http://2012.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=250&target=S.Sureka2012.igem.org - User contributions [en]2024-03-28T09:00:15ZFrom 2012.igem.orgMediaWiki 1.16.0http://2012.igem.org/File:CEA.PNGFile:CEA.PNG2013-01-10T20:02:11Z<p>S.Sureka: uploaded a new version of &quot;File:CEA.PNG&quot;: Reverted to version as of 20:00, 10 January 2013</p>
<hr />
<div></div>S.Surekahttp://2012.igem.org/File:CEA.PNGFile:CEA.PNG2013-01-10T20:01:57Z<p>S.Sureka: uploaded a new version of &quot;File:CEA.PNG&quot;</p>
<hr />
<div></div>S.Surekahttp://2012.igem.org/File:CEA.PNGFile:CEA.PNG2013-01-10T20:00:43Z<p>S.Sureka: uploaded a new version of &quot;File:CEA.PNG&quot;</p>
<hr />
<div></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/hprac/bioethicsTeam:Cornell/project/hprac/bioethics2012-10-27T03:47:33Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6 style="margin-top:32px;">Human Practices</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/CEA">Comprehensive Environmental Assessment</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/bioethics">Bioethics</a><br />
</li> <br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/oil_sands">Oil Sands</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/cayuga_watershed">Cayuga Watershed</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/safety">Safety</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row" id="ugd-members"><br />
<div class="twelve columns"><br />
<h2 class="centered">Bioethics</h2><br />
</div><br />
</div><br />
<div class="row last-ele"><br />
<div class="twelve columns"><br />
<br>Comprehensive Environmental Assessment was extremely helpful in providing guidance for research priorities; however, we thought it necessary to address ethical concerns associated with our project. As such, we designed our project in accordance with the ethical principles identified by the Presidential Commission for the Study of Bioethical Issues (2010). Our primary motive is public beneficence: to improve global public health by monitoring the safety of drinking water. We have also demonstrated responsible stewardship by considering the environmental implications of our project; the ecological impact of placing our genetically modified strain in water would be minimal because our filtration system will not allow bacteria to escape. <i>S. oneidensis</i> MR-1 is native to North America and poses no known threat to biodiversity or humans; however, before field testing, we would engineer our strains to be auxotrophic. We have spoken directly with Environment Canada representatives who confirmed our recombinant <i>S. oneidensis</i>-based biosensor is easily approvable for field deployment.</br><br />
<br />
<br>In addition, the electrochemical biosensor is an intellectually responsible pursuit: our project cannot foreseeably be used to cause people harm. In the spirit of democratic deliberation, the human practices component of our team seeks to account for others’ ethical concerns about our project. We have begun consulting with local citizens as well as public authorities in order to fully understand the possible impacts of our project. Our proposed system would be easy, cost-effective, and potentially usable on a global scale, demonstrating justice and fairness in its intended implementation. Additionally, the modularity of our biosensing platform allows it to be adapted to the needs of different communities, in order to best serve global populations and environments.</br><br />
</div><br />
<div class="twelve columns"><br />
<br><br><br />
<h6>References</h6><br />
Presidential Commission for the Study of Bioethical Issues. (2010). New directions: The ethics of synthetic biology and emerging technologies. Washington, D.C.: Presidential Commission for the Study of Bioethical Issues.<br />
</div><br />
</div><br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_hprac').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/hprac/CEATeam:Cornell/project/hprac/CEA2012-10-27T03:46:54Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6 style="margin-top:72px;">Human Practices</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac">Overview</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/CEA">Comprehensive Environmental Assessment</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/bioethics">Bioethics</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/oil_sands">Oil Sands</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/cayuga_watershed">Cayuga Watershed</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/safety">Safety</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row" id="ugd-members"><br />
<div class="twelve columns"><br />
<h2 class="centered">Comprehensive Environmental Assessment</h2><br />
</div><br />
</div><br />
<div class="row last-ele"><br />
<div class="twelve columns"><br />
<h3>Introduction to CEA</h3><br />
<br />
As scientists, we are often inclined to reduce complex procedures down to simple, step-by-step protocols. Assessing risk and evaluating environmental impact are no exception; our first instinct this year was to create a universal checklist of regulations that every environmental iGEM project could fulfill in order to ensure environmental safety, the idea being that we could easily and systematically find answers to questions of environmental safety in scientific literature. However, upon speaking with Dr. Christina Powers, a biologist at the US Environmental Protection Agency, and further exploring the concerns relating to our own project, we decided to adopt a new approach to issues of human practices: Comprehensive Environmental Assessment (CEA).<br />
</br><br />
<br>CEA differs from traditional methods of risk assessment by recognizing that risk assessment is fundamentally a decision-making process in which scientists, experts, and the public should be engaged. The goal is to foster transparent discussion and use collective judgment to evaluate limitations and trade-offs in order to arrive at holistic conclusions about the primary issues that researchers should address in their research planning.</br><br />
</div><br />
<div class="twelve columns"><br />
<h3>CEA &amp; Synthetic Biology</h3><br />
