072/if-you-thought-fish-were-sleepless-in-seattle-check-out-the-ones-off-the-coast-of-oregon/"><br />
<br />
== <div style="font-size:130%;text-align:center">'''Strategy'''</div> ==<br />
<br />
=== Refactoring Decaffeination Operon ===<br />
<br />
The first goal of this project involves refactoring the caffeine operon from the caffeine utilization pathway from ''Psuedomonas putida'' CBB5, first characterized by Summers et al. in early 2012. The operon, shown below, will be incorporated into the well characterized bacterium, ''Escherichia coli'' [3]. <br />
<br />
[[File:CBB5_Operon.png|center|650px]]<br />
<br />
Directly importing the operon into ''E. coli'' was determined impractical, as the strength and regulation of the ribosome binding sites (rbs) and operon-controlled promoters in the CBB5 operon may not be optimized for function in ''E. coli''. Additionally, the use in CBB5 of GTG start codons conflicts with E. coli’s preference for ATG – leading to problems in translation initiation.<br />
<br />
We therefore decided to separate out open reading frames for the genes of interest in the CBB5 operon and put them under controlled regulation in a refactored caffeine utilization operon for import into ''E. coli''. The operon's design, shown below and submitted as [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 BBa_K734000], aims to optimize its functionality in its new host. <br />
<br />
[[File:Austin_Texas_Decaffeination_design.png|center]]<br />
<br />
This includes the N-demethylase proteins: ''ndmA'', ''ndmB'', ''ndmC'', and the putative assisting protein ''ndmD''. Also included is the glutathione S-transferase from ''Janthinobacterium'' sp. strain Marseille, necessary for functionality of NdmC. Constitutive expression occurs with a strong, well-characterized promoter ([http://partsregistry.org/wiki/index.php/Part:BBa_J23100 BBa_J23100]) and a strong, well-characterized RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]). Finally, all GTG start codons have been replaced with ATG.<br />
<br />
Sources of parts used in our synthetic decaffeination circuit:<br />
<br />
[[File:Austin_Texas_Part_sources.png|center]]<br />
<br />
==== Assembly ====<br />
<br />
Our operon was assembled via a one-step, six-piece Gibson assembly. Briefly, genes to be stitched together were PCR amplified with overhangs homologous to adjacent genes (or homologous to the vector backbone in the case of the 5' end of the promoter and the 3' end of ''gst9''). The forward primers also contained our chosen RBS and ATG. In a one-pot reaction, a 5'-exonuclease chewed back on the homologous overhangs, allowing adjacent fragments to base pair, and a DNA ligase stitched them together. An overview is shown here.<br />
<br />
[[File:Austin_Texas_Decaffeination_assembly.png|center]] <br />
<br />
=== Operon Testing and Optimization ===<br />
<br />
We will employ two different assays for operon functionality; growth on caffeine as a sole carbon source, and a genetic selection for caffeine demethylation to xanthine. To evaluate the ability to use caffeine as a sole carbon source we will transform TOP 10 E.coli electrocompetent cells with the refactored caffeine utilization operon, grow transformed cells in rich media to saturation and then dilute 1:100 into M9 mineral media. Varying levels of caffeine concentrations will be used to determine the degree of caffeine utilization, and the optimal limit for growth.<br />
<br />
Since the cell has an extremely large requirement for carbon, the energy derived from demethylation may not be enough to support growth. For this reason a second assay for caffeine demethylation based on guanine auxotrophy has been devised. ''E. coli'' synthesizes the nucleotide guanine de novo via a pathway that involves Xanthosine-5’-phosphate (XMP) as an essential intermediate. The enzyme responsible for the formation of XMP (from inosine-5’-phosphate[IMP]) is IMP dehydrogenase, which is encoded by the GuaB gene. If GuaB is knocked out, the cell is unable to synthesize guanine and is therefore unable to grow on media lacking guanine. We plan to take advantage of this engineered auxotrophy and use it as a way to select for cells that are able to demethylate caffeine to xanthine which can then be converted to XMP by xanthine-guanine phosphoribotransferase (gpt) and thereby relieve the metabolic block and restore guanine synthesis allowing for cell growth.<br />
<br />
[[File:guaB_selection_1.jpg|center|650px]]<br />
<br />
Finally, after construction and preliminary testing of the caffeine degradation operon in''E. coli'', we will attempt to grow our cells in the presence of various commercial caffeinated beverages.<br />
<br />
=== Characterizing Inducible Promoters ===<br />
<br />
In Summers et al (2012)., the two open reading frames ''orf1'' and ''orf4'' are thought to be putative regulators of the caffeine degradation operon's N-demethylase proteins due to sequence homology to other known protein regulators (AraC and gntR family). They are hypothesized to bind to operator sequences in the intergenic regions between genes in the operon, which may serve as promoters for the various demethylases of the operon. <br />
<br />
Analysis of the sizes of the intergenic regions of the CBB5 caffeine utilization operon shows that the regions upstream of the ndm genes are all greater than 150bp. The large size of these intergenic regions and the fact that they precede the catabolic enzyme gene leads us to hypothesize that there are caffeine (or other methylxanthine) regulatory elements in these sequences.<br />
<br />
We will clone these open reading frames into the reporter plasmid pRA301. pRA301 contains a promoterless lacZ gene, preceded by a multiple cloning site (MCS). DNA fragments hypothesized to contain promoter elements can be cloned into the MCS and assayed for lacZ expression by Miller assay. Using this method, we can determine the regulatory functionality of each open reading frame by examining varying fluorescence levels.<br />
<br />
=== CBB5 Genome sequencing ===<br />
<br />
Since only a partial sequence (13.1kb) of the ''p.putida'' CBB5 decaffeination operon is available (Summers 2012), we are submitting genomic DNA for whole genome sequencing. The genome will be sequenced using Illumina next-gen sequencing by UT [[https://wikis.utexas.edu/display/GSAF/Home+Page GSAF]]. The assembled genome will be deposited to Genbank.<br />
<br />
==<div style="font-size:130%;text-align:center">'''Results</div>==<br />
<br />
===Decaffeination operon (+ gst9) enables growth of GuaB knockout===<br />
<br />
Our initial refactored operon consisted of CBB5 genes ''NdmA,B,C,D''. We found that this operon was able to support growth of the ''GuaB'' knockout on theophylline but not caffeine. This indicated that the demethylase responsible for removing the 7-methyl group (''NdmC'') was not functional. Of note, Summers et. al (2012) also could not detect NdmC activity when expressed in ''e.coli''. We reasoned that there could be a missing protein required for ''NdmC'' activity. Summers et al. (2012) showed that an uncharacterized protein (orf8) copurified in CBB5 protein fractions assayed for ''NdmC'' activity. We reasoned that this protein could be essential for NdmC function. Unfortunately, the complete DNA sequence of ''orf8'' was not available, only a partial sequence of the orf was contained in the known operon sequence. <br />
<br />
<br />
[[File:Orf8_partial.png|center|650px]]<br />
<br />
<br />
A protein homology search was performed using the available sequence to find potential homologs that might be able to substitute function of the missing orf. The search revealed that an uncharacterized gene, ''gst9'', from ''Janthinobacterium marseille'' shared a high degree of sequence homology (70%). We decided to synthesize the ''gst9'' gene from the available sequence and clone it into our decaffeination operon to see if it would enable ''NdmC'' activity and allow for complete demethylation of caffeine. We found our hyphothesis to be true, adding ''gst9'' to our refactored operon [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 (Bba_K734000)] did indeed enable growth of the ''guaB'' knockout on m9 mineral media:<br />
<br />
<br />
[[File:UtAustin2012DecaffeinationOperon.jpg|center|650px]]<br />
<br />
From this figure, we see that our decaffeination operon enables the GuaB knockout to grow in the absence of guanine or xanthine supplementation by instead demethylating the available caffeine to produce xanthine. This not only confirms the functionality of our refactored decaffeination operon, but proves a method by which we can use it to auxotrophically select for cells.<br />
<br />
To more accurately determine the utilization of caffeine by our operon, we tested the growth of our E. coli cells containing refactored operon and the knocked out GuaB gene under multiple caffeine concentration conditions. We found that our cells were able to grow at conditions as low as 10uM of caffeine, and peaked at a caffeine concentration of approximately 250uM. Concentrations were grown as high as 5000uM, at which point cells began to die, presumably from caffeine toxicity. <br />
<br />
[[File:AustiniGEM2012GrowthCurve.jpg|center|650px]]<br />
<br />
From these growth conditions, we plated dilutions of up to 10<sup>7</sup> dilution. This was used to determine individual cell growth based on caffeine. Approximately 7.6 +/- 0.8 pg of caffeine were utilized per cell. <br />
<br />
=== Engineered ''E. coli'' stoichiometrically convert caffeine to guanine for cell replication ===<br />
<br />
We were curious about how much of the provided caffeine was being used to create DNA and RNA for cellular replication since it seemed to limit growth. The genome of ''E. coli'' is roughly 4.6 Mb. Since this is double-stranded DNA and approximately 50% consists of G-C base pairs, there are about 2.3 x 10<sup>6</sup> guanines needed per cell to replicate its DNA. The dry weight of a typical ''E. coli'' cell is approximately 280 femtograms and 20% of this is RNA ([http://bionumbers.hms.harvard.edu Bionumbers]). Given the molecular weight of a typical RNA nucleotide is roughly 330 g/mol, and that 1/4 of these bases are guanine, this means that there are about 2.55 x 10<sup>10</sup> guanines needed per cell to replicate its RNA. So, overall the number of guanine molecules in RNA is roughly 10,000x the amount in DNA.<br />
<br />
We found that 7.6 +/- 0.8 pg of caffeine was utilized per cell. Given the molecular weight of 194.19 g/mol, this translates into 2.4 x 10^10 molecules of caffeine per cell. This is in amazing agreement with the number of molecules of guanine that we have calculated that is required to replicate a cell!<br />
<br />
===Growth in Caffeinated Beverages ===<br />
In order to make our experiment more relatable, we experimented with growth of our E. coli strain in various caffeinated beverages. Experiments were first performed on cells with only the GuaB knockout modification, in order to prove that growth in these beverages was even possible. Initial results, shown below, indicate that growth is in fact possible for a wide variety of beverages, including Coca-Cola, 5-Hour Energy, Lipton Tea, and Startbucks Espresso.<br />
<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthInitial.png|center|650px]]<br />
<br />
The graph above shows that the auxotrophic selection of cells using xanthine derivatives again functions as expected – without xanthine, cells were unable to grow under most conditions. The noticeable Optical Densities for 50% Coca-Cola and 50% Espresso are due to the strong background color of the culture and not actual cell growth. 50% 5-Hour Energy and Espresso were both shown to be toxic to our cells. Finally, tea was shown to contain enough natural xanthenes to allow for partial cell growth, and was excluded from further experiments.<br />
<br />
We then attempted to grow our cell strain containing both the GuaB knockout gene and the refactored decaffeination operon. The results of this experiment are shown below.<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthFinal.jpg|center|720px]]<br />
It is important to note that these cells were grown in M9 minimal media containing only 0.2% casein as a natural carbon source. The cells were required to scavenge virtually all of their carbon required for guanine synthesis from the caffeine supplied to the system, or die. Our E. coli was able to utilize the caffeine inherent to Coca-Cola, Starbucks Espresso and 5-Hour Energy, as well as caffeine in caffeine. However, without our refactored decaffeination operon, the cells were unable to grow under any conditions. The two small bars that appear above in 50% Coca-Cola and 10% Espresso are simply due to the high background color of the cultures. It is also worth note that the 10% 5-Hour Energy growth conditions proved marginally toxic to our E. coli cells, as the cells were unable to reach maximum Optical Densities.<br />
<br />
Utilizing the previous experiment in which we calculated the growth of our cells per caffeine molecule, we are able to estimate the total concentration of caffeine in each of the original caffeinated beverages. This is done by fitting the created equation that converts OD into predicted caffeine concentration. From caffeine concentration and the known dilution of caffeinated beverage added to each of the cultures, we can estimate the caffeine weight per beverage volume. These results are summarized below, and are very close to the values determined by the beverage manufacturers themselves. This serves as further reinforcement that our decaffeination operon works as intended, and even suggests a possible use in measuring the caffeine value of beverages. Note that the cells in 5-Hour Energy appeared to be in exponential growth phase, weakening the strength of the equation's fit to reality.<br />
<br />
<div style="font-size:130%;text-align:center"><br />
{| class="wikitable" style="text-align:center"<br />
|-<br />
! !! Caffeine Content we Calculated (g/L) !! Caffeine Content Manufacturer Calculated (g/L)<br />
|-<br />
| Coca-Cola || 99.1 || 98.6<br />
|-<br />
| Starbucks Espresso|| 44.7 || 39.5<br />
|-<br />
| 5-Hour Energy || 4259.8 || 2333.2<br />
|}<br />
</div><br />
<br />
Finally, we took pictures of our cells grown in caffeinated beverages cultures, as shown below. Cells in the left tubes do not contain the decaffeination operon, while cells in the right tubes actually do contain the decaffeination operon. Both contain the GuaB operon knocked out, and require xanthine or xanthine derived from caffeine in order to survive. As shown below, Coca-Cola, Diet Coke and Coffee, all of which contain caffeine, feature strong growth of the guaB knockouts with the decaffeination operon. However, Caffeine Free Diet Coke shows no growth even with the operon, as there is no caffeine to be used as a xanthine source.<br />
<br />
[[File:UTAustin2012iGEMCaffeinatedBeverages.jpg|center|900px]]<br />
<br />
===Transcriptional Regulators===<br />
As described earlier, we hypothesize that the large intergenic regions upstream of various genes in the CBB5 decaffeination operon, particularly upstream of ndmA, may contain methylxanthine regulated promoters. We propose that orf1 and orf4, which were annotated as putative regulators based on sequence homology, act as repressors for the promoters contained in the operon. <br />
<br />
To test these hypotheses, we cloned the intergentic region upstream of the ndmA gene into a promoterless LacZ reporter plasmid, pRA301. This vector enabled quantitative measurement of promoter strength using the β-galactosidase Miller Assay. Additionally, we created compatible biobrick plasmids of each putative repressor, orf1 and orf4, in order to assay their effect on ndmA promoter strength in the presence or absence of methylxanthine supplementation.<br />
<br />
We transformed these plasmids into the Top10 ''E.coli'' strain to create three strains: one containing only the ndmA-LacZ reporter plasmid, and cotransformants containing both the ndmA-LacZ plasmid and either orf1 or orf4 biobrick plasmids. All three ''E. coli'' strains were grown in M9 minimal media + .2% casein (+ appropriate supplement) at 30<sup>o</sup>C for 48 hrs, after which time Miller assays were performed. The results, summarized in the figure below, provide strong evidence that '''''expression of orf4 leads to inhibited ndmA promoter functionality''''', while orf1 expression provides negligible influence on the ndmA promoter. <br />
<br />
[[File:Austin2012ndmARepression.jpg|center|650px]]<br />
<br />
A higher Miller Unit correlates to a higher level of lacZ production, effectively quantifying the degree of gene expression. As the Miller Unit of the strain co-expressed ndmA promoter with orf4 is lower by a factor of roughly 4, it can be inferred that the protein encoded by orf4 regulates the degree to which the ndmA promoter is expressed during transcription.<br />
<br />
It should be noted that while expression of ndmA drops significantly in this experiment, this does not imply that orf4 only inhibits the expression of ndmA. This is discussed in the next section: Inducible Promoters.<br />
<br />
===Inducible Promoters===<br />
As shown above, it appears that orf4 acts as a transcriptional regulator of ndmA expression. One would expect a transcriptional regulator to regulate transcription in a way that is beneficial to the overall fitness of the organism. In certain situations in which a protein is necessary for survival, the transcriptional factor should up-regulate the production of said gene. Likewise, when a protein is not necessary, the transcriptional factor should down-regulate its production.<br />
<br />
We hypothesize that this is the way in which orf4 regulates transcription of ndmA. In situations of high caffeine and related xanthine concentrations, the protein encoded by orf4 up-regulates the expression of ndmA. In the experiment listed [[Team:Austin_Texas/Caffeinated_coli#Transcriptional_Regulators|above]], in which no xanthine derivative was added to the media, expression from the ndmA promoter is inhibited (as shown).<br />
<br />
In order to test this hypothesis, we subjected a strain of Top10 ''E. coli'' cells containing the orf4 gene and the ndmA promoter containing the lacZ gene to varying supplements of caffeine, theobromine, theophylline, and xanthine. Xanthine was shown to be insoluble at high concentrations, and was therefore removed from the experiment. The results of exposure to varying concentration levels is shown below.<br />
<br />
[[File:UTAustin2012InductionbySubstrate.jpg|center|650px]]<br />
<br />
As predicted, the '''''expression of ndmA appears to rise at higher caffeine concentrations'''''. Similarly, higher concentrations of theobromine and theophylline also appear to increase the expression of ndmA. <br />
<br />
From these experiments we conclude that the ndmA intergenic region contains a promoter that is negatively-regulated by the orf4 protein in the absence of methylxanthines. Upon exposure to methylxanthines, it appears that orf4-mediated repression is relieved, leading to induction.<br />
<br />
===Results Summary===<br />
The main accomplishments we achieved this Summer include the following:<br />
<br />
*Refactoring of decaffeination operon from ''P. putida'' into ''E. coli''<br />
*Construction of an auxotrophic selection method using our refactored operon, "addicting" ''E. coli'' to caffeine<br />
*Growth of auxtrophic cells on common caffeinated beverages<br />
*Discovery of a methyxanthine inducible promoter (''ndmA'') in the CBB5 operon<br />
*Characterization of an open reading frame (''orf4'') in the CBB5 operon that acts as a transcription regulator<br />
<br />
==References==<br />
<br />
Summers RM, Louie TM, Yu CL, Gakhar L, Louie KC, Subramanian M, "Novel, highly specific N-demethylases enable bacteria to live on caffeine and related purine alkaloids." Journal of Bacteriology, 2012, vol 194, no 8, pg 2041-2049.<br />
<br />
Rodriguez del Rey Z, Granek EF, Sylvester S, "Occurrence and concentration of caffeine in Oregon coastal waters." Marine Pollution Bulletin, 2012, vol 64, no 8, Pages 1417-1424.<br />
<br />
<html><br />
<div id="footer" /><br />
</html></div>Erik.quandthttp://2012.igem.org/Team:Austin_Texas/Caffeinated_coliTeam:Austin Texas/Caffeinated coli2012-10-03T18:40:53Z<p>Erik.quandt: /* Decaffeination operon (+ gst9) enables growth of GuaB knockout */</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli" class="selected"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
<br />
<br />
= '''<center><div style="font-size:150%">Project: Caffeinated Coli</div>''' =<br />
<br />
[[File:Caffeinated_Bacteria.jpg|375px|center]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Introduction'''</div> ==<br />
<br />
<html><br />
<a href="http://www.geog.ucsb.edu/events/department-news/1072/if-you-thought-fish-were-sleepless-in-seattle-check-out-the-ones-off-the-coast-of-oregon/"><img src="https://static.igem.org/mediawiki/2012/5/58/FishCoffee.png" alt="UT Austin CNS logo" width="240px"; height="240px"; style="float:right; padding:3px; clear:left;"/></a></html><br />
<br />
Caffeine is commonly used in foods and beverages such as coffee and chocolate and in pharmaceuticals as a cardiac and respiratory stimulant. As a result of the wide use of caffeine, it has become widely present in human waste and as a pollutant in the environment. Bacteria capable of degrading caffeine have been found naturally and could be used for bioremediation. We seek to port caffeine degradation functionality into ''Escherichia coli'' to produce strains that are better suited to degrade caffeine in an industrial setting. <br />
<br />
''Pseudomonas putida'' CBB5, discovered by Ryan Summers and Mani Subramanian at the University of Iowa, can live on caffeine as the sole carbon and nitrogen source. CBB5 uses a Nitrogen demethylation pathway to convert caffeine to xanthine with formaldehyde side products. The xanthine and formaldehyde are then used as the nitrogen and carbon sources respectively.<br />
<br />
The N-demethylation pathway consists of four demethylation genes: ''ndmA'', ''ndmB'', ''ndmC'', and ''ndmD''. ''ndmA'', ''ndmB'', and ''ndmC'' remove the methyl groups from the N-1, N-3, and N-7 respectively. This is done with the help of a reductase, ''ndmD''.<br />
<br />
[[File:Ndm diagram.JPG|center|650px]]<br />
<br />
<a href="http://cns.utexas.edu"><br />
<a href="http://www.geog.ucsb.edu/events/department-news/1072/if-you-thought-fish-were-sleepless-in-seattle-check-out-the-ones-off-the-coast-of-oregon/"><br />
<br />
== <div style="font-size:130%;text-align:center">'''Strategy'''</div> ==<br />
<br />
=== Refactoring Decaffeination Operon ===<br />
<br />
The first goal of this project involves refactoring the caffeine operon from the caffeine utilization pathway from ''Psuedomonas putida'' CBB5, first characterized by Summers et al. in early 2012. The operon, shown below, will be incorporated into the well characterized bacterium, ''Escherichia coli'' [3]. <br />
<br />
[[File:CBB5_Operon.png|center|650px]]<br />
<br />
Directly importing the operon into ''E. coli'' was determined impractical, as the strength and regulation of the ribosome binding sites (rbs) and operon-controlled promoters in the CBB5 operon may not be optimized for function in ''E. coli''. Additionally, the use in CBB5 of GTG start codons conflicts with E. coli’s preference for ATG – leading to problems in translation initiation.<br />
<br />
We therefore decided to separate out open reading frames for the genes of interest in the CBB5 operon and put them under controlled regulation in a refactored caffeine utilization operon for import into ''E. coli''. The operon's design, shown below and submitted as [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 BBa_K734000], aims to optimize its functionality in its new host. <br />
<br />
[[File:Austin_Texas_Decaffeination_design.png|center]]<br />
<br />
This includes the N-demethylase proteins: ''ndmA'', ''ndmB'', ''ndmC'', and the putative assisting protein ''ndmD''. Also included is the glutathione S-transferase from ''Janthinobacterium'' sp. strain Marseille, necessary for functionality of NdmC. Constitutive expression occurs with a strong, well-characterized promoter ([http://partsregistry.org/wiki/index.php/Part:BBa_J23100 BBa_J23100]) and a strong, well-characterized RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]). Finally, all GTG start codons have been replaced with ATG.<br />
<br />
Sources of parts used in our synthetic decaffeination circuit:<br />
<br />
[[File:Austin_Texas_Part_sources.png|center]]<br />
<br />
==== Assembly ====<br />
<br />
Our operon was assembled via a one-step, six-piece Gibson assembly. Briefly, genes to be stitched together were PCR amplified with overhangs homologous to adjacent genes (or homologous to the vector backbone in the case of the 5' end of the promoter and the 3' end of ''gst9''). The forward primers also contained our chosen RBS and ATG. In a one-pot reaction, a 5'-exonuclease chewed back on the homologous overhangs, allowing adjacent fragments to base pair, and a DNA ligase stitched them together. An overview is shown here.<br />
<br />
[[File:Austin_Texas_Decaffeination_assembly.png|center]] <br />
<br />
=== Operon Testing and Optimization ===<br />
<br />
We will employ two different assays for operon functionality; growth on caffeine as a sole carbon source, and a genetic selection for caffeine demethylation to xanthine. To evaluate the ability to use caffeine as a sole carbon source we will transform TOP 10 E.coli electrocompetent cells with the refactored caffeine utilization operon, grow transformed cells in rich media to saturation and then dilute 1:100 into M9 mineral media. Varying levels of caffeine concentrations will be used to determine the degree of caffeine utilization, and the optimal limit for growth.<br />
<br />
Since the cell has an extremely large requirement for carbon, the energy derived from demethylation may not be enough to support growth. For this reason a second assay for caffeine demethylation based on guanine auxotrophy has been devised. ''E. coli'' synthesizes the nucleotide guanine de novo via a pathway that involves Xanthosine-5’-phosphate (XMP) as an essential intermediate. The enzyme responsible for the formation of XMP (from inosine-5’-phosphate[IMP]) is IMP dehydrogenase, which is encoded by the GuaB gene. If GuaB is knocked out, the cell is unable to synthesize guanine and is therefore unable to grow on media lacking guanine. We plan to take advantage of this engineered auxotrophy and use it as a way to select for cells that are able to demethylate caffeine to xanthine which can then be converted to XMP by xanthine-guanine phosphoribotransferase (gpt) and thereby relieve the metabolic block and restore guanine synthesis allowing for cell growth.<br />
<br />
[[File:guaB_selection_1.jpg|center|650px]]<br />
<br />
Finally, after construction and preliminary testing of the caffeine degradation operon in''E. coli'', we will attempt to grow our cells in the presence of various commercial caffeinated beverages.<br />
<br />
=== Characterizing Inducible Promoters ===<br />
<br />
In Summers et al (2012)., the two open reading frames ''orf1'' and ''orf4'' are thought to be putative regulators of the caffeine degradation operon's N-demethylase proteins due to sequence homology to other known protein regulators (AraC and gntR family). They are hypothesized to bind to operator sequences in the intergenic regions between genes in the operon, which may serve as promoters for the various demethylases of the operon. <br />
<br />
Analysis of the sizes of the intergenic regions of the CBB5 caffeine utilization operon shows that the regions upstream of the ndm genes are all greater than 150bp. The large size of these intergenic regions and the fact that they precede the catabolic enzyme gene leads us to hypothesize that there are caffeine (or other methylxanthine) regulatory elements in these sequences.<br />
<br />
We will clone these open reading frames into the reporter plasmid pRA301. pRA301 contains a promoterless lacZ gene, preceded by a multiple cloning site (MCS). DNA fragments hypothesized to contain promoter elements can be cloned into the MCS and assayed for lacZ expression by Miller assay. Using this method, we can determine the regulatory functionality of each open reading frame by examining varying fluorescence levels.<br />
<br />
=== CBB5 Genome sequencing ===<br />
<br />
Since only a partial sequence (13.1kb) of the ''p.putida'' CBB5 decaffeination operon is available (Summers 2012), we are submitting genomic DNA for whole genome sequencing. The genome will be sequenced using Illumina next-gen sequencing by UT [[https://wikis.utexas.edu/display/GSAF/Home+Page GSAF]]. The assembled genome will be deposited to Genbank.<br />
<br />
==<div style="font-size:130%;text-align:center">'''Results</div>==<br />
<br />
===Decaffeination operon (+ gst9) enables growth of GuaB knockout===<br />
<br />
Our initial refactored operon consisted of CBB5 genes ''NdmA,B,C,D''. We found that this operon was able to support growth of the ''GuaB'' knockout on theophylline but not caffeine. This indicated that the demethylase responsible for removing the 7-methyl group (''NdmC'') was not functional. Of note, Summers et. al (2012) also could not detect NdmC activity when expressed in ''e.coli''. We reasoned that there could be a missing protein required for ''NdmC'' activity. Summers et al. (2012) showed that an uncharacterized protein (orf8) copurified in CBB5 protein fractions assayed for ''NdmC'' activity. We reasoned that this protein could be essential for NdmC function. Unfortunately, the complete DNA sequence of ''orf8'' was not available, only a partial sequence of the orf was contained in the known operon sequence. <br />
<br />
<br />
[[File:Orf8_partial.png|center|650px]]<br />
<br />
<br />
A protein homology search was performed using the available sequence to find potential homologs that might be able to substitute function of the missing orf. The search revealed that an uncharacterized gene, ''gst9'', from ''Janthinobacterium marseille'' shared a high degree of sequence homology (70%). We decided to synthesize the ''gst9'' gene from the available sequence and clone it into our decaffeination operon to see if it would enable ''NdmC'' activity and allow for complete demethylation of caffeine. We found our hyphothesis to be true, adding ''gst9'' to our refactored operon [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 (Bba_K734000)] did indeed enable growth of the ''guaB'' knockout on m9 mineral media:<br />
<br />
<br />
[[File:UtAustin2012DecaffeinationOperon.jpg|center|650px]]<br />
<br />
From this figure, we see that our decaffeination operon enables the GuaB knockout to grow in the absence of guanine or xanthine supplementation by instead demethylating the available caffeine to produce xanthine. This not only confirms the functionality of our refactored decaffeination operon, but proves a method by which we can use it to auxotrophically select for cells.<br />
<br />
To more accurately determine the utilization of caffeine by our operon, we tested the growth of our E. coli cells containing refactored operon and the knocked out GuaB gene under multiple caffeine concentration conditions. We found that our cells were able to grow at conditions as low as 10uM of caffeine, and peaked at a caffeine concentration of approximately 250uM. Concentrations were grown as high as 5000uM, at which point cells began to die, presumably from caffeine toxicity. <br />
<br />
[[File:AustiniGEM2012GrowthCurve.jpg|center|650px]]<br />
<br />
From these growth conditions, we plated dilutions of up to 10<sup>7</sup> dilution. This was used to determine individual cell growth based on caffeine. Approximately 7.6 +/- 0.8 pg of caffeine were utilized per cell. Assuming the use of guanine in E. coli DNA that is roughly 9.2 Mb and 50% GC, approximately 2.3*10<sup>6</sup> guanines derived from caffeine are shown to be utilized per cell in our engineered organisms. As there are roughly 10<sup>11</sup> bases of RNA per E. coli cell, and approximately 25% of these are guanine, there are approximately 2.55*10<sup>10</sup> guanines required for E. coli cell growth. From this calculation, we can include that our cells are scavenging and utilizing approximately all the caffeine present in the system.<br />
<br />
===Growth in Caffeinated Beverages ===<br />
In order to make our experiment more relatable, we experimented with growth of our E. coli strain in various caffeinated beverages. Experiments were first performed on cells with only the GuaB knockout modification, in order to prove that growth in these beverages was even possible. Initial results, shown below, indicate that growth is in fact possible for a wide variety of beverages, including Coca-Cola, 5-Hour Energy, Lipton Tea, and Startbucks Espresso.<br />
<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthInitial.png|center|650px]]<br />
<br />
The graph above shows that the auxotrophic selection of cells using xanthine derivatives again functions as expected – without xanthine, cells were unable to grow under most conditions. The noticeable Optical Densities for 50% Coca-Cola and 50% Espresso are due to the strong background color of the culture and not actual cell growth. 50% 5-Hour Energy and Espresso were both shown to be toxic to our cells. Finally, tea was shown to contain enough natural xanthenes to allow for partial cell growth, and was excluded from further experiments.<br />
<br />
We then attempted to grow our cell strain containing both the GuaB knockout gene and the refactored decaffeination operon. The results of this experiment are shown below.<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthFinal.jpg|center|720px]]<br />
It is important to note that these cells were grown in M9 minimal media containing only 0.2% casein as a natural carbon source. The cells were required to scavenge virtually all of their carbon required for guanine synthesis from the caffeine supplied to the system, or die. Our E. coli was able to utilize the caffeine inherent to Coca-Cola, Starbucks Espresso and 5-Hour Energy, as well as caffeine in caffeine. However, without our refactored decaffeination operon, the cells were unable to grow under any conditions. The two small bars that appear above in 50% Coca-Cola and 10% Espresso are simply due to the high background color of the cultures. It is also worth note that the 10% 5-Hour Energy growth conditions proved marginally toxic to our E. coli cells, as the cells were unable to reach maximum Optical Densities.<br />
<br />
Utilizing the previous experiment in which we calculated the growth of our cells per caffeine molecule, we are able to estimate the total concentration of caffeine in each of the original caffeinated beverages. This is done by fitting the created equation that converts OD into predicted caffeine concentration. From caffeine concentration and the known dilution of caffeinated beverage added to each of the cultures, we can estimate the caffeine weight per beverage volume. These results are summarized below, and are very close to the values determined by the beverage manufacturers themselves. This serves as further reinforcement that our decaffeination operon works as intended, and even suggests a possible use in measuring the caffeine value of beverages. Note that the cells in 5-Hour Energy appeared to be in exponential growth phase, weakening the strength of the equation's fit to reality.<br />
<br />
<div style="font-size:130%;text-align:center"><br />
{| class="wikitable" style="text-align:center"<br />
|-<br />
! !! Caffeine Content we Calculated (g/L) !! Caffeine Content Manufacturer Calculated (g/L)<br />
|-<br />
| Coca-Cola || 99.1 || 98.6<br />
|-<br />
| Starbucks Espresso|| 44.7 || 39.5<br />
|-<br />
| 5-Hour Energy || 4259.8 || 2333.2<br />
|}<br />
</div><br />
<br />
Finally, we took pictures of our cells grown in caffeinated beverages cultures, as shown below. Cells in the left tubes do not contain the decaffeination operon, while cells in the right tubes actually do contain the decaffeination operon. Both contain the GuaB operon knocked out, and require xanthine or xanthine derived from caffeine in order to survive. As shown below, meh i'll finish this later<br />
<br />
[[File:UTAustin2012iGEMCaffeinatedBeverages.jpg|center|900px]]<br />
<br />
===Transcriptional Regulators===<br />
As described earlier, we hypothesize that the large intergenic regions upstream of various genes in the CBB5 decaffeination operon, particularly upstream of ndmA, may contain methylxanthine regulated promoters. We propose that orf1 and orf4, which were annotated as putative regulators based on sequence homology, act as repressors for the promoters contained in the operon. <br />
<br />
To test these hypotheses, we cloned the intergentic region upstream of the ndmA gene into a promoterless LacZ reporter plasmid, pRA301. This vector enabled quantitative measurement of promoter strength using the β-galactosidase Miller Assay. Additionally, we created compatible biobrick plasmids of each putative repressor, orf1 and orf4, in order to assay their effect on ndmA promoter strength in the presence or absence of methylxanthine supplementation.<br />
<br />
We transformed these plasmids into the Top10 ''E.coli'' strain to create three strains: one containing only the ndmA-LacZ reporter plasmid, and cotransformants containing both the ndmA-LacZ plasmid and either orf1 or orf4 biobrick plasmids. All three ''E. coli'' strains were grown in M9 minimal media + .2% casein (+ appropriate supplement) at 30<sup>o</sup>C for 48 hrs, after which time Miller assays were performed. The results, summarized in the figure below, provide strong evidence that '''''expression of orf4 leads to inhibited ndmA promoter functionality''''', while orf1 expression provides negligible influence on the ndmA promoter. <br />
<br />
[[File:Austin2012ndmARepression.jpg|center|650px]]<br />
<br />
A higher Miller Unit correlates to a higher level of lacZ production, effectively quantifying the degree of gene expression. As the Miller Unit of the strain co-expressed ndmA promoter with orf4 is lower by a factor of roughly 4, it can be inferred that the protein encoded by orf4 regulates the degree to which the ndmA promoter is expressed during transcription.<br />
<br />
It should be noted that while expression of ndmA drops significantly in this experiment, this does not imply that orf4 only inhibits the expression of ndmA. This is discussed in the next section: Inducible Promoters.<br />
<br />
===Inducible Promoters===<br />
As shown above, it appears that orf4 acts as a transcriptional regulator of ndmA expression. One would expect a transcriptional regulator to regulate transcription in a way that is beneficial to the overall fitness of the organism. In certain situations in which a protein is necessary for survival, the transcriptional factor should up-regulate the production of said gene. Likewise, when a protein is not necessary, the transcriptional factor should down-regulate its production.<br />
<br />
We hypothesize that this is the way in which orf4 regulates transcription of ndmA. In situations of high caffeine and related xanthine concentrations, the protein encoded by orf4 up-regulates the expression of ndmA. In the experiment listed [[Team:Austin_Texas/Caffeinated_coli#Transcriptional_Regulators|above]], in which no xanthine derivative was added to the media, expression from the ndmA promoter is inhibited (as shown).<br />
<br />
In order to test this hypothesis, we subjected a strain of Top10 ''E. coli'' cells containing the orf4 gene and the ndmA promoter containing the lacZ gene to varying supplements of caffeine, theobromine, theophylline, and xanthine. Xanthine was shown to be insoluble at high concentrations, and was therefore removed from the experiment. The results of exposure to varying concentration levels is shown below.<br />
<br />
[[File:UTAustin2012InductionbySubstrate.jpg|center|650px]]<br />
<br />
As predicted, the '''''expression of ndmA appears to rise at higher caffeine concentrations'''''. Similarly, higher concentrations of theobromine and theophylline also appear to increase the expression of ndmA. <br />
<br />
From these experiments we conclude that the ndmA intergenic region contains a promoter that is negatively-regulated by the orf4 protein in the absence of methylxanthines. Upon exposure to methylxanthines, it appears that orf4-mediated repression is relieved, leading to induction.<br />
<br />
===Results Summary===<br />
The main accomplishments we achieved this Summer include the following:<br />
<br />
*Refactoring of decaffeination operon from ''P. putida'' into ''E. coli''<br />
*Construction of a auxotrophic selection method using our refactored operon, "addicting" ''E. coli'' to caffeine<br />
*Growth of auxtrophic cells on common caffeinated beverages<br />
*Discovery of a methyxanthine inducible promoter (ndmA) in the CBB5 operon<br />
*Characterization of an open reading frame (orf4) in the CBB5 operon that acts as a transcription regulator<br />
<br />
==References==<br />
<br />
Summers RM, Louie TM, Yu CL, Gakhar L, Louie KC, Subramanian M, "Novel, highly specific N-demethylases enable bacteria to live on caffeine and related purine alkaloids." Journal of Bacteriology, 2012, vol 194, no 8, pg 2041-2049.<br />
<br />
Rodriguez del Rey Z, Granek EF, Sylvester S, "Occurrence and concentration of caffeine in Oregon coastal waters." Marine Pollution Bulletin, 2012, vol 64, no 8, Pages 1417-1424.<br />
<br />
<html><br />
<div id="footer" /><br />
</html></div>Erik.quandthttp://2012.igem.org/File:Orf8_partial.pngFile:Orf8 partial.png2012-10-03T18:38:30Z<p>Erik.quandt: uploaded a new version of &quot;File:Orf8 partial.png&quot;</p>
<hr />
<div></div>Erik.quandthttp://2012.igem.org/File:Orf8_partial.pngFile:Orf8 partial.png2012-10-03T18:37:20Z<p>Erik.quandt: </p>
<hr />
<div></div>Erik.quandthttp://2012.igem.org/Team:Austin_Texas/Caffeinated_coliTeam:Austin Texas/Caffeinated coli2012-10-03T14:20:16Z<p>Erik.quandt: /* Decaffeination operon (+ gst9) enables growth of GuaB knockout */</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli" class="selected"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
<br />
<br />
= '''<center><div style="font-size:150%">Project: Caffeinated Coli</div>''' =<br />
<br />
[[File:Caffeinated_Bacteria.jpg|375px|center]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Introduction'''</div> ==<br />
<br />
<html><br />
<a href="http://www.geog.ucsb.edu/events/department-news/1072/if-you-thought-fish-were-sleepless-in-seattle-check-out-the-ones-off-the-coast-of-oregon/"><img src="https://static.igem.org/mediawiki/2012/5/58/FishCoffee.png" alt="UT Austin CNS logo" width="240px"; height="240px"; style="float:right; padding:3px; clear:left;"/></a></html><br />
<br />
Caffeine is commonly used in foods and beverages such as coffee and chocolate and in pharmaceuticals as a cardiac and respiratory stimulant. As a result of the wide use of caffeine, it has become widely present in human waste and as a pollutant in the environment. Bacteria capable of degrading caffeine have been found naturally and could be used for bioremediation. We seek to port caffeine degradation functionality into ''Escherichia coli'' to produce strains that are better suited to degrade caffeine in an industrial setting. <br />
<br />
''Pseudomonas putida'' CBB5, discovered by Ryan Summers and Mani Subramanian at the University of Iowa, can live on caffeine as the sole carbon and nitrogen source. CBB5 uses a Nitrogen demethylation pathway to convert caffeine to xanthine with formaldehyde side products. The xanthine and formaldehyde are then used as the nitrogen and carbon sources respectively.<br />
<br />
The N-demethylation pathway consists of four demethylation genes: ''ndmA'', ''ndmB'', ''ndmC'', and ''ndmD''. ''ndmA'', ''ndmB'', and ''ndmC'' remove the methyl groups from the N-1, N-3, and N-7 respectively. This is done with the help of a reductase, ''ndmD''.<br />
<br />
[[File:Ndm diagram.JPG|center|650px]]<br />
<br />
<a href="http://cns.utexas.edu"><br />
<a href="http://www.geog.ucsb.edu/events/department-news/1072/if-you-thought-fish-were-sleepless-in-seattle-check-out-the-ones-off-the-coast-of-oregon/"><br />
<br />
== <div style="font-size:130%;text-align:center">'''Strategy'''</div> ==<br />
<br />
=== Refactoring Decaffeination Operon ===<br />
<br />
The first goal of this project involves refactoring the caffeine operon from the caffeine utilization pathway from ''Psuedomonas putida'' CBB5, first characterized by Summers et al. in early 2012. The operon, shown below, will be incorporated into the well characterized bacterium, ''Escherichia coli'' [3]. <br />
<br />
[[File:CBB5_Operon.png|center|650px]]<br />
<br />
Directly importing the operon into ''E. coli'' was determined impractical, as the strength and regulation of the ribosome binding sites (rbs) and operon-controlled promoters in the CBB5 operon may not be optimized for function in ''E. coli''. Additionally, the use in CBB5 of GTG start codons conflicts with E. coli’s preference for ATG – leading to problems in translation initiation.<br />
<br />
We therefore decided to separate out open reading frames for the genes of interest in the CBB5 operon and put them under controlled regulation in a refactored caffeine utilization operon for import into ''E. coli''. The operon's design, shown below and submitted as [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 BBa_K734000], aims to optimize its functionality in its new host. <br />
<br />
[[File:Austin_Texas_Decaffeination_design.png|center]]<br />
<br />
This includes the N-demethylase proteins: ''ndmA'', ''ndmB'', ''ndmC'', and the putative assisting protein ''ndmD''. Also included is the glutathione S-transferase from ''Janthinobacterium'' sp. strain Marseille, necessary for functionality of NdmC. Constitutive expression occurs with a strong, well-characterized promoter ([http://partsregistry.org/wiki/index.php/Part:BBa_J23100 BBa_J23100]) and a strong, well-characterized RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]). Finally, all GTG start codons have been replaced with ATG.<br />
<br />
Sources of parts used in our synthetic decaffeination circuit:<br />
<br />
[[File:Austin_Texas_Part_sources.png|center]]<br />
<br />
==== Assembly ====<br />
<br />
Our operon was assembled via a one-step, six-piece Gibson assembly. Briefly, genes to be stitched together were PCR amplified with overhangs homologous to adjacent genes (or homologous to the vector backbone in the case of the 5' end of the promoter and the 3' end of ''gst9''). The forward primers also contained our chosen RBS and ATG. In a one-pot reaction, a 5'-exonuclease chewed back on the homologous overhangs, allowing adjacent fragments to base pair, and a DNA ligase stitched them together. An overview is shown here.<br />
<br />
[[File:Austin_Texas_Decaffeination_assembly.png|center]] <br />
<br />
=== Operon Testing and Optimization ===<br />
<br />
We will employ two different assays for operon functionality; growth on caffeine as a sole carbon source, and a genetic selection for caffeine demethylation to xanthine. To evaluate the ability to use caffeine as a sole carbon source we will transform TOP 10 E.coli electrocompetent cells with the refactored caffeine utilization operon, grow transformed cells in rich media to saturation and then dilute 1:100 into M9 mineral media. Varying levels of caffeine concentrations will be used to determine the degree of caffeine utilization, and the optimal limit for growth.<br />
<br />
Since the cell has an extremely large requirement for carbon, the energy derived from demethylation may not be enough to support growth. For this reason a second assay for caffeine demethylation based on guanine auxotrophy has been devised. ''E. coli'' synthesizes the nucleotide guanine de novo via a pathway that involves Xanthosine-5’-phosphate (XMP) as an essential intermediate. The enzyme responsible for the formation of XMP (from inosine-5’-phosphate[IMP]) is IMP dehydrogenase, which is encoded by the GuaB gene. If GuaB is knocked out, the cell is unable to synthesize guanine and is therefore unable to grow on media lacking guanine. We plan to take advantage of this engineered auxotrophy and use it as a way to select for cells that are able to demethylate caffeine to xanthine which can then be converted to XMP by xanthine-guanine phosphoribotransferase (gpt) and thereby relieve the metabolic block and restore guanine synthesis allowing for cell growth.<br />
<br />
[[File:guaB_selection_1.jpg|center|650px]]<br />
<br />
Finally, after construction and preliminary testing of the caffeine degradation operon in''E. coli'', we will attempt to grow our cells in the presence of various commercial caffeinated beverages.<br />
<br />
=== Characterizing Inducible Promoters ===<br />
<br />
In Summers et al (2012)., the two open reading frames ''orf1'' and ''orf4'' are thought to be putative regulators of the caffeine degradation operon's N-demethylase proteins due to sequence homology to other known protein regulators (AraC and gntR family). They are hypothesized to bind to operator sequences in the intergenic regions between genes in the operon, which may serve as promoters for the various demethylases of the operon. <br />
<br />
Analysis of the sizes of the intergenic regions of the CBB5 caffeine utilization operon shows that the regions upstream of the ndm genes are all greater than 150bp. The large size of these intergenic regions and the fact that they precede the catabolic enzyme gene leads us to hypothesize that there are caffeine (or other methylxanthine) regulatory elements in these sequences.<br />
<br />
We will clone these open reading frames into the reporter plasmid pRA301. pRA301 contains a promoterless lacZ gene, preceded by a multiple cloning site (MCS). DNA fragments hypothesized to contain promoter elements can be cloned into the MCS and assayed for lacZ expression by Miller assay. Using this method, we can determine the regulatory functionality of each open reading frame by examining varying fluorescence levels.<br />
<br />
=== CBB5 Genome sequencing ===<br />
<br />
Since only a partial sequence (13.1kb) of the ''p.putida'' CBB5 decaffeination operon is available (Summers 2012), we are submitting genomic DNA for whole genome sequencing. The genome will be sequenced using Illumina next-gen sequencing by UT [[https://wikis.utexas.edu/display/GSAF/Home+Page GSAF]]. The assembled genome will be deposited to Genbank.<br />
<br />
==<div style="font-size:130%;text-align:center">'''Results</div>==<br />
<br />
===Decaffeination operon (+ gst9) enables growth of GuaB knockout===<br />
<br />
Our initial refactored operon consisted of CBB5 genes ''NdmA,B,C,D''. We found that this operon was able to support growth of the ''GuaB'' knockout on theophylline but not caffeine. This indicated that the demethylase responsible for removing the 7-methyl group (''NdmC'') was not functional. Of note, Summers et. al (2012) also could not detect NdmC activity when expressed in ''e.coli''. We reasoned that there could be a missing protein required for ''NdmC'' activity. Summers et al. (2012) showed that an uncharacterized protein (orf8) copurified in CBB5 protein fractions assayed for ''NdmC'' activity. We reasoned that this protein could be essential for NdmC function. Unfortunately, the complete DNA sequence of ''orf8'' was not available, only a partial sequence of the orf was contained in the known operon sequence. A protein homology search was performed using the available sequence to find potential homologs that might be able to substitute function of the missing orf. The search revealed that an uncharacterized gene, ''gst9'', from ''Janthinobacterium marseille'' shared a high degree of sequence homology (70%). We decided to synthesize the ''gst9'' gene from the available sequence and clone it into our decaffeination operon to see if it would enable ''NdmC'' activity and allow for complete demethylation of caffeine. We found our hyphothesis to be true, adding ''gst9'' to our refactored operon [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 (Bba_K734000)] did indeed enable growth of the ''guaB'' knockout on m9 mineral media:<br />
<br />
<br />
[[File:UtAustin2012DecaffeinationOperon.jpg|center|650px]]<br />
<br />
From this figure, we see that our decaffeination operon enables the GuaB knockout to grow in the absence of guanine or xanthine supplementation by instead demethylating the available caffeine to produce xanthine. This not only confirms the functionality of our refactored decaffeination operon, but proves a method by which we can use it to auxotrophically select for cells.<br />
<br />
To more accurately determine the utilization of caffeine by our operon, we tested the growth of our E. coli cells containing refactored operon and the knocked out GuaB gene under multiple caffeine concentration conditions. We found that our cells were able to grow at conditions as low as 10uM of caffeine, and peaked at a caffeine concentration of approximately 250uM. Concentrations were grown as high as 5000uM, at which point cells began to die, presumably from caffeine toxicity. <br />
<br />
[[File:AustiniGEM2012GrowthCurve.jpg|center|650px]]<br />
<br />
From these growth conditions, we plated dilutions of up to 10<sup>7</sup> dilution. This was used to determine individual cell growth based on caffeine. Approximately 7.6 +/- 0.8 pg of caffeine were utilized per cell. Assuming the use of guanine in E. coli DNA that is roughly 9.2 Mb and 50% GC, approximately 2.3*10<sup>6</sup> guanines derived from caffeine are shown to be utilized per cell in our engineered organisms. As there are roughly 10<sup>11</sup> bases of RNA per E. coli cell, and approximately 25% of these are guanine, there are approximately 2.55*10<sup>10</sup> guanines required for E. coli cell growth. From this calculation, we can include that our cells are scavenging and utilizing approximately all the caffeine present in the system.<br />
<br />
===Growth in Caffeinated Beverages ===<br />
In order to make our experiment more relatable, we experimented with growth of our E. coli strain in various caffeinated beverages. Experiments were first performed on cells with only the GuaB knockout modification, in order to prove that growth in these beverages was even possible. Initial results, shown below, indicate that growth is in fact possible for a wide variety of beverages, including Coca-Cola, 5-Hour Energy, Lipton Tea, and Startbucks Espresso.<br />
<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthInitial.png|center|650px]]<br />
<br />
The graph above shows that the auxotrophic selection of cells using xanthine derivatives again functions as expected – without xanthine, cells were unable to grow under most conditions. The noticeable Optical Densities for 50% Coca-Cola and 50% Espresso are due to the strong background color of the culture and not actual cell growth. 50% 5-Hour Energy and Espresso were both shown to be toxic to our cells. Finally, tea was shown to contain enough natural xanthenes to allow for partial cell growth, and was excluded from further experiments.<br />
<br />
We then attempted to grow our cell strain containing both the GuaB knockout gene and the refactored decaffeination operon. The results of this experiment are shown below.<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthFinal.jpg|center|720px]]<br />
It is important to note that these cells were grown in M9 minimal media containing only 0.2% casein as a natural carbon source. The cells were required to scavenge virtually all of their carbon required for guanine synthesis from the caffeine supplied to the system, or die. Our E. coli was able to utilize the caffeine inherent to Coca-Cola, Starbucks Espresso and 5-Hour Energy, as well as caffeine in caffeine. However, without our refactored decaffeination operon, the cells were unable to grow under any conditions. The two small bars that appear above in 50% Coca-Cola and 10% Espresso are simply due to the high background color of the cultures. It is also worth note that the 10% 5-Hour Energy growth conditions proved marginally toxic to our E. coli cells, as the cells were unable to reach maximum Optical Densities.<br />
<br />
Utilizing the previous experiment in which we calculated the growth of our cells per caffeine molecule, we are able to estimate the total concentration of caffeine in each of the original caffeinated beverages. This is done by fitting the created equation that converts OD into predicted caffeine concentration. From caffeine concentration and the known dilution of caffeinated beverage added to each of the cultures, we can estimate the caffeine weight per beverage volume. These results are summarized below, and are very close to the values determined by the beverage manufacturers themselves. This serves as further reinforcement that our decaffeination operon works as intended, and even suggests a possible use in measuring the caffeine value of beverages. Note that the cells in 5-Hour Energy appeared to be in exponential growth phase, weakening the strength of the equation's fit to reality.<br />
<br />
<div style="font-size:130%;text-align:center"><br />
{| class="wikitable" style="text-align:center"<br />
|-<br />
! !! Caffeine Content we Calculated (g/L) !! Caffeine Content Manufacturer Calculated (g/L)<br />
|-<br />
| Coca-Cola || 99.1 || 98.6<br />
|-<br />
| Starbucks Espresso|| 44.7 || 39.5<br />
|-<br />
| 5-Hour Energy || 4259.8 || 2333.2<br />
|}<br />
</div><br />
<br />
Finally, we took pictures of our cells grown in caffeinated beverages cultures, as shown below. Cells in the left tubes do not contain the decaffeination operon, while cells in the right tubes actually do contain the decaffeination operon. Both contain the GuaB operon knocked out, and require xanthine or xanthine derived from caffeine in order to survive. As shown below, meh i'll finish this later<br />
<br />
[[File:UTAustin2012iGEMCaffeinatedBeverages.jpg|center|900px]]<br />
<br />
===Transcriptional Regulators===<br />
As described earlier, we hypothesize that the large intergenic regions upstream of various genes in the CBB5 decaffeination operon, particularly upstream of ndmA, may contain methylxanthine regulated promoters. We propose that orf1 and orf4, which were annotated as putative regulators based on sequence homology, act as repressors for the promoters contained in the operon. <br />
<br />
To test these hypotheses, we cloned the intergentic region upstream of the ndmA gene into a promoterless LacZ reporter plasmid, pRA301. This vector enabled quantitative measurement of promoter strength using the β-galactosidase Miller Assay. Additionally, we created compatible biobrick plasmids of each putative repressor, orf1 and orf4, in order to assay their effect on ndmA promoter strength in the presence or absence of methylxanthine supplementation.<br />
<br />
We transformed these plasmids into the Top10 ''E.coli'' strain to create three strains: one containing only the ndmA-LacZ reporter plasmid, and cotransformants containing both the ndmA-LacZ plasmid and either orf1 or orf4 biobrick plasmids. All three ''E. coli'' strains were grown in M9 minimal media + .2% casein (+ appropriate supplement) at 30<sup>o</sup>C for 48 hrs, after which time Miller assays were performed. The results, summarized in the figure below, provide strong evidence that '''''expression of orf4 leads to inhibited ndmA promoter functionality''''', while orf1 expression provides negligible influence on the ndmA promoter. <br />
<br />
[[File:Austin2012ndmARepression.jpg|center|650px]]<br />
<br />
A higher Miller Unit correlates to a higher level of lacZ production, effectively quantifying the degree of gene expression. As the Miller Unit of the strain co-expressed ndmA promoter with orf4 is lower by a factor of roughly 4, it can be inferred that the protein encoded by orf4 regulates the degree to which the ndmA promoter is expressed during transcription.<br />
<br />
It should be noted that while expression of ndmA drops significantly in this experiment, this does not imply that orf4 only inhibits the expression of ndmA. This is discussed in the next section: Inducible Promoters.<br />
<br />
===Inducible Promoters===<br />
As shown above, it appears that orf4 acts as a transcriptional regulator of ndmA expression. One would expect a transcriptional regulator to regulate transcription in a way that is beneficial to the overall fitness of the organism. In certain situations in which a protein is necessary for survival, the transcriptional factor should up-regulate the production of said gene. Likewise, when a protein is not necessary, the transcriptional factor should down-regulate its production.<br />
<br />
We hypothesize that this is the way in which orf4 regulates transcription of ndmA. In situations of high caffeine and related xanthine concentrations, the protein encoded by orf4 up-regulates the expression of ndmA. In the experiment listed [[Team:Austin_Texas/Caffeinated_coli#Transcriptional_Regulators|above]], in which no xanthine derivative was added to the media, expression from the ndmA promoter is inhibited (as shown).<br />
<br />
In order to test this hypothesis, we subjected a strain of Top10 ''E. coli'' cells containing the orf4 gene and the ndmA promoter containing the lacZ gene to varying supplements of caffeine, theobromine, theophylline, and xanthine. Xanthine was shown to be insoluble at high concentrations, and was therefore removed from the experiment. The results of exposure to varying concentration levels is shown below.<br />
<br />
[[File:UTAustin2012InductionbySubstrate.jpg|center|650px]]<br />
<br />
As predicted, the '''''expression of ndmA appears to rise at higher caffeine concentrations'''''. Similarly, higher concentrations of theobromine and theophylline also appear to increase the expression of ndmA. <br />
<br />
From these experiments we conclude that the ndmA intergenic region contains a promoter that is negatively-regulated by the orf4 protein in the absence of methylxanthines. Upon exposure to methylxanthines, it appears that orf4-mediated repression is relieved, leading to induction.<br />
<br />
===Results Summary===<br />
The main accomplishments we achieved this Summer include the following:<br />
<br />
*Refactoring of decaffeination operon from ''P. putida'' into ''E. coli''<br />
*Construction of a auxotrophic selection method using our refactored operon, "addicting" ''E. coli'' to caffeine<br />
*Growth of auxtrophic cells on common caffeinated beverages<br />
*Discovery of a methyxanthine inducible promoter (ndmA) in the CBB5 operon<br />
*Characterization of an open reading frame (orf4) in the CBB5 operon that acts as a transcription regulator<br />
<br />
==References==<br />
<br />
Summers RM, Louie TM, Yu CL, Gakhar L, Louie KC, Subramanian M, "Novel, highly specific N-demethylases enable bacteria to live on caffeine and related purine alkaloids." Journal of Bacteriology, 2012, vol 194, no 8, pg 2041-2049.<br />
<br />
Rodriguez del Rey Z, Granek EF, Sylvester S, "Occurrence and concentration of caffeine in Oregon coastal waters." Marine Pollution Bulletin, 2012, vol 64, no 8, Pages 1417-1424.<br />
<br />
<html><br />
<div id="footer" /><br />
</html></div>Erik.quandthttp://2012.igem.org/Team:Austin_TexasTeam:Austin Texas2012-10-03T01:51:54Z<p>Erik.quandt: /* Project Spinach-mCherry Dual Reporter */</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" class="selected" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
[[File:CokeGrowth.png|355px|left]]<br />
[[File:DietCokeGrowth.png|355px|right]]<br />
[[File:UTAustinTower.jpg|x355px|center]]<br />
<br />
<br />
== Project Caffeinated coli ==<br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/d/d1/Caffeinated_Coli.jpeg"; alt="Caffeinated Coli"; width="170px"; height="250px"; style="float:left; padding:3px; clear:right;"/></html><br />
<br />
<br />
<br />
The widespread use of caffeine (1,3,7–trimethylxanthine) and other methylxanthines in beverages and pharmaceuticals has led to significant environmental pollution. We have developed a novel detection and bioremediation strategy for caffeine contamination by refactoring the methylxanthine degradation operon native to ''Pseudomonas putida'' CBB5. ''Escherichia coli'' cells with this synthetic operon degrade caffeine by N-demethylation to the guanine precursor, xanthine. Cells deficient in guanine biosynthesis and containing our refactored operon were addicted to caffeine; their growth density was limited by the availability of caffeine. Remarkably, they were able to sense the caffeine content of several common beverages. Characterization of nearby genes in the ''P. putida'' operon revealed a potential methylxanthine regulatory system for use in biological circuit design. The synthetic N-demethylation operon could be useful for cheaply producing pharmaceuticals or precursor molecules and for detoxifying waste so that it can be recycled into animal feed and biofuels. <br />
<br />
<br /><br /><br /><br /><br /><br />
<br />
== Project ZombiE.coli ==<br />
<br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/a/a9/Austin_Texas_logo.png"; alt="ZombiE.coli"; width="170px"; height="250px"; style="float:left; padding:3px; clear:right;"/></html><br />
<br />
<br />
<br />
UT’s ZombiE.coli project aims to a develop a tightly regulated genetic switch that is triggered by bacterial quorum signaling and leads to feed-forward propagation of the genetic output in the form of red or green fluorescence as well as amplification of quorum signaling. The switch relies on simple one-way Cre/loxP recombination combined with native quorum signaling to provide us with a system that models transmissible disease spread between populations. We have likened this to an airborne zombie epidemic, in which an “infected” zombie cell is capable of restructuring the genes of a normal cell, turning it into a flesh-hungry counterpart. This system will be useful not only as a simple disease outbreak model for intermediate-level biology education, but also, could provide new insights to how bacterial populations communicate in three dimensions and under different genetic backgrounds. <br />
<br />
<br /><br /><br /><br /><br /><br />
<br />
== Project Spinach-mCherry Dual Reporter ==<br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/8/85/Spinach_icon.png"; alt="PopeyEcoli"; width="170px"; height="250px"; style="float:left; padding:3px; clear:right;"/></html><br />
<br />
<br />
<br />
In an effort to improve both efficiency, ease, and quality of promoter and RBS strength meaurements, we focused on developing a dual fluorescence reporter for simultaneous monitoring both transcription and translation. To measure both processes separately, two fluorescent reporters, the Spinach aptamer and mCherry red fluorescent protein, were assembled into a single construct. The Spinach-mCherry dual reporter is a unique concept; Spinach is a short RNA aptamer that binds to its ligand, DFHBI, and allows it to emit green fluorescence similar to GFP. This gives insight into the direct production of the mCherry-encoding mRNA without the need to wait for protein folding and maturation of the fluorophore. This technique attempted to expand upon current efforts to measure promoter strength relative to a reference standard used by the iGEM community.<br />
<br />
<html><br />
<br /><br /><br /><br /><br /><br /><br /><br />
<center><br />
<a href="http://www.geneious.com/"><img src="https://static.igem.org/mediawiki/2012/d/db/Geneious.png" alt="Geneious logo" width="150px" height="62px" /></a><br />
<a href="http://www.neb.com"><img src="https://static.igem.org/mediawiki/2012/d/d6/Austin_Texas_NEB_logo.jpeg" alt="NEB logo" width="150px" height="58px" /></a><br />
<a href="http://www.epochlifescience.com"><img src="https://static.igem.org/mediawiki/2012/c/c6/Austin_Texas_Epoch_logo.jpg" alt="Epoch logo" width="150px" height="65px" /></a><br />
<a href="http://cssb.utexas.edu"><img src="https://static.igem.org/mediawiki/2012/4/43/UT_Austin_CSSB.jpg" alt="UT Austin CSSB logo" width="150px" height="65px" /></a><br />
<a href="http://cns.utexas.edu"><img src="https://static.igem.org/mediawiki/2012/e/ec/UT_Austin_CNS.png" alt="UT Austin CNS logo" width="150px" height="65px" /></a><br />
<br />
</center><br />
<br />
<div id="footer" /><br />
</html><br />
<br />
<!-- this is commented out<br />
<br />
{|align="justify"<br />
|You can write a background of your team here. Give us a background of your team, the members, etc. Or tell us more about something of your choosing.<br />
|<br />
|-<br />
|<br />
''Tell us more about your project. Give us background. Use this as the abstract of your project. Be descriptive but concise (1-2 paragraphs)''<br />
|[[Image:Austin_Texas_team.png|right|frame|Your team picture]]<br />
|-<br />
|<br />
|<br />
|}<br />
<br />
--></div>Erik.quandthttp://2012.igem.org/Team:Austin_Texas/Caffeinated_coliTeam:Austin Texas/Caffeinated coli2012-10-03T01:41:03Z<p>Erik.quandt: /* Growth in Caffeinated Beverages */</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli" class="selected"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
<br />
<br />
= '''<center><div style="font-size:150%">Project: Caffeinated Coli</div>''' =<br />
<br />
[[File:Caffeinated_Bacteria.jpg|375px|center]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Introduction'''</div> ==<br />
<br />
<a href="http://www.geog.ucsb.edu/events/department-news/1072/if-you-thought-fish-were-sleepless-in-seattle-check-out-the-ones-off-the-coast-of-oregon/"><img src="https://static.igem.org/mediawiki/2012/5/58/FishCoffee.png" alt="UT Austin CNS logo" width="150px" height="65px" /></a><br />
<br />
Caffeine is commonly used in foods and beverages such as coffee and chocolate and in pharmaceuticals as a cardiac and respiratory stimulant. As a result of the wide use of caffeine, it has become widely present in human waste and as a pollutant in the environment. Bacteria capable of degrading caffeine have been found naturally and could be used for bioremediation. We seek to port caffeine degradation functionality into ''Escherichia coli'' to produce strains that are better suited to degrade caffeine in an industrial setting. <br />
<br />
''Pseudomonas putida'' CBB5, discovered by Ryan Summers and Mani Subramanian at the University of Iowa, can live on caffeine as the sole carbon and nitrogen source. CBB5 uses a Nitrogen demethylation pathway to convert caffeine to xanthine with formaldehyde side products. The xanthine and formaldehyde are then used as the nitrogen and carbon sources respectively.<br />
<br />
The N-demethylation pathway consists of four demethylation genes: ''ndmA'', ''ndmB'', ''ndmC'', and ''ndmD''. ''ndmA'', ''ndmB'', and ''ndmC'' remove the methyl groups from the N-1, N-3, and N-7 respectively. This is done with the help of a reductase, ''ndmD''.<br />
<br />
[[File:Ndm diagram.JPG|center|650px]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Strategy'''</div> ==<br />
<br />
=== Refactoring Decaffeination Operon ===<br />
<br />
The first goal of this project involves refactoring the caffeine operon from the caffeine utilization pathway from ''Psuedomonas putida'' CBB5, first characterized by Summers et al. in early 2012. The operon, shown below, will be incorporated into the well characterized bacterium, ''Escherichia coli'' [3]. <br />
<br />
[[File:CBB5_Operon.png|center|650px]]<br />
<br />
Directly importing the operon into ''E. coli'' was determined impractical, as the strength and regulation of the ribosome binding sites (rbs) and operon-controlled promoters in the CBB5 operon may not be optimized for function in ''E. coli''. Additionally, the use in CBB5 of GTG start codons conflicts with E. coli’s preference for ATG – leading to problems in translation initiation.<br />
<br />
We therefore decided to separate out open reading frames for the genes of interest in the CBB5 operon and put them under controlled regulation in a refactored caffeine utilization operon for import into ''E. coli''. The operon's design, shown below and submitted as [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 BBa_K734000], aims to optimize its functionality in its new host. <br />
<br />
[[File:Austin_Texas_Decaffeination_design.png|center]]<br />
<br />
This includes the N-demethylase proteins: ''ndmA'', ''ndmB'', ''ndmC'', and the putative assisting protein ''ndmD''. Also included is the glutathione S-transferase from ''Janthinobacterium'' sp. strain Marseille, necessary for functionality of NdmC. Constitutive expression occurs with a strong, well-characterized promoter ([http://partsregistry.org/wiki/index.php/Part:BBa_J23100 BBa_J23100]) and a strong, well-characterized RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]). Finally, all GTG start codons have been replaced with ATG.<br />
<br />
Sources of parts used in our synthetic decaffeination circuit:<br />
<br />
[[File:Austin_Texas_Part_sources.png|center]]<br />
<br />
==== Assembly ====<br />
<br />
Our operon was assembled via a one-step, six-piece Gibson assembly. Briefly, genes to be stitched together were PCR amplified with overhangs homologous to adjacent genes (or homologous to the vector backbone in the case of the 5' end of the promoter and the 3' end of ''gst9''). The forward primers also contained our chosen RBS and ATG. In a one-pot reaction, a 5'-exonuclease chewed back on the homologous overhangs, allowing adjacent fragments to base pair, and a DNA ligase stitched them together. An overview is shown here.<br />
<br />
[[File:Austin_Texas_Decaffeination_assembly.png|center]] <br />
<br />
=== Operon Testing and Optimization ===<br />
<br />
We will employ two different assays for operon functionality; growth on caffeine as a sole carbon source, and a genetic selection for caffeine demethylation to xanthine. To evaluate the ability to use caffeine as a sole carbon source we will transform TOP 10 E.coli electrocompetent cells with the refactored caffeine utilization operon, grow transformed cells in rich media to saturation and then dilute 1:100 into M9 mineral media. Varying levels of caffeine concentrations will be used to determine the degree of caffeine utilization, and the optimal limit for growth.<br />
<br />
Since the cell has an extremely large requirement for carbon, the energy derived from demethylation may not be enough to support growth. For this reason a second assay for caffeine demethylation based on guanine auxotrophy has been devised. ''E. coli'' synthesizes the nucleotide guanine de novo via a pathway that involves Xanthosine-5’-phosphate (XMP) as an essential intermediate. The enzyme responsible for the formation of XMP (from inosine-5’-phosphate[IMP]) is IMP dehydrogenase, which is encoded by the GuaB gene. If GuaB is knocked out, the cell is unable to synthesize guanine and is therefore unable to grow on media lacking guanine. We plan to take advantage of this engineered auxotrophy and use it as a way to select for cells that are able to demethylate caffeine to xanthine which can then be converted to XMP by xanthine-guanine phosphoribotransferase (gpt) and thereby relieve the metabolic block and restore guanine synthesis allowing for cell growth.<br />
<br />
[[File:guaB_selection_1.jpg|center|650px]]<br />
<br />
Finally, after construction and preliminary testing of the caffeine degradation operon in''E. coli'', we will attempt to grow our cells in the presence of various commercial caffeinated beverages.<br />
<br />
=== Characterizing Inducible Promoters ===<br />
<br />
In Summers et al (2012)., the two open reading frames ''orf1'' and ''orf4'' are thought to be putative regulators of the caffeine degradation operon's N-demethylase proteins due to sequence homology to other known protein regulators (AraC and gntR family). They are hypothesized to bind to operator sequences in the intergenic regions between genes in the operon, which may serve as promoters for the various demethylases of the operon. <br />
<br />
Analysis of the sizes of the intergenic regions of the CBB5 caffeine utilization operon shows that the regions upstream of the ndm genes are all greater than 150bp. The large size of these intergenic regions and the fact that they precede the catabolic enzyme gene leads us to hypothesize that there are caffeine (or other methylxanthine) regulatory elements in these sequences.<br />
<br />
We will clone these open reading frames into the reporter plasmid pRA301. pRA301 contains a promoterless lacZ gene, preceded by a multiple cloning site (MCS). DNA fragments hypothesized to contain promoter elements can be cloned into the MCS and assayed for lacZ expression by Miller assay. Using this method, we can determine the regulatory functionality of each open reading frame by examining varying fluorescence levels.<br />
<br />
=== CBB5 Genome sequencing ===<br />
<br />
Since only a partial sequence (13.1kb) of the ''p.putida'' CBB5 decaffeination operon is available (Summers 2012), we are submitting genomic DNA for whole genome sequencing. The genome will be sequenced using Illumina next-gen sequencing by UT [[https://wikis.utexas.edu/display/GSAF/Home+Page GSAF]]. The assembled genome will be deposited to Genbank.<br />
<br />
==<div style="font-size:130%;text-align:center">'''Results</div>==<br />
<br />
===Decaffeination operon (+ gst9) enables growth of GuaB knockout===<br />
<br />
Our initial refactored operon consisted of CBB5 genes NdmA,B,C,D. We found that this operon was able to support growth of the GuaB knockout on theophylline but not caffeine. This indicated that the demethylase responsible for removing the 7-methyl group (NdmC) was not functional. Of note, Summers et. al (2012) also could not detect NdmC activity when expressed in ''e.coli''. We reasoned that there could be a missing protein required for NdmC activity. Summers et al. (2012) showed that an uncharacterized protein (orf8) copurified in protein fractions assayed for NdmC activity. We reasoned that this protein could be essential for NdmC function. Unfortunately, the complete DNA sequence of orf8 was not available, only a partial sequence of the orf was contained in the known operon sequence. A protein homology search was performed using the available sequence to find potential homologs that might be able to substitute function of the missing orf. The search revealed that an uncharacterized gene, gst9, from ''Janthinobacterium marseille'' shared a high degree of sequence homology (70%). We decided to synthesize the gst9 gene from the available sequence and clone it into our decaffeination operon to see if it would enable NdmC activity and allow for complete demethylation of caffeine. We found our hyphothesis to be true, adding gst9 to our refactored operon [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 (Bba_K734000)] did indeed enable growth of the guaB knockout on m9 mineral media:<br />
<br />
<br />
[[File:UtAustin2012DecaffeinationOperon.jpg|center|650px]]<br />
<br />
From this figure, we see that our decaffeination operon enables the GuaB knockout to grow in the absence of guanine or xanthine supplementation by instead demethylating the available caffeine to produce xanthine. This not only confirms the functionality of our refactored decaffeination operon, but proves a method by which we can use it to auxotrophically select for cells.<br />
<br />
To more accurately determine the utilization of caffeine by our operon, we tested the growth of our E. coli cells containing refactored operon and the knocked out GuaB gene under multiple caffeine concentration conditions. We found that our cells were able to grow at conditions as low as 10uM of caffeine, and peaked at a caffeine concentration of approximately 250uM. Concentrations were grown as high as 5000uM, at which point cells began to die, presumably from caffeine toxicity. <br />
<br />
[[File:AustiniGEM2012GrowthCurve.jpg|center|650px]]<br />
<br />
From these growth conditions, we plated dilutions of up to 10<sup>7</sup> dilution. This was used to determine individual cell growth based on caffeine. Approximately 7.6 +/- 0.8 pg of caffeine were utilized per cell. Assuming the use of guanine in E. coli DNA that is roughly 9.2 Mb and 50% GC, approximately 2.3*10<sup>6</sup> guanines derived from caffeine are shown to be utilized per cell in our engineered organisms. As there are roughly 10<sup>11</sup> bases of RNA per E. coli cell, and approximately 25% of these are guanine, there are approximately 2.55*10<sup>10</sup> guanines required for E. coli cell growth. From this calculation, we can include that our cells are scavenging and utilizing approximately all the caffeine present in the system.<br />
<br />
===Growth in Caffeinated Beverages ===<br />
In order to make our experiment more relatable, we experimented with growth of our E. coli strain in various caffeinated beverages. Experiments were first performed on cells with only the GuaB knockout modification, in order to prove that growth in these beverages was even possible. Initial results, shown below, indicate that growth is in fact possible for a wide variety of beverages, including Coca-Cola, 5-Hour Energy, Lipton Tea, and Startbucks Espresso.<br />
<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthInitial.png|center|650px]]<br />
<br />
The graph above shows that the auxotrophic selection of cells using xanthine derivatives again functions as expected – without xanthine, cells were unable to grow under most conditions. The noticeable Optical Densities for 50% Coca-Cola and 50% Espresso are due to the strong background color of the culture and not actual cell growth. 50% 5-Hour Energy and Espresso were both shown to be toxic to our cells. Finally, tea was shown to contain enough natural xanthenes to allow for partial cell growth, and was excluded from further experiments.<br />
<br />
We then attempted to grow our cell strain containing both the GuaB knockout gene and the refactored decaffeination operon. The results of this experiment are shown below.<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthFinal.jpg|center|720px]]<br />
It is important to note that these cells were grown in M9 minimal media containing only 0.2% casein as a natural carbon source. The cells were required to scavenge virtually all of their carbon required for guanine synthesis from the caffeine supplied to the system, or die. Our E. coli was able to utilize the caffeine inherent to Coca-Cola, Starbucks Espresso and 5-Hour Energy, as well as caffeine in caffeine. However, without our refactored decaffeination operon, the cells were unable to grow under any conditions. The two small bars that appear above in 50% Coca-Cola and 10% Espresso are simply due to the high background color of the cultures. It is also worth note that the 10% 5-Hour Energy growth conditions proved marginally toxic to our E. coli cells, as the cells were unable to reach maximum Optical Densities.<br />
<br />
Utilizing the previous experiment in which we calculated the growth of our cells per caffeine molecule, we are able to estimate the total concentration of caffeine in each of the original caffeinated beverages. This is done by fitting the created equation that converts OD into predicted caffeine concentration. From caffeine concentration and the known dilution of caffeinated beverage added to each of the cultures, we can estimate the caffeine weight per beverage volume. These results are summarized below, and are very close to the values determined by the beverage manufacturers themselves. This serves as further reinforcement that our decaffeination operon works as intended, and even suggests a possible use in measuring the caffeine value of beverages. Note that the cells in 5-Hour Energy appeared to be in exponential growth phase, weakening the strength of the equation's fit to reality.<br />
<br />
<div style="font-size:130%;text-align:center"><br />
{| class="wikitable" style="text-align:center"<br />
|-<br />
! !! Caffeine Content we Calculated (g/L) !! Caffeine Content Manufacturer Calculated (g/L)<br />
|-<br />
| Coca-Cola || 99.1 || 98.6<br />
|-<br />
| Starbucks Espresso|| 44.7 || 39.5<br />
|-<br />
| 5-Hour Energy || 4259.8 || 2333.2<br />
|}<br />
</div><br />
<br />
===Transcriptional Regulators===<br />
As described earlier, we hypothesize that the large intergenic regions upstream of various genes in the CBB5 decaffeination operon, particularly upstream of ndmA, may contain methylxanthine regulated promoters. We propose that orf1 and orf4, which were annotated as putative regulators based on sequence homology, act as repressors for the promoters contained in the operon. <br />
<br />
To test these hypotheses, we cloned the intergentic region upstream of the ndmA gene into a promoterless LacZ reporter plasmid, pRA301. This vector enabled quantitative measurement of promoter strength using the β-galactosidase Miller Assay. Additionally, we created compatible biobrick plasmids of each putative repressor, orf1 and orf4, in order to assay their effect on ndmA promoter strength in the presence or absence of methylxanthine supplementation.<br />
<br />
We transformed these plasmids into the Top10 ''E.coli'' strain to create three strains: one containing only the ndmA-LacZ reporter plasmid, and cotransformants containing both the ndmA-LacZ plasmid and either orf1 or orf4 biobrick plasmids. All three ''E. coli'' strains were grown in M9 minimal media + .2% casein (+ appropriate supplement) at 30<sup>o</sup>C for 48 hrs, after which time Miller assays were performed. The results, summarized in the figure below, provide strong evidence that '''''expression of orf4 leads to inhibited ndmA promoter functionality''''', while orf1 expression provides negligible influence on the ndmA promoter. <br />
<br />
[[File:Austin2012ndmARepression.jpg|center|650px]]<br />
<br />
A higher Miller Unit correlates to a higher level of lacZ production, effectively quantifying the degree of gene expression. As the Miller Unit of the strain co-expressed ndmA promoter with orf4 is lower by a factor of roughly 4, it can be inferred that the protein encoded by orf4 regulates the degree to which the ndmA promoter is expressed during transcription.<br />
<br />
It should be noted that while expression of ndmA drops significantly in this experiment, this does not imply that orf4 only inhibits the expression of ndmA. This is discussed in the next section: Inducible Promoters.<br />
<br />
===Inducible Promoters===<br />
As shown above, it appears that orf4 acts as a transcriptional regulator of ndmA expression. One would expect a transcriptional regulator to regulate transcription in a way that is beneficial to the overall fitness of the organism. In certain situations in which a protein is necessary for survival, the transcriptional factor should up-regulate the production of said gene. Likewise, when a protein is not necessary, the transcriptional factor should down-regulate its production.<br />
<br />
We hypothesize that this is the way in which orf4 regulates transcription of ndmA. In situations of high caffeine and related xanthine concentrations, the protein encoded by orf4 up-regulates the expression of ndmA. In the experiment listed [[Team:Austin_Texas/Caffeinated_coli#Transcriptional_Regulators|above]], in which no xanthine derivative was added to the media, expression from the ndmA promoter is inhibited (as shown).<br />
<br />
In order to test this hypothesis, we subjected a strain of Top10 ''E. coli'' cells containing the orf4 gene and the ndmA promoter containing the lacZ gene to varying supplements of caffeine, theobromine, theophylline, and xanthine. Xanthine was shown to be insoluble at high concentrations, and was therefore removed from the experiment. The results of exposure to varying concentration levels is shown below.<br />
<br />
[[File:UTAustin2012InductionbySubstrate.jpg|center|650px]]<br />
<br />
As predicted, the '''''expression of ndmA appears to rise at higher caffeine concentrations'''''. Similarly, higher concentrations of theobromine and theophylline also appear to increase the expression of ndmA. <br />
<br />
From these experiments we conclude that the ndmA intergenic region contains a promoter that is negatively-regulated by the orf4 protein in the absence of methylxanthines. Upon exposure to methylxanthines, it appears that orf4-mediated repression is relieved, leading to induction.<br />
<br />
===Results Summary===<br />
The main accomplishments we achieved this Summer include the following:<br />
<br />
*Refactoring of decaffeination operon from ''P. putida'' into ''E. coli''<br />
*Construction of a auxotrophic selection method using our refactored operon, "addicting" ''E. coli'' to caffeine<br />
*Growth of auxtrophic cells on common caffeinated beverages<br />
*Discovery of a methyxanthine inducible promoter (ndmA) in the CBB5 operon<br />
*Characterization of an open reading frame (orf4) in the CBB5 operon that acts as a transcription regulator<br />
<br />
==References==<br />
<br />
Summers RM, Louie TM, Yu CL, Gakhar L, Louie KC, Subramanian M, "Novel, highly specific N-demethylases enable bacteria to live on caffeine and related purine alkaloids." Journal of Bacteriology, 2012, vol 194, no 8, pg 2041-2049.<br />
<br />
Rodriguez del Rey Z, Granek EF, Sylvester S, "Occurrence and concentration of caffeine in Oregon coastal waters." Marine Pollution Bulletin, 2012, vol 64, no 8, Pages 1417-1424.<br />
<br />
<html><br />
<div id="footer" /><br />
</html></div>Erik.quandthttp://2012.igem.org/Team:Austin_Texas/Caffeinated_coliTeam:Austin Texas/Caffeinated coli2012-10-03T01:39:40Z<p>Erik.quandt: /* CBB5 Genome sequencing */</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli" class="selected"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
<br />
<br />
= '''<center><div style="font-size:150%">Project: Caffeinated Coli</div>''' =<br />
<br />
[[File:Caffeinated_Bacteria.jpg|375px|center]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Introduction'''</div> ==<br />
<br />
<a href="http://www.geog.ucsb.edu/events/department-news/1072/if-you-thought-fish-were-sleepless-in-seattle-check-out-the-ones-off-the-coast-of-oregon/"><img src="https://static.igem.org/mediawiki/2012/5/58/FishCoffee.png" alt="UT Austin CNS logo" width="150px" height="65px" /></a><br />
<br />
Caffeine is commonly used in foods and beverages such as coffee and chocolate and in pharmaceuticals as a cardiac and respiratory stimulant. As a result of the wide use of caffeine, it has become widely present in human waste and as a pollutant in the environment. Bacteria capable of degrading caffeine have been found naturally and could be used for bioremediation. We seek to port caffeine degradation functionality into ''Escherichia coli'' to produce strains that are better suited to degrade caffeine in an industrial setting. <br />
<br />
''Pseudomonas putida'' CBB5, discovered by Ryan Summers and Mani Subramanian at the University of Iowa, can live on caffeine as the sole carbon and nitrogen source. CBB5 uses a Nitrogen demethylation pathway to convert caffeine to xanthine with formaldehyde side products. The xanthine and formaldehyde are then used as the nitrogen and carbon sources respectively.<br />
<br />
The N-demethylation pathway consists of four demethylation genes: ''ndmA'', ''ndmB'', ''ndmC'', and ''ndmD''. ''ndmA'', ''ndmB'', and ''ndmC'' remove the methyl groups from the N-1, N-3, and N-7 respectively. This is done with the help of a reductase, ''ndmD''.<br />
<br />
[[File:Ndm diagram.JPG|center|650px]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Strategy'''</div> ==<br />
<br />
=== Refactoring Decaffeination Operon ===<br />
<br />
The first goal of this project involves refactoring the caffeine operon from the caffeine utilization pathway from ''Psuedomonas putida'' CBB5, first characterized by Summers et al. in early 2012. The operon, shown below, will be incorporated into the well characterized bacterium, ''Escherichia coli'' [3]. <br />
<br />
[[File:CBB5_Operon.png|center|650px]]<br />
<br />
Directly importing the operon into ''E. coli'' was determined impractical, as the strength and regulation of the ribosome binding sites (rbs) and operon-controlled promoters in the CBB5 operon may not be optimized for function in ''E. coli''. Additionally, the use in CBB5 of GTG start codons conflicts with E. coli’s preference for ATG – leading to problems in translation initiation.<br />
<br />
We therefore decided to separate out open reading frames for the genes of interest in the CBB5 operon and put them under controlled regulation in a refactored caffeine utilization operon for import into ''E. coli''. The operon's design, shown below and submitted as [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 BBa_K734000], aims to optimize its functionality in its new host. <br />
<br />
[[File:Austin_Texas_Decaffeination_design.png|center]]<br />
<br />
This includes the N-demethylase proteins: ''ndmA'', ''ndmB'', ''ndmC'', and the putative assisting protein ''ndmD''. Also included is the glutathione S-transferase from ''Janthinobacterium'' sp. strain Marseille, necessary for functionality of NdmC. Constitutive expression occurs with a strong, well-characterized promoter ([http://partsregistry.org/wiki/index.php/Part:BBa_J23100 BBa_J23100]) and a strong, well-characterized RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]). Finally, all GTG start codons have been replaced with ATG.<br />
<br />
Sources of parts used in our synthetic decaffeination circuit:<br />
<br />
[[File:Austin_Texas_Part_sources.png|center]]<br />
<br />
==== Assembly ====<br />
<br />
Our operon was assembled via a one-step, six-piece Gibson assembly. Briefly, genes to be stitched together were PCR amplified with overhangs homologous to adjacent genes (or homologous to the vector backbone in the case of the 5' end of the promoter and the 3' end of ''gst9''). The forward primers also contained our chosen RBS and ATG. In a one-pot reaction, a 5'-exonuclease chewed back on the homologous overhangs, allowing adjacent fragments to base pair, and a DNA ligase stitched them together. An overview is shown here.<br />
<br />
[[File:Austin_Texas_Decaffeination_assembly.png|center]] <br />
<br />
=== Operon Testing and Optimization ===<br />
<br />
We will employ two different assays for operon functionality; growth on caffeine as a sole carbon source, and a genetic selection for caffeine demethylation to xanthine. To evaluate the ability to use caffeine as a sole carbon source we will transform TOP 10 E.coli electrocompetent cells with the refactored caffeine utilization operon, grow transformed cells in rich media to saturation and then dilute 1:100 into M9 mineral media. Varying levels of caffeine concentrations will be used to determine the degree of caffeine utilization, and the optimal limit for growth.<br />
<br />
Since the cell has an extremely large requirement for carbon, the energy derived from demethylation may not be enough to support growth. For this reason a second assay for caffeine demethylation based on guanine auxotrophy has been devised. ''E. coli'' synthesizes the nucleotide guanine de novo via a pathway that involves Xanthosine-5’-phosphate (XMP) as an essential intermediate. The enzyme responsible for the formation of XMP (from inosine-5’-phosphate[IMP]) is IMP dehydrogenase, which is encoded by the GuaB gene. If GuaB is knocked out, the cell is unable to synthesize guanine and is therefore unable to grow on media lacking guanine. We plan to take advantage of this engineered auxotrophy and use it as a way to select for cells that are able to demethylate caffeine to xanthine which can then be converted to XMP by xanthine-guanine phosphoribotransferase (gpt) and thereby relieve the metabolic block and restore guanine synthesis allowing for cell growth.<br />