While the Environmental Protection Agency primarily uses the CEA approach for nanomaterials, the Woodrow Wilson International Center for Scholars in Washington, D.C., recently launched efforts to lay out a framework to apply CEA to synthetic biology. This groundbreaking project set out to assess the CEA approach’s relevance to synthetic biology, in anticipation of the growing demand for synthetic biology-based solutions to global issues. They arrived at the conclusion that scientists should focus on four major areas of risk assessment: altered physiology, competition and biodiversity, evolutionary prediction, and gene transfer.<br />
</br><br />
<br>The Woodrow Wilson Center’s Synthetic Biology Project recommended that CEA be applied to more developed projects that were approaching field deployment in order to evaluate it as a risk-assessment approach for synthetic biology at large. This is where we come in: can CEA be successfully used to evaluate the risks of our field-deployable device? What are its limitations? </br><br />
<br />
<br>We began by attempting to apply the Synthetic Biology Project’s modified guidelines for prioritizing research questions to our own project as it currently stands.</br><br />
<img src="https://static.igem.org/mediawiki/2012/5/5a/CEA.PNG" class="inline"><br />
Above is a simplified schematic of our risk assessment approach, as adapted from the Woodrow Wilson Center. We hope that this framework will prove useful to other environmental iGEM teams in the future.<br />
<br><br><br />
<h5>Altered Physiology</h5><br />
<br />
The current versions of our genetically modified strains have a membrane protein in the Mtr pathway for anaerobic respiration knocked out and complemented on a plasmid. They differ from wild-type <i>Shewanella oneidensis</i> MR-1 in that their capacity for anaerobic respiration is upregulated in the presence of analyte (arsenic or naphthalene). This plasmid appears to be producing mtrB in a fully functional form that successfully completes the anaerobic respiration pathway when induced. One important difference is that when uninduced, the bacteria loses much of its anaerobic respiratory activity, and must rely significantly more on aerobic respiration; this is further discussed below.<br />
<br />
<br>In addition, our salicylate reporter strain contains the nah operon, which allows the cells to constitutively degrade naphthalene into salicylate. Salicylate, a metabolic intermediate in the <i>Pseudomonas</i> strain from which the nah operon was taken, is less toxic to the environment than naphthalene. <i>P. putida</i> G7 can further degrade salicylate into a catechol, an edible carbon source using the sal operon; this second operon is not present in our cells, so our <i>Shewanella</i> strains are unable to actively degrade salicylate. This means that our cells cannot use naphthalene as a carbon source, a conclusion that is supported by our naphthalene growth assays. The effects of salicylate production on the cells appear to be negligible, but this should be further explored in future characterization work. </br><br />
<br />
<br>One of our future plans is to integrate our constructs into the chromosomes of our strains, in order to ensure that mtrB is not saturating at its uninduced, basal expression levels. This poses new questions: will chromosomal integration alter the expression patterns of this engineered pathway? Will it interfere with other functions of the cells? Functionality can be altered depending on the position of the construct within the chromosome. This is our first forthcoming research priority: determining any potential adverse effects of <b>chromosomal integration</b>, carrying it out, and thoroughly testing the functionality of our new engineered strains. </br><br />
<br />
<h5>Competition &amp; Biodiversity </h5><br />
A second concern is that engineered strains could possibly outcompete wild-type species in the environment and pose a threat to biodiversity. Our first line of defense against this possibility is physical containment: the inlet and outlet of our current prototype are equipped with 0.1 µm filters, effectively eliminating the possibility that our engineered strains may interact with natural organisms. However, imagine that there could be a mechanical error: physical breakage of the device, slight discrepancies in filter pore sizes, et cetera, that could leave a slim possibility that our strains could come into contact with natural species. What then?<br />
<br />
<br>To answer this question, we return to the altered physiology of our strains: the primary distinguishing characteristic to note is that the cells cannot carry out the wild-type levels of anaerobic respiration unless they are induced. This means that in situations where oxygen availability is limiting, and toxins are not highly prevalent, <b>our strains are less able to compete than wild-type <i>Shewanella</i></b>; this is our second line of defense. <i>S. oneidensis</i> is native to freshwater ecosystems in our area, so our strains should not be disruptive to biodiversity. In addition, we have observed that inserting the nah operon into cells seems to significantly increase their doubling time, so our salicylate reporter strains would be even less able to compete than our arsenic reporters.</br><br />
<br />
<br>However, what happens in the case that oxygen availability is not limiting? It is probable that our current engineered strains would be able to survive and thrive in aerobic conditions, and live alongside wild-type <i>Shewanella</i>. We need a third line of defense for this situation, a modification that would prevent our strains from being able to survive outside of our physical device. For this, we propose <b>auxotrophy:</b> in a truly field-deployable device, we would use a strain that had a gene for a key metabolite knocked out, so that the strain would rely upon supplementation of this nutrient in order to survive. We would then supplement this metabolite inside of the device, so that our strains would function properly within our device. If the bacteria were to somehow escape, their functionality would be severely impaired by the lack of nutritional supplementation, and they would be quickly outcompeted by wild-type strains.</br><br />