<br />
[[File:guaB_selection_1.jpg|center|650px]]<br />
<br />
Finally, after construction and preliminary testing of the caffeine degradation operon in''E. coli'', we will attempt to grow our cells in the presence of various commercial caffeinated beverages.<br />
<br />
=== Characterizing Inducible Promoters ===<br />
<br />
In Summers et al (2012)., the two open reading frames ''orf1'' and ''orf4'' are thought to be putative regulators of the caffeine degradation operon's N-demethylase proteins due to sequence homology to other known protein regulators (AraC and gntR family). They are hypothesized to bind to operator sequences in the intergenic regions between genes in the operon, which may serve as promoters for the various demethylases of the operon. <br />
<br />
Analysis of the sizes of the intergenic regions of the CBB5 caffeine utilization operon shows that the regions upstream of the ndm genes are all greater than 150bp. The large size of these intergenic regions and the fact that they precede the catabolic enzyme gene leads us to hypothesize that there are caffeine (or other methylxanthine) regulatory elements in these sequences.<br />
<br />
We will clone these open reading frames into the reporter plasmid pRA301. pRA301 contains a promoterless lacZ gene, preceded by a multiple cloning site (MCS). DNA fragments hypothesized to contain promoter elements can be cloned into the MCS and assayed for lacZ expression by Miller assay. Using this method, we can determine the regulatory functionality of each open reading frame by examining varying fluorescence levels.<br />
<br />
=== CBB5 Genome sequencing ===<br />
<br />
Since only a partial sequence (13.1kb) of the ''p.putida'' CBB5 decaffeination operon is available (Summers 2012), we are submitting genomic DNA for whole genome sequencing. The genome will be sequenced using Illumina next-gen sequencing by UT [[https://wikis.utexas.edu/display/GSAF/Home+Page GSAF]]. The assembled genome will be deposited to Genbank.<br />
<br />
==<div style="font-size:130%;text-align:center">'''Results</div>==<br />
<br />
===Decaffeination operon (+ gst9) enables growth of GuaB knockout===<br />
<br />
Our initial refactored operon consisted of CBB5 genes NdmA,B,C,D. We found that this operon was able to support growth of the GuaB knockout on theophylline but not caffeine. This indicated that the demethylase responsible for removing the 7-methyl group (NdmC) was not functional. Of note, Summers et. al (2012) also could not detect NdmC activity when expressed in ''e.coli''. We reasoned that there could be a missing protein required for NdmC activity. Summers et al. (2012) showed that an uncharacterized protein (orf8) copurified in protein fractions assayed for NdmC activity. We reasoned that this protein could be essential for NdmC function. Unfortunately, the complete DNA sequence of orf8 was not available, only a partial sequence of the orf was contained in the known operon sequence. A protein homology search was performed using the available sequence to find potential homologs that might be able to substitute function of the missing orf. The search revealed that an uncharacterized gene, gst9, from ''Janthinobacterium marseille'' shared a high degree of sequence homology (70%). We decided to synthesize the gst9 gene from the available sequence and clone it into our decaffeination operon to see if it would enable NdmC activity and allow for complete demethylation of caffeine. We found our hyphothesis to be true, adding gst9 to our refactored operon [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 (Bba_K734000)] did indeed enable growth of the guaB knockout on m9 mineral media:<br />
<br />
<br />
[[File:UtAustin2012DecaffeinationOperon.jpg|center|650px]]<br />
<br />
From this figure, we see that our decaffeination operon enables the GuaB knockout to grow in the absence of guanine or xanthine supplementation by instead demethylating the available caffeine to produce xanthine. This not only confirms the functionality of our refactored decaffeination operon, but proves a method by which we can use it to auxotrophically select for cells.<br />
<br />
To more accurately determine the utilization of caffeine by our operon, we tested the growth of our E. coli cells containing refactored operon and the knocked out GuaB gene under multiple caffeine concentration conditions. We found that our cells were able to grow at conditions as low as 10uM of caffeine, and peaked at a caffeine concentration of approximately 250uM. Concentrations were grown as high as 5000uM, at which point cells began to die, presumably from caffeine toxicity. <br />
<br />
[[File:AustiniGEM2012GrowthCurve.jpg|center|650px]]<br />
<br />
From these growth conditions, we plated dilutions of up to 10<sup>7</sup> dilution. This was used to determine individual cell growth based on caffeine. Approximately 7.6 +/- 0.8 pg of caffeine were utilized per cell. Assuming the use of guanine in E. coli DNA that is roughly 9.2 Mb and 50% GC, approximately 2.3*10<sup>6</sup> guanines derived from caffeine are shown to be utilized per cell in our engineered organisms. As there are roughly 10<sup>11</sup> bases of RNA per E. coli cell, and approximately 25% of these are guanine, there are approximately 2.55*10<sup>10</sup> guanines required for E. coli cell growth. From this calculation, we can include that our cells are scavenging and utilizing approximately all the caffeine present in the system.<br />
<br />
===Growth in Caffeinated Beverages ===<br />
In order to make our experiment more relatable, we experimented with growth of our E. coli strain in various caffeinated beverages. Experiments were first performed on cells with only the GuaB knockout modification, in order to prove that growth in these beverages was even possible. Initial results, shown below, indicate that growth is in fact possible for a wide variety of beverages, including Coca-Cola, 5-Hour Energy, Lipton Tea, and Startbucks Espresso.<br />
<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthInitial.png|center|650px]]<br />
<br />
The graph above shows that the auxotrophic selection of cells using xanthine derivatives again functions as expected – without xanthine, cells were unable to grow under most conditions. The noticeable Optical Densities for 50% Coca-Cola and 50% Espresso are due to the strong background color of the culture and not actual cell growth. 50% 5-Hour Energy and Espresso were both shown to be toxic to our cells. Finally, tea was shown to contain enough natural xanthenes to allow for partial cell growth, and was excluded from further experiments.<br />
<br />
We then attempted to grow our cell strain containing both the GuaB knockout gene and the refactored decaffeination operon. The results of this experiment are shown below.<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthFinal.jpg|center|720px]]<br />
It is important to note that these cells were grown in M9 minimal media containing only 0.2% casein as a natural carbon source. The cells were required to scavenge virtually all of their carbon required for guanine synthesis from the caffeine supplied to the system, or die. Our E. coli was able to utilize the caffeine inherent to Coca-Cola, Starbucks Espresso and 5-Hour Energy, as well as caffeine in caffeine. However, without our refactored decaffeination operon, the cells were unable to grow under any conditions. The two small bars that appear above in 50% Coca-Cola and 10% Espresso are simply due to the high background color of the cultures. It is also worth note that the 10% 5-Hour Energy growth conditions proved marginally toxic to our E. coli cells, as the cells were unable to reach maximum Optical Densities.<br />
<br />
Utilizing the previous experiment in which we calculated the growth of our cells per caffeine molecule, we are able to estimate the total concentration of caffeine in each of the original caffeinated beverages. This is done by fitting the created equation that converts OD into predicted caffeine concentration. From caffeine concentration and the known dilution of caffeinated beverage added to each of the cultures, we can estimate the caffeine weight per beverage volume. These results are summarized below, and are very close to the values determined by the beverage manufacturers themselves. This serves as further reinforcement that our decaffeination operon works as intended, and even suggests a possible use in measuring the caffeine value of beverages. Note that the cells in 5-Hour Energy appeared to be in exponential growth phase, weakening the strength of the equation's fit to reality.<br />
<br />
<div style="font-size:130%;text-align:center"><br />
{| class="wikitable" style="text-align:center"<br />
|-<br />
! !! Caffeine Content we Calculated (mg/L) !! Caffeine Content Manufacturer Calculated (g/L)<br />
|-<br />
| Coca-Cola || 99.1 || 98.6<br />
|-<br />
| Starbucks Espresso|| 44.7 || 39.5<br />
|-<br />
| 5-Hour Energy || 4259.8 || 2333.2<br />
|}<br />
</div><br />
<br />
===Transcriptional Regulators===<br />
As described earlier, we hypothesize that the large intergenic regions upstream of various genes in the CBB5 decaffeination operon, particularly upstream of ndmA, may contain methylxanthine regulated promoters. We propose that orf1 and orf4, which were annotated as putative regulators based on sequence homology, act as repressors for the promoters contained in the operon. <br />
<br />
To test these hypotheses, we cloned the intergentic region upstream of the ndmA gene into a promoterless LacZ reporter plasmid, pRA301. This vector enabled quantitative measurement of promoter strength using the β-galactosidase Miller Assay. Additionally, we created compatible biobrick plasmids of each putative repressor, orf1 and orf4, in order to assay their effect on ndmA promoter strength in the presence or absence of methylxanthine supplementation.<br />
<br />
We transformed these plasmids into the Top10 ''E.coli'' strain to create three strains: one containing only the ndmA-LacZ reporter plasmid, and cotransformants containing both the ndmA-LacZ plasmid and either orf1 or orf4 biobrick plasmids. All three ''E. coli'' strains were grown in M9 minimal media + .2% casein (+ appropriate supplement) at 30<sup>o</sup>C for 48 hrs, after which time Miller assays were performed. The results, summarized in the figure below, provide strong evidence that '''''expression of orf4 leads to inhibited ndmA promoter functionality''''', while orf1 expression provides negligible influence on the ndmA promoter. <br />
<br />
[[File:Austin2012ndmARepression.jpg|center|650px]]<br />
<br />
A higher Miller Unit correlates to a higher level of lacZ production, effectively quantifying the degree of gene expression. As the Miller Unit of the strain co-expressed ndmA promoter with orf4 is lower by a factor of roughly 4, it can be inferred that the protein encoded by orf4 regulates the degree to which the ndmA promoter is expressed during transcription.<br />
<br />
It should be noted that while expression of ndmA drops significantly in this experiment, this does not imply that orf4 only inhibits the expression of ndmA. This is discussed in the next section: Inducible Promoters.<br />
<br />
===Inducible Promoters===<br />
As shown above, it appears that orf4 acts as a transcriptional regulator of ndmA expression. One would expect a transcriptional regulator to regulate transcription in a way that is beneficial to the overall fitness of the organism. In certain situations in which a protein is necessary for survival, the transcriptional factor should up-regulate the production of said gene. Likewise, when a protein is not necessary, the transcriptional factor should down-regulate its production.<br />
<br />
We hypothesize that this is the way in which orf4 regulates transcription of ndmA. In situations of high caffeine and related xanthine concentrations, the protein encoded by orf4 up-regulates the expression of ndmA. In the experiment listed [[Team:Austin_Texas/Caffeinated_coli#Transcriptional_Regulators|above]], in which no xanthine derivative was added to the media, expression from the ndmA promoter is inhibited (as shown).<br />
<br />
In order to test this hypothesis, we subjected a strain of Top10 ''E. coli'' cells containing the orf4 gene and the ndmA promoter containing the lacZ gene to varying supplements of caffeine, theobromine, theophylline, and xanthine. Xanthine was shown to be insoluble at high concentrations, and was therefore removed from the experiment. The results of exposure to varying concentration levels is shown below.<br />
<br />
[[File:UTAustin2012InductionbySubstrate.jpg|center|650px]]<br />
<br />
As predicted, the '''''expression of ndmA appears to rise at higher caffeine concentrations'''''. Similarly, higher concentrations of theobromine and theophylline also appear to increase the expression of ndmA. <br />
<br />
From these experiments we conclude that the ndmA intergenic region contains a promoter that is negatively-regulated by the orf4 protein in the absence of methylxanthines. Upon exposure to methylxanthines, it appears that orf4-mediated repression is relieved, leading to induction.<br />
<br />
===Results Summary===<br />
The main accomplishments we achieved this Summer include the following:<br />
<br />
*Refactoring of decaffeination operon from ''P. putida'' into ''E. coli''<br />
*Construction of a auxotrophic selection method using our refactored operon, "addicting" ''E. coli'' to caffeine<br />
*Growth of auxtrophic cells on common caffeinated beverages<br />
*Discovery of a methyxanthine inducible promoter (ndmA) in the CBB5 operon<br />
*Characterization of an open reading frame (orf4) in the CBB5 operon that acts as a transcription regulator<br />
<br />
==References==<br />
<br />
Summers RM, Louie TM, Yu CL, Gakhar L, Louie KC, Subramanian M, "Novel, highly specific N-demethylases enable bacteria to live on caffeine and related purine alkaloids." Journal of Bacteriology, 2012, vol 194, no 8, pg 2041-2049.<br />
<br />
Rodriguez del Rey Z, Granek EF, Sylvester S, "Occurrence and concentration of caffeine in Oregon coastal waters." Marine Pollution Bulletin, 2012, vol 64, no 8, Pages 1417-1424.<br />
<br />
<html><br />
<div id="footer" /><br />
</html></div>Erik.quandthttp://2012.igem.org/Team:Austin_Texas/Caffeinated_coliTeam:Austin Texas/Caffeinated coli2012-10-03T01:38:40Z<p>Erik.quandt: uwe</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli" class="selected"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
<br />
<br />
= '''<center><div style="font-size:150%">Project: Caffeinated Coli</div>''' =<br />
<br />
[[File:Caffeinated_Bacteria.jpg|375px|center]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Introduction'''</div> ==<br />
<br />
<a href="http://www.geog.ucsb.edu/events/department-news/1072/if-you-thought-fish-were-sleepless-in-seattle-check-out-the-ones-off-the-coast-of-oregon/"><img src="https://static.igem.org/mediawiki/2012/5/58/FishCoffee.png" alt="UT Austin CNS logo" width="150px" height="65px" /></a><br />
<br />
Caffeine is commonly used in foods and beverages such as coffee and chocolate and in pharmaceuticals as a cardiac and respiratory stimulant. As a result of the wide use of caffeine, it has become widely present in human waste and as a pollutant in the environment. Bacteria capable of degrading caffeine have been found naturally and could be used for bioremediation. We seek to port caffeine degradation functionality into ''Escherichia coli'' to produce strains that are better suited to degrade caffeine in an industrial setting. <br />
<br />
''Pseudomonas putida'' CBB5, discovered by Ryan Summers and Mani Subramanian at the University of Iowa, can live on caffeine as the sole carbon and nitrogen source. CBB5 uses a Nitrogen demethylation pathway to convert caffeine to xanthine with formaldehyde side products. The xanthine and formaldehyde are then used as the nitrogen and carbon sources respectively.<br />
<br />
The N-demethylation pathway consists of four demethylation genes: ''ndmA'', ''ndmB'', ''ndmC'', and ''ndmD''. ''ndmA'', ''ndmB'', and ''ndmC'' remove the methyl groups from the N-1, N-3, and N-7 respectively. This is done with the help of a reductase, ''ndmD''.<br />
<br />
[[File:Ndm diagram.JPG|center|650px]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Strategy'''</div> ==<br />
<br />
=== Refactoring Decaffeination Operon ===<br />
<br />
The first goal of this project involves refactoring the caffeine operon from the caffeine utilization pathway from ''Psuedomonas putida'' CBB5, first characterized by Summers et al. in early 2012. The operon, shown below, will be incorporated into the well characterized bacterium, ''Escherichia coli'' [3]. <br />
<br />
[[File:CBB5_Operon.png|center|650px]]<br />
<br />
Directly importing the operon into ''E. coli'' was determined impractical, as the strength and regulation of the ribosome binding sites (rbs) and operon-controlled promoters in the CBB5 operon may not be optimized for function in ''E. coli''. Additionally, the use in CBB5 of GTG start codons conflicts with E. coli’s preference for ATG – leading to problems in translation initiation.<br />
<br />
We therefore decided to separate out open reading frames for the genes of interest in the CBB5 operon and put them under controlled regulation in a refactored caffeine utilization operon for import into ''E. coli''. The operon's design, shown below and submitted as [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 BBa_K734000], aims to optimize its functionality in its new host. <br />
<br />
[[File:Austin_Texas_Decaffeination_design.png|center]]<br />
<br />
This includes the N-demethylase proteins: ''ndmA'', ''ndmB'', ''ndmC'', and the putative assisting protein ''ndmD''. Also included is the glutathione S-transferase from ''Janthinobacterium'' sp. strain Marseille, necessary for functionality of NdmC. Constitutive expression occurs with a strong, well-characterized promoter ([http://partsregistry.org/wiki/index.php/Part:BBa_J23100 BBa_J23100]) and a strong, well-characterized RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]). Finally, all GTG start codons have been replaced with ATG.<br />
<br />
Sources of parts used in our synthetic decaffeination circuit:<br />
<br />
[[File:Austin_Texas_Part_sources.png|center]]<br />
<br />
==== Assembly ====<br />
<br />
Our operon was assembled via a one-step, six-piece Gibson assembly. Briefly, genes to be stitched together were PCR amplified with overhangs homologous to adjacent genes (or homologous to the vector backbone in the case of the 5' end of the promoter and the 3' end of ''gst9''). The forward primers also contained our chosen RBS and ATG. In a one-pot reaction, a 5'-exonuclease chewed back on the homologous overhangs, allowing adjacent fragments to base pair, and a DNA ligase stitched them together. An overview is shown here.<br />
<br />
[[File:Austin_Texas_Decaffeination_assembly.png|center]] <br />
<br />
=== Operon Testing and Optimization ===<br />
<br />
We will employ two different assays for operon functionality; growth on caffeine as a sole carbon source, and a genetic selection for caffeine demethylation to xanthine. To evaluate the ability to use caffeine as a sole carbon source we will transform TOP 10 E.coli electrocompetent cells with the refactored caffeine utilization operon, grow transformed cells in rich media to saturation and then dilute 1:100 into M9 mineral media. Varying levels of caffeine concentrations will be used to determine the degree of caffeine utilization, and the optimal limit for growth.<br />
<br />
Since the cell has an extremely large requirement for carbon, the energy derived from demethylation may not be enough to support growth. For this reason a second assay for caffeine demethylation based on guanine auxotrophy has been devised. ''E. coli'' synthesizes the nucleotide guanine de novo via a pathway that involves Xanthosine-5’-phosphate (XMP) as an essential intermediate. The enzyme responsible for the formation of XMP (from inosine-5’-phosphate[IMP]) is IMP dehydrogenase, which is encoded by the GuaB gene. If GuaB is knocked out, the cell is unable to synthesize guanine and is therefore unable to grow on media lacking guanine. We plan to take advantage of this engineered auxotrophy and use it as a way to select for cells that are able to demethylate caffeine to xanthine which can then be converted to XMP by xanthine-guanine phosphoribotransferase (gpt) and thereby relieve the metabolic block and restore guanine synthesis allowing for cell growth.<br />
<br />
[[File:guaB_selection_1.jpg|center|650px]]<br />
<br />
Finally, after construction and preliminary testing of the caffeine degradation operon in''E. coli'', we will attempt to grow our cells in the presence of various commercial caffeinated beverages.<br />
<br />
=== Characterizing Inducible Promoters ===<br />
<br />
In Summers et al (2012)., the two open reading frames ''orf1'' and ''orf4'' are thought to be putative regulators of the caffeine degradation operon's N-demethylase proteins due to sequence homology to other known protein regulators (AraC and gntR family). They are hypothesized to bind to operator sequences in the intergenic regions between genes in the operon, which may serve as promoters for the various demethylases of the operon. <br />
<br />
Analysis of the sizes of the intergenic regions of the CBB5 caffeine utilization operon shows that the regions upstream of the ndm genes are all greater than 150bp. The large size of these intergenic regions and the fact that they precede the catabolic enzyme gene leads us to hypothesize that there are caffeine (or other methylxanthine) regulatory elements in these sequences.<br />
<br />
We will clone these open reading frames into the reporter plasmid pRA301. pRA301 contains a promoterless lacZ gene, preceded by a multiple cloning site (MCS). DNA fragments hypothesized to contain promoter elements can be cloned into the MCS and assayed for lacZ expression by Miller assay. Using this method, we can determine the regulatory functionality of each open reading frame by examining varying fluorescence levels.<br />
<br />
=== CBB5 Genome sequencing ===<br />
<br />
Since only a partial sequence (13.1kb)of the ''p.putida'' CBB5 decaffeination operon is available (Summers 2012), we are submitting genomic DNA for whole genome sequencing. The genome will be sequenced using Illumina next-gen sequencing by UT [[https://wikis.utexas.edu/display/GSAF/Home+Page GSAF]]. The assembled genome will be deposited to Genbank. <br />
<br />
==<div style="font-size:130%;text-align:center">'''Results</div>==<br />
<br />
===Decaffeination operon (+ gst9) enables growth of GuaB knockout===<br />
<br />
Our initial refactored operon consisted of CBB5 genes NdmA,B,C,D. We found that this operon was able to support growth of the GuaB knockout on theophylline but not caffeine. This indicated that the demethylase responsible for removing the 7-methyl group (NdmC) was not functional. Of note, Summers et. al (2012) also could not detect NdmC activity when expressed in ''e.coli''. We reasoned that there could be a missing protein required for NdmC activity. Summers et al. (2012) showed that an uncharacterized protein (orf8) copurified in protein fractions assayed for NdmC activity. We reasoned that this protein could be essential for NdmC function. Unfortunately, the complete DNA sequence of orf8 was not available, only a partial sequence of the orf was contained in the known operon sequence. A protein homology search was performed using the available sequence to find potential homologs that might be able to substitute function of the missing orf. The search revealed that an uncharacterized gene, gst9, from ''Janthinobacterium marseille'' shared a high degree of sequence homology (70%). We decided to synthesize the gst9 gene from the available sequence and clone it into our decaffeination operon to see if it would enable NdmC activity and allow for complete demethylation of caffeine. We found our hyphothesis to be true, adding gst9 to our refactored operon [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 (Bba_K734000)] did indeed enable growth of the guaB knockout on m9 mineral media:<br />
<br />
<br />
[[File:UtAustin2012DecaffeinationOperon.jpg|center|650px]]<br />
<br />
From this figure, we see that our decaffeination operon enables the GuaB knockout to grow in the absence of guanine or xanthine supplementation by instead demethylating the available caffeine to produce xanthine. This not only confirms the functionality of our refactored decaffeination operon, but proves a method by which we can use it to auxotrophically select for cells.<br />
<br />
To more accurately determine the utilization of caffeine by our operon, we tested the growth of our E. coli cells containing refactored operon and the knocked out GuaB gene under multiple caffeine concentration conditions. We found that our cells were able to grow at conditions as low as 10uM of caffeine, and peaked at a caffeine concentration of approximately 250uM. Concentrations were grown as high as 5000uM, at which point cells began to die, presumably from caffeine toxicity. <br />
<br />
[[File:AustiniGEM2012GrowthCurve.jpg|center|650px]]<br />
<br />
From these growth conditions, we plated dilutions of up to 10<sup>7</sup> dilution. This was used to determine individual cell growth based on caffeine. Approximately 7.6 +/- 0.8 pg of caffeine were utilized per cell. Assuming the use of guanine in E. coli DNA that is roughly 9.2 Mb and 50% GC, approximately 2.3*10<sup>6</sup> guanines derived from caffeine are shown to be utilized per cell in our engineered organisms. As there are roughly 10<sup>11</sup> bases of RNA per E. coli cell, and approximately 25% of these are guanine, there are approximately 2.55*10<sup>10</sup> guanines required for E. coli cell growth. From this calculation, we can include that our cells are scavenging and utilizing approximately all the caffeine present in the system.<br />
<br />
===Growth in Caffeinated Beverages ===<br />
In order to make our experiment more relatable, we experimented with growth of our E. coli strain in various caffeinated beverages. Experiments were first performed on cells with only the GuaB knockout modification, in order to prove that growth in these beverages was even possible. Initial results, shown below, indicate that growth is in fact possible for a wide variety of beverages, including Coca-Cola, 5-Hour Energy, Lipton Tea, and Startbucks Espresso.<br />
<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthInitial.png|center|650px]]<br />
<br />
The graph above shows that the auxotrophic selection of cells using xanthine derivatives again functions as expected – without xanthine, cells were unable to grow under most conditions. The noticeable Optical Densities for 50% Coca-Cola and 50% Espresso are due to the strong background color of the culture and not actual cell growth. 50% 5-Hour Energy and Espresso were both shown to be toxic to our cells. Finally, tea was shown to contain enough natural xanthenes to allow for partial cell growth, and was excluded from further experiments.<br />
<br />
We then attempted to grow our cell strain containing both the GuaB knockout gene and the refactored decaffeination operon. The results of this experiment are shown below.<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthFinal.jpg|center|720px]]<br />
It is important to note that these cells were grown in M9 minimal media containing only 0.2% casein as a natural carbon source. The cells were required to scavenge virtually all of their carbon required for guanine synthesis from the caffeine supplied to the system, or die. Our E. coli was able to utilize the caffeine inherent to Coca-Cola, Starbucks Espresso and 5-Hour Energy, as well as caffeine in caffeine. However, without our refactored decaffeination operon, the cells were unable to grow under any conditions. The two small bars that appear above in 50% Coca-Cola and 10% Espresso are simply due to the high background color of the cultures. It is also worth note that the 10% 5-Hour Energy growth conditions proved marginally toxic to our E. coli cells, as the cells were unable to reach maximum Optical Densities.<br />
<br />
Utilizing the previous experiment in which we calculated the growth of our cells per caffeine molecule, we are able to estimate the total concentration of caffeine in each of the original caffeinated beverages. This is done by fitting the created equation that converts OD into predicted caffeine concentration. From caffeine concentration and the known dilution of caffeinated beverage added to each of the cultures, we can estimate the caffeine weight per beverage volume. These results are summarized below, and are very close to the values determined by the beverage manufacturers themselves. This serves as further reinforcement that our decaffeination operon works as intended, and even suggests a possible use in measuring the caffeine value of beverages. Note that the cells in 5-Hour Energy appeared to be in exponential growth phase, weakening the strength of the equation's fit to reality.<br />
<br />
<div style="font-size:130%;text-align:center"><br />
{| class="wikitable" style="text-align:center"<br />
|-<br />
! !! Caffeine Content we Calculated (mg/L) !! Caffeine Content Manufacturer Calculated (g/L)<br />
|-<br />
| Coca-Cola || 99.1 || 98.6<br />
|-<br />
| Starbucks Espresso|| 44.7 || 39.5<br />
|-<br />
| 5-Hour Energy || 4259.8 || 2333.2<br />
|}<br />
</div><br />
<br />
===Transcriptional Regulators===<br />
As described earlier, we hypothesize that the large intergenic regions upstream of various genes in the CBB5 decaffeination operon, particularly upstream of ndmA, may contain methylxanthine regulated promoters. We propose that orf1 and orf4, which were annotated as putative regulators based on sequence homology, act as repressors for the promoters contained in the operon. <br />
<br />
To test these hypotheses, we cloned the intergentic region upstream of the ndmA gene into a promoterless LacZ reporter plasmid, pRA301. This vector enabled quantitative measurement of promoter strength using the β-galactosidase Miller Assay. Additionally, we created compatible biobrick plasmids of each putative repressor, orf1 and orf4, in order to assay their effect on ndmA promoter strength in the presence or absence of methylxanthine supplementation.<br />
<br />
We transformed these plasmids into the Top10 ''E.coli'' strain to create three strains: one containing only the ndmA-LacZ reporter plasmid, and cotransformants containing both the ndmA-LacZ plasmid and either orf1 or orf4 biobrick plasmids. All three ''E. coli'' strains were grown in M9 minimal media + .2% casein (+ appropriate supplement) at 30<sup>o</sup>C for 48 hrs, after which time Miller assays were performed. The results, summarized in the figure below, provide strong evidence that '''''expression of orf4 leads to inhibited ndmA promoter functionality''''', while orf1 expression provides negligible influence on the ndmA promoter. <br />
<br />
[[File:Austin2012ndmARepression.jpg|center|650px]]<br />
<br />
A higher Miller Unit correlates to a higher level of lacZ production, effectively quantifying the degree of gene expression. As the Miller Unit of the strain co-expressed ndmA promoter with orf4 is lower by a factor of roughly 4, it can be inferred that the protein encoded by orf4 regulates the degree to which the ndmA promoter is expressed during transcription.<br />
<br />
It should be noted that while expression of ndmA drops significantly in this experiment, this does not imply that orf4 only inhibits the expression of ndmA. This is discussed in the next section: Inducible Promoters.<br />
<br />
===Inducible Promoters===<br />
As shown above, it appears that orf4 acts as a transcriptional regulator of ndmA expression. One would expect a transcriptional regulator to regulate transcription in a way that is beneficial to the overall fitness of the organism. In certain situations in which a protein is necessary for survival, the transcriptional factor should up-regulate the production of said gene. Likewise, when a protein is not necessary, the transcriptional factor should down-regulate its production.<br />
<br />
We hypothesize that this is the way in which orf4 regulates transcription of ndmA. In situations of high caffeine and related xanthine concentrations, the protein encoded by orf4 up-regulates the expression of ndmA. In the experiment listed [[Team:Austin_Texas/Caffeinated_coli#Transcriptional_Regulators|above]], in which no xanthine derivative was added to the media, expression from the ndmA promoter is inhibited (as shown).<br />
<br />
In order to test this hypothesis, we subjected a strain of Top10 ''E. coli'' cells containing the orf4 gene and the ndmA promoter containing the lacZ gene to varying supplements of caffeine, theobromine, theophylline, and xanthine. Xanthine was shown to be insoluble at high concentrations, and was therefore removed from the experiment. The results of exposure to varying concentration levels is shown below.<br />
<br />
[[File:UTAustin2012InductionbySubstrate.jpg|center|650px]]<br />
<br />
As predicted, the '''''expression of ndmA appears to rise at higher caffeine concentrations'''''. Similarly, higher concentrations of theobromine and theophylline also appear to increase the expression of ndmA. <br />
<br />
From these experiments we conclude that the ndmA intergenic region contains a promoter that is negatively-regulated by the orf4 protein in the absence of methylxanthines. Upon exposure to methylxanthines, it appears that orf4-mediated repression is relieved, leading to induction.<br />
<br />
===Results Summary===<br />
The main accomplishments we achieved this Summer include the following:<br />
<br />
*Refactoring of decaffeination operon from ''P. putida'' into ''E. coli''<br />
*Construction of a auxotrophic selection method using our refactored operon, "addicting" ''E. coli'' to caffeine<br />
*Growth of auxtrophic cells on common caffeinated beverages<br />
*Discovery of a methyxanthine inducible promoter (ndmA) in the CBB5 operon<br />
*Characterization of an open reading frame (orf4) in the CBB5 operon that acts as a transcription regulator<br />
<br />
==References==<br />
<br />
Summers RM, Louie TM, Yu CL, Gakhar L, Louie KC, Subramanian M, "Novel, highly specific N-demethylases enable bacteria to live on caffeine and related purine alkaloids." Journal of Bacteriology, 2012, vol 194, no 8, pg 2041-2049.<br />
<br />
Rodriguez del Rey Z, Granek EF, Sylvester S, "Occurrence and concentration of caffeine in Oregon coastal waters." Marine Pollution Bulletin, 2012, vol 64, no 8, Pages 1417-1424.<br />
<br />
<html><br />
<div id="footer" /><br />
</html></div>Erik.quandthttp://2012.igem.org/Team:Austin_Texas/Caffeinated_coliTeam:Austin Texas/Caffeinated coli2012-10-03T00:51:52Z<p>Erik.quandt: /* Introduction */</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli" class="selected"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
<br />
<br />
= '''<center><div style="font-size:150%">Project: Caffeinated Coli</div>''' =<br />
<br />
<br />
[[File:Caffeinated_Bacteria.jpg|center|650px]]<br />
<br />
<br />
<br />
== <div style="font-size:130%;text-align:center">'''Introduction'''</div> ==<br />
<br />
Caffeine is commonly used in foods and beverages such as coffee and chocolate and in pharmaceuticals as a cardiac and respiratory stimulant. As a result of the wide use of caffeine, it has become widely present in human waste and as a pollutant in the environment. Bacteria capable of degrading caffeine have been found naturally and could be used for bioremediation. We seek to port caffeine degradation functionality into ''Escherichia coli'' to produce strains that are better suited to degrade caffeine in an industrial setting. <br />
<br />
''Pseudomonas putida'' CBB5, discovered by Ryan Summers and Mani Subramanian at the University of Iowa can live on caffeine as the sole carbon and nitrogen source. CBB5 uses a Nitrogen demethylation pathway to convert caffeine to xanthine with formaldehyde side products. The xanthine and formaldehyde are then used as the nitrogen and carbon sources respectively.<br />
<br />
The N-demethylation pathway consists of four demethylation genes, ndmA, ndmB, ndmC, and ndmD. ndmA, B, and C remove the methyl groups from the N-1, N-3, and N-7 respectively. This is done with the help of a reductase, ndmD.<br />
<br />
[[File:Ndm diagram.JPG|center|650px]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Strategy'''</div> ==<br />
<br />
=== Refactoring Decaffeination Operon ===<br />
<br />
The first goal of this project involves refactoring the caffeine operon from the caffeine utilization pathway from ''Psuedomonas putida'' CBB5, first characterized by Summers et al. in early 2012. The operon, shown below, will be incorporated into the well characterized bacterium, ''Escherichia coli'' [3]. <br />
<br />
[[File:CBB5_Operon.png|center|650px]]<br />
<br />
Directly importing the operon into ''E. coli'' was determined impractical, as the strength and regulation of the ribosome binding sites (rbs) and operon-controlled promoters in the CBB5 operon may not be optimized for function in ''E. coli''. Additionally, the use in CBB5 of GTG start codons conflicts with E. coli’s preference for ATG – leading to problems in translation initiation.<br />
<br />
We therefore decided to separate out open reading frames for the genes of interest in the CBB5 operon and put them under controlled regulation in a refactored caffeine utilization operon for import into ''E. coli''. The operon's design, shown below and submitted as [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 BBa_K734000], aims to optimize its functionality in its new host. <br />
<br />
[[File:Austin_Texas_Decaffeination_design.png|center]]<br />
<br />
This includes the N-demethylase proteins: ''ndmA'', ''ndmB'', ''ndmC'', and the putative assisting protein ''ndmD''. Also included is the glutathione S-transferase from ''Janthinobacterium'' sp. strain Marseille, necessary for functionality of NdmC. Constitutive expression occurs with a strong, well-characterized promoter ([http://partsregistry.org/wiki/index.php/Part:BBa_J23100 BBa_J23100]) and a strong, well-characterized RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]). Finally, all GTG start codons have been replaced with ATG.<br />
<br />
Sources of parts used in our synthetic decaffeination circuit:<br />
<br />
[[File:Austin_Texas_Part_sources.png|center]]<br />
<br />
==== Assembly ====<br />
<br />
Our operon was assembled via a one-step, six-piece Gibson assembly. Briefly, genes to be stitched together were PCR amplified with overhangs homologous to adjacent genes (or homologous to the vector backbone in the case of the 5' end of the promoter and the 3' end of ''gst9''). The forward primers also contained our chosen RBS and ATG. In a one-pot reaction, a 5'-exonuclease chewed back on the homologous overhangs, allowing adjacent fragments to base pair, and a DNA ligase stitched them together. An overview is shown here.<br />
<br />
[[File:Austin_Texas_Decaffeination_assembly.png|center]] <br />
<br />
=== Operon Testing and Optimization ===<br />
<br />
We will employ two different assays for operon functionality; growth on caffeine as a sole carbon source, and a genetic selection for caffeine demethylation to xanthine. To evaluate the ability to use caffeine as a sole carbon source we will transform TOP 10 E.coli electrocompetent cells with the refactored caffeine utilization operon, grow transformed cells in rich media to saturation and then dilute 1:100 into M9 mineral media. Varying levels of caffeine concentrations will be used to determine the degree of caffeine utilization, and the optimal limit for growth.<br />
<br />
Since the cell has an extremely large requirement for carbon, the energy derived from demethylation may not be enough to support growth. For this reason a second assay for caffeine demethylation based on guanine auxotrophy has been devised. ''E. coli'' synthesizes the nucleotide guanine de novo via a pathway that involves Xanthosine-5’-phosphate (XMP) as an essential intermediate. The enzyme responsible for the formation of XMP (from inosine-5’-phosphate[IMP]) is IMP dehydrogenase, which is encoded by the GuaB gene. If GuaB is knocked out, the cell is unable to synthesize guanine and is therefore unable to grow on media lacking guanine. We plan to take advantage of this engineered auxotrophy and use it as a way to select for cells that are able to demethylate caffeine to xanthine which can then be converted to XMP by xanthine-guanine phosphoribotransferase (gpt) and thereby relieve the metabolic block and restore guanine synthesis allowing for cell growth.<br />
<br />
[[File:guaB_selection_1.jpg|center|650px]]<br />
<br />
Finally, after construction and preliminary testing of the caffeine degradation operon in''E. coli'', we will attempt to grow our cells in the presence of various commercial caffeinated beverages.<br />
<br />
=== Characterizing Inducible Promoters ===<br />
<br />
In Summers et al (2012)., the two open reading frames ''orf1'' and ''orf4'' are thought to be putative regulators of the caffeine degradation operon's N-demethylase proteins due to sequence homology to other known protein regulators (AraC and gntR family). They are hypothesized to bind to operator sequences in the intergenic regions between genes in the operon, which may serve as promoters for the various demethylases of the operon. <br />
<br />
Analysis of the sizes of the intergenic regions of the CBB5 caffeine utilization operon shows that the regions upstream of the ndm genes are all greater than 150bp. The large size of these intergenic regions and the fact that they precede the catabolic enzyme gene leads us to hypothesize that there are caffeine (or other methylxanthine) regulatory elements in these sequences.<br />
<br />
We will clone these open reading frames into the reporter plasmid pRA301. pRA301 contains a promoterless lacZ gene, preceded by a multiple cloning site (MCS). DNA fragments hypothesized to contain promoter elements can be cloned into the MCS and assayed for lacZ expression by Miller assay. Using this method, we can determine the regulatory functionality of each open reading frame by examining varying fluorescence levels.<br />
<br />
==<div style="font-size:130%;text-align:center">'''Results</div>==<br />
<br />
===Decaffeination operon (+ gst9) enables growth of GuaB knockout===<br />
<br />
Our initial refactored operon consisted of CBB5 genes NdmA,B,C,D. We found that this operon was able to support growth of the GuaB knockout on theophylline but not caffeine. This indicated that the demethylase responsible for removing the 7-methyl group (NdmC) was not functional. Of note, Summers et. al (2012) also could not detect NdmC activity when expressed in ''e.coli''. We reasoned that there could be a missing protein required for NdmC activity. Summers et al. (2012) showed that an uncharacterized protein (orf8) copurified in protein fractions assayed for NdmC activity. We reasoned that this protein could be essential for NdmC function. Unfortunately, the complete DNA sequence of orf8 was not available, only a partial sequence of the orf was contained in the known operon sequence. A protein homology search was performed using the available sequence to find potential homologs that might be able to substitute function of the missing orf. The search revealed that an uncharacterized gene, gst9, from ''Janthinobacterium marseille'' shared a high degree of sequence homology (70%). We decided to synthesize the gst9 gene from the available sequence and clone it into our decaffeination operon to see if it would enable NdmC activity and allow for complete demethylation of caffeine. We found our hyphothesis to be true, adding gst9 to our refactored operon [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 (Bba_K734000)] did indeed enable growth of the guaB knockout on m9 mineral media:<br />
<br />
<br />
[[File:UtAustin2012DecaffeinationOperon.jpg|center|650px]]<br />
<br />
From this figure, we see that our decaffeination operon enables the GuaB knockout to grow in the absence of guanine or xanthine supplementation by instead demethylating the available caffeine to produce xanthine. This not only confirms the functionality of our refactored decaffeination operon, but proves a method by which we can use it to auxotrophically select for cells.<br />
<br />
To more accurately determine the utilization of caffeine by our operon, we tested the growth of our E. coli cells containing refactored operon and the knocked out GuaB gene under multiple caffeine concentration conditions. We found that our cells were able to grow at conditions as low as 10uM of caffeine, and peaked at a caffeine concentration of approximately 250uM. Concentrations were grown as high as 5000uM, at which point cells began to die, presumably from caffeine toxicity. <br />
<br />
[[File:AustiniGEM2012GrowthCurve.jpg|center|650px]]<br />
<br />
From these growth conditions, we plated dilutions of up to 10<sup>7</sup> dilution. This was used to determine individual cell growth based on caffeine. Approximately 7.6 +/- 0.8 pg of caffeine were utilized per cell. Assuming the use of guanine in E. coli DNA that is roughly 9.2 Mb and 50% GC, approximately 2.3*10<sup>6</sup> guanines derived from caffeine are shown to be utilized per cell in our engineered organisms. As there are roughly 10<sup>11</sup> bases of RNA per E. coli cell, and approximately 25% of these are guanine, there are approximately 2.55*10<sup>10</sup> guanines required for E. coli cell growth. From this calculation, we can include that our cells are scavenging and utilizing approximately all the caffeine present in the system.<br />
<br />
===Growth in Caffeinated Beverages ===<br />
In order to make our experiment more relatable, we experimented with growth of our E. coli strain in various caffeinated beverages. Experiments were first performed on cells with only the GuaB knockout modification, in order to prove that growth in these beverages was even possible. Initial results, shown below, indicate that growth is in fact possible for a wide variety of beverages, including Coca-Cola, 5-Hour Energy, Lipton Tea, and Startbucks Espresso.<br />
<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthInitial.png|center|650px]]<br />
<br />
The graph above shows that the auxotrophic selection of cells using xanthine derivatives again functions as expected – without xanthine, cells were unable to grow under most conditions. The noticeable Optical Densities for 50% Coca-Cola and 50% Espresso are due to the strong background color of the culture and not actual cell growth. 50% 5-Hour Energy and Espresso were both shown to be toxic to our cells. Finally, tea was shown to contain enough natural xanthenes to allow for partial cell growth, and was excluded from further experiments.<br />
<br />
We then attempted to grow our cell strain containing both the GuaB knockout gene and the refactored decaffeination operon. The results of this experiment are shown below.<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthFinal.jpg|center|720px]]<br />
It is important to note that these cells were grown in M9 minimal media containing only 0.2% casein as a natural carbon source. The cells were required to scavenge virtually all of their carbon required for guanine synthesis from the caffeine supplied to the system, or die. Our E. coli was able to utilize the caffeine inherent to Coca-Cola, Starbucks Espresso and 5-Hour Energy, as well as caffeine in caffeine. However, without our refactored decaffeination operon, the cells were unable to grow under any conditions. The two small bars that appear above in 50% Coca-Cola and 10% Espresso are simply due to the high background color of the cultures. It is also worth note that the 10% 5-Hour Energy growth conditions proved marginally toxic to our E. coli cells, as the cells were unable to reach maximum Optical Densities.<br />
<br />
Utilizing the previous experiment in which we calculated the growth of our cells per caffeine molecule, we are able to estimate the total concentration of caffeine in each of the original caffeinated beverages. These results are summarized below, and are very close to the values determined by the beverage manufacturers themselves. This serves as further reinforcement that our decaffeination operon works as intended. Note that due to the toxic effect of 10% 5-Hour Energy, the value we estimate for it is much lower than that provided by the manufacturer.<br />
<br />
<div style="font-size:130%;text-align:center"><br />
{| class="wikitable" style="text-align:center"<br />
|-<br />
! !! Caffeine Content we Calculated (g/L) !! Caffeine Content Manufacturer Calculated (g/L)<br />
|-<br />
| Coca-Cola || 0.11 || 0.10<br />
|-<br />
| Starbucks Espresso|| 0.30 || 0.39<br />
|-<br />
| 5-Hour Energy || 0.41*Low due to cell death || 2.33<br />
|}<br />
</div><br />
<br />
===Transcriptional Regulators===<br />
As described earlier, we hypothesize that the large intergenic regions upstream of various genes in the CBB5 decaffeination operon, particularly upstream of ndmA, may contain methylxanthine regulated promoters. We propose that orf1 and orf4, which were annotated as putative regulators based on sequence homology, act as repressors for the promoters contained in the operon. <br />
<br />
To test these hypotheses, we cloned the intergentic region upstream of the ndmA gene into a promoterless LacZ reporter plasmid, pRA301. This vector enabled quantitative measurement of promoter strength using the β-galactosidase Miller Assay. Additionally, we created compatible biobrick plasmids of each putative repressor, orf1 and orf4, in order to assay their effect on ndmA promoter strength in the presence or absence of methylxanthine supplementation.<br />
<br />
We transformed these plasmids into the Top10 ''E.coli'' strain to create three strains: one containing only the ndmA-LacZ reporter plasmid, and cotransformants containing both the ndmA-LacZ plasmid and either orf1 or orf4 biobrick plasmids. All three ''E. coli'' strains were grown in M9 minimal media + .2% casein (+ appropriate supplement) at 30<sup>o</sup>C for 48 hrs, after which time Miller assays were performed. The results, summarized in the figure below, provide strong evidence that '''''expression of orf4 leads to inhibited ndmA promoter functionality''''', while orf1 expression provides negligible influence on the ndmA promoter. <br />
<br />
[[File:Austin2012ndmARepression.jpg|center|650px]]<br />
<br />
A higher Miller Unit correlates to a higher level of lacZ production, effectively quantifying the degree of gene expression. As the Miller Unit of the strain co-expressed ndmA promoter with orf4 is lower by a factor of roughly 4, it can be inferred that the protein encoded by orf4 regulates the degree to which the ndmA promoter is expressed during transcription.<br />
<br />
It should be noted that while expression of ndmA drops significantly in this experiment, this does not imply that orf4 only inhibits the expression of ndmA. This is discussed in the next section: Inducible Promoters.<br />
<br />
===Inducible Promoters===<br />
As shown above, it appears that orf4 acts as a transcriptional regulator of ndmA expression. One would expect a transcriptional regulator to regulate transcription in a way that is beneficial to the overall fitness of the organism. In certain situations in which a protein is necessary for survival, the transcriptional factor should up-regulate the production of said gene. Likewise, when a protein is not necessary, the transcriptional factor should down-regulate its production.<br />
<br />
We hypothesize that this is the way in which orf4 regulates transcription of ndmA. In situations of high caffeine and related xanthine concentrations, the protein encoded by orf4 up-regulates the expression of ndmA. In the experiment listed [[Team:Austin_Texas/Caffeinated_coli#Transcriptional_Regulators|above]], in which no xanthine derivative was added to the media, expression from the ndmA promoter is inhibited (as shown).<br />
<br />
In order to test this hypothesis, we subjected a strain of Top10 ''E. coli'' cells containing the orf4 gene and the ndmA promoter containing the lacZ gene to varying supplements of caffeine, theobromine, theophylline, and xanthine. Xanthine was shown to be insoluble at high concentrations, and was therefore removed from the experiment. The results of exposure to varying concentration levels is shown below.<br />
<br />
[[File:UTAustin2012InductionbySubstrate.jpg|center|650px]]<br />
<br />
As predicted, the '''''expression of ndmA appears to rise at higher caffeine concentrations'''''. Similarly, higher concentrations of theobromine and theophylline also appear to increase the expression of ndmA. <br />
<br />
From these experiments we conclude that the ndmA intergenic region contains a promoter that is negatively-regulated by the orf4 protein in the absence of methylxanthines. Upon exposure to methylxanthines, it appears that orf4-mediated repression is relieved, leading to induction.<br />
<br />
===Results Summary===<br />
The main accomplishments we achieved this Summer include the following:<br />
<br />
*Refactoring of decaffeination operon from ''P. putida'' into ''E. coli''<br />
*Construction of a auxotrophic selection method using our refactored operon, "addicting" ''E. coli'' to caffeine<br />
*Growth of auxtrophic cells on common caffeinated beverages<br />
*Discovery of a methyxanthine inducible promoter (ndmA) in the CBB5 operon<br />
*Characterization of an open reading frame (orf4) in the CBB5 operon that acts as a transcription regulator<br />
<br />
==References==<br />
<br />
#Summers RM, Louie TM, Yu CL, Gakhar L, Louie KC, Subramanian M, "Novel, highly specific N-demethylases enable bacteria to live on caffeine and related purine alkaloids." Journal of Bacteriology, 2012, vol 194, no 8, pg 2041-2049.<br />
<br />
<html><br />
<div id="footer" /><br />
</html></div>Erik.quandthttp://2012.igem.org/Team:Austin_Texas/Caffeinated_coliTeam:Austin Texas/Caffeinated coli2012-10-03T00:45:00Z<p>Erik.quandt: /* Introduction */</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli" class="selected"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
<br />
<br />
= '''<center><div style="font-size:150%">Project: Caffeinated Coli</div>''' =<br />
<br />
<br />
[[File:Caffeinated_Bacteria.jpg|center|650px]]<br />
<br />
<br />
<br />
== <div style="font-size:130%;text-align:center">'''Introduction'''</div> ==<br />
<br />
Caffeine is commonly used in foods and beverages such as coffee and chocolate and in pharmaceuticals as a cardiac and respiratory stimulant. As a result of the wide use of caffeine, it has become widely present in human waste and as a pollutant in the environment. Bacteria capable of degrading caffeine have been found naturally and could be used for bioremediation.<br />
<br />
''Pseudomonas putida'' CBB5, discovered by Ryan Summers and Mani Subramanian at the University of Iowa can live on caffeine as the sole carbon and nitrogen source. CBB5 uses a Nitrogen demethylation pathway to convert caffeine to xanthine with formaldehyde side products. The xanthine and formaldehyde are then used as the nitrogen and carbon sources respectively.<br />
<br />
The N-demethylation pathway consists of four demethylation genes, ndmA, ndmB, ndmC, and ndmD. ndmA, B, and C remove the methyl groups from the N-1, N-3, and N-7 respectively. This is done with the help of a reductase, ndmD.<br />
<br />
[[File:Ndm diagram.JPG|center|650px]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Strategy'''</div> ==<br />
<br />
=== Refactoring Decaffeination Operon ===<br />
<br />
The first goal of this project involves refactoring the caffeine operon from the caffeine utilization pathway from ''Psuedomonas putida'' CBB5, first characterized by Summers et al. in early 2012. The operon, shown below, will be incorporated into the well characterized bacterium, ''Escherichia coli'' [3]. <br />
<br />
[[File:CBB5_Operon.png|center|650px]]<br />
<br />
Directly importing the operon into ''E. coli'' was determined impractical, as the strength and regulation of the ribosome binding sites (rbs) and operon-controlled promoters in the CBB5 operon may not be optimized for function in ''E. coli''. Additionally, the use in CBB5 of GTG start codons conflicts with E. coli’s preference for ATG – leading to problems in translation initiation.<br />
<br />
We therefore decided to separate out open reading frames for the genes of interest in the CBB5 operon and put them under controlled regulation in a refactored caffeine utilization operon for import into ''E. coli''. The operon's design, shown below and submitted as [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 BBa_K734000], aims to optimize its functionality in its new host. <br />
<br />
[[File:Austin_Texas_Decaffeination_design.png|center]]<br />
<br />
This includes the N-demethylase proteins: ''ndmA'', ''ndmB'', ''ndmC'', and the putative assisting protein ''ndmD''. Also included is the glutathione S-transferase from ''Janthinobacterium'' sp. strain Marseille, necessary for functionality of NdmC. Constitutive expression occurs with a strong, well-characterized promoter ([http://partsregistry.org/wiki/index.php/Part:BBa_J23100 BBa_J23100]) and a strong, well-characterized RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]). Finally, all GTG start codons have been replaced with ATG.<br />
<br />
Sources of parts used in our synthetic decaffeination circuit:<br />
<br />
[[File:Austin_Texas_Part_sources.png|center]]<br />
<br />
==== Assembly ====<br />
<br />
Our operon was assembled via a one-step, six-piece Gibson assembly. Briefly, genes to be stitched together were PCR amplified with overhangs homologous to adjacent genes (or homologous to the vector backbone in the case of the 5' end of the promoter and the 3' end of ''gst9''). The forward primers also contained our chosen RBS and ATG. In a one-pot reaction, a 5'-exonuclease chewed back on the homologous overhangs, allowing adjacent fragments to base pair, and a DNA ligase stitched them together. An overview is shown here.<br />
<br />
[[File:Austin_Texas_Decaffeination_assembly.png|center]] <br />
<br />
=== Operon Testing and Optimization ===<br />
<br />
We will employ two different assays for operon functionality; growth on caffeine as a sole carbon source, and a genetic selection for caffeine demethylation to xanthine. To evaluate the ability to use caffeine as a sole carbon source we will transform TOP 10 E.coli electrocompetent cells with the refactored caffeine utilization operon, grow transformed cells in rich media to saturation and then dilute 1:100 into M9 mineral media. Varying levels of caffeine concentrations will be used to determine the degree of caffeine utilization, and the optimal limit for growth.<br />
<br />
Since the cell has an extremely large requirement for carbon, the energy derived from demethylation may not be enough to support growth. For this reason a second assay for caffeine demethylation based on guanine auxotrophy has been devised. ''E. coli'' synthesizes the nucleotide guanine de novo via a pathway that involves Xanthosine-5’-phosphate (XMP) as an essential intermediate. The enzyme responsible for the formation of XMP (from inosine-5’-phosphate[IMP]) is IMP dehydrogenase, which is encoded by the GuaB gene. If GuaB is knocked out, the cell is unable to synthesize guanine and is therefore unable to grow on media lacking guanine. We plan to take advantage of this engineered auxotrophy and use it as a way to select for cells that are able to demethylate caffeine to xanthine which can then be converted to XMP by xanthine-guanine phosphoribotransferase (gpt) and thereby relieve the metabolic block and restore guanine synthesis allowing for cell growth.<br />
<br />
[[File:guaB_selection_1.jpg|center|650px]]<br />
<br />
Finally, after construction and preliminary testing of the caffeine degradation operon in''E. coli'', we will attempt to grow our cells in the presence of various commercial caffeinated beverages.<br />
<br />
=== Characterizing Inducible Promoters ===<br />
<br />
In Summers et al (2012)., the two open reading frames ''orf1'' and ''orf4'' are thought to be putative regulators of the caffeine degradation operon's N-demethylase proteins due to sequence homology to other known protein regulators (AraC and gntR family). They are hypothesized to bind to operator sequences in the intergenic regions between genes in the operon, which may serve as promoters for the various demethylases of the operon. <br />
<br />
Analysis of the sizes of the intergenic regions of the CBB5 caffeine utilization operon shows that the regions upstream of the ndm genes are all greater than 150bp. The large size of these intergenic regions and the fact that they precede the catabolic enzyme gene leads us to hypothesize that there are caffeine (or other methylxanthine) regulatory elements in these sequences.<br />
<br />
We will clone these open reading frames into the reporter plasmid pRA301. pRA301 contains a promoterless lacZ gene, preceded by a multiple cloning site (MCS). DNA fragments hypothesized to contain promoter elements can be cloned into the MCS and assayed for lacZ expression by Miller assay. Using this method, we can determine the regulatory functionality of each open reading frame by examining varying fluorescence levels.<br />
<br />
==<div style="font-size:130%;text-align:center">'''Results</div>==<br />
<br />
===Decaffeination operon (+ gst9) enables growth of GuaB knockout===<br />
<br />
Our initial refactored operon consisted of CBB5 genes NdmA,B,C,D. We found that this operon was able to support growth of the GuaB knockout on theophylline but not caffeine. This indicated that the demethylase responsible for removing the 7-methyl group (NdmC) was not functional. Of note, Summers et. al (2012) also could not detect NdmC activity when expressed in ''e.coli''. We reasoned that there could be a missing protein required for NdmC activity. Summers et al. (2012) showed that an uncharacterized protein (orf8) copurified in protein fractions assayed for NdmC activity. We reasoned that this protein could be essential for NdmC function. Unfortunately, the complete DNA sequence of orf8 was not available, only a partial sequence of the orf was contained in the known operon sequence. A protein homology search was performed using the available sequence to find potential homologs that might be able to substitute function of the missing orf. The search revealed that an uncharacterized gene, gst9, from ''Janthinobacterium marseille'' shared a high degree of sequence homology (70%). We decided to synthesize the gst9 gene from the available sequence and clone it into our decaffeination operon to see if it would enable NdmC activity and allow for complete demethylation of caffeine. We found our hyphothesis to be true, adding gst9 to our refactored operon [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 (Bba_K734000)] did indeed enable growth of the guaB knockout on m9 mineral media:<br />
<br />
<br />
[[File:UtAustin2012DecaffeinationOperon.jpg|center|650px]]<br />
<br />
From this figure, we see that our decaffeination operon enables the GuaB knockout to grow in the absence of guanine or xanthine supplementation by instead demethylating the available caffeine to produce xanthine. This not only confirms the functionality of our refactored decaffeination operon, but proves a method by which we can use it to auxotrophically select for cells.<br />
<br />
To more accurately determine the utilization of caffeine by our operon, we tested the growth of our E. coli cells containing refactored operon and the knocked out GuaB gene under multiple caffeine concentration conditions. We found that our cells were able to grow at conditions as low as 10uM of caffeine, and peaked at a caffeine concentration of approximately 250uM. Concentrations were grown as high as 5000uM, at which point cells began to die, presumably from caffeine toxicity. <br />
<br />
[[File:AustiniGEM2012GrowthCurve.jpg|center|650px]]<br />
<br />
From these growth conditions, we plated dilutions of up to 10<sup>7</sup> dilution. This was used to determine individual cell growth based on caffeine. Approximately 7.6 +/- 0.8 pg of caffeine were utilized per cell. Assuming the use of guanine in E. coli DNA that is roughly 9.2 Mb and 50% GC, approximately 2.3*10<sup>6</sup> guanines derived from caffeine are shown to be utilized per cell in our engineered organisms. As there are roughly 10<sup>11</sup> bases of RNA per E. coli cell, and approximately 25% of these are guanine, there are approximately 2.55*10<sup>10</sup> guanines required for E. coli cell growth. From this calculation, we can include that our cells are scavenging and utilizing approximately all the caffeine present in the system.<br />
<br />
===Growth in Caffeinated Beverages ===<br />
In order to make our experiment more relatable, we experimented with growth of our E. coli strain in various caffeinated beverages. Experiments were first performed on cells with only the GuaB knockout modification, in order to prove that growth in these beverages was even possible. Initial results, shown below, indicate that growth is in fact possible for a wide variety of beverages, including Coca-Cola, 5-Hour Energy, Lipton Tea, and Startbucks Espresso.<br />
<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthInitial.png|center|650px]]<br />
<br />
The graph above shows that the auxotrophic selection of cells using xanthine derivatives again functions as expected – without xanthine, cells were unable to grow under most conditions. The noticeable Optical Densities for 50% Coca-Cola and 50% Espresso are due to the strong background color of the culture and not actual cell growth. 50% 5-Hour Energy and Espresso were both shown to be toxic to our cells. Finally, tea was shown to contain enough natural xanthenes to allow for partial cell growth, and was excluded from further experiments.<br />
<br />
We then attempted to grow our cell strain containing both the GuaB knockout gene and the refactored decaffeination operon. The results of this experiment are shown below.<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthFinal.jpg|center|720px]]<br />
It is important to note that these cells were grown in M9 minimal media containing only 0.2% casein as a natural carbon source. The cells were required to scavenge virtually all of their carbon required for guanine synthesis from the caffeine supplied to the system, or die. Our E. coli was able to utilize the caffeine inherent to Coca-Cola, Starbucks Espresso and 5-Hour Energy, as well as caffeine in caffeine. However, without our refactored decaffeination operon, the cells were unable to grow under any conditions. The two small bars that appear above in 50% Coca-Cola and 10% Espresso are simply due to the high background color of the cultures. It is also worth note that the 10% 5-Hour Energy growth conditions proved marginally toxic to our E. coli cells, as the cells were unable to reach maximum Optical Densities.<br />
<br />
Utilizing the previous experiment in which we calculated the growth of our cells per caffeine molecule, we are able to estimate the total concentration of caffeine in each of the original caffeinated beverages. These results are summarized below, and are very close to the values determined by the beverage manufacturers themselves. This serves as further reinforcement that our decaffeination operon works as intended. Note that due to the toxic effect of 10% 5-Hour Energy, the value we estimate for it is much lower than that provided by the manufacturer.<br />
<br />
<div style="font-size:130%;text-align:center"><br />
{| class="wikitable" style="text-align:center"<br />
|-<br />
! !! Caffeine Content we Calculated (g/L) !! Caffeine Content Manufacturer Calculated (g/L)<br />
|-<br />
| Coca-Cola || 0.11 || 0.10<br />
|-<br />
| Starbucks Espresso|| 0.30 || 0.39<br />
|-<br />
| 5-Hour Energy || 0.41*Low due to cell death || 2.33<br />
|}<br />
</div><br />
<br />
===Transcriptional Regulators===<br />
As described earlier, we hypothesize that the large intergenic regions upstream of various genes in the CBB5 decaffeination operon, particularly upstream of ndmA, may contain methylxanthine regulated promoters. We propose that orf1 and orf4, which were annotated as putative regulators based on sequence homology, act as repressors for the promoters contained in the operon. <br />
<br />
To test these hypotheses, we cloned the intergentic region upstream of the ndmA gene into a promoterless LacZ reporter plasmid, pRA301. This vector enabled quantitative measurement of promoter strength using the β-galactosidase Miller Assay. Additionally, we created compatible biobrick plasmids of each putative repressor, orf1 and orf4, in order to assay their effect on ndmA promoter strength in the presence or absence of methylxanthine supplementation.<br />
<br />
We transformed these plasmids into the Top10 ''E.coli'' strain to create three strains: one containing only the ndmA-LacZ reporter plasmid, and cotransformants containing both the ndmA-LacZ plasmid and either orf1 or orf4 biobrick plasmids. All three ''E. coli'' strains were grown in M9 minimal media + .2% casein (+ appropriate supplement) at 30<sup>o</sup>C for 48 hrs, after which time Miller assays were performed. The results, summarized in the figure below, provide strong evidence that '''''expression of orf4 leads to inhibited ndmA promoter functionality''''', while orf1 expression provides negligible influence on the ndmA promoter. <br />
<br />
[[File:Austin2012ndmARepression.jpg|center|650px]]<br />
<br />
A higher Miller Unit correlates to a higher level of lacZ production, effectively quantifying the degree of gene expression. As the Miller Unit of the strain co-expressed ndmA promoter with orf4 is lower by a factor of roughly 4, it can be inferred that the protein encoded by orf4 regulates the degree to which the ndmA promoter is expressed during transcription.<br />
<br />
It should be noted that while expression of ndmA drops significantly in this experiment, this does not imply that orf4 only inhibits the expression of ndmA. This is discussed in the next section: Inducible Promoters.<br />
<br />
===Inducible Promoters===<br />
As shown above, it appears that orf4 acts as a transcriptional regulator of ndmA expression. One would expect a transcriptional regulator to regulate transcription in a way that is beneficial to the overall fitness of the organism. In certain situations in which a protein is necessary for survival, the transcriptional factor should up-regulate the production of said gene. Likewise, when a protein is not necessary, the transcriptional factor should down-regulate its production.<br />
<br />
We hypothesize that this is the way in which orf4 regulates transcription of ndmA. In situations of high caffeine and related xanthine concentrations, the protein encoded by orf4 up-regulates the expression of ndmA. In the experiment listed [[Team:Austin_Texas/Caffeinated_coli#Transcriptional_Regulators|above]], in which no xanthine derivative was added to the media, expression from the ndmA promoter is inhibited (as shown).<br />
<br />
In order to test this hypothesis, we subjected a strain of Top10 ''E. coli'' cells containing the orf4 gene and the ndmA promoter containing the lacZ gene to varying supplements of caffeine, theobromine, theophylline, and xanthine. Xanthine was shown to be insoluble at high concentrations, and was therefore removed from the experiment. The results of exposure to varying concentration levels is shown below.<br />
<br />
[[File:UTAustin2012InductionbySubstrate.jpg|center|650px]]<br />
<br />
As predicted, the '''''expression of ndmA appears to rise at higher caffeine concentrations'''''. Similarly, higher concentrations of theobromine and theophylline also appear to increase the expression of ndmA. <br />
<br />
From these experiments we conclude that the ndmA intergenic region contains a promoter that is negatively-regulated by the orf4 protein in the absence of methylxanthines. Upon exposure to methylxanthines, it appears that orf4-mediated repression is relieved, leading to induction.<br />
<br />
===Results Summary===<br />
The main accomplishments we achieved this Summer include the following:<br />
<br />
*Refactoring of decaffeination operon from ''P. putida'' into ''E. coli''<br />
*Construction of a auxotrophic selection method using our refactored operon, "addicting" ''E. coli'' to caffeine<br />
*Growth of auxtrophic cells on common caffeinated beverages<br />
*Discovery of a methyxanthine inducible promoter (ndmA) in the CBB5 operon<br />
*Characterization of an open reading frame (orf4) in the CBB5 operon that acts as a transcription regulator<br />
<br />
==References==<br />
<br />
#Summers RM, Louie TM, Yu CL, Gakhar L, Louie KC, Subramanian M, "Novel, highly specific N-demethylases enable bacteria to live on caffeine and related purine alkaloids." Journal of Bacteriology, 2012, vol 194, no 8, pg 2041-2049.<br />
<br />
<html><br />
<div id="footer" /><br />
</html></div>Erik.quandthttp://2012.igem.org/Team:Austin_TexasTeam:Austin Texas2012-10-03T00:42:17Z<p>Erik.quandt: /* Project Caffeinated coli */</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" class="selected" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
[[File:CokeGrowth.png|360px|left]]<br />
[[File:DietCokeGrowth.png|355px|right]]<br />
[[File:UTAustinTower.jpg|159px|center]]<br />
<br />
<br />
== Project Caffeinated coli ==<br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/d/d1/Caffeinated_Coli.jpeg"; alt="Caffeinated Coli"; width="170px"; height="250px"; style="float:left; padding:3px; clear:right;"/></html><br />
<br />
<br />
<br />
The widespread use of caffeine (1,3,7–trimethylxanthine) and other methylxanthines in beverages and pharmaceuticals has led to significant environmental pollution. We have developed a novel detection and bioremediation strategy for caffeine contamination by refactoring the methylxanthine degradation operon native to ''Pseudomonas putida'' CBB5. ''Escherichia coli'' cells with this synthetic operon degrade caffeine by N-demethylation to the guanine precursor, xanthine. Cells deficient in guanine biosynthesis and containing our refactored operon were addicted to caffeine; their growth density was limited by the availability of caffeine. Remarkably, they were able to sense the caffeine content of several common beverages. Characterization of nearby genes in the ''P. putida'' operon revealed a potential methylxanthine regulatory system for use in biological circuit design. The synthetic N-demethylation operon could be useful for cheaply producing pharmaceuticals or precursor molecules and for detoxifying waste so that it can be recycled into animal feed and biofuels. <br />
<br />
<br /><br /><br /><br /><br /><br />
<br />
== Project ZombiE.coli ==<br />
<br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/a/a9/Austin_Texas_logo.png"; alt="ZombiE.coli"; width="170px"; height="250px"; style="float:left; padding:3px; clear:right;"/></html><br />
<br />
<br />
<br />
UT’s ZombiE.coli aims to a develop a tightly regulated genetic switch that is triggered by bacterial quorum signaling and leads to feed-forward propagation of the genetic output in the form of red or green fluorescence as well as amplification of quorum signaling. The switch relies on simple one-way Cre/loxP recombination combined with native quorum signaling to provide us with a system that models transmissible disease spread between populations. We have likened this to an airborne zombie epidemic, in which a an “infected” zombie cell is capable of restructuring the genes of a normal cell, turning it into a flesh-hungry counterpart. This system will be useful not only as a simple disease outbreak model for intermediate-level biology education, but also, could provide new insights to how bacterial populations communicate in three dimensions and under different genetic backgrounds. <br />
<br />
<br /><br /><br /><br /><br /><br />
== Project Spinach-mCherry Dual Reporter ==<br />
<br />
In an effort to improve both efficiency, ease, and quality of promoter and RBS strength meaurements, we focused on developing a dual fluorescence reporter for simultaneous monitoring both transcription and translation. To measure both processes separately, two fluorescent reporters, the Spinach aptamer and mCherry red fluorescent protein, were assembled into a single construct. The Spinach-mCherry dual reporter is a unique concept; Spinach is a short RNA aptamer that binds to its ligand, DFHBI, and allows it to emit green fluorescence similar to GFP. This gives insight into the direct production of the mCherry-encoding mRNA without the need to wait for protein folding and maturation of the fluorophore. This technique attempted to expand upon current efforts to measure promoter strength relative to a reference standard used by the iGEM community.<br />
<br />
<html><br />
<br /><br /><br /><br /><br /><br />
<center><br />
<a href="http://www.geneious.com/"><img src="https://static.igem.org/mediawiki/2012/d/db/Geneious.png" alt="Geneious logo" width="150px" height="62px" /></a><br />
<a href="http://www.neb.com"><img src="https://static.igem.org/mediawiki/2012/d/d6/Austin_Texas_NEB_logo.jpeg" alt="NEB logo" width="150px" height="58px" /></a><br />
<a href="http://www.epochlifescience.com"><img src="https://static.igem.org/mediawiki/2012/c/c6/Austin_Texas_Epoch_logo.jpg" alt="Epoch logo" width="150px" height="65px" /></a><br />
<a href="http://cssb.utexas.edu"><img src="https://static.igem.org/mediawiki/2012/4/43/UT_Austin_CSSB.jpg" alt="UT Austin CSSB logo" width="150px" height="65px" /></a><br />
<a href="http://cns.utexas.edu"><img src="https://static.igem.org/mediawiki/2012/e/ec/UT_Austin_CNS.png" alt="UT Austin CNS logo" width="150px" height="65px" /></a><br />
<br />
</center><br />
<br />
<div id="footer" /><br />
</html><br />
<br />
<!-- this is commented out<br />
<br />
{|align="justify"<br />
|You can write a background of your team here. Give us a background of your team, the members, etc. Or tell us more about something of your choosing.<br />
|<br />
|-<br />
|<br />
''Tell us more about your project. Give us background. Use this as the abstract of your project. Be descriptive but concise (1-2 paragraphs)''<br />
|[[Image:Austin_Texas_team.png|right|frame|Your team picture]]<br />
|-<br />
|<br />
|<br />
|}<br />
<br />
--></div>Erik.quandthttp://2012.igem.org/Team:Austin_Texas/Spinach_reporterTeam:Austin Texas/Spinach reporter2012-10-03T00:18:49Z<p>Erik.quandt: /* Project 3: Spinach+mCherry Dual florescence Reporter */</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" class="selected" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
<br />
==Project 3: Spinach+mCherry Dual flourescence Reporter==<br />
===Background===<br />
In an effort to improve both efficiency, ease, and quality of promoter and RBS strength measurements, we focused on developing a dual fluorescence reporter for simultaneous monitoring both transcription and translation. To measure both processes separately, two fluorescent reporters, the Spinach aptamer and mCherry red fluorescent protein, were assembled into a single construct. The Spinach-mCherry dual reporter is a unique concept; Spinach is a short RNA aptamer that binds to its ligand, DFHBI, and allows it to emit green fluorescence similar to GFP. This gives insight into the direct production of the mCherry-encoding mRNA without the need to wait for protein folding and maturation of the fluorophore. This technique attempted to expand upon current efforts to measure promoter strength relative to a reference standard used by the iGEM community.<br />
<br />
===Design===<br />
The reporter was designed in two ways: constructs with the mCherry gene 5' of the spinach aptamer, and with the mCherry gene 3' of the spinach aptamer. The construct was assembled in a pET plasmid, with the spinach aptamer containing a small, stabilzing tRNA scaffold on both sides of aptamer. (original Spinach pET plasmid was obtained from Xi Chen of the Ellington Lab, UT Austin) The plasmid containing mCherry, pAAV-miniCMV-mCherry was obtained from Addgene (Addgene plasmid 27970, Church lab Harvard University.) Through the use of gibson assembly, the the mCherry fluorescent protein gene was inserted into the spinach pET plasmid, at both 5' and 3' locations of the spinach aptamer. '''Include image of constructs''' Little troubleshooting was needed as the gibson worked quite well. However, many errors were encountered when using various fluorescent plate readers, often wasting whole trials due to machine detection error. (more detail?) The promoter that would be tested for Spinach fluorescence was the T7 Promoter: TAATACGACTCACTATAGGGT, resembles closely Bba_J64997 constitutive T7 promoter. (Should I reference this or make my own part page for this promoter?)<br />
<br />
===Results===<br />
====Protocol====<br />
The protocol for using the dual fluorescent reporter was performed as follows:<br />
*Grow culture of construct (both 5' and 3') overnight in BL21 AI or BL21 DE3 (BL21 contains gene coding for T7 RNAP under control of LacUV5)<br />
*Dilute on the following day and grow until mid-log phase<br />
*Induce BL21 cells (DE3 or AI) with either 1mM IPTG, and 1mM IPTG and 0.2% arabinose, respectively.<br />
*Add 200uL aliquots of construct and control cells in a 96-well plate<br />
*The fluorphore for spinach fluorescence, DFHBI, was added either into the well plate if performing a dilution series, or directly into the culture of cells<br />
*Dilution series of DFHBI, revealed 100-200uM DFHBI being the ideal concentration in culture for max RFU values and minimal cell death<br />
*Analyze graphs of Spinach Fluorescence (RFU/ABS) vs Time<br />
<br />
<br />
====Data====<br />
<br />
Graphs of Spinach fluorescence vs time (calculated by (RFUt/OD600t - RFUc/OD600t) vs time)<br />
-Show the 5', 3' construct graphs<br />
<br />
[[File:Optiminal Fluorescence.png|center|800px|]]<br />
<br />
=Issues with results=<br />
After considerable time using the Spinach+mCherry dual fluorescence reporter it became clear that mCherry was not developing in the plate reader during fluorescence experiments, but this was not immediately obvious. Originally, the plate reader being used for this project was showing no fluorescence change in either the wavelengths of spinach or mcherry (Spinach- ex: 469nm em: 501nm, mCherry- ex:587 em: 610nm), the assumption was made that the construct was not performing as intended. It wasn't until trying multiple other flurescence plate readers that we stumbled upon a Tecan F200 plate reader in the Zhang lab (UT Austin) that was able to detect the spinach fluorescence. Once the plate reader issue had been realized, it became obvious that the mCherry fluorescent protein was not able to develop fully during the plate reader experiments. This can likely be contributed to the low oxygen conditions that existed in the machine during fluorescence trials, as well other issues, including the demanding qualities of the construct itself. (Should I mention that we got mCherry fluorescence under blue light but not in a plate reader?)<br />
<br />
Given the difficulty with quantifying the translational strength due to poor mCherry signal, it was decided that focus would be put on characterizing the Spinach aptamer + stabilizing tRNA scaffold by itself.<br />
<br />
'''Spa+tRNA Graphs with varying levels of DFHBI.'''<br />
<br />
Note: the graphs I have to add include the 5' and 3' constructs as well SpA by itself. I'll include these, any other images besides the constructs themselves need to be added? Perhaps something relating to protocol?<br />
<br />
<html><br />
<div id="footer" /><br />
</html></div>Erik.quandthttp://2012.igem.org/Team:Austin_Texas/Caffeinated_coliTeam:Austin Texas/Caffeinated coli2012-10-03T00:11:55Z<p>Erik.quandt: /* Inducible Promoters */</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli" class="selected"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
<br />
<br />
= '''<center><div style="font-size:150%">Project: Caffeinated Coli</div>''' =<br />
<br />
<br />
[[File:Caffeinated_Bacteria.jpg|center|650px]]<br />
<br />
<br />
<br />
== <div style="font-size:130%;text-align:center">'''Introduction'''</div> ==<br />
<br />
Caffeine is commonly used in foods and beverages such as coffee and chocolate and in pharmaceuticals as a cardiac and respiratory stimulant. As a result of the wide use of caffeine, it has become widely present in human waste and as a pollutant in the environment. Bacteria capable of degrading caffeine have been found naturally and could be used for bioremediation of the environment from caffeine. <br />
<br />
''Pseudomonas putida'' CBB5, discovered by Ryan Summers and Mani Subramanian at the University of Iowa can live on caffeine as the sole carbon and nitrogen source. CBB5 uses a Nitrogen demethylation pathway to convert caffeine to xanthine with formaldehyde side products. The xanthine and formaldehyde are then used as the nitrogen and carbon sources respectively.<br />
<br />
The N-demethylation pathway consists of four demethylation genes, ndmA, ndmB, ndmC, and ndmD. ndmA, B, and C remove the methyl groups from the N-1, N-3, and N-7 respectively. This is done with the help of a reductase, ndmD.<br />
<br />
[[File:Ndm diagram.JPG|center|650px]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Strategy'''</div> ==<br />
<br />
=== Refactoring Decaffeination Operon ===<br />
<br />
The first goal of this project involves refactoring the caffeine operon from the caffeine utilization pathway from ''Psuedomonas putida'' CBB5, first characterized by Summers et al. in early 2012. The operon, shown below, will be incorporated into the well characterized bacterium, ''Escherichia coli'' [3]. <br />
<br />
[[File:CBB5_Operon.png|center|650px]]<br />
<br />
Directly importing the operon into ''E. coli'' was determined impractical, as the strength and regulation of the ribosome binding sites (rbs) and operon-controlled promoters in the CBB5 operon may not be optimized for function in ''E. coli''. Additionally, the use in CBB5 of GTG start codons conflicts with E. coli’s preference for ATG – leading to problems in translation initiation.<br />
<br />
We therefore decided to separate out open reading frames for the genes of interest in the CBB5 operon and put them under controlled regulation in a refactored caffeine utilization operon for import into ''E. coli''. The operon's design, shown below and submitted as [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 BBa_K734000], aims to optimize its functionality in its new host. <br />
<br />
[[File:Austin_Texas_Decaffeination_design.png|center]]<br />
<br />
This includes the N-demethylase proteins: ''ndmA'', ''ndmB'', ''ndmC'', and the putative assisting protein ''ndmD''. Also included is the glutathione S-transferase from ''Janthinobacterium'' sp. strain Marseille, necessary for functionality of NdmC. Constitutive expression occurs with a strong, well-characterized promoter ([http://partsregistry.org/wiki/index.php/Part:BBa_J23100 BBa_J23100]) and a strong, well-characterized RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]). Finally, all GTG start codons have been replaced with ATG.<br />
<br />
Sources of parts used in our synthetic decaffeination circuit:<br />
<br />
[[File:Austin_Texas_Part_sources.png|center]]<br />
<br />
==== Assembly ====<br />
<br />
Our operon was assembled via a one-step, six-piece Gibson assembly. Briefly, genes to be stitched together were PCR amplified with overhangs homologous to adjacent genes (or homologous to the vector backbone in the case of the 5' end of the promoter and the 3' end of ''gst9''). The forward primers also contained our chosen RBS and ATG. In a one-pot reaction, a 5'-exonuclease chewed back on the homologous overhangs, allowing adjacent fragments to base pair, and a DNA ligase stitched them together. An overview is shown here.<br />
<br />
[[File:Austin_Texas_Decaffeination_assembly.png|center]] <br />
<br />
=== Operon Testing and Optimization ===<br />
<br />
We will employ two different assays for operon functionality; growth on caffeine as a sole carbon source, and a genetic selection for caffeine demethylation to xanthine. To evaluate the ability to use caffeine as a sole carbon source we will transform TOP 10 E.coli electrocompetent cells with the refactored caffeine utilization operon, grow transformed cells in rich media to saturation and then dilute 1:100 into M9 mineral media. Varying levels of caffeine concentrations will be used to determine the degree of caffeine utilization, and the optimal limit for growth.<br />
<br />
Since the cell has an extremely large requirement for carbon, the energy derived from demethylation may not be enough to support growth. For this reason a second assay for caffeine demethylation based on guanine auxotrophy has been devised. ''E. coli'' synthesizes the nucleotide guanine de novo via a pathway that involves Xanthosine-5’-phosphate (XMP) as an essential intermediate. The enzyme responsible for the formation of XMP (from inosine-5’-phosphate[IMP]) is IMP dehydrogenase, which is encoded by the GuaB gene. If GuaB is knocked out, the cell is unable to synthesize guanine and is therefore unable to grow on media lacking guanine. We plan to take advantage of this engineered auxotrophy and use it as a way to select for cells that are able to demethylate caffeine to xanthine which can then be converted to XMP by xanthine-guanine phosphoribotransferase (gpt) and thereby relieve the metabolic block and restore guanine synthesis allowing for cell growth.<br />
<br />
[[File:guaB_selection_1.jpg|center|650px]]<br />
<br />
Finally, after construction and preliminary testing of the caffeine degradation operon in''E. coli'', we will attempt to grow our cells in the presence of various commercial caffeinated beverages.<br />
<br />
=== Characterizing Inducible Promoters ===<br />
<br />
In Summers et al (2012)., the two open reading frames ''orf1'' and ''orf4'' are thought to be putative regulators of the caffeine degradation operon's N-demethylase proteins due to sequence homology to other known protein regulators (AraC and gntR family). They are hypothesized to bind to operator sequences in the intergenic regions between genes in the operon, which may serve as promoters for the various demethylases of the operon. <br />
<br />
Analysis of the sizes of the intergenic regions of the CBB5 caffeine utilization operon shows that the regions upstream of the ndm genes are all greater than 150bp. The large size of these intergenic regions and the fact that they precede the catabolic enzyme gene leads us to hypothesize that there are caffeine (or other methylxanthine) regulatory elements in these sequences.<br />
<br />
We will clone these open reading frames into the reporter plasmid pRA301. pRA301 contains a promoterless lacZ gene, preceded by a multiple cloning site (MCS). DNA fragments hypothesized to contain promoter elements can be cloned into the MCS and assayed for lacZ expression by Miller assay. Using this method, we can determine the regulatory functionality of each open reading frame by examining varying fluorescence levels.<br />
<br />
==<div style="font-size:130%;text-align:center">'''Results</div>==<br />
<br />
===Decaffeination operon (+ gst9) enables growth of GuaB knockout===<br />
<br />
Our initial refactored operon consisted of CBB5 genes NdmA,B,C,D. We found that this operon was able to support growth of the GuaB knockout on theophylline but not caffeine. This indicated that the demethylase responsible for removing the 7-methyl group (NdmC) was not functional. Of note, Summers et. al (2012) also could not detect NdmC activity when expressed in ''e.coli''. We reasoned that there could be a missing protein required for NdmC activity. Summers et al. (2012) showed that an uncharacterized protein (orf8) copurified in protein fractions assayed for NdmC activity. We reasoned that this protein could be essential for NdmC function. Unfortunately, the complete DNA sequence of orf8 was not available, only a partial sequence of the orf was contained in the known operon sequence. A protein homology search was performed using the available sequence to find potential homologs that might be able to substitute function of the missing orf. The search revealed that an uncharacterized gene, gst9, from ''Janthinobacterium marseille'' shared a high degree of sequence homology (70%). We decided to synthesize the gst9 gene from the available sequence and clone it into our decaffeination operon to see if it would enable NdmC activity and allow for complete demethylation of caffeine. We found our hyphothesis to be true, adding gst9 to our refactored operon [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 (Bba_K734000)] did indeed enable growth of the guaB knockout on m9 mineral media:<br />
<br />
<br />
[[File:UtAustin2012DecaffeinationOperon.jpg|center|650px]]<br />
<br />
From this figure, we see that our decaffeination operon enables the GuaB knockout to grow in the absence of guanine or xanthine supplementation by instead demethylating the available caffeine to produce xanthine. This not only confirms the functionality of our refactored decaffeination operon, but proves a method by which we can use it to auxotrophically select for cells.<br />
<br />
To more accurately determine the utilization of caffeine by our operon, we tested the growth of our E. coli cells containing refactored operon and the knocked out GuaB gene under multiple caffeine concentration conditions. We found that our cells were able to grow at conditions as low as 10uM of caffeine, and peaked at a caffeine concentration of approximately 250uM. Concentrations were grown as high as 5000uM, at which point cells began to die, presumably from caffeine toxicity. <br />
<br />
[[File:AustiniGEM2012GrowthCurve.jpg|center|650px]]<br />
<br />
From these growth conditions, we plated dilutions of up to 10<sup>7</sup> dilution. This was used to determine individual cell growth based on caffeine. Approximately 7.6 +/- 0.8 pg of caffeine were utilized per cell. Assuming the use of guanine in E. coli DNA that is roughly 9.2 Mb and 50% GC, approximately 2.3*10<sup>6</sup> guanines derived from caffeine are shown to be utilized per cell in our engineered organisms. As there are roughly 10<sup>11</sup> bases of RNA per E. coli cell, and approximately 25% of these are guanine, there are approximately 2.55*10<sup>10</sup> guanines required for E. coli cell growth. From this calculation, we can include that our cells are scavenging and utilizing approximately all the caffeine present in the system.<br />
<br />
===Growth in Caffeinated Beverages ===<br />
In order to make our experiment more relatable, we experimented with growth of our E. coli strain in various caffeinated beverages. Experiments were first performed on cells with only the GuaB knockout modification, in order to prove that growth in these beverages was even possible. Initial results, shown below, indicate that growth is in fact possible for a wide variety of beverages, including Coca-Cola, 5-Hour Energy, Lipton Tea, and Startbucks Espresso.<br />
<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthInitial.png|center|650px]]<br />
<br />
The graph above shows that the auxotrophic selection of cells using xanthine derivatives again functions as expected – without xanthine, cells were unable to grow under most conditions. The noticeable Optical Densities for 50% Coca-Cola and 50% Espresso are due to the strong background color of the culture and not actual cell growth. 50% 5-Hour Energy and Espresso were both shown to be toxic to our cells. Finally, tea was shown to contain enough natural xanthenes to allow for partial cell growth, and was excluded from further experiments.<br />
<br />
We then attempted to grow our cell strain containing both the GuaB knockout gene and the refactored decaffeination operon. The results of this experiment are shown below.<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthFinal.jpg|center|720px]]<br />
It is important to note that these cells were grown in M9 minimal media containing only 0.2% casein as a natural carbon source. The cells were required to scavenge virtually all of their carbon required for guanine synthesis from the caffeine supplied to the system, or die. Our E. coli was able to utilize the caffeine inherent to Coca-Cola, Starbucks Espresso and 5-Hour Energy, as well as caffeine in caffeine. However, without our refactored decaffeination operon, the cells were unable to grow under any conditions. The two small bars that appear above in 50% Coca-Cola and 10% Espresso are simply due to the high background color of the cultures. It is also worth note that the 10% 5-Hour Energy growth conditions proved marginally toxic to our E. coli cells, as the cells were unable to reach maximum Optical Densities.<br />
<br />
Utilizing the previous experiment in which we calculated the growth of our cells per caffeine molecule, we are able to estimate the total concentration of caffeine in each of the original caffeinated beverages. These results are summarized below, and are very close to the values determined by the beverage manufacturers themselves. This serves as further reinforcement that our decaffeination operon works as intended. Note that due to the toxic effect of 10% 5-Hour Energy, the value we estimate for it is much lower than that provided by the manufacturer.<br />
<br />
<div style="font-size:130%;text-align:center"><br />
{| class="wikitable" style="text-align:center"<br />
|-<br />
! !! Caffeine Content we Calculated (g/L) !! Caffeine Content Manufacturer Calculated (g/L)<br />
|-<br />
| Coca-Cola || 0.11 || 0.10<br />
|-<br />
| Starbucks Espresso|| 0.30 || 0.39<br />
|-<br />
| 5-Hour Energy || 0.41*Low due to cell death || 2.33<br />
|}<br />
</div><br />
<br />
===Transcriptional Regulators===<br />
As described earlier, we hypothesize that the large intergenic regions upstream of various genes in the CBB5 decaffeination operon, particularly upstream of ndmA, may contain methylxanthine regulated promoters. We propose that orf1 and orf4, which were annotated as putative regulators based on sequence homology, act as repressors for the promoters contained in the operon. <br />
<br />
To test these hypotheses, we cloned the intergentic region upstream of the ndmA gene into a promoterless LacZ reporter plasmid, pRA301. This vector enabled quantitative measurement of promoter strength using the β-galactosidase Miller Assay. Additionally, we created compatible biobrick plasmids of each putative repressor, orf1 and orf4, in order to assay their effect on ndmA promoter strength in the presence or absence of methylxanthine supplementation.<br />
<br />
We transformed these plasmids into the Top10 ''E.coli'' strain to create three strains: one containing only the ndmA-LacZ reporter plasmid, and cotransformants containing both the ndmA-LacZ plasmid and either orf1 or orf4 biobrick plasmids. All three ''E. coli'' strains were grown in M9 minimal media + .2% casein (+ appropriate supplement) at 30<sup>o</sup>C for 48 hrs, after which time Miller assays were performed. The results, summarized in the figure below, provide strong evidence that '''''expression of orf4 leads to inhibited ndmA promoter functionality''''', while orf1 expression provides negligible influence on the ndmA promoter. <br />
<br />
[[File:Austin2012ndmARepression.jpg|center|650px]]<br />
<br />
A higher Miller Unit correlates to a higher level of lacZ production, effectively quantifying the degree of gene expression. As the Miller Unit of the strain co-expressed ndmA promoter with orf4 is lower by a factor of roughly 4, it can be inferred that the protein encoded by orf4 regulates the degree to which the ndmA promoter is expressed during transcription.<br />
<br />
It should be noted that while expression of ndmA drops significantly in this experiment, this does not imply that orf4 only inhibits the expression of ndmA. This is discussed in the next section: Inducible Promoters.<br />
<br />
===Inducible Promoters===<br />
As shown above, it appears that orf4 acts as a transcriptional regulator of ndmA expression. One would expect a transcriptional regulator to regulate transcription in a way that is beneficial to the overall fitness of the organism. In certain situations in which a protein is necessary for survival, the transcriptional factor should up-regulate the production of said gene. Likewise, when a protein is not necessary, the transcriptional factor should down-regulate its production.<br />
<br />
We hypothesize that this is the way in which orf4 regulates transcription of ndmA. In situations of high caffeine and related xanthine concentrations, the protein encoded by orf4 up-regulates the expression of ndmA. In the experiment listed [[Team:Austin_Texas/Caffeinated_coli#Transcriptional_Regulators|above]], in which no xanthine derivative was added to the media, expression from the ndmA promoter is inhibited (as shown).<br />
<br />
In order to test this hypothesis, we subjected a strain of Top10 ''E. coli'' cells containing the orf4 gene and the ndmA promoter containing the lacZ gene to varying supplements of caffeine, theobromine, theophylline, and xanthine. Xanthine was shown to be insoluble at high concentrations, and was therefore removed from the experiment. The results of exposure to varying concentration levels is shown below.<br />
<br />
[[File:UTAustin2012InductionbySubstrate.jpg|center|650px]]<br />
<br />
As predicted, the '''''expression of ndmA appears to rise at higher caffeine concentrations'''''. Similarly, higher concentrations of theobromine and theophylline also appear to increase the expression of ndmA. <br />
<br />
From these experiments we conclude that the ndmA intergenic region contains a promoter that is negatively-regulated by the orf4 protein in the absence of methylxanthines. Upon exposure to methylxanthines, it appears that orf4-mediated repression is relieved, leading to induction.<br />
<br />
===Results Summary===<br />
The main accomplishments we achieved this Summer include the following:\<br />
<br />
<br />
*Refactoring of decaffeination operon from ''P. putida'' into ''E. coli''<br />
*Construction of a auxotrophic selection method using our refactored operon, "addicting" ''E. coli'' to caffeine<br />
*Growth of auxtrophic cells on common caffeinated beverages<br />
*Discovery of a methyxanthine inducible promoter (ndmA) in the CBB5 operon<br />
*Characterization of an open reading frame (orf4) in the CBB5 operon that acts as a transcription regulator<br />
<br />
==References==<br />
<br />
#Summers RM, Louie TM, Yu CL, Gakhar L, Louie KC, Subramanian M, "Novel, highly specific N-demethylases enable bacteria to live on caffeine and related purine alkaloids." Journal of Bacteriology, 2012, vol 194, no 8, pg 2041-2049.<br />
<br />
<html><br />
<div id="footer" /><br />
</html></div>Erik.quandthttp://2012.igem.org/Team:Austin_Texas/Caffeinated_coliTeam:Austin Texas/Caffeinated coli2012-10-03T00:11:03Z<p>Erik.quandt: /* Inducible Promoters */</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli" class="selected"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
<br />
<br />
= '''<center><div style="font-size:150%">Project: Caffeinated Coli</div>''' =<br />
<br />
<br />
[[File:Caffeinated_Bacteria.jpg|center|650px]]<br />
<br />
<br />
<br />
== <div style="font-size:130%;text-align:center">'''Introduction'''</div> ==<br />
<br />
Caffeine is commonly used in foods and beverages such as coffee and chocolate and in pharmaceuticals as a cardiac and respiratory stimulant. As a result of the wide use of caffeine, it has become widely present in human waste and as a pollutant in the environment. Bacteria capable of degrading caffeine have been found naturally and could be used for bioremediation of the environment from caffeine. <br />
<br />
''Pseudomonas putida'' CBB5, discovered by Ryan Summers and Mani Subramanian at the University of Iowa can live on caffeine as the sole carbon and nitrogen source. CBB5 uses a Nitrogen demethylation pathway to convert caffeine to xanthine with formaldehyde side products. The xanthine and formaldehyde are then used as the nitrogen and carbon sources respectively.<br />
<br />
The N-demethylation pathway consists of four demethylation genes, ndmA, ndmB, ndmC, and ndmD. ndmA, B, and C remove the methyl groups from the N-1, N-3, and N-7 respectively. This is done with the help of a reductase, ndmD.<br />
<br />
[[File:Ndm diagram.JPG|center|650px]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Strategy'''</div> ==<br />
<br />
=== Refactoring Decaffeination Operon ===<br />
<br />
The first goal of this project involves refactoring the caffeine operon from the caffeine utilization pathway from ''Psuedomonas putida'' CBB5, first characterized by Summers et al. in early 2012. The operon, shown below, will be incorporated into the well characterized bacterium, ''Escherichia coli'' [3]. <br />
<br />
[[File:CBB5_Operon.png|center|650px]]<br />
<br />
Directly importing the operon into ''E. coli'' was determined impractical, as the strength and regulation of the ribosome binding sites (rbs) and operon-controlled promoters in the CBB5 operon may not be optimized for function in ''E. coli''. Additionally, the use in CBB5 of GTG start codons conflicts with E. coli’s preference for ATG – leading to problems in translation initiation.<br />
<br />
We therefore decided to separate out open reading frames for the genes of interest in the CBB5 operon and put them under controlled regulation in a refactored caffeine utilization operon for import into ''E. coli''. The operon's design, shown below and submitted as [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 BBa_K734000], aims to optimize its functionality in its new host. <br />
<br />
[[File:Austin_Texas_Decaffeination_design.png|center]]<br />
<br />
This includes the N-demethylase proteins: ''ndmA'', ''ndmB'', ''ndmC'', and the putative assisting protein ''ndmD''. Also included is the glutathione S-transferase from ''Janthinobacterium'' sp. strain Marseille, necessary for functionality of NdmC. Constitutive expression occurs with a strong, well-characterized promoter ([http://partsregistry.org/wiki/index.php/Part:BBa_J23100 BBa_J23100]) and a strong, well-characterized RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]). Finally, all GTG start codons have been replaced with ATG.<br />
<br />
Sources of parts used in our synthetic decaffeination circuit:<br />
<br />
[[File:Austin_Texas_Part_sources.png|center]]<br />
<br />
==== Assembly ====<br />
<br />
Our operon was assembled via a one-step, six-piece Gibson assembly. Briefly, genes to be stitched together were PCR amplified with overhangs homologous to adjacent genes (or homologous to the vector backbone in the case of the 5' end of the promoter and the 3' end of ''gst9''). The forward primers also contained our chosen RBS and ATG. In a one-pot reaction, a 5'-exonuclease chewed back on the homologous overhangs, allowing adjacent fragments to base pair, and a DNA ligase stitched them together. An overview is shown here.<br />
<br />
[[File:Austin_Texas_Decaffeination_assembly.png|center]] <br />
<br />
=== Operon Testing and Optimization ===<br />
<br />
We will employ two different assays for operon functionality; growth on caffeine as a sole carbon source, and a genetic selection for caffeine demethylation to xanthine. To evaluate the ability to use caffeine as a sole carbon source we will transform TOP 10 E.coli electrocompetent cells with the refactored caffeine utilization operon, grow transformed cells in rich media to saturation and then dilute 1:100 into M9 mineral media. Varying levels of caffeine concentrations will be used to determine the degree of caffeine utilization, and the optimal limit for growth.<br />
<br />
Since the cell has an extremely large requirement for carbon, the energy derived from demethylation may not be enough to support growth. For this reason a second assay for caffeine demethylation based on guanine auxotrophy has been devised. ''E. coli'' synthesizes the nucleotide guanine de novo via a pathway that involves Xanthosine-5’-phosphate (XMP) as an essential intermediate. The enzyme responsible for the formation of XMP (from inosine-5’-phosphate[IMP]) is IMP dehydrogenase, which is encoded by the GuaB gene. If GuaB is knocked out, the cell is unable to synthesize guanine and is therefore unable to grow on media lacking guanine. We plan to take advantage of this engineered auxotrophy and use it as a way to select for cells that are able to demethylate caffeine to xanthine which can then be converted to XMP by xanthine-guanine phosphoribotransferase (gpt) and thereby relieve the metabolic block and restore guanine synthesis allowing for cell growth.<br />
<br />
[[File:guaB_selection_1.jpg|center|650px]]<br />
<br />
Finally, after construction and preliminary testing of the caffeine degradation operon in''E. coli'', we will attempt to grow our cells in the presence of various commercial caffeinated beverages.<br />
<br />
=== Characterizing Inducible Promoters ===<br />
<br />
In Summers et al (2012)., the two open reading frames ''orf1'' and ''orf4'' are thought to be putative regulators of the caffeine degradation operon's N-demethylase proteins due to sequence homology to other known protein regulators (AraC and gntR family). They are hypothesized to bind to operator sequences in the intergenic regions between genes in the operon, which may serve as promoters for the various demethylases of the operon. <br />
<br />
Analysis of the sizes of the intergenic regions of the CBB5 caffeine utilization operon shows that the regions upstream of the ndm genes are all greater than 150bp. The large size of these intergenic regions and the fact that they precede the catabolic enzyme gene leads us to hypothesize that there are caffeine (or other methylxanthine) regulatory elements in these sequences.<br />
<br />
We will clone these open reading frames into the reporter plasmid pRA301. pRA301 contains a promoterless lacZ gene, preceded by a multiple cloning site (MCS). DNA fragments hypothesized to contain promoter elements can be cloned into the MCS and assayed for lacZ expression by Miller assay. Using this method, we can determine the regulatory functionality of each open reading frame by examining varying fluorescence levels.<br />
<br />
==<div style="font-size:130%;text-align:center">'''Results</div>==<br />
<br />
===Decaffeination operon (+ gst9) enables growth of GuaB knockout===<br />
<br />
Our initial refactored operon consisted of CBB5 genes NdmA,B,C,D. We found that this operon was able to support growth of the GuaB knockout on theophylline but not caffeine. This indicated that the demethylase responsible for removing the 7-methyl group (NdmC) was not functional. Of note, Summers et. al (2012) also could not detect NdmC activity when expressed in ''e.coli''. We reasoned that there could be a missing protein required for NdmC activity. Summers et al. (2012) showed that an uncharacterized protein (orf8) copurified in protein fractions assayed for NdmC activity. We reasoned that this protein could be essential for NdmC function. Unfortunately, the complete DNA sequence of orf8 was not available, only a partial sequence of the orf was contained in the known operon sequence. A protein homology search was performed using the available sequence to find potential homologs that might be able to substitute function of the missing orf. The search revealed that an uncharacterized gene, gst9, from ''Janthinobacterium marseille'' shared a high degree of sequence homology (70%). We decided to synthesize the gst9 gene from the available sequence and clone it into our decaffeination operon to see if it would enable NdmC activity and allow for complete demethylation of caffeine. We found our hyphothesis to be true, adding gst9 to our refactored operon [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 (Bba_K734000)] did indeed enable growth of the guaB knockout on m9 mineral media:<br />
<br />
<br />
[[File:UtAustin2012DecaffeinationOperon.jpg|center|650px]]<br />
<br />
From this figure, we see that our decaffeination operon enables the GuaB knockout to grow in the absence of guanine or xanthine supplementation by instead demethylating the available caffeine to produce xanthine. This not only confirms the functionality of our refactored decaffeination operon, but proves a method by which we can use it to auxotrophically select for cells.<br />
<br />
To more accurately determine the utilization of caffeine by our operon, we tested the growth of our E. coli cells containing refactored operon and the knocked out GuaB gene under multiple caffeine concentration conditions. We found that our cells were able to grow at conditions as low as 10uM of caffeine, and peaked at a caffeine concentration of approximately 250uM. Concentrations were grown as high as 5000uM, at which point cells began to die, presumably from caffeine toxicity. <br />
<br />
[[File:AustiniGEM2012GrowthCurve.jpg|center|650px]]<br />
<br />
From these growth conditions, we plated dilutions of up to 10<sup>7</sup> dilution. This was used to determine individual cell growth based on caffeine. Approximately 7.6 +/- 0.8 pg of caffeine were utilized per cell. Assuming the use of guanine in E. coli DNA that is roughly 9.2 Mb and 50% GC, approximately 2.3*10<sup>6</sup> guanines derived from caffeine are shown to be utilized per cell in our engineered organisms. As there are roughly 10<sup>11</sup> bases of RNA per E. coli cell, and approximately 25% of these are guanine, there are approximately 2.55*10<sup>10</sup> guanines required for E. coli cell growth. From this calculation, we can include that our cells are scavenging and utilizing approximately all the caffeine present in the system.<br />
<br />
===Growth in Caffeinated Beverages ===<br />
In order to make our experiment more relatable, we experimented with growth of our E. coli strain in various caffeinated beverages. Experiments were first performed on cells with only the GuaB knockout modification, in order to prove that growth in these beverages was even possible. Initial results, shown below, indicate that growth is in fact possible for a wide variety of beverages, including Coca-Cola, 5-Hour Energy, Lipton Tea, and Startbucks Espresso.<br />
<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthInitial.png|center|650px]]<br />
<br />
The graph above shows that the auxotrophic selection of cells using xanthine derivatives again functions as expected – without xanthine, cells were unable to grow under most conditions. The noticeable Optical Densities for 50% Coca-Cola and 50% Espresso are due to the strong background color of the culture and not actual cell growth. 50% 5-Hour Energy and Espresso were both shown to be toxic to our cells. Finally, tea was shown to contain enough natural xanthenes to allow for partial cell growth, and was excluded from further experiments.<br />
<br />
We then attempted to grow our cell strain containing both the GuaB knockout gene and the refactored decaffeination operon. The results of this experiment are shown below.<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthFinal.jpg|center|720px]]<br />
It is important to note that these cells were grown in M9 minimal media containing only 0.2% casein as a natural carbon source. The cells were required to scavange virtually all of their carbon required for guanine synthesis from the caffeine supplied to the system, or die. Our E. coli was able to utilize the caffeine inherent to Coca-Cola, Starbucks Espresso and 5-Hour Energy, as well as caffeine in caffeine. However, without our refactored decaffeination operon, the cells were unable to grow under any conditions. The two small bars that appear above in 50% Coca-Cola and 10% Espresso are simply due to the high background color of the cultures.<br />
<br />
<div style="font-size:130%;text-align:center"><br />
{| class="wikitable" style="text-align:center"<br />
|-<br />
! !! Caffeine Content we Calculated (g/L) !! Caffeine Content Manufacturer Calculated (g/L)<br />
|-<br />
| Coca-Cola || 0.11 || 0.10<br />
|-<br />
| Starbucks Espresso|| 0.30 || 0.39<br />
|-<br />
| 5-Hour Energy || 0.41*Low due to cell death || 2.33<br />
|}<br />
</div><br />
<br />
===Transcriptional Regulators===<br />
As described earlier, we hypothesize that the large intergenic regions upstream of various genes in the CBB5 decaffeination operon, particularly upstream of ndmA, may contain methylxanthine regulated promoters. We propose that orf1 and orf4, which were annotated as putative regulators based on sequence homology, act as repressors for the promoters contained in the operon. <br />
<br />
To test these hypotheses, we cloned the intergentic region upstream of the ndmA gene into a promoterless LacZ reporter plasmid, pRA301. This vector enabled quantitative measurement of promoter strength using the β-galactosidase Miller Assay. Additionally, we created compatible biobrick plasmids of each putative repressor, orf1 and orf4, in order to assay their effect on ndmA promoter strength in the presence or absence of methylxanthine supplementation.<br />
<br />
We transformed these plasmids into the Top10 ''E.coli'' strain to create three strains: one containing only the ndmA-LacZ reporter plasmid, and cotransformants containing both the ndmA-LacZ plasmid and either orf1 or orf4 biobrick plasmids. All three ''E. coli'' strains were grown in M9 minimal media + .2% casein (+ appropriate supplement) at 30<sup>o</sup>C for 48 hrs, after which time Miller assays were performed. The results, summarized in the figure below, provide strong evidence that '''''expression of orf4 leads to inhibited ndmA promoter functionality''''', while orf1 expression provides negligible influence on the ndmA promoter. <br />
<br />
[[File:Austin2012ndmARepression.jpg|center|650px]]<br />
<br />
A higher Miller Unit correlates to a higher level of lacZ production, effectively quantifying the degree of gene expression. As the Miller Unit of the strain co-expressed ndmA promoter with orf4 is lower by a factor of roughly 4, it can be inferred that the protein encoded by orf4 regulates the degree to which the ndmA promoter is expressed during transcription.<br />
<br />
It should be noted that while expression of ndmA drops significantly in this experiment, this does not imply that orf4 only inhibits the expression of ndmA. This is discussed in the next section: Inducible Promoters.<br />
<br />
===Inducible Promoters===<br />
As shown above, it appears that orf4 acts as a transcriptional regulator of ndmA expression. One would expect a transcriptional regulator to regulate transcription in a way that is beneficial to the overall fitness of the organism. In certain situations in which a protein is necessary for survival, the transcriptional factor should up-regulate the production of said gene. Likewise, when a protein is not necessary, the transcriptional factor should down-regulate its production.<br />
<br />
We hypothesize that this is the way in which orf4 regulates transcription of ndmA. In situations of high caffeine and related xanthine concentrations, the protein encoded by orf4 up-regulates the expression of ndmA. In the experiment listed [[Team:Austin_Texas/Caffeinated_coli#Transcriptional_Regulators|above]], in which no xanthine derivative was added to the media, expression from the ndmA promoter is inhibited (as shown).<br />
<br />
In order to test this hypothesis, we subjected a strain of Top10 ''E. coli'' cells containing the orf4 gene and the ndmA promoter containing the lacZ gene to varying supplements of caffeine, theobromine, theophylline, and xanthine. Xanthine was shown to be insoluble at high concentratinos, and was therefore removed from the experiment. The results of exposure to varying concentration levels is shown below.<br />
<br />
[[File:UTAustin2012InductionbySubstrate.jpg|center|650px]]<br />
<br />
As predicted, the '''''expression of ndmA appears to rise at higher caffeine concentrations'''''. Similarly, higher concentrations of theobromine and theophylline also appear to increase the expression of ndmA. <br />
<br />
From these experiments we conclude that the ndmA intergenic region contains a promoter that is negatively-regulated by the orf4 protein in the absence of methylxanthines. Upon exposure to methylxanthines, it appears that orf4-mediated repression is relieved, leading to induction.<br />
<br />
===Results Summary===<br />
The main accomplishments we achieved this Summer include<br />
*Refactoring of decaffeination operon from ''P. putida'' into ''E. coli''<br />
*Construction of a auxotrophic selection method using our refactored operon, "addicting" ''E. coli'' to caffeine<br />
*Growth of auxtrophic cells on common caffeinated beverages<br />
*Discovery of a methyxanthine inducible promoter (ndmA) in the CBB5 operon<br />
*Characterization of an open reading frame (orf4) in the CBB5 operon that acts as a transcription regulator<br />
<br />
==References==<br />
<br />
#Summers RM, Louie TM, Yu CL, Gakhar L, Louie KC, Subramanian M, "Novel, highly specific N-demethylases enable bacteria to live on caffeine and related purine alkaloids." Journal of Bacteriology, 2012, vol 194, no 8, pg 2041-2049.<br />
<br />
<html><br />
<div id="footer" /><br />
</html></div>Erik.quandthttp://2012.igem.org/Team:Austin_Texas/Caffeinated_coliTeam:Austin Texas/Caffeinated coli2012-10-03T00:10:17Z<p>Erik.quandt: /* Results Summary */</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli" class="selected"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
<br />
<br />
= '''<center><div style="font-size:150%">Project: Caffeinated Coli</div>''' =<br />
<br />
<br />
[[File:Caffeinated_Bacteria.jpg|center|650px]]<br />
<br />
<br />
<br />
== <div style="font-size:130%;text-align:center">'''Introduction'''</div> ==<br />
<br />
Caffeine is commonly used in foods and beverages such as coffee and chocolate and in pharmaceuticals as a cardiac and respiratory stimulant. As a result of the wide use of caffeine, it has become widely present in human waste and as a pollutant in the environment. Bacteria capable of degrading caffeine have been found naturally and could be used for bioremediation of the environment from caffeine. <br />
<br />
''Pseudomonas putida'' CBB5, discovered by Ryan Summers and Mani Subramanian at the University of Iowa can live on caffeine as the sole carbon and nitrogen source. CBB5 uses a Nitrogen demethylation pathway to convert caffeine to xanthine with formaldehyde side products. The xanthine and formaldehyde are then used as the nitrogen and carbon sources respectively.<br />
<br />
The N-demethylation pathway consists of four demethylation genes, ndmA, ndmB, ndmC, and ndmD. ndmA, B, and C remove the methyl groups from the N-1, N-3, and N-7 respectively. This is done with the help of a reductase, ndmD.<br />
<br />
[[File:Ndm diagram.JPG|center|650px]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Strategy'''</div> ==<br />
<br />
=== Refactoring Decaffeination Operon ===<br />
<br />
The first goal of this project involves refactoring the caffeine operon from the caffeine utilization pathway from ''Psuedomonas putida'' CBB5, first characterized by Summers et al. in early 2012. The operon, shown below, will be incorporated into the well characterized bacterium, ''Escherichia coli'' [3]. <br />
<br />
[[File:CBB5_Operon.png|center|650px]]<br />
<br />
Directly importing the operon into ''E. coli'' was determined impractical, as the strength and regulation of the ribosome binding sites (rbs) and operon-controlled promoters in the CBB5 operon may not be optimized for function in ''E. coli''. Additionally, the use in CBB5 of GTG start codons conflicts with E. coli’s preference for ATG – leading to problems in translation initiation.<br />
<br />
We therefore decided to separate out open reading frames for the genes of interest in the CBB5 operon and put them under controlled regulation in a refactored caffeine utilization operon for import into ''E. coli''. The operon's design, shown below and submitted as [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 BBa_K734000], aims to optimize its functionality in its new host. <br />
<br />
[[File:Austin_Texas_Decaffeination_design.png|center]]<br />
<br />
This includes the N-demethylase proteins: ''ndmA'', ''ndmB'', ''ndmC'', and the putative assisting protein ''ndmD''. Also included is the glutathione S-transferase from ''Janthinobacterium'' sp. strain Marseille, necessary for functionality of NdmC. Constitutive expression occurs with a strong, well-characterized promoter ([http://partsregistry.org/wiki/index.php/Part:BBa_J23100 BBa_J23100]) and a strong, well-characterized RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]). Finally, all GTG start codons have been replaced with ATG.<br />
<br />
Sources of parts used in our synthetic decaffeination circuit:<br />
<br />
[[File:Austin_Texas_Part_sources.png|center]]<br />
<br />
==== Assembly ====<br />
<br />
Our operon was assembled via a one-step, six-piece Gibson assembly. Briefly, genes to be stitched together were PCR amplified with overhangs homologous to adjacent genes (or homologous to the vector backbone in the case of the 5' end of the promoter and the 3' end of ''gst9''). The forward primers also contained our chosen RBS and ATG. In a one-pot reaction, a 5'-exonuclease chewed back on the homologous overhangs, allowing adjacent fragments to base pair, and a DNA ligase stitched them together. An overview is shown here.<br />
<br />
[[File:Austin_Texas_Decaffeination_assembly.png|center]] <br />
<br />
=== Operon Testing and Optimization ===<br />
<br />
We will employ two different assays for operon functionality; growth on caffeine as a sole carbon source, and a genetic selection for caffeine demethylation to xanthine. To evaluate the ability to use caffeine as a sole carbon source we will transform TOP 10 E.coli electrocompetent cells with the refactored caffeine utilization operon, grow transformed cells in rich media to saturation and then dilute 1:100 into M9 mineral media. Varying levels of caffeine concentrations will be used to determine the degree of caffeine utilization, and the optimal limit for growth.<br />
<br />
Since the cell has an extremely large requirement for carbon, the energy derived from demethylation may not be enough to support growth. For this reason a second assay for caffeine demethylation based on guanine auxotrophy has been devised. ''E. coli'' synthesizes the nucleotide guanine de novo via a pathway that involves Xanthosine-5’-phosphate (XMP) as an essential intermediate. The enzyme responsible for the formation of XMP (from inosine-5’-phosphate[IMP]) is IMP dehydrogenase, which is encoded by the GuaB gene. If GuaB is knocked out, the cell is unable to synthesize guanine and is therefore unable to grow on media lacking guanine. We plan to take advantage of this engineered auxotrophy and use it as a way to select for cells that are able to demethylate caffeine to xanthine which can then be converted to XMP by xanthine-guanine phosphoribotransferase (gpt) and thereby relieve the metabolic block and restore guanine synthesis allowing for cell growth.<br />
<br />
[[File:guaB_selection_1.jpg|center|650px]]<br />
<br />
Finally, after construction and preliminary testing of the caffeine degradation operon in''E. coli'', we will attempt to grow our cells in the presence of various commercial caffeinated beverages.<br />
<br />
=== Characterizing Inducible Promoters ===<br />
<br />
In Summers et al (2012)., the two open reading frames ''orf1'' and ''orf4'' are thought to be putative regulators of the caffeine degradation operon's N-demethylase proteins due to sequence homology to other known protein regulators (AraC and gntR family). They are hypothesized to bind to operator sequences in the intergenic regions between genes in the operon, which may serve as promoters for the various demethylases of the operon. <br />
<br />
Analysis of the sizes of the intergenic regions of the CBB5 caffeine utilization operon shows that the regions upstream of the ndm genes are all greater than 150bp. The large size of these intergenic regions and the fact that they precede the catabolic enzyme gene leads us to hypothesize that there are caffeine (or other methylxanthine) regulatory elements in these sequences.<br />
<br />
We will clone these open reading frames into the reporter plasmid pRA301. pRA301 contains a promoterless lacZ gene, preceded by a multiple cloning site (MCS). DNA fragments hypothesized to contain promoter elements can be cloned into the MCS and assayed for lacZ expression by Miller assay. Using this method, we can determine the regulatory functionality of each open reading frame by examining varying fluorescence levels.<br />
<br />
==<div style="font-size:130%;text-align:center">'''Results</div>==<br />
<br />
===Decaffeination operon (+ gst9) enables growth of GuaB knockout===<br />
<br />
Our initial refactored operon consisted of CBB5 genes NdmA,B,C,D. We found that this operon was able to support growth of the GuaB knockout on theophylline but not caffeine. This indicated that the demethylase responsible for removing the 7-methyl group (NdmC) was not functional. Of note, Summers et. al (2012) also could not detect NdmC activity when expressed in ''e.coli''. We reasoned that there could be a missing protein required for NdmC activity. Summers et al. (2012) showed that an uncharacterized protein (orf8) copurified in protein fractions assayed for NdmC activity. We reasoned that this protein could be essential for NdmC function. Unfortunately, the complete DNA sequence of orf8 was not available, only a partial sequence of the orf was contained in the known operon sequence. A protein homology search was performed using the available sequence to find potential homologs that might be able to substitute function of the missing orf. The search revealed that an uncharacterized gene, gst9, from ''Janthinobacterium marseille'' shared a high degree of sequence homology (70%). We decided to synthesize the gst9 gene from the available sequence and clone it into our decaffeination operon to see if it would enable NdmC activity and allow for complete demethylation of caffeine. We found our hyphothesis to be true, adding gst9 to our refactored operon [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 (Bba_K734000)] did indeed enable growth of the guaB knockout on m9 mineral media:<br />
<br />
<br />
[[File:UtAustin2012DecaffeinationOperon.jpg|center|650px]]<br />
<br />
From this figure, we see that our decaffeination operon enables the GuaB knockout to grow in the absence of guanine or xanthine supplementation by instead demethylating the available caffeine to produce xanthine. This not only confirms the functionality of our refactored decaffeination operon, but proves a method by which we can use it to auxotrophically select for cells.<br />
<br />
To more accurately determine the utilization of caffeine by our operon, we tested the growth of our E. coli cells containing refactored operon and the knocked out GuaB gene under multiple caffeine concentration conditions. We found that our cells were able to grow at conditions as low as 10uM of caffeine, and peaked at a caffeine concentration of approximately 250uM. Concentrations were grown as high as 5000uM, at which point cells began to die, presumably from caffeine toxicity. <br />
<br />
[[File:AustiniGEM2012GrowthCurve.jpg|center|650px]]<br />
<br />
From these growth conditions, we plated dilutions of up to 10<sup>7</sup> dilution. This was used to determine individual cell growth based on caffeine. Approximately 7.6 +/- 0.8 pg of caffeine were utilized per cell. Assuming the use of guanine in E. coli DNA that is roughly 9.2 Mb and 50% GC, approximately 2.3*10<sup>6</sup> guanines derived from caffeine are shown to be utilized per cell in our engineered organisms. As there are roughly 10<sup>11</sup> bases of RNA per E. coli cell, and approximately 25% of these are guanine, there are approximately 2.55*10<sup>10</sup> guanines required for E. coli cell growth. From this calculation, we can include that our cells are scavenging and utilizing approximately all the caffeine present in the system.<br />
<br />
===Growth in Caffeinated Beverages ===<br />
In order to make our experiment more relatable, we experimented with growth of our E. coli strain in various caffeinated beverages. Experiments were first performed on cells with only the GuaB knockout modification, in order to prove that growth in these beverages was even possible. Initial results, shown below, indicate that growth is in fact possible for a wide variety of beverages, including Coca-Cola, 5-Hour Energy, Lipton Tea, and Startbucks Espresso.<br />
<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthInitial.png|center|650px]]<br />
<br />
The graph above shows that the auxotrophic selection of cells using xanthine derivatives again functions as expected – without xanthine, cells were unable to grow under most conditions. The noticeable Optical Densities for 50% Coca-Cola and 50% Espresso are due to the strong background color of the culture and not actual cell growth. 50% 5-Hour Energy and Espresso were both shown to be toxic to our cells. Finally, tea was shown to contain enough natural xanthenes to allow for partial cell growth, and was excluded from further experiments.<br />
<br />
We then attempted to grow our cell strain containing both the GuaB knockout gene and the refactored decaffeination operon. The results of this experiment are shown below.<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthFinal.jpg|center|720px]]<br />
It is important to note that these cells were grown in M9 minimal media containing only 0.2% casein as a natural carbon source. The cells were required to scavange virtually all of their carbon required for guanine synthesis from the caffeine supplied to the system, or die. Our E. coli was able to utilize the caffeine inherent to Coca-Cola, Starbucks Espresso and 5-Hour Energy, as well as caffeine in caffeine. However, without our refactored decaffeination operon, the cells were unable to grow under any conditions. The two small bars that appear above in 50% Coca-Cola and 10% Espresso are simply due to the high background color of the cultures.<br />
<br />
<div style="font-size:130%;text-align:center"><br />
{| class="wikitable" style="text-align:center"<br />
|-<br />
! !! Caffeine Content we Calculated (g/L) !! Caffeine Content Manufacturer Calculated (g/L)<br />
|-<br />
| Coca-Cola || 0.11 || 0.10<br />
|-<br />
| Starbucks Espresso|| 0.30 || 0.39<br />
|-<br />
| 5-Hour Energy || 0.41*Low due to cell death || 2.33<br />
|}<br />
</div><br />
<br />
===Transcriptional Regulators===<br />
As described earlier, we hypothesize that the large intergenic regions upstream of various genes in the CBB5 decaffeination operon, particularly upstream of ndmA, may contain methylxanthine regulated promoters. We propose that orf1 and orf4, which were annotated as putative regulators based on sequence homology, act as repressors for the promoters contained in the operon. <br />
<br />
To test these hypotheses, we cloned the intergentic region upstream of the ndmA gene into a promoterless LacZ reporter plasmid, pRA301. This vector enabled quantitative measurement of promoter strength using the β-galactosidase Miller Assay. Additionally, we created compatible biobrick plasmids of each putative repressor, orf1 and orf4, in order to assay their effect on ndmA promoter strength in the presence or absence of methylxanthine supplementation.<br />
<br />
We transformed these plasmids into the Top10 ''E.coli'' strain to create three strains: one containing only the ndmA-LacZ reporter plasmid, and cotransformants containing both the ndmA-LacZ plasmid and either orf1 or orf4 biobrick plasmids. All three ''E. coli'' strains were grown in M9 minimal media + .2% casein (+ appropriate supplement) at 30<sup>o</sup>C for 48 hrs, after which time Miller assays were performed. The results, summarized in the figure below, provide strong evidence that '''''expression of orf4 leads to inhibited ndmA promoter functionality''''', while orf1 expression provides negligible influence on the ndmA promoter. <br />
<br />
[[File:Austin2012ndmARepression.jpg|center|650px]]<br />
<br />
A higher Miller Unit correlates to a higher level of lacZ production, effectively quantifying the degree of gene expression. As the Miller Unit of the strain co-expressed ndmA promoter with orf4 is lower by a factor of roughly 4, it can be inferred that the protein encoded by orf4 regulates the degree to which the ndmA promoter is expressed during transcription.<br />
<br />
It should be noted that while expression of ndmA drops significantly in this experiment, this does not imply that orf4 only inhibits the expression of ndmA. This is discussed in the next section: Inducible Promoters.<br />
<br />
===Inducible Promoters===<br />
As shown above, it appears that orf4 acts as a transcriptional regulator of ndmA expression. One would expect a transcriptional regulator to regulate transcription in a way that is beneficial to the overall fitness of the organism. In certain situations in which a protein is necessary for survival, the transcriptional factor should up-regulate the production of said gene. Likewise, when a protein is not necessary, the transcriptional factor should down-regulate its production.<br />
<br />
We hypothesize that this is the way in which orf4 regulates transcription of ndmA. In situations of high caffeine and related xanthine concentrations, the protein encoded by orf4 up-regulates the expression of ndmA. In the experiment listed [[Team:Austin_Texas/Caffeinated_coli#Transcriptional_Regulators|above]], in which no xanthine derivative was added to the media, the expression of ndmA is inhibited (as shown).<br />
<br />
In order to test this hypothesis, we subjected a strain of Top10 ''E. coli'' cells containing the orf4 gene and the ndmA promoter containing the lacZ gene to varying supplements of caffeine, theobromine, theophylline, and xanthine. Xanthine was shown to be insoluble at high concentratinos, and was therefore removed from the experiment. The results of exposure to varying concentration levels is shown below.<br />
<br />
[[File:UTAustin2012InductionbySubstrate.jpg|center|650px]]<br />
<br />
As predicted, the '''''expression of ndmA appears to rise at higher caffeine concentrations'''''. Similarly, higher concentrations of theobromine and theophylline also appear to increase the expression of ndmA. <br />
<br />
From these experiments we conclude that the ndmA intergenic region contains a promoter that is negatively-regulated by the orf4 protein in the absence of methylxanthines. Upon exposure to methylxanthines, it appears that orf4-mediated repression is relieved, leading to induction. <br />
<br />
===Results Summary===<br />
The main accomplishments we achieved this Summer include<br />
*Refactoring of decaffeination operon from ''P. putida'' into ''E. coli''<br />
*Construction of a auxotrophic selection method using our refactored operon, "addicting" ''E. coli'' to caffeine<br />
*Growth of auxtrophic cells on common caffeinated beverages<br />
*Discovery of a methyxanthine inducible promoter (ndmA) in the CBB5 operon<br />
*Characterization of an open reading frame (orf4) in the CBB5 operon that acts as a transcription regulator<br />
<br />
==References==<br />
<br />
#Summers RM, Louie TM, Yu CL, Gakhar L, Louie KC, Subramanian M, "Novel, highly specific N-demethylases enable bacteria to live on caffeine and related purine alkaloids." Journal of Bacteriology, 2012, vol 194, no 8, pg 2041-2049.<br />
<br />
<html><br />
<div id="footer" /><br />
</html></div>Erik.quandthttp://2012.igem.org/Team:Austin_Texas/Caffeinated_coliTeam:Austin Texas/Caffeinated coli2012-10-03T00:07:54Z<p>Erik.quandt: /* Project: Caffeinated Coli */</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli" class="selected"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
<br />
<br />
= '''<center><div style="font-size:150%">Project: Caffeinated Coli</div>''' =<br />
<br />
<br />
[[File:Caffeinated_Bacteria.jpg|center|650px]]<br />
<br />
<br />
<br />
== <div style="font-size:130%;text-align:center">'''Introduction'''</div> ==<br />
<br />
Caffeine is commonly used in foods and beverages such as coffee and chocolate and in pharmaceuticals as a cardiac and respiratory stimulant. As a result of the wide use of caffeine, it has become widely present in human waste and as a pollutant in the environment. Bacteria capable of degrading caffeine have been found naturally and could be used for bioremediation of the environment from caffeine. <br />
<br />
''Pseudomonas putida'' CBB5, discovered by Ryan Summers and Mani Subramanian at the University of Iowa can live on caffeine as the sole carbon and nitrogen source. CBB5 uses a Nitrogen demethylation pathway to convert caffeine to xanthine with formaldehyde side products. The xanthine and formaldehyde are then used as the nitrogen and carbon sources respectively.<br />
<br />
The N-demethylation pathway consists of four demethylation genes, ndmA, ndmB, ndmC, and ndmD. ndmA, B, and C remove the methyl groups from the N-1, N-3, and N-7 respectively. This is done with the help of a reductase, ndmD.<br />
<br />
[[File:Ndm diagram.JPG|center|650px]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Strategy'''</div> ==<br />
<br />
=== Refactoring Decaffeination Operon ===<br />
<br />
The first goal of this project involves refactoring the caffeine operon from the caffeine utilization pathway from ''Psuedomonas putida'' CBB5, first characterized by Summers et al. in early 2012. The operon, shown below, will be incorporated into the well characterized bacterium, ''Escherichia coli'' [3]. <br />
<br />
[[File:CBB5_Operon.png|center|650px]]<br />
<br />
Directly importing the operon into ''E. coli'' was determined impractical, as the strength and regulation of the ribosome binding sites (rbs) and operon-controlled promoters in the CBB5 operon may not be optimized for function in ''E. coli''. Additionally, the use in CBB5 of GTG start codons conflicts with E. coli’s preference for ATG – leading to problems in translation initiation.<br />
<br />
We therefore decided to separate out open reading frames for the genes of interest in the CBB5 operon and put them under controlled regulation in a refactored caffeine utilization operon for import into ''E. coli''. The operon's design, shown below and submitted as [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 BBa_K734000], aims to optimize its functionality in its new host. <br />
<br />
[[File:Austin_Texas_Decaffeination_design.png|center]]<br />
<br />
This includes the N-demethylase proteins: ''ndmA'', ''ndmB'', ''ndmC'', and the putative assisting protein ''ndmD''. Also included is the glutathione S-transferase from ''Janthinobacterium'' sp. strain Marseille, necessary for functionality of NdmC. Constitutive expression occurs with a strong, well-characterized promoter ([http://partsregistry.org/wiki/index.php/Part:BBa_J23100 BBa_J23100]) and a strong, well-characterized RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]). Finally, all GTG start codons have been replaced with ATG.<br />
<br />
Sources of parts used in our synthetic decaffeination circuit:<br />
<br />
[[File:Austin_Texas_Part_sources.png|center]]<br />
<br />
==== Assembly ====<br />
<br />
Our operon was assembled via a one-step, six-piece Gibson assembly. Briefly, genes to be stitched together were PCR amplified with overhangs homologous to adjacent genes (or homologous to the vector backbone in the case of the 5' end of the promoter and the 3' end of ''gst9''). The forward primers also contained our chosen RBS and ATG. In a one-pot reaction, a 5'-exonuclease chewed back on the homologous overhangs, allowing adjacent fragments to base pair, and a DNA ligase stitched them together. An overview is shown here.<br />
<br />
[[File:Austin_Texas_Decaffeination_assembly.png|center]] <br />
<br />
=== Operon Testing and Optimization ===<br />
<br />
We will employ two different assays for operon functionality; growth on caffeine as a sole carbon source, and a genetic selection for caffeine demethylation to xanthine. To evaluate the ability to use caffeine as a sole carbon source we will transform TOP 10 E.coli electrocompetent cells with the refactored caffeine utilization operon, grow transformed cells in rich media to saturation and then dilute 1:100 into M9 mineral media. Varying levels of caffeine concentrations will be used to determine the degree of caffeine utilization, and the optimal limit for growth.<br />
<br />
Since the cell has an extremely large requirement for carbon, the energy derived from demethylation may not be enough to support growth. For this reason a second assay for caffeine demethylation based on guanine auxotrophy has been devised. ''E. coli'' synthesizes the nucleotide guanine de novo via a pathway that involves Xanthosine-5’-phosphate (XMP) as an essential intermediate. The enzyme responsible for the formation of XMP (from inosine-5’-phosphate[IMP]) is IMP dehydrogenase, which is encoded by the GuaB gene. If GuaB is knocked out, the cell is unable to synthesize guanine and is therefore unable to grow on media lacking guanine. We plan to take advantage of this engineered auxotrophy and use it as a way to select for cells that are able to demethylate caffeine to xanthine which can then be converted to XMP by xanthine-guanine phosphoribotransferase (gpt) and thereby relieve the metabolic block and restore guanine synthesis allowing for cell growth.<br />
<br />
[[File:guaB_selection_1.jpg|center|650px]]<br />
<br />
Finally, after construction and preliminary testing of the caffeine degradation operon in''E. coli'', we will attempt to grow our cells in the presence of various commercial caffeinated beverages.<br />
<br />
=== Characterizing Inducible Promoters ===<br />
<br />
In Summers et al (2012)., the two open reading frames ''orf1'' and ''orf4'' are thought to be putative regulators of the caffeine degradation operon's N-demethylase proteins due to sequence homology to other known protein regulators (AraC and gntR family). They are hypothesized to bind to operator sequences in the intergenic regions between genes in the operon, which may serve as promoters for the various demethylases of the operon. <br />
<br />
Analysis of the sizes of the intergenic regions of the CBB5 caffeine utilization operon shows that the regions upstream of the ndm genes are all greater than 150bp. The large size of these intergenic regions and the fact that they precede the catabolic enzyme gene leads us to hypothesize that there are caffeine (or other methylxanthine) regulatory elements in these sequences.<br />
<br />
We will clone these open reading frames into the reporter plasmid pRA301. pRA301 contains a promoterless lacZ gene, preceded by a multiple cloning site (MCS). DNA fragments hypothesized to contain promoter elements can be cloned into the MCS and assayed for lacZ expression by Miller assay. Using this method, we can determine the regulatory functionality of each open reading frame by examining varying fluorescence levels.<br />
<br />
==<div style="font-size:130%;text-align:center">'''Results</div>==<br />
<br />
===Decaffeination operon (+ gst9) enables growth of GuaB knockout===<br />
<br />
Our initial refactored operon consisted of CBB5 genes NdmA,B,C,D. We found that this operon was able to support growth of the GuaB knockout on theophylline but not caffeine. This indicated that the demethylase responsible for removing the 7-methyl group (NdmC) was not functional. Of note, Summers et. al (2012) also could not detect NdmC activity when expressed in ''e.coli''. We reasoned that there could be a missing protein required for NdmC activity. Summers et al. (2012) showed that an uncharacterized protein (orf8) copurified in protein fractions assayed for NdmC activity. We reasoned that this protein could be essential for NdmC function. Unfortunately, the complete DNA sequence of orf8 was not available, only a partial sequence of the orf was contained in the known operon sequence. A protein homology search was performed using the available sequence to find potential homologs that might be able to substitute function of the missing orf. The search revealed that an uncharacterized gene, gst9, from ''Janthinobacterium marseille'' shared a high degree of sequence homology (70%). We decided to synthesize the gst9 gene from the available sequence and clone it into our decaffeination operon to see if it would enable NdmC activity and allow for complete demethylation of caffeine. We found our hyphothesis to be true, adding gst9 to our refactored operon [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 (Bba_K734000)] did indeed enable growth of the guaB knockout on m9 mineral media:<br />
<br />
<br />
[[File:UtAustin2012DecaffeinationOperon.jpg|center|650px]]<br />
<br />
From this figure, we see that our decaffeination operon enables the GuaB knockout to grow in the absence of guanine or xanthine supplementation by instead demethylating the available caffeine to produce xanthine. This not only confirms the functionality of our refactored decaffeination operon, but proves a method by which we can use it to auxotrophically select for cells.<br />
<br />
To more accurately determine the utilization of caffeine by our operon, we tested the growth of our E. coli cells containing refactored operon and the knocked out GuaB gene under multiple caffeine concentration conditions. We found that our cells were able to grow at conditions as low as 10uM of caffeine, and peaked at a caffeine concentration of approximately 250uM. Concentrations were grown as high as 5000uM, at which point cells began to die, presumably from caffeine toxicity. <br />
<br />
[[File:AustiniGEM2012GrowthCurve.jpg|center|650px]]<br />
<br />
From these growth conditions, we plated dilutions of up to 10<sup>7</sup> dilution. This was used to determine individual cell growth based on caffeine. Approximately 7.6 +/- 0.8 pg of caffeine were utilized per cell. Assuming the use of guanine in E. coli DNA that is roughly 9.2 Mb and 50% GC, approximately 2.3*10<sup>6</sup> guanines derived from caffeine are shown to be utilized per cell in our engineered organisms. As there are roughly 10<sup>11</sup> bases of RNA per E. coli cell, and approximately 25% of these are guanine, there are approximately 2.55*10<sup>10</sup> guanines required for E. coli cell growth. From this calculation, we can include that our cells are scavenging and utilizing approximately all the caffeine present in the system.<br />
<br />
===Growth in Caffeinated Beverages ===<br />
In order to make our experiment more relatable, we experimented with growth of our E. coli strain in various caffeinated beverages. Experiments were first performed on cells with only the GuaB knockout modification, in order to prove that growth in these beverages was even possible. Initial results, shown below, indicate that growth is in fact possible for a wide variety of beverages, including Coca-Cola, 5-Hour Energy, Lipton Tea, and Startbucks Espresso.<br />
<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthInitial.png|center|650px]]<br />
<br />
The graph above shows that the auxotrophic selection of cells using xanthine derivatives again functions as expected – without xanthine, cells were unable to grow under most conditions. The noticeable Optical Densities for 50% Coca-Cola and 50% Espresso are due to the strong background color of the culture and not actual cell growth. 50% 5-Hour Energy and Espresso were both shown to be toxic to our cells. Finally, tea was shown to contain enough natural xanthenes to allow for partial cell growth, and was excluded from further experiments.<br />
<br />
We then attempted to grow our cell strain containing both the GuaB knockout gene and the refactored decaffeination operon. The results of this experiment are shown below.<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthFinal.jpg|center|720px]]<br />
It is important to note that these cells were grown in M9 minimal media containing only 0.2% casein as a natural carbon source. The cells were required to scavange virtually all of their carbon required for guanine synthesis from the caffeine supplied to the system, or die. Our E. coli was able to utilize the caffeine inherent to Coca-Cola, Starbucks Espresso and 5-Hour Energy, as well as caffeine in caffeine. However, without our refactored decaffeination operon, the cells were unable to grow under any conditions. The two small bars that appear above in 50% Coca-Cola and 10% Espresso are simply due to the high background color of the cultures.<br />
<br />
<div style="font-size:130%;text-align:center"><br />
{| class="wikitable" style="text-align:center"<br />
|-<br />
! !! Caffeine Content we Calculated (g/L) !! Caffeine Content Manufacturer Calculated (g/L)<br />
|-<br />
| Coca-Cola || 0.11 || 0.10<br />
|-<br />
| Starbucks Espresso|| 0.30 || 0.39<br />
|-<br />
| 5-Hour Energy || 0.41*Low due to cell death || 2.33<br />
|}<br />
</div><br />
<br />
===Transcriptional Regulators===<br />
As described earlier, we hypothesize that the large intergenic regions upstream of various genes in the CBB5 decaffeination operon, particularly upstream of ndmA, may contain methylxanthine regulated promoters. We propose that orf1 and orf4, which were annotated as putative regulators based on sequence homology, act as repressors for the promoters contained in the operon. <br />
<br />
To test these hypotheses, we cloned the intergentic region upstream of the ndmA gene into a promoterless LacZ reporter plasmid, pRA301. This vector enabled quantitative measurement of promoter strength using the β-galactosidase Miller Assay. Additionally, we created compatible biobrick plasmids of each putative repressor, orf1 and orf4, in order to assay their effect on ndmA promoter strength in the presence or absence of methylxanthine supplementation.<br />
<br />
We transformed these plasmids into the Top10 ''E.coli'' strain to create three strains: one containing only the ndmA-LacZ reporter plasmid, and cotransformants containing both the ndmA-LacZ plasmid and either orf1 or orf4 biobrick plasmids. All three ''E. coli'' strains were grown in M9 minimal media + .2% casein (+ appropriate supplement) at 30<sup>o</sup>C for 48 hrs, after which time Miller assays were performed. The results, summarized in the figure below, provide strong evidence that '''''expression of orf4 leads to inhibited ndmA promoter functionality''''', while orf1 expression provides negligible influence on the ndmA promoter. <br />
<br />
[[File:Austin2012ndmARepression.jpg|center|650px]]<br />
<br />
A higher Miller Unit correlates to a higher level of lacZ production, effectively quantifying the degree of gene expression. As the Miller Unit of the strain co-expressed ndmA promoter with orf4 is lower by a factor of roughly 4, it can be inferred that the protein encoded by orf4 regulates the degree to which the ndmA promoter is expressed during transcription.<br />
<br />
It should be noted that while expression of ndmA drops significantly in this experiment, this does not imply that orf4 only inhibits the expression of ndmA. This is discussed in the next section: Inducible Promoters.<br />
<br />
===Inducible Promoters===<br />
As shown above, it appears that orf4 acts as a transcriptional regulator of ndmA expression. One would expect a transcriptional regulator to regulate transcription in a way that is beneficial to the overall fitness of the organism. In certain situations in which a protein is necessary for survival, the transcriptional factor should up-regulate the production of said gene. Likewise, when a protein is not necessary, the transcriptional factor should down-regulate its production.<br />
<br />
We hypothesize that this is the way in which orf4 regulates transcription of ndmA. In situations of high caffeine and related xanthine concentrations, the protein encoded by orf4 up-regulates the expression of ndmA. In the experiment listed [[Team:Austin_Texas/Caffeinated_coli#Transcriptional_Regulators|above]], in which no xanthine derivative was added to the media, the expression of ndmA is inhibited (as shown).<br />
<br />
In order to test this hypothesis, we subjected a strain of Top10 ''E. coli'' cells containing the orf4 gene and the ndmA promoter containing the lacZ gene to varying supplements of caffeine, theobromine, theophylline, and xanthine. Xanthine was shown to be insoluble at high concentratinos, and was therefore removed from the experiment. The results of exposure to varying concentration levels is shown below.<br />
<br />
[[File:UTAustin2012InductionbySubstrate.jpg|center|650px]]<br />
<br />
As predicted, the '''''expression of ndmA appears to rise at higher caffeine concentrations'''''. Similarly, higher concentrations of theobromine and theophylline also appear to increase the expression of ndmA. <br />
<br />
From these experiments we conclude that the ndmA intergenic region contains a promoter that is negatively-regulated by the orf4 protein in the absence of methylxanthines. Upon exposure to methylxanthines, it appears that orf4-mediated repression is relieved, leading to induction. <br />
<br />
===Results Summary===<br />
The main accomplishments we achieved this Summer include<br />
*Refactoring of decaffeination operon from ''P. putida'' into ''E. coli''<br />
*Construction of a auxotrophic selection method using our refactored operon, "addicting" ''E. coli'' to caffeine<br />
*Growth of above cells in common caffeinated beverages<br />
*Discovery of a promoter in the CBB5 operon<br />
*Characterization of an open reading frames in the CBB5 operon as a transcription regulator<br />
<br />
==References==<br />
<br />
#Summers RM, Louie TM, Yu CL, Gakhar L, Louie KC, Subramanian M, "Novel, highly specific N-demethylases enable bacteria to live on caffeine and related purine alkaloids." Journal of Bacteriology, 2012, vol 194, no 8, pg 2041-2049.<br />
<br />
<html><br />
<div id="footer" /><br />
</html></div>Erik.quandthttp://2012.igem.org/Team:Austin_TexasTeam:Austin Texas2012-10-02T23:54:02Z<p>Erik.quandt: /* Project Caffeinated coli */</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" class="selected" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
[[File:CokeGrowth.png|360px|left]]<br />
[[File:DietCokeGrowth.png|360px|right]]<br />
[[File:UTAustinTower.jpg|175px|center]]<br />
<br />
<br />
== Project Caffeinated coli ==<br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/d/d1/Caffeinated_Coli.jpeg"; alt="Caffeinated Coli"; width="170px"; height="250px"; style="float:left; padding:3px; clear:right;"/></html><br />
<br />
<br />
<br />
The widespread use of caffeine (1,3,7–trimethylxanthine) and other methylxanthines in beverages and pharmaceuticals has led to significant environmental pollution. We have developed a novel detection and bioremediation strategy for caffeine contamination by refactoring the methylxanthine degradation operon native to Pseudomonas putida CBB5. Escherichia coli cells with this synthetic operon degrade caffeine by N-demethylation to the guanine precursor, xanthine. Cells deficient in guanine biosynthesis and containing our refactored operon were addicted to caffeine; their growth density was limited by the availability of caffeine. Remarkably, they were able to sense the caffeine content of several common beverages. Characterization of nearby genes in the P. putida operon revealed a potential methylxanthine regulatory system for use in biological circuit design. The synthetic N-demethylation operon could be useful for cheaply producing pharmaceuticals or precursor molecules and for detoxifying waste so that it can be recycled into animal feed and biofuels. <br />
<br />
<br /><br /><br /><br /><br /><br />
<br />
== Project ZombiE.coli ==<br />
<br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/a/a9/Austin_Texas_logo.png"; alt="ZombiE.coli"; width="170px"; height="250px"; style="float:left; padding:3px; clear:right;"/></html><br />
<br />
<br />
<br />
UT’s ZombiE.coli aims to a develop a tightly regulated genetic switch that is triggered by bacterial quorum signaling and leads to feed-forward propagation of the genetic output in the form of red or green fluorescence as well as amplification of quorum signaling. The switch relies on simple one-way Cre/loxP recombination combined with native quorum signaling to provide us with a system that models transmissible disease spread between populations. We have likened this to an airborne zombie epidemic, in which a an “infected” zombie cell is capable of restructuring the genes of a normal cell, turning it into a flesh-hungry counterpart. This system will be useful not only as a simple disease outbreak model for intermediate-level biology education, but also, could provide new insights to how bacterial populations communicate in three dimensions and under different genetic backgrounds. <br />
<br />
<br /><br /><br /><br /><br /><br />
== Project Spinach-mCherry Dual Reporter ==<br />
<br />
In an effort to improve both efficiency, ease, and quality of promoter and RBS strength meaurements, we focused on developing a dual fluorescence reporter for simultaneous monitoring both transcription and translation. To measure both processes separately, two fluorescent reporters, the Spinach aptamer and mCherry red fluorescent protein, were assembled into a single construct. The Spinach-mCherry dual reporter is a unique concept; Spinach is a short RNA aptamer that binds to its ligand, DFHBI, and allows it to emit green fluorescence similar to GFP. This gives insight into the direct production of the mCherry-encoding mRNA without the need to wait for protein folding and maturation of the fluorophore. This technique attempted to expand upon current efforts to measure promoter strength relative to a reference standard used by the iGEM community.<br />
<br />
<html><br />
<br /><br /><br /><br /><br /><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2012/d/db/Geneious.png" alt="Geneious logo" width="150px" height="62px" /><br />
<img src="https://static.igem.org/mediawiki/2012/d/d6/Austin_Texas_NEB_logo.jpeg" alt="NEB logo" width="150px" height="58px" /><br />
<img src="https://static.igem.org/mediawiki/2012/c/c6/Austin_Texas_Epoch_logo.jpg" alt="Epoch logo" width="150px" height="65px" /><br />
</center><br />
<br />
<div id="footer" /><br />
</html><br />
<br />
<!-- this is commented out<br />
<br />
{|align="justify"<br />
|You can write a background of your team here. Give us a background of your team, the members, etc. Or tell us more about something of your choosing.<br />
|<br />
|-<br />
|<br />
''Tell us more about your project. Give us background. Use this as the abstract of your project. Be descriptive but concise (1-2 paragraphs)''<br />
|[[Image:Austin_Texas_team.png|right|frame|Your team picture]]<br />
|-<br />
|<br />
|<br />
|}<br />
<br />
--></div>Erik.quandthttp://2012.igem.org/Team:Austin_Texas/Caffeinated_coliTeam:Austin Texas/Caffeinated coli2012-10-02T23:43:06Z<p>Erik.quandt: /* Characterizing Inducible Promoters */</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli" class="selected"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
<br />
<br />
= '''<center><div style="font-size:150%">Project: Caffeinated Coli</div>''' =<br />
<br />
<br />
[[File:Caffeinated_Bacteria.jpg|center|650px]]<br />
<br />
<br />
<br />
== <div style="font-size:130%;text-align:center">'''Introduction'''</div> ==<br />
''Pseudomonas putida'' CBB5, discovered by Ryan Summers and Mani Subramanian at the University of Iowa can live on caffeine as the sole carbon and nitrogen source. CBB5 uses a Nitrogen demethylation pathway to convert caffeine to xanthine with formaldehyde side products. The xanthine and formaldehyde are then used as the nitrogen and carbon sources respectively.<br />
<br />
The N-demethylation pathway consists of four demethylation genes, ndmA, ndmB, ndmC, and ndmD. ndmA, B, and C remove the methyl groups from the N-1, N-3, and N-7 respectively. This is done with the help of a reductase, ndmD.<br />
<br />
[[File:Ndm diagram.JPG|center|650px]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Strategy'''</div> ==<br />
<br />
=== Refactoring Decaffeination Operon ===<br />
<br />
The first goal of this project involves refactoring the caffeine operon from the caffeine utilization pathway from ''Psuedomonas putida'' CBB5, first characterized by Summers et al. in early 2012. The operon, shown below, will be incorporated into the well characterized bacterium, ''Escherichia coli'' [3]. <br />
<br />
[[File:CBB5_Operon.png|center|650px]]<br />
<br />
Directly importing the operon into ''E. coli'' was determined impractical, as the strength and regulation of the ribosome binding sites (rbs) and operon-controlled promoters in the CBB5 operon may not be optimized for function in ''E. coli''. Additionally, the use in CBB5 of GTG start codons conflicts with E. coli’s preference for ATG – leading to problems in translation initiation.<br />
<br />
We therefore decided to separate out open reading frames for the genes of interest in the CBB5 operon and put them under controlled regulation in a refactored caffeine utilization operon for import into ''E. coli''. The operon's design, shown below and submitted as [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 BBa_K734000], aims to optimize its functionality in its new host. <br />
<br />
[[File:Austin_Texas_Decaffeination_design.png|center]]<br />
<br />
This includes the N-demethylase proteins: ''ndmA'', ''ndmB'', ''ndmC'', and the putative assisting protein ''ndmD''. Also included is the glutathione S-transferase from ''Janthinobacterium'' sp. strain Marseille, necessary for functionality of NdmC. Constitutive expression occurs with a strong, well-characterized promoter ([http://partsregistry.org/wiki/index.php/Part:BBa_J23100 BBa_J23100]) and a strong, well-characterized RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]). Finally, all GTG start codons have been replaced with ATG.<br />
<br />
Sources of parts used in our synthetic decaffeination circuit:<br />
<br />
[[File:Austin_Texas_Part_sources.png|center]]<br />
<br />
==== Assembly ====<br />
<br />
Our operon was assembled via a one-step, six-piece Gibson assembly. Briefly, genes to be stitched together were PCR amplified with overhangs homologous to adjacent genes (or homologous to the vector backbone in the case of the 5' end of the promoter and the 3' end of ''gst9''). The forward primers also contained our chosen RBS and ATG. In a one-pot reaction, a 5'-exonuclease chewed back on the homologous overhangs, allowing adjacent fragments to base pair, and a DNA ligase stitched them together. An overview is shown here.<br />
<br />
[[File:Austin_Texas_Decaffeination_assembly.png|center]] <br />
<br />
=== Operon Testing and Optimization ===<br />
<br />
We will employ two different assays for operon functionality; growth on caffeine as a sole carbon source, and a genetic selection for caffeine demethylation to xanthine. To evaluate the ability to use caffeine as a sole carbon source we will transform TOP 10 E.coli electrocompetent cells with the refactored caffeine utilization operon, grow transformed cells in rich media to saturation and then dilute 1:100 into M9 mineral media. Varying levels of caffeine concentrations will be used to determine the degree of caffeine utilization, and the optimal limit for growth.<br />
<br />
Since the cell has an extremely large requirement for carbon, the energy derived from demethylation may not be enough to support growth. For this reason a second assay for caffeine demethylation based on guanine auxotrophy has been devised. ''E. coli'' synthesizes the nucleotide guanine de novo via a pathway that involves Xanthosine-5’-phosphate (XMP) as an essential intermediate. The enzyme responsible for the formation of XMP (from inosine-5’-phosphate[IMP]) is IMP dehydrogenase, which is encoded by the GuaB gene. If GuaB is knocked out, the cell is unable to synthesize guanine and is therefore unable to grow on media lacking guanine. We plan to take advantage of this engineered auxotrophy and use it as a way to select for cells that are able to demethylate caffeine to xanthine which can then be converted to XMP by xanthine-guanine phosphoribotransferase (gpt) and thereby relieve the metabolic block and restore guanine synthesis allowing for cell growth.<br />
<br />
[[File:guaB_selection_1.jpg|center|650px]]<br />
<br />
Finally, after construction and preliminary testing of the caffeine degradation operon in''E. coli'', we will attempt to grow our cells in the presence of various commercial caffeinated beverages.<br />
<br />
=== Characterizing Inducible Promoters ===<br />
<br />
In Summers et al (2012)., the two open reading frames ''orf1'' and ''orf4'' are thought to be putative regulators of the caffeine degradation operon's N-demethylase proteins due to sequence homology to other known protein regulators (AraC and gntR family). They are hypothesized to bind to operator sequences in the intergenic regions between genes in the operon, which may serve as promoters for the various demethylases of the operon. <br />
<br />
Analysis of the sizes of the intergenic regions of the CBB5 caffeine utilization operon shows that the regions upstream of the ndm genes are all greater than 150bp. The large size of these intergenic regions and the fact that they precede the catabolic enzyme gene leads us to hypothesize that there are caffeine (or other methylxanthine) regulatory elements in these sequences.<br />
<br />
We will clone these open reading frames into the reporter plasmid pRA301. pRA301 contains a promoterless lacZ gene, preceded by a multiple cloning site (MCS). DNA fragments hypothesized to contain promoter elements can be cloned into the MCS and assayed for lacZ expression by Miller assay. Using this method, we can determine the regulatory functionality of each open reading frame by examining varying fluorescence levels.<br />
<br />
==<div style="font-size:130%;text-align:center">'''Results</div>==<br />
<br />
===Decaffeination operon (+ gst9) enables growth of GuaB knockout===<br />
<br />
Our initial refactored operon consisted of CBB5 genes NdmA,B,C,D. We found that this operon was able to support growth of the GuaB knockout on theophylline but not caffeine. This indicated that the demethylase responsible for removing the 7-methyl group (NdmC) was not functional. Of note, Summers et. al (2012) also could not detect NdmC activity when expressed in ''e.coli''. We reasoned that there could be a missing protein required for NdmC activity. Summers et al. (2012) showed that an uncharacterized protein (orf8) copurified in protein fractions assayed for NdmC activity. We reasoned that this protein could be essential for NdmC function. Unfortunately, the complete DNA sequence of orf8 was not available, only a partial sequence of the orf was contained in the known operon sequence. A protein homology search was performed using the available sequence to find potential homologs that might be able to substitute function of the missing orf. The search revealed that an uncharacterized gene, gst9, from ''Janthinobacterium marseille'' shared a high degree of sequence homology (70%). We decided to synthesize the gst9 gene from the available sequence and clone it into our decaffeination operon to see if it would enable NdmC activity and allow for complete demethylation of caffeine. We found our hyphothesis to be true, adding gst9 to our refactored operon [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 (Bba_K734000)] did indeed enable growth of the guaB knockout on m9 mineral media:<br />
<br />
<br />
[[File:UtAustin2012DecaffeinationOperon.jpg|center|650px]]<br />
<br />
From this figure, we see that our decaffeination operon enables the GuaB knockout to grow in the absence of guanine or xanthine supplementation by instead demethylating the available caffeine to produce xanthine. This not only confirms the functionality of our refactored decaffeination operon, but proves a method by which we can use it to auxotrophically select for cells.<br />
<br />
To more accurately determine the utilization of caffeine by our operon, we tested the growth of our E. coli cells containing refactored operon and the knocked out GuaB gene under multiple caffeine concentration conditions. We found that our cells were able to grow at conditions as low as 10uM of caffeine, and peaked at a caffeine concentration of approximately 250uM. Concentrations were grown as high as 5000uM, at which point cells began to die, presumably from caffeine toxicity. <br />
<br />
[[File:AustiniGEM2012GrowthCurve.jpg|center|650px]]<br />
<br />
From these growth conditions, we plated dilutions of up to 10<sup>7</sup> dilution. This was used to determine individual cell growth based on caffeine. Approximately 7.6 +/- 0.8 pg of caffeine were utilized per cell. Assuming the use of guanine in E. coli DNA that is roughly 9.2 Mb and 50% GC, approximately 2.3*10<sup>6</sup> guanines derived from caffeine are shown to be utilized per cell in our engineered organisms. As there are roughly 10<sup>11</sup> bases of RNA per E. coli cell, and approximately 25% of these are guanine, there are approximately 2.55*10<sup>10</sup> guanines required for E. coli cell growth. From this calculation, we can include that our cells are scavenging and utilizing approximately all the caffeine present in the system.<br />
<br />
===Growth in Caffeinated Beverages (Aurko)===<br />
In order to make our experiment more relatable, we experimented with growth of our E. coli strain in various caffeinated beverages. Experiments were first performed on cells with only the GuaB knockout modification, in order to prove that growth in these beverages was even possible. Initial results, shown below, indicate that growth is in fact possible for a wide variety of beverages, including Coca-Cola, 5-Hour Energy, Lipton Tea, and Startbucks Espresso.<br />
<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthInitial.png|center|650px]]<br />
<br />
The graph above shows that the auxotrophic selection of cells using xanthine derivatives again functions as expected – without xanthine, cells were unable to grow under most conditions. The noticeable Optical Densities for 50% Coca-Cola and 50% Espresso are due to the strong background color of the culture and not actual cell growth. 50% 5-Hour Energy and Espresso were both shown to be toxic to our cells. Finally, tea was shown to contain enough natural xanthenes to allow for partial cell growth, and was excluded from further experiments.<br />
<br />
We then attempted to grow our cell strain containing both the GuaB knockout gene and the refactored decaffeination operon. The results of this experiment are shown below.<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthFinal.jpg|center|720px]]<br />
It is important to note that these cells were grown in M9 minimal media containing only 0.2% casein as a natural carbon source. The cells were required to scavange virtually all of their carbon required for guanine synthesis from the caffeine supplied to the system, or die. Our E. coli was able to utilize the caffeine inherent to Coca-Cola, Starbucks Espresso and 5-Hour Energy, as well as caffeine in caffeine. However, without our refactored decaffeination operon, the cells were unable to grow under any conditions. The two small bars that appear above in 50% Coca-Cola and 10% Espresso are simply due to the high background color of the cultures.<br />
<br />
===Transcriptional Regulators===<br />
As described earlier, we hypothesize that the large intergenic regions upstream of various genes in the CBB5 decaffeination operon, particularly upstream of ndmA, may contain methylxanthine regulated promoters. We propose that orf1 and orf4, which were annotated as putative regulators based on sequence homology, act as repressors for the promoters contained in the operon. <br />
<br />
To test these hypotheses, we cloned the intergentic region upstream of the ndmA gene into a promoterless LacZ reporter plasmid, pRA301. This vector enabled quantitative measurement of promoter strength using the β-galactosidase Miller Assay. Additionally, we created compatible biobrick plasmids of each putative repressor, orf1 and orf4, in order to assay their effect on ndmA promoter strength in the presence or absence of methylxanthine supplementation.<br />
<br />
We transformed these plasmids into the Top10 ''E.coli'' strain to create three strains: one containing only the ndmA-LacZ reporter plasmid, and cotransformants containing both the ndmA-LacZ plasmid and either orf1 or orf4 biobrick plasmids. All three ''E. coli'' strains were grown in M9 minimal media + .2% casein (+ appropriate supplement) at 30<sup>o</sup>C for 48 hrs, after which time Miller assays were performed. The results, summarized in the figure below, provide strong evidence that '''''expression of orf4 leads to inhibited ndmA promoter functionality''''', while orf1 expression provides negligible influence on the ndmA promoter. <br />
<br />
[[File:Austin2012ndmARepression.jpg|center|650px]]<br />
<br />
A higher Miller Unit correlates to a higher level of lacZ production, effectively quantifying the degree of gene expression. As the Miller Unit of the strain co-expressed ndmA promoter with orf4 is lower by a factor of roughly 4, it can be inferred that the protein encoded by orf4 regulates the degree to which the ndmA promoter is expressed during transcription.<br />
<br />
It should be noted that while expression of ndmA drops significantly in this experiment, this does not imply that orf4 only inhibits the expression of ndmA. This is discussed in the next section: Inducible Promoters.<br />
<br />
===Inducible Promoters===<br />
As shown above, it appears that orf4 acts as a transcriptional regulator of ndmA expression. One would expect a transcriptional regulator to regulate transcription in a way that is beneficial to the overall fitness of the organism. In certain situations in which a protein is necessary for survival, the transcriptional factor should up-regulate the production of said gene. Likewise, when a protein is not necessary, the transcriptional factor should down-regulate its production.<br />
<br />
We hypothesize that this is the way in which orf4 regulates transcription of ndmA. In situations of high caffeine and related xanthine concentrations, the protein encoded by orf4 up-regulates the expression of ndmA. In the experiment listed [[Team:Austin_Texas/Caffeinated_coli#Transcriptional_Regulators|above]], in which no xanthine derivative was added to the media, the expression of ndmA is inhibited (as shown).<br />
<br />
In order to test this hypothesis, we subjected a strain of Top10 ''E. coli'' cells containing the orf4 gene and the ndmA promoter containing the lacZ gene to varying supplements of caffeine, theobromine, theophylline, and xanthine. Xanthine was shown to be insoluble at high concentratinos, and was therefore removed from the experiment. The results of exposure to varying concentration levels is shown below.<br />
<br />
[[File:UTAustin2012InductionbySubstrate.jpg|center|650px]]<br />
<br />
As predicted, the '''''expression of ndmA appears to rise at higher caffeine concentrations'''''. Similarly, higher concentrations of theobromine and theophylline also appear to increase the expression of ndmA. <br />
<br />
From these experiments we conclude that the ndmA intergenic region contains a promoter that is negatively-regulated by the orf4 protein in the absence of methylxanthines. Upon exposure to methylxanthines, it appears that orf4-mediated repression is relieved, leading to induction. <br />
<br />
===Results Summary===<br />
The main accomplishments we achieved this Summer include<br />
*Refactoring of decaffeination operon from ''P. putida'' into ''E. coli''<br />
*Construction of a auxotrophic selection method using our refactored operon, "addicting" ''E. coli'' to caffeine<br />
*Growth of above cells in common caffeinated beverages<br />
*Discovery of a promoter in the CBB5 operon<br />
*Characterization of an open reading frames in the CBB5 operon as a transcription regulator<br />
<br />
<br />
<html><br />
<div id="footer" /><br />
</html></div>Erik.quandthttp://2012.igem.org/Team:Austin_Texas/Caffeinated_coliTeam:Austin Texas/Caffeinated coli2012-10-02T23:41:10Z<p>Erik.quandt: /* Decaffeination operon (+ gst9) enables growth of GuaB knockout */</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli" class="selected"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
<br />
<br />
= '''<center><div style="font-size:150%">Project: Caffeinated Coli</div>''' =<br />
<br />
<br />
[[File:Caffeinated_Bacteria.jpg|center|650px]]<br />
<br />
<br />
<br />
== <div style="font-size:130%;text-align:center">'''Introduction'''</div> ==<br />
''Pseudomonas putida'' CBB5, discovered by Ryan Summers and Mani Subramanian at the University of Iowa can live on caffeine as the sole carbon and nitrogen source. CBB5 uses a Nitrogen demethylation pathway to convert caffeine to xanthine with formaldehyde side products. The xanthine and formaldehyde are then used as the nitrogen and carbon sources respectively.<br />
<br />
The N-demethylation pathway consists of four demethylation genes, ndmA, ndmB, ndmC, and ndmD. ndmA, B, and C remove the methyl groups from the N-1, N-3, and N-7 respectively. This is done with the help of a reductase, ndmD.<br />
<br />
[[File:Ndm diagram.JPG|center|650px]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Strategy'''</div> ==<br />
<br />
=== Refactoring Decaffeination Operon ===<br />
<br />
The first goal of this project involves refactoring the caffeine operon from the caffeine utilization pathway from ''Psuedomonas putida'' CBB5, first characterized by Summers et al. in early 2012. The operon, shown below, will be incorporated into the well characterized bacterium, ''Escherichia coli'' [3]. <br />
<br />
[[File:CBB5_Operon.png|center|650px]]<br />
<br />
Directly importing the operon into ''E. coli'' was determined impractical, as the strength and regulation of the ribosome binding sites (rbs) and operon-controlled promoters in the CBB5 operon may not be optimized for function in ''E. coli''. Additionally, the use in CBB5 of GTG start codons conflicts with E. coli’s preference for ATG – leading to problems in translation initiation.<br />
<br />
We therefore decided to separate out open reading frames for the genes of interest in the CBB5 operon and put them under controlled regulation in a refactored caffeine utilization operon for import into ''E. coli''. The operon's design, shown below and submitted as [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 BBa_K734000], aims to optimize its functionality in its new host. <br />
<br />
[[File:Austin_Texas_Decaffeination_design.png|center]]<br />
<br />
This includes the N-demethylase proteins: ''ndmA'', ''ndmB'', ''ndmC'', and the putative assisting protein ''ndmD''. Also included is the glutathione S-transferase from ''Janthinobacterium'' sp. strain Marseille, necessary for functionality of NdmC. Constitutive expression occurs with a strong, well-characterized promoter ([http://partsregistry.org/wiki/index.php/Part:BBa_J23100 BBa_J23100]) and a strong, well-characterized RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]). Finally, all GTG start codons have been replaced with ATG.<br />
<br />
Sources of parts used in our synthetic decaffeination circuit:<br />
<br />
[[File:Austin_Texas_Part_sources.png|center]]<br />
<br />
==== Assembly ====<br />
<br />
Our operon was assembled via a one-step, six-piece Gibson assembly. Briefly, genes to be stitched together were PCR amplified with overhangs homologous to adjacent genes (or homologous to the vector backbone in the case of the 5' end of the promoter and the 3' end of ''gst9''). The forward primers also contained our chosen RBS and ATG. In a one-pot reaction, a 5'-exonuclease chewed back on the homologous overhangs, allowing adjacent fragments to base pair, and a DNA ligase stitched them together. An overview is shown here.<br />
<br />
[[File:Austin_Texas_Decaffeination_assembly.png|center]] <br />
<br />
=== Operon Testing and Optimization ===<br />
<br />
We will employ two different assays for operon functionality; growth on caffeine as a sole carbon source, and a genetic selection for caffeine demethylation to xanthine. To evaluate the ability to use caffeine as a sole carbon source we will transform TOP 10 E.coli electrocompetent cells with the refactored caffeine utilization operon, grow transformed cells in rich media to saturation and then dilute 1:100 into M9 mineral media. Varying levels of caffeine concentrations will be used to determine the degree of caffeine utilization, and the optimal limit for growth.<br />
<br />
Since the cell has an extremely large requirement for carbon, the energy derived from demethylation may not be enough to support growth. For this reason a second assay for caffeine demethylation based on guanine auxotrophy has been devised. ''E. coli'' synthesizes the nucleotide guanine de novo via a pathway that involves Xanthosine-5’-phosphate (XMP) as an essential intermediate. The enzyme responsible for the formation of XMP (from inosine-5’-phosphate[IMP]) is IMP dehydrogenase, which is encoded by the GuaB gene. If GuaB is knocked out, the cell is unable to synthesize guanine and is therefore unable to grow on media lacking guanine. We plan to take advantage of this engineered auxotrophy and use it as a way to select for cells that are able to demethylate caffeine to xanthine which can then be converted to XMP by xanthine-guanine phosphoribotransferase (gpt) and thereby relieve the metabolic block and restore guanine synthesis allowing for cell growth.<br />
<br />
[[File:guaB_selection_1.jpg|center|650px]]<br />
<br />
Finally, after construction and preliminary testing of the caffeine degradation operon in''E. coli'', we will attempt to grow our cells in the presence of various commercial caffeinated beverages.<br />
<br />
=== Characterizing Inducible Promoters ===<br />
<br />
In Summmers et al., the two open reading frames ''orf1'' and ''orf4'' are thought to be putative regulators of the caffeine degradation operon's N-demethylase proteins due to the proximity of their genes. They are hypothesized to bind to operator sequences in the intergenic regions between genes in the operon, which may serve as promoters for the various demethylases of the operon. <br />
<br />
Analysis of the sizes of the intergenic regions of the CBB5 caffeine utilization operon shows that the regions upstream of the ndm genes are all greater than 150bp. The large size of these intergenic regions and the fact that they precede the catabolic enzyme gene leads us to hypothesize that there are caffeine (or other methylxanthine) regulatory elements in these sequences.<br />
<br />
We will clone these open reading frames into the reporter plasmid pRA301. pRA301 contains a promoterless lacZ gene, preceded by a multiple cloning site (MCS). DNA fragments hypothesized to contain promoter elements can be cloned into the MCS and assayed for lacZ expression by Miller assay. Using this method, we can determine the regulatory functionality of each open reading frame by examining varying fluorescence levels.<br />
<br />
<br />
<br />
<br />
==<div style="font-size:130%;text-align:center">'''Results</div>==<br />
<br />
===Decaffeination operon (+ gst9) enables growth of GuaB knockout===<br />
<br />
Our initial refactored operon consisted of CBB5 genes NdmA,B,C,D. We found that this operon was able to support growth of the GuaB knockout on theophylline but not caffeine. This indicated that the demethylase responsible for removing the 7-methyl group (NdmC) was not functional. Of note, Summers et. al (2012) also could not detect NdmC activity when expressed in ''e.coli''. We reasoned that there could be a missing protein required for NdmC activity. Summers et al. (2012) showed that an uncharacterized protein (orf8) copurified in protein fractions assayed for NdmC activity. We reasoned that this protein could be essential for NdmC function. Unfortunately, the complete DNA sequence of orf8 was not available, only a partial sequence of the orf was contained in the known operon sequence. A protein homology search was performed using the available sequence to find potential homologs that might be able to substitute function of the missing orf. The search revealed that an uncharacterized gene, gst9, from ''Janthinobacterium marseille'' shared a high degree of sequence homology (70%). We decided to synthesize the gst9 gene from the available sequence and clone it into our decaffeination operon to see if it would enable NdmC activity and allow for complete demethylation of caffeine. We found our hyphothesis to be true, adding gst9 to our refactored operon [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 (Bba_K734000)] did indeed enable growth of the guaB knockout on m9 mineral media:<br />
<br />
<br />
[[File:UtAustin2012DecaffeinationOperon.jpg|center|650px]]<br />
<br />
From this figure, we see that our decaffeination operon enables the GuaB knockout to grow in the absence of guanine or xanthine supplementation by instead demethylating the available caffeine to produce xanthine. This not only confirms the functionality of our refactored decaffeination operon, but proves a method by which we can use it to auxotrophically select for cells.<br />
<br />
To more accurately determine the utilization of caffeine by our operon, we tested the growth of our E. coli cells containing refactored operon and the knocked out GuaB gene under multiple caffeine concentration conditions. We found that our cells were able to grow at conditions as low as 10uM of caffeine, and peaked at a caffeine concentration of approximately 250uM. Concentrations were grown as high as 5000uM, at which point cells began to die, presumably from caffeine toxicity. <br />
<br />
[[File:AustiniGEM2012GrowthCurve.jpg|center|650px]]<br />
<br />
From these growth conditions, we plated dilutions of up to 10<sup>7</sup> dilution. This was used to determine individual cell growth based on caffeine. Approximately 7.6 +/- 0.8 pg of caffeine were utilized per cell. Assuming the use of guanine in E. coli DNA that is roughly 9.2 Mb and 50% GC, approximately 2.3*10<sup>6</sup> guanines derived from caffeine are shown to be utilized per cell in our engineered organisms. As there are roughly 10<sup>11</sup> bases of RNA per E. coli cell, and approximately 25% of these are guanine, there are approximately 2.55*10<sup>10</sup> guanines required for E. coli cell growth. From this calculation, we can include that our cells are scavenging and utilizing approximately all the caffeine present in the system.<br />
<br />
===Growth in Caffeinated Beverages (Aurko)===<br />
In order to make our experiment more relatable, we experimented with growth of our E. coli strain in various caffeinated beverages. Experiments were first performed on cells with only the GuaB knockout modification, in order to prove that growth in these beverages was even possible. Initial results, shown below, indicate that growth is in fact possible for a wide variety of beverages, including Coca-Cola, 5-Hour Energy, Lipton Tea, and Startbucks Espresso.<br />
<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthInitial.png|center|650px]]<br />
<br />
The graph above shows that the auxotrophic selection of cells using xanthine derivatives again functions as expected – without xanthine, cells were unable to grow under most conditions. The noticeable Optical Densities for 50% Coca-Cola and 50% Espresso are due to the strong background color of the culture and not actual cell growth. 50% 5-Hour Energy and Espresso were both shown to be toxic to our cells. Finally, tea was shown to contain enough natural xanthenes to allow for partial cell growth, and was excluded from further experiments.<br />
<br />
We then attempted to grow our cell strain containing both the GuaB knockout gene and the refactored decaffeination operon. The results of this experiment are shown below.<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthFinal.jpg|center|720px]]<br />
It is important to note that these cells were grown in M9 minimal media containing only 0.2% casein as a natural carbon source. The cells were required to scavange virtually all of their carbon required for guanine synthesis from the caffeine supplied to the system, or die. Our E. coli was able to utilize the caffeine inherent to Coca-Cola, Starbucks Espresso and 5-Hour Energy, as well as caffeine in caffeine. However, without our refactored decaffeination operon, the cells were unable to grow under any conditions. The two small bars that appear above in 50% Coca-Cola and 10% Espresso are simply due to the high background color of the cultures.<br />
<br />
===Transcriptional Regulators===<br />
As described earlier, we hypothesize that the large intergenic regions upstream of various genes in the CBB5 decaffeination operon, particularly upstream of ndmA, may contain methylxanthine regulated promoters. We propose that orf1 and orf4, which were annotated as putative regulators based on sequence homology, act as repressors for the promoters contained in the operon. <br />
<br />
To test these hypotheses, we cloned the intergentic region upstream of the ndmA gene into a promoterless LacZ reporter plasmid, pRA301. This vector enabled quantitative measurement of promoter strength using the β-galactosidase Miller Assay. Additionally, we created compatible biobrick plasmids of each putative repressor, orf1 and orf4, in order to assay their effect on ndmA promoter strength in the presence or absence of methylxanthine supplementation.<br />
<br />
We transformed these plasmids into the Top10 ''E.coli'' strain to create three strains: one containing only the ndmA-LacZ reporter plasmid, and cotransformants containing both the ndmA-LacZ plasmid and either orf1 or orf4 biobrick plasmids. All three ''E. coli'' strains were grown in M9 minimal media + .2% casein (+ appropriate supplement) at 30<sup>o</sup>C for 48 hrs, after which time Miller assays were performed. The results, summarized in the figure below, provide strong evidence that '''''expression of orf4 leads to inhibited ndmA promoter functionality''''', while orf1 expression provides negligible influence on the ndmA promoter. <br />
<br />
[[File:Austin2012ndmARepression.jpg|center|650px]]<br />
<br />
A higher Miller Unit correlates to a higher level of lacZ production, effectively quantifying the degree of gene expression. As the Miller Unit of the strain co-expressed ndmA promoter with orf4 is lower by a factor of roughly 4, it can be inferred that the protein encoded by orf4 regulates the degree to which the ndmA promoter is expressed during transcription.<br />
<br />
It should be noted that while expression of ndmA drops significantly in this experiment, this does not imply that orf4 only inhibits the expression of ndmA. This is discussed in the next section: Inducible Promoters.<br />
<br />
===Inducible Promoters===<br />
As shown above, it appears that orf4 acts as a transcriptional regulator of ndmA expression. One would expect a transcriptional regulator to regulate transcription in a way that is beneficial to the overall fitness of the organism. In certain situations in which a protein is necessary for survival, the transcriptional factor should up-regulate the production of said gene. Likewise, when a protein is not necessary, the transcriptional factor should down-regulate its production.<br />
<br />
We hypothesize that this is the way in which orf4 regulates transcription of ndmA. In situations of high caffeine and related xanthine concentrations, the protein encoded by orf4 up-regulates the expression of ndmA. In the experiment listed [[Team:Austin_Texas/Caffeinated_coli#Transcriptional_Regulators|above]], in which no xanthine derivative was added to the media, the expression of ndmA is inhibited (as shown).<br />
<br />
In order to test this hypothesis, we subjected a strain of Top10 ''E. coli'' cells containing the orf4 gene and the ndmA promoter containing the lacZ gene to varying supplements of caffeine, theobromine, theophylline, and xanthine. Xanthine was shown to be insoluble at high concentratinos, and was therefore removed from the experiment. The results of exposure to varying concentration levels is shown below.<br />
<br />
[[File:UTAustin2012InductionbySubstrate.jpg|center|650px]]<br />
<br />
As predicted, the '''''expression of ndmA appears to rise at higher caffeine concentrations'''''. Similarly, higher concentrations of theobromine and theophylline also appear to increase the expression of ndmA. <br />
<br />
From these experiments we conclude that the ndmA intergenic region contains a promoter that is negatively-regulated by the orf4 protein in the absence of methylxanthines. Upon exposure to methylxanthines, it appears that orf4-mediated repression is relieved, leading to induction. <br />
<br />
===Results Summary===<br />
The main accomplishments we achieved this Summer include<br />
*Refactoring of decaffeination operon from ''P. putida'' into ''E. coli''<br />
*Construction of a auxotrophic selection method using our refactored operon, "addicting" ''E. coli'' to caffeine<br />
*Growth of above cells in common caffeinated beverages<br />
*Discovery of a promoter in the CBB5 operon<br />
*Characterization of an open reading frames in the CBB5 operon as a transcription regulator<br />
<br />
<br />
<html><br />
<div id="footer" /><br />
</html></div>Erik.quandthttp://2012.igem.org/Team:Austin_Texas/Caffeinated_coliTeam:Austin Texas/Caffeinated coli2012-10-02T23:40:12Z<p>Erik.quandt: /* Decaffeination operon (+ gst9) enables growth of GuaB knockout */</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli" class="selected"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
<br />
<br />
= '''<center><div style="font-size:150%">Project: Caffeinated Coli</div>''' =<br />
<br />
<br />
[[File:Caffeinated_Bacteria.jpg|center|650px]]<br />
<br />
<br />
<br />
== <div style="font-size:130%;text-align:center">'''Introduction'''</div> ==<br />
''Pseudomonas putida'' CBB5, discovered by Ryan Summers and Mani Subramanian at the University of Iowa can live on caffeine as the sole carbon and nitrogen source. CBB5 uses a Nitrogen demethylation pathway to convert caffeine to xanthine with formaldehyde side products. The xanthine and formaldehyde are then used as the nitrogen and carbon sources respectively.<br />
<br />
The N-demethylation pathway consists of four demethylation genes, ndmA, ndmB, ndmC, and ndmD. ndmA, B, and C remove the methyl groups from the N-1, N-3, and N-7 respectively. This is done with the help of a reductase, ndmD.<br />
<br />
[[File:Ndm diagram.JPG|center|650px]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Strategy'''</div> ==<br />
<br />
=== Refactoring Decaffeination Operon ===<br />
<br />
The first goal of this project involves refactoring the caffeine operon from the caffeine utilization pathway from ''Psuedomonas putida'' CBB5, first characterized by Summers et al. in early 2012. The operon, shown below, will be incorporated into the well characterized bacterium, ''Escherichia coli'' [3]. <br />
<br />
[[File:CBB5_Operon.png|center|650px]]<br />
<br />
Directly importing the operon into ''E. coli'' was determined impractical, as the strength and regulation of the ribosome binding sites (rbs) and operon-controlled promoters in the CBB5 operon may not be optimized for function in ''E. coli''. Additionally, the use in CBB5 of GTG start codons conflicts with E. coli’s preference for ATG – leading to problems in translation initiation.<br />
<br />
We therefore decided to separate out open reading frames for the genes of interest in the CBB5 operon and put them under controlled regulation in a refactored caffeine utilization operon for import into ''E. coli''. The operon's design, shown below and submitted as [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 BBa_K734000], aims to optimize its functionality in its new host. <br />
<br />
[[File:Austin_Texas_Decaffeination_design.png|center]]<br />
<br />
This includes the N-demethylase proteins: ''ndmA'', ''ndmB'', ''ndmC'', and the putative assisting protein ''ndmD''. Also included is the glutathione S-transferase from ''Janthinobacterium'' sp. strain Marseille, necessary for functionality of NdmC. Constitutive expression occurs with a strong, well-characterized promoter ([http://partsregistry.org/wiki/index.php/Part:BBa_J23100 BBa_J23100]) and a strong, well-characterized RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]). Finally, all GTG start codons have been replaced with ATG.<br />
<br />
Sources of parts used in our synthetic decaffeination circuit:<br />
<br />
[[File:Austin_Texas_Part_sources.png|center]]<br />
<br />
==== Assembly ====<br />
<br />
Our operon was assembled via a one-step, six-piece Gibson assembly. Briefly, genes to be stitched together were PCR amplified with overhangs homologous to adjacent genes (or homologous to the vector backbone in the case of the 5' end of the promoter and the 3' end of ''gst9''). The forward primers also contained our chosen RBS and ATG. In a one-pot reaction, a 5'-exonuclease chewed back on the homologous overhangs, allowing adjacent fragments to base pair, and a DNA ligase stitched them together. An overview is shown here.<br />
<br />
[[File:Austin_Texas_Decaffeination_assembly.png|center]] <br />
<br />
=== Operon Testing and Optimization ===<br />
<br />
We will employ two different assays for operon functionality; growth on caffeine as a sole carbon source, and a genetic selection for caffeine demethylation to xanthine. To evaluate the ability to use caffeine as a sole carbon source we will transform TOP 10 E.coli electrocompetent cells with the refactored caffeine utilization operon, grow transformed cells in rich media to saturation and then dilute 1:100 into M9 mineral media. Varying levels of caffeine concentrations will be used to determine the degree of caffeine utilization, and the optimal limit for growth.<br />
<br />
Since the cell has an extremely large requirement for carbon, the energy derived from demethylation may not be enough to support growth. For this reason a second assay for caffeine demethylation based on guanine auxotrophy has been devised. ''E. coli'' synthesizes the nucleotide guanine de novo via a pathway that involves Xanthosine-5’-phosphate (XMP) as an essential intermediate. The enzyme responsible for the formation of XMP (from inosine-5’-phosphate[IMP]) is IMP dehydrogenase, which is encoded by the GuaB gene. If GuaB is knocked out, the cell is unable to synthesize guanine and is therefore unable to grow on media lacking guanine. We plan to take advantage of this engineered auxotrophy and use it as a way to select for cells that are able to demethylate caffeine to xanthine which can then be converted to XMP by xanthine-guanine phosphoribotransferase (gpt) and thereby relieve the metabolic block and restore guanine synthesis allowing for cell growth.<br />
<br />
[[File:guaB_selection_1.jpg|center|650px]]<br />
<br />
Finally, after construction and preliminary testing of the caffeine degradation operon in''E. coli'', we will attempt to grow our cells in the presence of various commercial caffeinated beverages.<br />
<br />
=== Characterizing Inducible Promoters ===<br />
<br />
In Summmers et al., the two open reading frames ''orf1'' and ''orf4'' are thought to be putative regulators of the caffeine degradation operon's N-demethylase proteins due to the proximity of their genes. They are hypothesized to bind to operator sequences in the intergenic regions between genes in the operon, which may serve as promoters for the various demethylases of the operon. <br />
<br />
Analysis of the sizes of the intergenic regions of the CBB5 caffeine utilization operon shows that the regions upstream of the ndm genes are all greater than 150bp. The large size of these intergenic regions and the fact that they precede the catabolic enzyme gene leads us to hypothesize that there are caffeine (or other methylxanthine) regulatory elements in these sequences.<br />
<br />
We will clone these open reading frames into the reporter plasmid pRA301. pRA301 contains a promoterless lacZ gene, preceded by a multiple cloning site (MCS). DNA fragments hypothesized to contain promoter elements can be cloned into the MCS and assayed for lacZ expression by Miller assay. Using this method, we can determine the regulatory functionality of each open reading frame by examining varying fluorescence levels.<br />
<br />
<br />
<br />
<br />
==<div style="font-size:130%;text-align:center">'''Results</div>==<br />
<br />
===Decaffeination operon (+ gst9) enables growth of GuaB knockout===<br />
<br />
Our initial refactored operon consisted of genes NdmA,B,C,D. We found that this operon was able to support growth of the GuaB knockout on theophylline but not caffeine. This indicated that the demethylase responsible for removing the 7-methyl group (NdmC) was not functional. Of note, Summers et. al (2012) also could not detect NdmC activity when expressed in ''e.coli''. We reasoned that there could be a missing protein required for NdmC activity. Summers et al. (2012) showed that an uncharacterized protein (orf8) copurified in protein fractions assayed for NdmC activity. We reasoned that this protein could be essential for NdmC function. Unfortunately, the complete DNA sequence of orf8 was not available, only a partial sequence of the orf was contained in the known operon sequence. A protein homology search was performed using the available sequence to find potential homologs that might be able to substitute function of the missing orf. The search revealed that an uncharacterized gene, gst9, from ''Janthinobacterium marseille'' shared a high degree of sequence homology (70%). We decided to synthesize the gst9 gene from the available sequence and clone it into our decaffeination operon to see if it would enable NdmC activity and allow for complete demethylation of caffeine. We found our hyphothesis to be true, adding gst9 to our refactored operon [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 (Bba_K734000)] did indeed enable growth of the guaB knockout on m9 mineral media:<br />
<br />
<br />
[[File:UtAustin2012DecaffeinationOperon.jpg|center|650px]]<br />
<br />
From this figure, we see that our decaffeination operon enables the GuaB knockout to grow in the absence of guanine or xanthine supplementation by instead demethylating the available caffeine to produce xanthine. This not only confirms the functionality of our refactored decaffeination operon, but proves a method by which we can use it to auxotrophically select for cells.<br />
<br />
To more accurately determine the utilization of caffeine by our operon, we tested the growth of our E. coli cells containing refactored operon and the knocked out GuaB gene under multiple caffeine concentration conditions. We found that our cells were able to grow at conditions as low as 10uM of caffeine, and peaked at a caffeine concentration of approximately 250uM. Concentrations were grown as high as 5000uM, at which point cells began to die, presumably from caffeine toxicity. <br />
<br />
[[File:AustiniGEM2012GrowthCurve.jpg|center|650px]]<br />
<br />
From these growth conditions, we plated dilutions of up to 10<sup>7</sup> dilution. This was used to determine individual cell growth based on caffeine. Approximately 7.6 +/- 0.8 pg of caffeine were utilized per cell. Assuming the use of guanine in E. coli DNA that is roughly 9.2 Mb and 50% GC, approximately 2.3*10<sup>6</sup> guanines derived from caffeine are shown to be utilized per cell in our engineered organisms. As there are roughly 10<sup>11</sup> bases of RNA per E. coli cell, and approximately 25% of these are guanine, there are approximately 2.55*10<sup>10</sup> guanines required for E. coli cell growth. From this calculation, we can include that our cells are scavenging and utilizing approximately all the caffeine present in the system.<br />
<br />
===Growth in Caffeinated Beverages (Aurko)===<br />
In order to make our experiment more relatable, we experimented with growth of our E. coli strain in various caffeinated beverages. Experiments were first performed on cells with only the GuaB knockout modification, in order to prove that growth in these beverages was even possible. Initial results, shown below, indicate that growth is in fact possible for a wide variety of beverages, including Coca-Cola, 5-Hour Energy, Lipton Tea, and Startbucks Espresso.<br />
<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthInitial.png|center|650px]]<br />
<br />
The graph above shows that the auxotrophic selection of cells using xanthine derivatives again functions as expected – without xanthine, cells were unable to grow under most conditions. The noticeable Optical Densities for 50% Coca-Cola and 50% Espresso are due to the strong background color of the culture and not actual cell growth. 50% 5-Hour Energy and Espresso were both shown to be toxic to our cells. Finally, tea was shown to contain enough natural xanthenes to allow for partial cell growth, and was excluded from further experiments.<br />
<br />
We then attempted to grow our cell strain containing both the GuaB knockout gene and the refactored decaffeination operon. The results of this experiment are shown below.<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthFinal.jpg|center|720px]]<br />
It is important to note that these cells were grown in M9 minimal media containing only 0.2% casein as a natural carbon source. The cells were required to scavange virtually all of their carbon required for guanine synthesis from the caffeine supplied to the system, or die. Our E. coli was able to utilize the caffeine inherent to Coca-Cola, Starbucks Espresso and 5-Hour Energy, as well as caffeine in caffeine. However, without our refactored decaffeination operon, the cells were unable to grow under any conditions. The two small bars that appear above in 50% Coca-Cola and 10% Espresso are simply due to the high background color of the cultures.<br />
<br />
===Transcriptional Regulators===<br />
As described earlier, we hypothesize that the large intergenic regions upstream of various genes in the CBB5 decaffeination operon, particularly upstream of ndmA, may contain methylxanthine regulated promoters. We propose that orf1 and orf4, which were annotated as putative regulators based on sequence homology, act as repressors for the promoters contained in the operon. <br />
<br />
To test these hypotheses, we cloned the intergentic region upstream of the ndmA gene into a promoterless LacZ reporter plasmid, pRA301. This vector enabled quantitative measurement of promoter strength using the β-galactosidase Miller Assay. Additionally, we created compatible biobrick plasmids of each putative repressor, orf1 and orf4, in order to assay their effect on ndmA promoter strength in the presence or absence of methylxanthine supplementation.<br />
<br />
We transformed these plasmids into the Top10 ''E.coli'' strain to create three strains: one containing only the ndmA-LacZ reporter plasmid, and cotransformants containing both the ndmA-LacZ plasmid and either orf1 or orf4 biobrick plasmids. All three ''E. coli'' strains were grown in M9 minimal media + .2% casein (+ appropriate supplement) at 30<sup>o</sup>C for 48 hrs, after which time Miller assays were performed. The results, summarized in the figure below, provide strong evidence that '''''expression of orf4 leads to inhibited ndmA promoter functionality''''', while orf1 expression provides negligible influence on the ndmA promoter. <br />
<br />
[[File:Austin2012ndmARepression.jpg|center|650px]]<br />
<br />
A higher Miller Unit correlates to a higher level of lacZ production, effectively quantifying the degree of gene expression. As the Miller Unit of the strain co-expressed ndmA promoter with orf4 is lower by a factor of roughly 4, it can be inferred that the protein encoded by orf4 regulates the degree to which the ndmA promoter is expressed during transcription.<br />
<br />
It should be noted that while expression of ndmA drops significantly in this experiment, this does not imply that orf4 only inhibits the expression of ndmA. This is discussed in the next section: Inducible Promoters.<br />
<br />
===Inducible Promoters===<br />
As shown above, it appears that orf4 acts as a transcriptional regulator of ndmA expression. One would expect a transcriptional regulator to regulate transcription in a way that is beneficial to the overall fitness of the organism. In certain situations in which a protein is necessary for survival, the transcriptional factor should up-regulate the production of said gene. Likewise, when a protein is not necessary, the transcriptional factor should down-regulate its production.<br />
<br />
We hypothesize that this is the way in which orf4 regulates transcription of ndmA. In situations of high caffeine and related xanthine concentrations, the protein encoded by orf4 up-regulates the expression of ndmA. In the experiment listed [[Team:Austin_Texas/Caffeinated_coli#Transcriptional_Regulators|above]], in which no xanthine derivative was added to the media, the expression of ndmA is inhibited (as shown).<br />
<br />
In order to test this hypothesis, we subjected a strain of Top10 ''E. coli'' cells containing the orf4 gene and the ndmA promoter containing the lacZ gene to varying supplements of caffeine, theobromine, theophylline, and xanthine. Xanthine was shown to be insoluble at high concentratinos, and was therefore removed from the experiment. The results of exposure to varying concentration levels is shown below.<br />
<br />
[[File:UTAustin2012InductionbySubstrate.jpg|center|650px]]<br />
<br />
As predicted, the '''''expression of ndmA appears to rise at higher caffeine concentrations'''''. Similarly, higher concentrations of theobromine and theophylline also appear to increase the expression of ndmA. <br />
<br />
From these experiments we conclude that the ndmA intergenic region contains a promoter that is negatively-regulated by the orf4 protein in the absence of methylxanthines. Upon exposure to methylxanthines, it appears that orf4-mediated repression is relieved, leading to induction. <br />
<br />
===Results Summary===<br />
The main accomplishments we achieved this Summer include<br />
*Refactoring of decaffeination operon from ''P. putida'' into ''E. coli''<br />
*Construction of a auxotrophic selection method using our refactored operon, "addicting" ''E. coli'' to caffeine<br />
*Growth of above cells in common caffeinated beverages<br />
*Discovery of a promoter in the CBB5 operon<br />
*Characterization of an open reading frames in the CBB5 operon as a transcription regulator<br />
<br />
<br />
<html><br />
<div id="footer" /><br />
</html></div>Erik.quandthttp://2012.igem.org/Team:Austin_Texas/Caffeinated_coliTeam:Austin Texas/Caffeinated coli2012-10-02T23:38:29Z<p>Erik.quandt: /* Decaffeination operon (+ gst9) enables growth of GuaB knockout */</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli" class="selected"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
<br />
<br />
= '''<center><div style="font-size:150%">Project: Caffeinated Coli</div>''' =<br />
<br />
<br />
[[File:Caffeinated_Bacteria.jpg|center|650px]]<br />
<br />
<br />
<br />
== <div style="font-size:130%;text-align:center">'''Introduction'''</div> ==<br />
''Pseudomonas putida'' CBB5, discovered by Ryan Summers and Mani Subramanian at the University of Iowa can live on caffeine as the sole carbon and nitrogen source. CBB5 uses a Nitrogen demethylation pathway to convert caffeine to xanthine with formaldehyde side products. The xanthine and formaldehyde are then used as the nitrogen and carbon sources respectively.<br />
<br />
The N-demethylation pathway consists of four demethylation genes, ndmA, ndmB, ndmC, and ndmD. ndmA, B, and C remove the methyl groups from the N-1, N-3, and N-7 respectively. This is done with the help of a reductase, ndmD.<br />
<br />
[[File:Ndm diagram.JPG|center|650px]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Strategy'''</div> ==<br />
<br />
=== Refactoring Decaffeination Operon ===<br />
<br />
The first goal of this project involves refactoring the caffeine operon from the caffeine utilization pathway from ''Psuedomonas putida'' CBB5, first characterized by Summers et al. in early 2012. The operon, shown below, will be incorporated into the well characterized bacterium, ''Escherichia coli'' [3]. <br />
<br />
[[File:CBB5_Operon.png|center|650px]]<br />
<br />
Directly importing the operon into ''E. coli'' was determined impractical, as the strength and regulation of the ribosome binding sites (rbs) and operon-controlled promoters in the CBB5 operon may not be optimized for function in ''E. coli''. Additionally, the use in CBB5 of GTG start codons conflicts with E. coli’s preference for ATG – leading to problems in translation initiation.<br />
<br />
We therefore decided to separate out open reading frames for the genes of interest in the CBB5 operon and put them under controlled regulation in a refactored caffeine utilization operon for import into ''E. coli''. The operon's design, shown below and submitted as [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 BBa_K734000], aims to optimize its functionality in its new host. <br />
<br />
[[File:Austin_Texas_Decaffeination_design.png|center]]<br />
<br />
This includes the N-demethylase proteins: ''ndmA'', ''ndmB'', ''ndmC'', and the putative assisting protein ''ndmD''. Also included is the glutathione S-transferase from ''Janthinobacterium'' sp. strain Marseille, necessary for functionality of NdmC. Constitutive expression occurs with a strong, well-characterized promoter ([http://partsregistry.org/wiki/index.php/Part:BBa_J23100 BBa_J23100]) and a strong, well-characterized RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]). Finally, all GTG start codons have been replaced with ATG.<br />
<br />
Sources of parts used in our synthetic decaffeination circuit:<br />
<br />
[[File:Austin_Texas_Part_sources.png|center]]<br />
<br />
==== Assembly ====<br />
<br />
Our operon was assembled via a one-step, six-piece Gibson assembly. Briefly, genes to be stitched together were PCR amplified with overhangs homologous to adjacent genes (or homologous to the vector backbone in the case of the 5' end of the promoter and the 3' end of ''gst9''). The forward primers also contained our chosen RBS and ATG. In a one-pot reaction, a 5'-exonuclease chewed back on the homologous overhangs, allowing adjacent fragments to base pair, and a DNA ligase stitched them together. An overview is shown here.<br />
<br />
[[File:Austin_Texas_Decaffeination_assembly.png|center]] <br />
<br />
=== Operon Testing and Optimization ===<br />
<br />
We will employ two different assays for operon functionality; growth on caffeine as a sole carbon source, and a genetic selection for caffeine demethylation to xanthine. To evaluate the ability to use caffeine as a sole carbon source we will transform TOP 10 E.coli electrocompetent cells with the refactored caffeine utilization operon, grow transformed cells in rich media to saturation and then dilute 1:100 into M9 mineral media. Varying levels of caffeine concentrations will be used to determine the degree of caffeine utilization, and the optimal limit for growth.<br />
<br />
Since the cell has an extremely large requirement for carbon, the energy derived from demethylation may not be enough to support growth. For this reason a second assay for caffeine demethylation based on guanine auxotrophy has been devised. ''E. coli'' synthesizes the nucleotide guanine de novo via a pathway that involves Xanthosine-5’-phosphate (XMP) as an essential intermediate. The enzyme responsible for the formation of XMP (from inosine-5’-phosphate[IMP]) is IMP dehydrogenase, which is encoded by the GuaB gene. If GuaB is knocked out, the cell is unable to synthesize guanine and is therefore unable to grow on media lacking guanine. We plan to take advantage of this engineered auxotrophy and use it as a way to select for cells that are able to demethylate caffeine to xanthine which can then be converted to XMP by xanthine-guanine phosphoribotransferase (gpt) and thereby relieve the metabolic block and restore guanine synthesis allowing for cell growth.<br />
<br />
[[File:guaB_selection_1.jpg|center|650px]]<br />
<br />
Finally, after construction and preliminary testing of the caffeine degradation operon in''E. coli'', we will attempt to grow our cells in the presence of various commercial caffeinated beverages.<br />
<br />
=== Characterizing Inducible Promoters ===<br />
<br />
In Summmers et al., the two open reading frames ''orf1'' and ''orf4'' are thought to be putative regulators of the caffeine degradation operon's N-demethylase proteins due to the proximity of their genes. They are hypothesized to bind to operator sequences in the intergenic regions between genes in the operon, which may serve as promoters for the various demethylases of the operon. <br />
<br />
Analysis of the sizes of the intergenic regions of the CBB5 caffeine utilization operon shows that the regions upstream of the ndm genes are all greater than 150bp. The large size of these intergenic regions and the fact that they precede the catabolic enzyme gene leads us to hypothesize that there are caffeine (or other methylxanthine) regulatory elements in these sequences.<br />
<br />
We will clone these open reading frames into the reporter plasmid pRA301. pRA301 contains a promoterless lacZ gene, preceded by a multiple cloning site (MCS). DNA fragments hypothesized to contain promoter elements can be cloned into the MCS and assayed for lacZ expression by Miller assay. Using this method, we can determine the regulatory functionality of each open reading frame by examining varying fluorescence levels.<br />
<br />
<br />
<br />
<br />
==<div style="font-size:130%;text-align:center">'''Results</div>==<br />
<br />
===Decaffeination operon (+ gst9) enables growth of GuaB knockout===<br />
<br />
Our initial refactored operon consisted of genes NdmA,B,C,D. We found that this operon was able to support growth of the GuaB knockout on theophylline but not caffeine. This indicated that the demethylase responsible for removing the 7-methyl group (NdmC) was not functional. Of note, Summers et. al (2012) also could not detect NdmC activity when expressed in ''e.coli''. We reasoned that there could be a missing protein required for NdmC activity. Summers et al. (2012) showed that an uncharacterized protein (orf8) copurified in protein fractions assayed for NdmC activity. We reasoned that this protein could be essential for NdmC function. Unfortunately, the complete DNA sequence of orf8 was not available, only a partial sequence of the orf was contained in the known operon sequence. A protein homology search was performed using the available sequence to find potential homologs that might be able to substitute function of the missing orf. The search revealed that an uncharacterized gene, gst9, from ''Janthinobacterium marseille'' shared a high degree of sequence homology (70%). We decided to synthesize the gst9 gene from the available sequence and clone it into our decaffeination operon to see if it would enable NdmC activity and allow for complete demethylation of caffeine. We found our hyphothesis to be true, adding gst9 to our refactored operon [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 Bba_K734000] did indeed enable growth of the guaB knockout on m9 mineral media:<br />
<br />
<br />
[[File:UtAustin2012DecaffeinationOperon.jpg|center|650px]]<br />
<br />
From this figure, we see that our decaffeination operon enables the GuaB knockout to grow in the absence of guanine or xanthine supplementation by instead demethylating the available caffeine to produce xanthine. This not only confirms the functionality of our refactored decaffeination operon, but proves a method by which we can use it to auxotrophically select for cells.<br />
<br />
To more accurately determine the utilization of caffeine by our operon, we tested the growth of our E. coli cells containing refactored operon and the knocked out GuaB gene under multiple caffeine concentration conditions. We found that our cells were able to grow at conditions as low as 10uM of caffeine, and peaked at a caffeine concentration of approximately 250uM. Concentrations were grown as high as 5000uM, at which point cells began to die, presumably from caffeine toxicity. <br />
<br />
[[File:AustiniGEM2012GrowthCurve.jpg|center|650px]]<br />
<br />
From these growth conditions, we plated dilutions of up to 10<sup>7</sup> dilution. This was used to determine individual cell growth based on caffeine. Approximately 7.6 +/- 0.8 pg of caffeine were utilized per cell. Assuming the use of guanine in E. coli DNA that is roughly 9.2 Mb and 50% GC, approximately 2.3*10<sup>6</sup> guanines derived from caffeine are shown to be utilized per cell in our engineered organisms. As there are roughly 10<sup>11</sup> bases of RNA per E. coli cell, and approximately 25% of these are guanine, there are approximately 2.55*10<sup>10</sup> guanines required for E. coli cell growth. From this calculation, we can include that our cells are scavenging and utilizing approximately all the caffeine present in the system.<br />
<br />
===Growth in Caffeinated Beverages (Aurko)===<br />
In order to make our experiment more relatable, we experimented with growth of our E. coli strain in various caffeinated beverages. Experiments were first performed on cells with only the GuaB knockout modification, in order to prove that growth in these beverages was even possible. Initial results, shown below, indicate that growth is in fact possible for a wide variety of beverages, including Coca-Cola, 5-Hour Energy, Lipton Tea, and Startbucks Espresso.<br />
<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthInitial.png|center|650px]]<br />
<br />
The graph above shows that the auxotrophic selection of cells using xanthine derivatives again functions as expected – without xanthine, cells were unable to grow under most conditions. The noticeable Optical Densities for 50% Coca-Cola and 50% Espresso are due to the strong background color of the culture and not actual cell growth. 50% 5-Hour Energy and Espresso were both shown to be toxic to our cells. Finally, tea was shown to contain enough natural xanthenes to allow for partial cell growth, and was excluded from further experiments.<br />
<br />
We then attempted to grow our cell strain containing both the GuaB knockout gene and the refactored decaffeination operon. The results of this experiment are shown below.<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthFinal.jpg|center|720px]]<br />
It is important to note that these cells were grown in M9 minimal media containing only 0.2% casein as a natural carbon source. The cells were required to scavange virtually all of their carbon required for guanine synthesis from the caffeine supplied to the system, or die. Our E. coli was able to utilize the caffeine inherent to Coca-Cola, Starbucks Espresso and 5-Hour Energy, as well as caffeine in caffeine. However, without our refactored decaffeination operon, the cells were unable to grow under any conditions. The two small bars that appear above in 50% Coca-Cola and 10% Espresso are simply due to the high background color of the cultures.<br />
<br />
===Transcriptional Regulators===<br />
As described earlier, we hypothesize that the large intergenic regions upstream of various genes in the CBB5 decaffeination operon, particularly upstream of ndmA, may contain methylxanthine regulated promoters. We propose that orf1 and orf4, which were annotated as putative regulators based on sequence homology, act as repressors for the promoters contained in the operon. <br />
<br />
To test these hypotheses, we cloned the intergentic region upstream of the ndmA gene into a promoterless LacZ reporter plasmid, pRA301. This vector enabled quantitative measurement of promoter strength using the β-galactosidase Miller Assay. Additionally, we created compatible biobrick plasmids of each putative repressor, orf1 and orf4, in order to assay their effect on ndmA promoter strength in the presence or absence of methylxanthine supplementation.<br />
<br />
We transformed these plasmids into the Top10 ''E.coli'' strain to create three strains: one containing only the ndmA-LacZ reporter plasmid, and cotransformants containing both the ndmA-LacZ plasmid and either orf1 or orf4 biobrick plasmids. All three ''E. coli'' strains were grown in M9 minimal media + .2% casein (+ appropriate supplement) at 30<sup>o</sup>C for 48 hrs, after which time Miller assays were performed. The results, summarized in the figure below, provide strong evidence that '''''expression of orf4 leads to inhibited ndmA promoter functionality''''', while orf1 expression provides negligible influence on the ndmA promoter. <br />
<br />
[[File:Austin2012ndmARepression.jpg|center|650px]]<br />
<br />
A higher Miller Unit correlates to a higher level of lacZ production, effectively quantifying the degree of gene expression. As the Miller Unit of the strain co-expressed ndmA promoter with orf4 is lower by a factor of roughly 4, it can be inferred that the protein encoded by orf4 regulates the degree to which the ndmA promoter is expressed during transcription.<br />
<br />
It should be noted that while expression of ndmA drops significantly in this experiment, this does not imply that orf4 only inhibits the expression of ndmA. This is discussed in the next section: Inducible Promoters.<br />
<br />
===Inducible Promoters===<br />
As shown above, it appears that orf4 acts as a transcriptional regulator of ndmA expression. One would expect a transcriptional regulator to regulate transcription in a way that is beneficial to the overall fitness of the organism. In certain situations in which a protein is necessary for survival, the transcriptional factor should up-regulate the production of said gene. Likewise, when a protein is not necessary, the transcriptional factor should down-regulate its production.<br />
<br />
We hypothesize that this is the way in which orf4 regulates transcription of ndmA. In situations of high caffeine and related xanthine concentrations, the protein encoded by orf4 up-regulates the expression of ndmA. In the experiment listed [[Team:Austin_Texas/Caffeinated_coli#Transcriptional_Regulators|above]], in which no xanthine derivative was added to the media, the expression of ndmA is inhibited (as shown).<br />
<br />
In order to test this hypothesis, we subjected a strain of Top10 ''E. coli'' cells containing the orf4 gene and the ndmA promoter containing the lacZ gene to varying supplements of caffeine, theobromine, theophylline, and xanthine. Xanthine was shown to be insoluble at high concentratinos, and was therefore removed from the experiment. The results of exposure to varying concentration levels is shown below.<br />
<br />
[[File:UTAustin2012InductionbySubstrate.jpg|center|650px]]<br />
<br />
As predicted, the '''''expression of ndmA appears to rise at higher caffeine concentrations'''''. Similarly, higher concentrations of theobromine and theophylline also appear to increase the expression of ndmA. <br />
<br />
From these experiments we conclude that the ndmA intergenic region contains a promoter that is negatively-regulated by the orf4 protein in the absence of methylxanthines. Upon exposure to methylxanthines, it appears that orf4-mediated repression is relieved, leading to induction. <br />
<br />
===Results Summary===<br />
The main accomplishments we achieved this Summer include<br />
*Refactoring of decaffeination operon from ''P. putida'' into ''E. coli''<br />
*Construction of a auxotrophic selection method using our refactored operon, "addicting" ''E. coli'' to caffeine<br />
*Growth of above cells in common caffeinated beverages<br />
*Discovery of a promoter in the CBB5 operon<br />
*Characterization of an open reading frames in the CBB5 operon as a transcription regulator<br />
<br />
<br />
<html><br />
<div id="footer" /><br />
</html></div>Erik.quandthttp://2012.igem.org/Team:Austin_Texas/Caffeinated_coliTeam:Austin Texas/Caffeinated coli2012-10-02T23:36:43Z<p>Erik.quandt: /* Decaffeination operon (+ gst9) enables growth of GuaB knockout */</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli" class="selected"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
<br />
<br />
= '''<center><div style="font-size:150%">Project: Caffeinated Coli</div>''' =<br />
<br />
<br />
[[File:Caffeinated_Bacteria.jpg|center|650px]]<br />
<br />
<br />
<br />
== <div style="font-size:130%;text-align:center">'''Introduction'''</div> ==<br />
''Pseudomonas putida'' CBB5, discovered by Ryan Summers and Mani Subramanian at the University of Iowa can live on caffeine as the sole carbon and nitrogen source. CBB5 uses a Nitrogen demethylation pathway to convert caffeine to xanthine with formaldehyde side products. The xanthine and formaldehyde are then used as the nitrogen and carbon sources respectively.<br />
<br />
The N-demethylation pathway consists of four demethylation genes, ndmA, ndmB, ndmC, and ndmD. ndmA, B, and C remove the methyl groups from the N-1, N-3, and N-7 respectively. This is done with the help of a reductase, ndmD.<br />
<br />
[[File:Ndm diagram.JPG|center|650px]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Strategy'''</div> ==<br />
<br />
=== Refactoring Decaffeination Operon ===<br />
<br />
The first goal of this project involves refactoring the caffeine operon from the caffeine utilization pathway from ''Psuedomonas putida'' CBB5, first characterized by Summers et al. in early 2012. The operon, shown below, will be incorporated into the well characterized bacterium, ''Escherichia coli'' [3]. <br />
<br />
[[File:CBB5_Operon.png|center|650px]]<br />
<br />
Directly importing the operon into ''E. coli'' was determined impractical, as the strength and regulation of the ribosome binding sites (rbs) and operon-controlled promoters in the CBB5 operon may not be optimized for function in ''E. coli''. Additionally, the use in CBB5 of GTG start codons conflicts with E. coli’s preference for ATG – leading to problems in translation initiation.<br />
<br />
We therefore decided to separate out open reading frames for the genes of interest in the CBB5 operon and put them under controlled regulation in a refactored caffeine utilization operon for import into ''E. coli''. The operon's design, shown below and submitted as [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 BBa_K734000], aims to optimize its functionality in its new host. <br />
<br />
[[File:Austin_Texas_Decaffeination_design.png|center]]<br />
<br />
This includes the N-demethylase proteins: ''ndmA'', ''ndmB'', ''ndmC'', and the putative assisting protein ''ndmD''. Also included is the glutathione S-transferase from ''Janthinobacterium'' sp. strain Marseille, necessary for functionality of NdmC. Constitutive expression occurs with a strong, well-characterized promoter ([http://partsregistry.org/wiki/index.php/Part:BBa_J23100 BBa_J23100]) and a strong, well-characterized RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]). Finally, all GTG start codons have been replaced with ATG.<br />
<br />
Sources of parts used in our synthetic decaffeination circuit:<br />
<br />
[[File:Austin_Texas_Part_sources.png|center]]<br />
<br />
==== Assembly ====<br />
<br />
Our operon was assembled via a one-step, six-piece Gibson assembly. Briefly, genes to be stitched together were PCR amplified with overhangs homologous to adjacent genes (or homologous to the vector backbone in the case of the 5' end of the promoter and the 3' end of ''gst9''). The forward primers also contained our chosen RBS and ATG. In a one-pot reaction, a 5'-exonuclease chewed back on the homologous overhangs, allowing adjacent fragments to base pair, and a DNA ligase stitched them together. An overview is shown here.<br />
<br />
[[File:Austin_Texas_Decaffeination_assembly.png|center]] <br />
<br />
=== Operon Testing and Optimization ===<br />
<br />
We will employ two different assays for operon functionality; growth on caffeine as a sole carbon source, and a genetic selection for caffeine demethylation to xanthine. To evaluate the ability to use caffeine as a sole carbon source we will transform TOP 10 E.coli electrocompetent cells with the refactored caffeine utilization operon, grow transformed cells in rich media to saturation and then dilute 1:100 into M9 mineral media. Varying levels of caffeine concentrations will be used to determine the degree of caffeine utilization, and the optimal limit for growth.<br />
<br />
Since the cell has an extremely large requirement for carbon, the energy derived from demethylation may not be enough to support growth. For this reason a second assay for caffeine demethylation based on guanine auxotrophy has been devised. ''E. coli'' synthesizes the nucleotide guanine de novo via a pathway that involves Xanthosine-5’-phosphate (XMP) as an essential intermediate. The enzyme responsible for the formation of XMP (from inosine-5’-phosphate[IMP]) is IMP dehydrogenase, which is encoded by the GuaB gene. If GuaB is knocked out, the cell is unable to synthesize guanine and is therefore unable to grow on media lacking guanine. We plan to take advantage of this engineered auxotrophy and use it as a way to select for cells that are able to demethylate caffeine to xanthine which can then be converted to XMP by xanthine-guanine phosphoribotransferase (gpt) and thereby relieve the metabolic block and restore guanine synthesis allowing for cell growth.<br />
<br />
[[File:guaB_selection_1.jpg|center|650px]]<br />
<br />
Finally, after construction and preliminary testing of the caffeine degradation operon in''E. coli'', we will attempt to grow our cells in the presence of various commercial caffeinated beverages.<br />
<br />
=== Characterizing Inducible Promoters ===<br />
<br />
In Summmers et al., the two open reading frames ''orf1'' and ''orf4'' are thought to be putative regulators of the caffeine degradation operon's N-demethylase proteins due to the proximity of their genes. They are hypothesized to bind to operator sequences in the intergenic regions between genes in the operon, which may serve as promoters for the various demethylases of the operon. <br />
<br />
Analysis of the sizes of the intergenic regions of the CBB5 caffeine utilization operon shows that the regions upstream of the ndm genes are all greater than 150bp. The large size of these intergenic regions and the fact that they precede the catabolic enzyme gene leads us to hypothesize that there are caffeine (or other methylxanthine) regulatory elements in these sequences.<br />
<br />
We will clone these open reading frames into the reporter plasmid pRA301. pRA301 contains a promoterless lacZ gene, preceded by a multiple cloning site (MCS). DNA fragments hypothesized to contain promoter elements can be cloned into the MCS and assayed for lacZ expression by Miller assay. Using this method, we can determine the regulatory functionality of each open reading frame by examining varying fluorescence levels.<br />
<br />
<br />
<br />
<br />
==<div style="font-size:130%;text-align:center">'''Results</div>==<br />
<br />
===Decaffeination operon (+ gst9) enables growth of GuaB knockout===<br />
<br />
Our initial refactored operon consisted of genes NdmA,B,C,D. We found that this operon was able to support growth of the GuaB knockout on theophylline but not caffeine. This indicated that the demethylase responsible for removing the 7-methyl group (NdmC) was not functional. Of note, Summers et. al (2012) also could not detect NdmC activity when expressed in ''e.coli''. We reasoned that there could be a missing protein required for NdmC activity. Summers et al. (2012) showed that an uncharacterized protein (orf8) copurified in protein fractions assayed for NdmC activity. We reasoned that this protein could be essential for NdmC function. Unfortunately, the complete DNA sequence of orf8 was not available, only a partial sequence of the orf was contained in the known operon sequence. A protein homology search was performed using the available sequence to find potential homologs that might be able to substitute function of the missing orf. The search revealed that an uncharacterized gene, gst9, from ''Janthinobacterium marseille'' shared a high degree of sequence homology (70%). We decided to synthesize the gst9 gene from the available sequence and clone it into our decaffeination operon to see if it would enable NdmC activity and allow for complete demethylation of caffeine. We found our hyphothesis to be true, adding gst9 to our refactored operon did indeed enable growth of the guaB knockout on media containing caffeine.<br />
<br />
<br />
<br />
The GuaB gene was successfully knocked out of E. coli cells through use of the BW25113 Keio Knockout Collection. This strain was then transformed with cells from our refactored CBB5 decaffeination operon [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 Bba_K734000]. Both strains were then grown on M9 mineral minimal media containing 0.2% Casein and 0.2% glucose. The results are shown below.<br />
<br />
[[File:UtAustin2012DecaffeinationOperon.jpg|center|650px]]<br />
<br />
From this figure, we see that our decaffeination operon enables the GuaB knockout to grow in the absence of guanine or xanthine supplementation by instead demethylating the available caffeine to produce xanthine. This not only confirms the functionality of our refactored decaffeination operon, but proves a method by which we can use it to auxotrophically select for cells.<br />
<br />
To more accurately determine the utilization of caffeine by our operon, we tested the growth of our E. coli cells containing refactored operon and the knocked out GuaB gene under multiple caffeine concentration conditions. We found that our cells were able to grow at conditions as low as 10uM of caffeine, and peaked at a caffeine concentration of approximately 250uM. Concentrations were grown as high as 5000uM, at which point cells began to die, presumably from caffeine toxicity. <br />
<br />
[[File:AustiniGEM2012GrowthCurve.jpg|center|650px]]<br />
<br />
From these growth conditions, we plated dilutions of up to 10<sup>7</sup> dilution. This was used to determine individual cell growth based on caffeine. Approximately 7.6 +/- 0.8 pg of caffeine were utilized per cell. Assuming the use of guanine in E. coli DNA that is roughly 9.2 Mb and 50% GC, approximately 2.3*10<sup>6</sup> guanines derived from caffeine are shown to be utilized per cell in our engineered organisms. As there are roughly 10<sup>11</sup> bases of RNA per E. coli cell, and approximately 25% of these are guanine, there are approximately 2.55*10<sup>10</sup> guanines required for E. coli cell growth. From this calculation, we can include that our cells are scavenging and utilizing approximately all the caffeine present in the system.<br />
<br />
===Growth in Caffeinated Beverages (Aurko)===<br />
In order to make our experiment more relatable, we experimented with growth of our E. coli strain in various caffeinated beverages. Experiments were first performed on cells with only the GuaB knockout modification, in order to prove that growth in these beverages was even possible. Initial results, shown below, indicate that growth is in fact possible for a wide variety of beverages, including Coca-Cola, 5-Hour Energy, Lipton Tea, and Startbucks Espresso.<br />
<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthInitial.png|center|650px]]<br />
<br />
The graph above shows that the auxotrophic selection of cells using xanthine derivatives again functions as expected – without xanthine, cells were unable to grow under most conditions. The noticeable Optical Densities for 50% Coca-Cola and 50% Espresso are due to the strong background color of the culture and not actual cell growth. 50% 5-Hour Energy and Espresso were both shown to be toxic to our cells. Finally, tea was shown to contain enough natural xanthenes to allow for partial cell growth, and was excluded from further experiments.<br />
<br />
We then attempted to grow our cell strain containing both the GuaB knockout gene and the refactored decaffeination operon. The results of this experiment are shown below.<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthFinal.jpg|center|720px]]<br />
It is important to note that these cells were grown in M9 minimal media containing only 0.2% casein as a natural carbon source. The cells were required to scavange virtually all of their carbon required for guanine synthesis from the caffeine supplied to the system, or die. Our E. coli was able to utilize the caffeine inherent to Coca-Cola, Starbucks Espresso and 5-Hour Energy, as well as caffeine in caffeine. However, without our refactored decaffeination operon, the cells were unable to grow under any conditions. The two small bars that appear above in 50% Coca-Cola and 10% Espresso are simply due to the high background color of the cultures.<br />
<br />
===Transcriptional Regulators===<br />
As described earlier, we hypothesize that the large intergenic regions upstream of various genes in the CBB5 decaffeination operon, particularly upstream of ndmA, may contain methylxanthine regulated promoters. We propose that orf1 and orf4, which were annotated as putative regulators based on sequence homology, act as repressors for the promoters contained in the operon. <br />
<br />
To test these hypotheses, we cloned the intergentic region upstream of the ndmA gene into a promoterless LacZ reporter plasmid, pRA301. This vector enabled quantitative measurement of promoter strength using the β-galactosidase Miller Assay. Additionally, we created compatible biobrick plasmids of each putative repressor, orf1 and orf4, in order to assay their effect on ndmA promoter strength in the presence or absence of methylxanthine supplementation.<br />
<br />
We transformed these plasmids into the Top10 ''E.coli'' strain to create three strains: one containing only the ndmA-LacZ reporter plasmid, and cotransformants containing both the ndmA-LacZ plasmid and either orf1 or orf4 biobrick plasmids. All three ''E. coli'' strains were grown in M9 minimal media + .2% casein (+ appropriate supplement) at 30<sup>o</sup>C for 48 hrs, after which time Miller assays were performed. The results, summarized in the figure below, provide strong evidence that '''''expression of orf4 leads to inhibited ndmA promoter functionality''''', while orf1 expression provides negligible influence on the ndmA promoter. <br />
<br />
[[File:Austin2012ndmARepression.jpg|center|650px]]<br />
<br />
A higher Miller Unit correlates to a higher level of lacZ production, effectively quantifying the degree of gene expression. As the Miller Unit of the strain co-expressed ndmA promoter with orf4 is lower by a factor of roughly 4, it can be inferred that the protein encoded by orf4 regulates the degree to which the ndmA promoter is expressed during transcription.<br />
<br />
It should be noted that while expression of ndmA drops significantly in this experiment, this does not imply that orf4 only inhibits the expression of ndmA. This is discussed in the next section: Inducible Promoters.<br />
<br />
===Inducible Promoters===<br />
As shown above, it appears that orf4 acts as a transcriptional regulator of ndmA expression. One would expect a transcriptional regulator to regulate transcription in a way that is beneficial to the overall fitness of the organism. In certain situations in which a protein is necessary for survival, the transcriptional factor should up-regulate the production of said gene. Likewise, when a protein is not necessary, the transcriptional factor should down-regulate its production.<br />
<br />
We hypothesize that this is the way in which orf4 regulates transcription of ndmA. In situations of high caffeine and related xanthine concentrations, the protein encoded by orf4 up-regulates the expression of ndmA. In the experiment listed [[Team:Austin_Texas/Caffeinated_coli#Transcriptional_Regulators|above]], in which no xanthine derivative was added to the media, the expression of ndmA is inhibited (as shown).<br />
<br />
In order to test this hypothesis, we subjected a strain of Top10 ''E. coli'' cells containing the orf4 gene and the ndmA promoter containing the lacZ gene to varying supplements of caffeine, theobromine, theophylline, and xanthine. Xanthine was shown to be insoluble at high concentratinos, and was therefore removed from the experiment. The results of exposure to varying concentration levels is shown below.<br />
<br />
[[File:UTAustin2012InductionbySubstrate.jpg|center|650px]]<br />
<br />
As predicted, the '''''expression of ndmA appears to rise at higher caffeine concentrations'''''. Similarly, higher concentrations of theobromine and theophylline also appear to increase the expression of ndmA. <br />
<br />
From these experiments we conclude that the ndmA intergenic region contains a promoter that is negatively-regulated by the orf4 protein in the absence of methylxanthines. Upon exposure to methylxanthines, it appears that orf4-mediated repression is relieved, leading to induction. <br />
<br />
===Results Summary===<br />
The main accomplishments we achieved this Summer include<br />
*Refactoring of decaffeination operon from ''P. putida'' into ''E. coli''<br />
*Construction of a auxotrophic selection method using our refactored operon, "addicting" ''E. coli'' to caffeine<br />
*Growth of above cells in common caffeinated beverages<br />
*Discovery of a promoter in the CBB5 operon<br />
*Characterization of an open reading frames in the CBB5 operon as a transcription regulator<br />
<br />
<br />
<html><br />
<div id="footer" /><br />
</html></div>Erik.quandthttp://2012.igem.org/Team:Austin_Texas/Caffeinated_coliTeam:Austin Texas/Caffeinated coli2012-10-02T23:31:54Z<p>Erik.quandt: /* Decaffeination operon (+gst9) enables growth of GuaB knockout */</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli" class="selected"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
<br />
<br />
= '''<center><div style="font-size:150%">Project: Caffeinated Coli</div>''' =<br />
<br />
<br />
[[File:Caffeinated_Bacteria.jpg|center|650px]]<br />
<br />
<br />
<br />
== <div style="font-size:130%;text-align:center">'''Introduction'''</div> ==<br />
''Pseudomonas putida'' CBB5, discovered by Ryan Summers and Mani Subramanian at the University of Iowa can live on caffeine as the sole carbon and nitrogen source. CBB5 uses a Nitrogen demethylation pathway to convert caffeine to xanthine with formaldehyde side products. The xanthine and formaldehyde are then used as the nitrogen and carbon sources respectively.<br />
<br />
The N-demethylation pathway consists of four demethylation genes, ndmA, ndmB, ndmC, and ndmD. ndmA, B, and C remove the methyl groups from the N-1, N-3, and N-7 respectively. This is done with the help of a reductase, ndmD.<br />
<br />
[[File:Ndm diagram.JPG|center|650px]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Strategy'''</div> ==<br />
<br />
=== Refactoring Decaffeination Operon ===<br />
<br />
The first goal of this project involves refactoring the caffeine operon from the caffeine utilization pathway from ''Psuedomonas putida'' CBB5, first characterized by Summers et al. in early 2012. The operon, shown below, will be incorporated into the well characterized bacterium, ''Escherichia coli'' [3]. <br />
<br />
[[File:CBB5_Operon.png|center|650px]]<br />
<br />
Directly importing the operon into ''E. coli'' was determined impractical, as the strength and regulation of the ribosome binding sites (rbs) and operon-controlled promoters in the CBB5 operon may not be optimized for function in ''E. coli''. Additionally, the use in CBB5 of GTG start codons conflicts with E. coli’s preference for ATG – leading to problems in translation initiation.<br />
<br />
We therefore decided to separate out open reading frames for the genes of interest in the CBB5 operon and put them under controlled regulation in a refactored caffeine utilization operon for import into ''E. coli''. The operon's design, shown below and submitted as [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 BBa_K734000], aims to optimize its functionality in its new host. <br />
<br />
[[File:Austin_Texas_Decaffeination_design.png|center]]<br />
<br />
This includes the N-demethylase proteins: ''ndmA'', ''ndmB'', ''ndmC'', and the putative assisting protein ''ndmD''. Also included is the glutathione S-transferase from ''Janthinobacterium'' sp. strain Marseille, necessary for functionality of NdmC. Constitutive expression occurs with a strong, well-characterized promoter ([http://partsregistry.org/wiki/index.php/Part:BBa_J23100 BBa_J23100]) and a strong, well-characterized RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]). Finally, all GTG start codons have been replaced with ATG.<br />
<br />
Sources of parts used in our synthetic decaffeination circuit:<br />
<br />
[[File:Austin_Texas_Part_sources.png|center]]<br />
<br />
==== Assembly ====<br />
<br />
Our operon was assembled via a one-step, six-piece Gibson assembly. Briefly, genes to be stitched together were PCR amplified with overhangs homologous to adjacent genes (or homologous to the vector backbone in the case of the 5' end of the promoter and the 3' end of ''gst9''). The forward primers also contained our chosen RBS and ATG. In a one-pot reaction, a 5'-exonuclease chewed back on the homologous overhangs, allowing adjacent fragments to base pair, and a DNA ligase stitched them together. An overview is shown here.<br />
<br />
[[File:Austin_Texas_Decaffeination_assembly.png|center]] <br />
<br />
=== Operon Testing and Optimization ===<br />
<br />
We will employ two different assays for operon functionality; growth on caffeine as a sole carbon source, and a genetic selection for caffeine demethylation to xanthine. To evaluate the ability to use caffeine as a sole carbon source we will transform TOP 10 E.coli electrocompetent cells with the refactored caffeine utilization operon, grow transformed cells in rich media to saturation and then dilute 1:100 into M9 mineral media. Varying levels of caffeine concentrations will be used to determine the degree of caffeine utilization, and the optimal limit for growth.<br />
<br />
Since the cell has an extremely large requirement for carbon, the energy derived from demethylation may not be enough to support growth. For this reason a second assay for caffeine demethylation based on guanine auxotrophy has been devised. ''E. coli'' synthesizes the nucleotide guanine de novo via a pathway that involves Xanthosine-5’-phosphate (XMP) as an essential intermediate. The enzyme responsible for the formation of XMP (from inosine-5’-phosphate[IMP]) is IMP dehydrogenase, which is encoded by the GuaB gene. If GuaB is knocked out, the cell is unable to synthesize guanine and is therefore unable to grow on media lacking guanine. We plan to take advantage of this engineered auxotrophy and use it as a way to select for cells that are able to demethylate caffeine to xanthine which can then be converted to XMP by xanthine-guanine phosphoribotransferase (gpt) and thereby relieve the metabolic block and restore guanine synthesis allowing for cell growth.<br />
<br />
[[File:guaB_selection_1.jpg|center|650px]]<br />
<br />
Finally, after construction and preliminary testing of the caffeine degradation operon in''E. coli'', we will attempt to grow our cells in the presence of various commercial caffeinated beverages.<br />
<br />
=== Characterizing Inducible Promoters ===<br />
<br />
In Summmers et al., the two open reading frames ''orf1'' and ''orf4'' are thought to be putative regulators of the caffeine degradation operon's N-demethylase proteins due to the proximity of their genes. They are hypothesized to bind to operator sequences in the intergenic regions between genes in the operon, which may serve as promoters for the various demethylases of the operon. <br />
<br />
Analysis of the sizes of the intergenic regions of the CBB5 caffeine utilization operon shows that the regions upstream of the ndm genes are all greater than 150bp. The large size of these intergenic regions and the fact that they precede the catabolic enzyme gene leads us to hypothesize that there are caffeine (or other methylxanthine) regulatory elements in these sequences.<br />
<br />
We will clone these open reading frames into the reporter plasmid pRA301. pRA301 contains a promoterless lacZ gene, preceded by a multiple cloning site (MCS). DNA fragments hypothesized to contain promoter elements can be cloned into the MCS and assayed for lacZ expression by Miller assay. Using this method, we can determine the regulatory functionality of each open reading frame by examining varying fluorescence levels.<br />
<br />
<br />
<br />
<br />
==<div style="font-size:130%;text-align:center">'''Results</div>==<br />
<br />
===Decaffeination operon (+ gst9) enables growth of GuaB knockout===<br />
<br />
Our initial refactored operon consisted of genes NdmA,B,C,D. We found that this operon was able to support growth of the GuaB knockout on theophylline but not caffeine. This indicated that the demethylase responsible for removing the 7-methyl group (NdmC) was not functional. Of note, Summers et. al (2012) also could not detect NdmC activity when expressed in ''e.coli''. We reasoned that there could be a missing protein required for NdmC activity. Summers et al. (2012) showed that an uncharacterized protein (orf8) copurified in protein fractions assayed for NdmC activity. We reasoned that this protein could be essential for NdmC function. Unfortunately, the complete DNA sequence of orf8 was not available, only a partial sequence of the orf was contained in the known operon sequence. A protein homology search was performed using the available sequence to find potential homologs that might be able to substitute function of the missing orf. The search revealed that an uncharacterized gene, gst9, from ''Janthinobacterium marseille'' shared a high degree of sequence homology (70%). We decided to synthesize the gst9 gene from the available sequence and clone it into our decaffeination operon to see if it would enable NdmC activity and allow for complete demethylation of caffeine. We found that constructs containing gst9 could indeed grow when supplemented with caffeine affirming our hypothesis that the gene was required for NdmC activity.<br />
<br />
<br />
<br />
The GuaB gene was successfully knocked out of E. coli cells through use of the BW25113 Keio Knockout Collection. This strain was then transformed with cells from our refactored CBB5 decaffeination operon [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 Bba_K734000]. Both strains were then grown on M9 mineral minimal media containing 0.2% Casein and 0.2% glucose. The results are shown below.<br />
<br />
[[File:UtAustin2012DecaffeinationOperon.jpg|center|650px]]<br />
<br />
From this figure, we see that our decaffeination operon enables the GuaB knockout to grow in the absence of guanine or xanthine supplementation by instead demethylating the available caffeine to produce xanthine. This not only confirms the functionality of our refactored decaffeination operon, but proves a method by which we can use it to auxotrophically select for cells.<br />
<br />
To more accurately determine the utilization of caffeine by our operon, we tested the growth of our E. coli cells containing refactored operon and the knocked out GuaB gene under multiple caffeine concentration conditions. We found that our cells were able to grow at conditions as low as 10uM of caffeine, and peaked at a caffeine concentration of approximately 250uM. Concentrations were grown as high as 5000uM, at which point cells began to die, presumably from caffeine toxicity. <br />
<br />
[[File:AustiniGEM2012GrowthCurve.jpg|center|650px]]<br />
<br />
From these growth conditions, we plated dilutions of up to 10<sup>7</sup> dilution. This was used to determine individual cell growth based on caffeine. Approximately 7.6 +/- 0.8 pg of caffeine were utilized per cell. Assuming the use of guanine in E. coli DNA that is roughly 9.2 Mb and 50% GC, approximately 2.3*10<sup>6</sup> guanines derived from caffeine are shown to be utilized per cell in our engineered organisms. As there are roughly 10<sup>11</sup> bases of RNA per E. coli cell, and approximately 25% of these are guanine, there are approximately 2.55*10<sup>10</sup> guanines required for E. coli cell growth. From this calculation, we can include that our cells are scavenging and utilizing approximately all the caffeine present in the system.<br />
<br />
===Growth in Caffeinated Beverages (Aurko)===<br />
In order to make our experiment more relatable, we experimented with growth of our E. coli strain in various caffeinated beverages. Experiments were first performed on cells with only the GuaB knockout modification, in order to prove that growth in these beverages was even possible. Initial results, shown below, indicate that growth is in fact possible for a wide variety of beverages, including Coca-Cola, 5-Hour Energy, Lipton Tea, and Startbucks Espresso.<br />
<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthInitial.png|center|650px]]<br />
<br />
The graph above shows that the auxotrophic selection of cells using xanthine derivatives again functions as expected – without xanthine, cells were unable to grow under most conditions. The noticeable Optical Densities for 50% Coca-Cola and 50% Espresso are due to the strong background color of the culture and not actual cell growth. 50% 5-Hour Energy and Espresso were both shown to be toxic to our cells. Finally, tea was shown to contain enough natural xanthenes to allow for partial cell growth, and was excluded from further experiments.<br />
<br />
We then attempted to grow our cell strain containing both the GuaB knockout gene and the refactored decaffeination operon. The results of this experiment are shown below.<br />
<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthFinal.jpg|center|720px]]<br />
<br />
It is important to note that these cells were grown in M9 minimal media containing only 0.2% casein as a natural carbon source. The cells were required to scavange virtually all of their carbon required for guanine synthesis from the caffeine supplied to the system, or die. Our E. coli was able to utilize the caffeine inherent to Coca-Cola, Starbucks Espresso and 5-Hour Energy, as well as caffeine in caffeine. However, without our refactored decaffeination operon, the cells were unable to grow under any conditions. The two small bars that appear above in 50% Coca-Cola and 10% Espresso are simply due to the high background color of the cultures.<br />
<br />
===Transcriptional Regulators===<br />
As described earlier, we hypothesize that the large intergenic regions upstream of various genes in the CBB5 decaffeination operon, particularly upstream of ndmA, may contain methylxanthine regulated promoters. We propose that orf1 and orf4, which were annotated as putative regulators based on sequence homology, act as repressors for the promoters contained in the operon. <br />
<br />
To test these hypotheses, we cloned the intergentic region upstream of the ndmA gene into a promoterless LacZ reporter plasmid, pRA301. This vector enabled quantitative measurement of promoter strength using the β-galactosidase Miller Assay. Additionally, we created compatible biobrick plasmids of each putative repressor, orf1 and orf4, in order to assay their effect on ndmA promoter strength in the presence or absence of methylxanthine supplementation.<br />
<br />
We transformed these plasmids into the Top10 ''E.coli'' strain to create three strains: one containing only the ndmA-LacZ reporter plasmid, and cotransformants containing both the ndmA-LacZ plasmid and either orf1 or orf4 biobrick plasmids. All three ''E. coli'' strains were grown in M9 minimal media + .2% casein (+ appropriate supplement) at 30<sup>o</sup>C for 48 hrs, after which time Miller assays were performed. The results, summarized in the figure below, provide strong evidence that '''''expression of orf4 leads to inhibited ndmA promoter functionality''''', while orf1 expression provides negligible influence on the ndmA promoter. <br />
<br />
[[File:Austin2012ndmARepression.jpg|center|650px]]<br />
<br />
A higher Miller Unit correlates to a higher level of lacZ production, effectively quantifying the degree of gene expression. As the Miller Unit of the strain co-expressed ndmA promoter with orf4 is lower by a factor of roughly 4, it can be inferred that the protein encoded by orf4 regulates the degree to which the ndmA promoter is expressed during transcription.<br />
<br />
It should be noted that while expression of ndmA drops significantly in this experiment, this does not imply that orf4 only inhibits the expression of ndmA. This is discussed in the next section: Inducible Promoters.<br />
<br />
===Inducible Promoters===<br />
As shown above, it appears that orf4 acts as a transcriptional regulator of ndmA expression. One would expect a transcriptional regulator to regulate transcription in a way that is beneficial to the overall fitness of the organism. In certain situations in which a protein is necessary for survival, the transcriptional factor should up-regulate the production of said gene. Likewise, when a protein is not necessary, the transcriptional factor should down-regulate its production.<br />
<br />
We hypothesize that this is the way in which orf4 regulates transcription of ndmA. In situations of high caffeine and related xanthine concentrations, the protein encoded by orf4 up-regulates the expression of ndmA. In the experiment listed [[Team:Austin_Texas/Caffeinated_coli#Transcriptional_Regulators|above]], in which no xanthine derivative was added to the media, the expression of ndmA is inhibited (as shown).<br />
<br />
In order to test this hypothesis, we subjected a strain of Top10 ''E. coli'' cells containing the orf4 gene and the ndmA promoter containing the lacZ gene to varying supplements of caffeine, theobromine, theophylline, and xanthine. Xanthine was shown to be insoluble at high concentratinos, and was therefore removed from the experiment. The results of exposure to varying concentration levels is shown below.<br />
<br />
[[File:UTAustin2012InductionbySubstrate.jpg|center|650px]]<br />
<br />
As predicted, the '''''expression of ndmA appears to rise at higher caffeine concentrations'''''. Similarly, higher concentrations of theobromine and theophylline also appear to increase the expression of ndmA. <br />
<br />
From these experiments we conclude that the ndmA intergenic region contains a promoter that is negatively-regulated by the orf4 protein in the absence of methylxanthines. Upon exposure to methylxanthines, it appears that orf4-mediated repression is relieved, leading to induction. <br />
<br />
===Results Summary===<br />
The main accomplishments we achieved this Summer include<br />
*Refactoring of decaffeination operon from ''P. putida'' into ''E. coli''<br />
*Construction of a auxotrophic selection method using our refactored operon, "addicting" ''E. coli'' to caffeine<br />
*Growth of above cells in common caffeinated beverages<br />
*Discovery of a promoter in the CBB5 operon<br />
*Characterization of an open reading frames in the CBB5 operon as a transcription regulator<br />
<br />
<br />
<html><br />
<div id="footer" /><br />
</html></div>Erik.quandthttp://2012.igem.org/Team:Austin_Texas/Caffeinated_coliTeam:Austin Texas/Caffeinated coli2012-10-02T23:25:59Z<p>Erik.quandt: /* Decaffeination operon (+gst9) enables growth of GuaB knockout */</p>
<hr />
<div>{{Template:Austin_Texas/Stylesheet}}<br />
<br />
<html><br />
<br />
<ul class="cssmenu" style="float:left;"><br />
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li><br />
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li><br />
<li class="official_team_profile"><a href="https://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li><br />
<li class="human_practices"><a href="/Team:Austin_Texas/ZombiE_coli#Human_Practices" title="Human Practices"><span class="displace">Human Practices</span></a></li><br />
<li class="Caffeinated_coli"><a href="/Team:Austin_Texas/Caffeinated_coli" title="Caffeinated_coli" class="selected"><span class="displace">Caffeinated coli</span></a></li><br />
<li class="ZombiE_coli"><a href="/Team:Austin_Texas/ZombiE_coli" title="ZombiE_coli"><span class="displace">ZombiE.coli</span></a></li><br />
<li class="Spinach_reporter"><a href="/Team:Austin_Texas/Spinach_reporter" title="Spinach_reporter"><span class="displace">Spinach reporter</span></a></li><br />
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" title="notebook"><span class="displace">Notebook</span></a></li><br />
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li><br />
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li><br />
<li class="attributions"><a href="/Team:Austin_Texas/Team#Attributions" title="attributions"><span class="displace">Attributions</span></a></li><br />
</ul><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/16/University_of_texas_logo.jpg" alt="University of Texas at Austin logo" class="ut_logo" /><br />
<br />
</html><br />
<br />
<br />
= '''<center><div style="font-size:150%">Project: Caffeinated Coli</div>''' =<br />
<br />
<br />
[[File:Caffeinated_Bacteria.jpg|center|650px]]<br />
<br />
<br />
<br />
== <div style="font-size:130%;text-align:center">'''Introduction'''</div> ==<br />
''Pseudomonas putida'' CBB5, discovered by Ryan Summers and Mani Subramanian at the University of Iowa can live on caffeine as the sole carbon and nitrogen source. CBB5 uses a Nitrogen demethylation pathway to convert caffeine to xanthine with formaldehyde side products. The xanthine and formaldehyde are then used as the nitrogen and carbon sources respectively.<br />
<br />
The N-demethylation pathway consists of four demethylation genes, ndmA, ndmB, ndmC, and ndmD. ndmA, B, and C remove the methyl groups from the N-1, N-3, and N-7 respectively. This is done with the help of a reductase, ndmD.<br />
<br />
[[File:CBB5 demethylation.jpg|center|650px]]<br />
<br />
== <div style="font-size:130%;text-align:center">'''Strategy'''</div> ==<br />
<br />
=== Refactoring Decaffeination Operon ===<br />
<br />
The first goal of this project involves refactoring the caffeine operon from the caffeine utilization pathway from ''Psuedomonas putida'' CBB5, first characterized by Summers et al. in early 2012. The operon, shown below, will be incorporated into the well characterized bacterium, ''Escherichia coli'' [3]. <br />
<br />
[[File:CBB5_Operon.png|center|650px]]<br />
<br />
Directly importing the operon into ''E. coli'' was determined impractical, as the strength and regulation of the ribosome binding sites (rbs) and operon-controlled promoters in the CBB5 operon may not be optimized for function in ''E. coli''. Additionally, the use in CBB5 of GTG start codons conflicts with E. coli’s preference for ATG – leading to problems in translation initiation.<br />
<br />
We therefore decided to separate out open reading frames for the genes of interest in the CBB5 operon and put them under controlled regulation in a refactored caffeine utilization operon for import into ''E. coli''. The operon's design, shown below and submitted as [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 BBa_K734000], aims to optimize its functionality in its new host. <br />
<br />
[[File:Austin_Texas_Decaffeination_design.png|center]]<br />
<br />
This includes the N-demethylase proteins: ''ndmA'', ''ndmB'', ''ndmC'', and the putative assisting protein ''ndmD''. Also included is the glutathione S-transferase from ''Janthinobacterium'' sp. strain Marseille, necessary for functionality of NdmC. Constitutive expression occurs with a strong, well-characterized promoter ([http://partsregistry.org/wiki/index.php/Part:BBa_J23100 BBa_J23100]) and a strong, well-characterized RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]). Finally, all GTG start codons have been replaced with ATG.<br />
<br />
Sources of parts used in our synthetic decaffeination circuit:<br />
<br />
[[File:Austin_Texas_Part_sources.png|center]]<br />
<br />
==== Assembly ====<br />
<br />
Our operon was assembled via a one-step, six-piece Gibson assembly. Briefly, genes to be stitched together were PCR amplified with overhangs homologous to adjacent genes (or homologous to the vector backbone in the case of the 5' end of the promoter and the 3' end of ''gst9''). The forward primers also contained our chosen RBS and ATG. In a one-pot reaction, a 5'-exonuclease chewed back on the homologous overhangs, allowing adjacent fragments to base pair, and a DNA ligase stitched them together. An overview is shown here.<br />
<br />
[[File:Austin_Texas_Decaffeination_assembly.png|center]] <br />
<br />
=== Operon Testing and Optimization ===<br />
<br />
We will employ two different assays for operon functionality; growth on caffeine as a sole carbon source, and a genetic selection for caffeine demethylation to xanthine. To evaluate the ability to use caffeine as a sole carbon source we will transform TOP 10 E.coli electrocompetent cells with the refactored caffeine utilization operon, grow transformed cells in rich media to saturation and then dilute 1:100 into M9 mineral media. Varying levels of caffeine concentrations will be used to determine the degree of caffeine utilization, and the optimal limit for growth.<br />
<br />
Since the cell has an extremely large requirement for carbon, the energy derived from demethylation may not be enough to support growth. For this reason a second assay for caffeine demethylation based on guanine auxotrophy has been devised. ''E. coli'' synthesizes the nucleotide guanine de novo via a pathway that involves Xanthosine-5’-phosphate (XMP) as an essential intermediate. The enzyme responsible for the formation of XMP (from inosine-5’-phosphate[IMP]) is IMP dehydrogenase, which is encoded by the GuaB gene. If GuaB is knocked out, the cell is unable to synthesize guanine and is therefore unable to grow on media lacking guanine. We plan to take advantage of this engineered auxotrophy and use it as a way to select for cells that are able to demethylate caffeine to xanthine which can then be converted to XMP by xanthine-guanine phosphoribotransferase (gpt) and thereby relieve the metabolic block and restore guanine synthesis allowing for cell growth.<br />
<br />
[[File:guaB_selection_1.jpg|center|650px]]<br />
<br />
Finally, after construction and preliminary testing of the caffeine degradation operon in''E. coli'', we will attempt to grow our cells in the presence of various commercial caffeinated beverages.<br />
<br />
=== Characterizing Inducible Promoters ===<br />
<br />
In Summmers et al., the two open reading frames ''orf1'' and ''orf4'' are thought to be putative regulators of the caffeine degradation operon's N-demethylase proteins due to the proximity of their genes. They are hypothesized to bind to operator sequences in the intergenic regions between genes in the operon, which may serve as promoters for the various demethylases of the operon. <br />
<br />
Analysis of the sizes of the intergenic regions of the CBB5 caffeine utilization operon shows that the regions upstream of the ndm genes are all greater than 150bp. The large size of these intergenic regions and the fact that they precede the catabolic enzyme gene leads us to hypothesize that there are caffeine (or other methylxanthine) regulatory elements in these sequences.<br />
<br />
We will clone these open reading frames into the reporter plasmid pRA301. pRA301 contains a promoterless lacZ gene, preceded by a multiple cloning site (MCS). DNA fragments hypothesized to contain promoter elements can be cloned into the MCS and assayed for lacZ expression by Miller assay. Using this method, we can determine the regulatory functionality of each open reading frame by examining varying fluorescence levels.<br />
<br />
<br />
<br />
<br />
==<div style="font-size:130%;text-align:center">'''Results</div>==<br />
<br />
===Decaffeination operon (+gst9) enables growth of GuaB knockout===<br />
<br />
Our initial refactored operon consisted of genes NdmA,B,C,D. We found that this operon was able to support growth of the GuaB knockout on theophylline but not caffeine. This indicated that the demethylase responsible for removing the 7-methyl group (NdmC) was not functional. Of note, Summers et. al (2012) also could not detect NdmC activity when expressed in ''e.coli''. We reasoned that there could be a missing protein required for NdmC activity. Summers et al. (2012) showed that an uncharacterized protein (orf8) copurified in protein fractions assayed for NdmC activity. We reasoned that this protein could be essential for NdmC function. Unfortunately, the complete DNA sequence of orf8 was not available, only a partial sequence of the orf was contained in the known operon sequence. A protein homology search was performed using the available sequence to find potential homologs that might be able to substitute function of the missing orf. The search revealed that an uncharacterized gene, gst9, from ''Janthinobacterium marseille'' shared a high degree of sequence homology (70%). We decided to synthesize the gst9 gene from the available sequence and clone it into our decaffeination operon to see if it would enable NdmC activity.<br />
<br />
<br />
<br />
The GuaB gene was successfully knocked out of E. coli cells through use of the BW25113 Keio Knockout Collection. This strain was then transformed with cells from our refactored CBB5 decaffeination operon [http://partsregistry.org/wiki/index.php?title=Part:BBa_K734000 Bba_K734000]. Both strains were then grown on M9 mineral minimal media containing 0.2% Casein and 0.2% glucose. The results are shown below.<br />
<br />
[[File:UtAustin2012DecaffeinationOperon.jpg|center|650px]]<br />
<br />
From this figure, we see that our decaffeination operon enables the GuaB knockout to grow in the absence of guanine or xanthine supplementation by instead demethylating the available caffeine to produce xanthine. This not only confirms the functionality of our refactored decaffeination operon, but proves a method by which we can use it to auxotrophically select for cells.<br />
<br />
To more accurately determine the utilization of caffeine by our operon, we tested the growth of our E. coli cells containing refactored operon and the knocked out GuaB gene under multiple caffeine concentration conditions. We found that our cells were able to grow at conditions as low as 10uM of caffeine, and peaked at a caffeine concentration of approximately 250uM. Concentrations were grown as high as 5000uM, at which point cells began to die, presumably from caffeine toxicity. <br />
<br />
[[File:AustiniGEM2012GrowthCurve.jpg|center|650px]]<br />
<br />
From these growth conditions, we plated dilutions of up to 10<sup>7</sup> dilution. This was used to determine individual cell growth based on caffeine. Approximately 7.6 +/- 0.8 pg of caffeine were utilized per cell. Assuming the use of guanine in E. coli DNA that is roughly 9.2 Mb and 50% GC, approximately 2.3*10<sup>6</sup> guanines derived from caffeine are shown to be utilized per cell in our engineered organisms. As there are roughly 10<sup>11</sup> bases of RNA per E. coli cell, and approximately 25% of these are guanine, there are approximately 2.55*10<sup>10</sup> guanines required for E. coli cell growth. From this calculation, we can include that our cells are scavenging and utilizing approximately all the caffeine present in the system.<br />
<br />
===Growth in Caffeinated Beverages (Aurko)===<br />
Initial growth tests for guaB KO cells in M9 media supplemented with give supplements, by volume. Growth on various caffeinated beverages with and without xanthine added. Shows if cells are viable in certain beverages, and at what concentrations lethality occurs. Basically proving for next graph that the cells could grow. May or may not even want to include this. :<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthInitial.png|center|650px]]<br />
<br />
Final growth tests for guaB KO cells in M9 media supplemented with given supplements, by volume. Note: THIS is when we used the decaffeination operon. Proves cells can scavenge xanthine from caffeine using the decafienation operon. Goes with the pretty pictures Erik and I (mostly Erik) took.<br />
[[File:AustiniGEM2012CaffeinatedBeveragesGrowthFinal.jpg|center|720px]]<br />
<br />
Lots of pictures! You should have all of them in the dropbox folder.<br />
<br />
===Transcriptional Regulators===<br />
As described earlier, we hypothesize that the large intergenic regions upstream of various genes in the CBB5 decaffeination operon, particularly upstream of ndmA, may contain methylxanthine regulated promoters. We propose that orf1 and orf4, which were annotated as putative regulators based on sequence homology, act as repressors for the promoters contained in the operon. <br />
<br />
To test these hypotheses, we cloned the intergentic region upstream of the ndmA gene into a promoterless LacZ reporter plasmid, pRA301. This vector enabled quantitative measurement of promoter strength using the β-galactosidase Miller Assay. Additionally, we created compatible biobrick plasmids of each putative repressor, orf1 and orf4, in order to assay their effect on ndmA promoter strength in the presence or absence of methylxanthine supplementation.<br />
<br />
We transformed these plasmids into the Top10 ''E.coli'' strain to create three strains: one containing only the ndmA-LacZ reporter plasmid, and cotransformants containing both the ndmA-LacZ plasmid and either orf1 or orf4 biobrick plasmids. All three ''E. coli'' strains were grown in M9 minimal media + .2% casein (+ appropriate supplement) at 30<sup>o</sup>C for 48 hrs, after which time Miller assays were performed. The results, summarized in the figure below, provide strong evidence that '''''expression of orf4 leads to inhibited ndmA promoter functionality''''', while orf1 expression provides negligible influence on the ndmA promoter. <br />
<br />
[[File:Austin2012ndmARepression.jpg|center|650px]]<br />
<br />
A higher Miller Unit correlates to a higher level of lacZ production, effectively quantifying the degree of gene expression. As the Miller Unit of the strain co-expressed ndmA promoter with orf4 is lower by a factor of roughly 4, it can be inferred that the protein encoded by orf4 regulates the degree to which the ndmA promoter is expressed during transcription.<br />
<br />
It should be noted that while expression of ndmA drops significantly in this experiment, this does not imply that orf4 only inhibits the expression of ndmA. This is discussed in the next section: Inducible Promoters.<br />
<br />
===Inducible Promoters===<br />
As shown above, it appears that orf4 acts as a transcriptional regulator of ndmA expression. One would expect a transcriptional regulator to regulate transcription in a way that is beneficial to the overall fitness of the organism. In certain situations in which a protein is necessary for survival, the transcriptional factor should up-regulate the production of said gene. Likewise, when a protein is not necessary, the transcriptional factor should down-regulate its production.<br />
<br />
We hypothesize that this is the way in which orf4 regulates transcription of ndmA. In situations of high caffeine and related xanthine concentrations, the protein encoded by orf4 up-regulates the expression of ndmA. In the experiment listed [[Team:Austin_Texas/Caffeinated_coli#Transcriptional_Regulators|above]], in which no xanthine derivative was added to the media, the expression of ndmA is inhibited (as shown).<br />
<br />
In order to test this hypothesis, we subjected a strain of Top10 ''E. coli'' cells containing the orf4 gene and the ndmA promoter containing the lacZ gene to varying supplements of caffeine, theobromine, theophylline, and xanthine. Xanthine was shown to be insoluble at high concentratinos, and was therefore removed from the experiment. The results of exposure to varying concentration levels is shown below.<br />
<br />
[[File:UTAustin2012InductionbySubstrate.jpg|center|650px]]<br />
<br />
As predicted, the '''''expression of ndmA appears to rise at higher caffeine concentrations'''''. Similarly, higher concentrations of theobromine and theophylline also appear to increase the expression of ndmA. <br />
<br />
From these experiments we conclude that the ndmA intergenic region contains a promoter that is negatively-regulated by the orf4 protein in the absence of methylxanthines. Upon exposure to methylxanthines, it appears that orf4-mediated repression is relieved, leading to induction. <br />
<br />
===Results Summary===<br />
The main accomplishments we achieved this Summer include<br />
*Refactoring of decaffeination operon from ''P. putida'' into ''E. coli''<br />
*Construction of a auxotrophic selection method using our refactored operon, "addicting" ''E. coli'' to caffeine<br />
*Growth of above cells in common caffeinated beverages<br />
*Discovery of a promoter in the CBB5 operon<br />
*Characterization of an open reading frames in the CBB5 operon as a transcription regulator<br />
<br />
<br />
<html><br />
<div id="footer" /><br />
</html></div>Erik.quandt