<br />
<br>This brings to the table a second research priority for field-deployability: engineer an auxotrophic strain of <i>Shewanella</i> to contain our constructs, and ensure that the likelihood of survival without nutritional supplementation is very, very low. We would also need to ensure, from a practical standpoint, that auxotrophy would not interfere with any other aspects of the physiology of the cells.<br><br />
<br />
<br><br />
<h5>Evolutionary Prediction</h5> <br />
Due to the relatively simple nature of our reporter system, we find it highly unlikely that our strains could evolve to possess any dangerous function if somehow released into the wild. However, it is still possible that the promoter regions of our constructs could mutate and alter the expected patterns of promoter activity, or that the functionality of mtrB would be impaired by a deleterious mutation. The former possibility could serve to make the strain more genetically similar to the wild-type, and thus more able to compete; this presents us with another reason to pursue auxotrophy as a solution, basically in order to ensure that our strains are not alive for long enough for mutations to accumulate. <br />
</br><br />
<br />
<br>However, we would also need to conduct extensive testing to ensure that our strains remain functional and responsive to analyte for the full 6-month period.<br />
</br><br />
<br />
<p><br />
<h5>Gene Transfer</h5> <br />
Perhaps the most pressing concern with any synthetic biology project is the possibility of horizontal gene transfer from engineered to natural strains, and vice versa. Again, our first line of defense is physical containment, but barring that, what can we do to reduce the possibility that our strains would transfer unnatural functions to natural cells? The biggest shortcoming of our current system is that antibiotic resistance is used as a selective marker on our plasmids, thus allowing for the possibility that antibiotic resistance could be spread among natural populations via conjugation or passive transformation. While we could explore the possibility of using another form of auxotrophy as a selective marker on a plasmid, we believe that a more viable solution would be to eliminate the need for a selective pressure in the first place, namely by chromosomal integration. The transfer of chromosomal DNA is much less likely than the transfer of a plasmid, and, as mentioned above, chromosomal integration would solve other problems in the functionality of our reporters.<br />
</p><br />
</div><br />
<br />
<div class="twelve columns"><br />
<h3>Limitations of CEA</h3><br />
CEA allowed us to think about crucial future work for our project in order to make it suitable for field-deployability. However, in our interactions with environmental groups, public officials in water quality management, and industrial groups, we encountered several important questions that were not built into existing CEA framework. Assessing the suitability of a synthetic biology-based device extends far beyond practical environmental risk assessment, into regulatory and economic concerns. The Presidential Commission for the Study of Bioethical Issues (PCSBI) released a report in December 2010 regarding important considerations for the ethics of synthetic biology projects, not all of which are encompassed by the CEA framework. In addition, as we approach field-deployability, the economics of the device become essential to assessing its viability as a solution to real-world water monitoring needs. These ideas are further explored in the remainder of this section.<br />
</div><br />
<div class="twelve columns"><br />
<h3>References</h3><br />
Dana, G. V., Kuiken, T., Rejeski, D., &amp; Snow, A. A. (2012). Synthetic biology: Four steps to avoid a synthetic-biology disaster. <i>Nature, 483.</i> doi:10.1038/483029a</br><br />
<br>Powers, C. M., Dana, G., Gillespie, P., Gwinn, M. R., Hendren, C. O., Long, T. C., Wang, A., Davis, J. M. (2012). Comprehensive Environmental Assessment: A Meta-Assessment Approach. <i>Environ. Sci. Technol., 46,</i> 9202−9208. http://dx.doi.org/10.1021/es3023072</br><br />
<br>Synthetic Biology Project. (2011, July 28). Comprehensive Environmental Assessment and Its Application to Synthetic Biology Applications. Retrieved from http://www.synbioproject.org/events/archive/cea/</br><br />
<br />
</div><br />
</div><br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_hprac').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/hprac/bioethicsTeam:Cornell/project/hprac/bioethics2012-10-27T03:41:21Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6 style="margin-top:32px;">Human Practices</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/CEA">Comprehensive Environmental Assessment</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/bioethics">Bioethics</a><br />
</li> <br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/oil_sands">Oil Sands</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/cayuga_watershed">Cayuga Watershed</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/safety">Safety</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row" id="ugd-members"><br />
<div class="twelve columns"><br />
<h2 class="centered">Bioethics</h2><br />
</div><br />
</div><br />
<div class="row last-ele"><br />
<div class="twelve columns"><br />
<br>Comprehensive Environmental Assessment was extremely helpful in providing guidance for research priorities; however, we thought it necessary to address ethical concerns associated with our project. As such, we designed our project in accordance with the ethical principles identified by the Presidential Commission for the Study of Bioethical Issues (2010). Our primary motive is public beneficence: to improve global public health by monitoring the safety of drinking water. We have also demonstrated responsible stewardship by considering the environmental implications of our project; the ecological impact of placing our genetically modified strain in water would be minimal because our filtration system will not allow bacteria to escape. <i>S. oneidensis</i> MR-1 is native to North America and poses no known threat to biodiversity or humans; however, before field testing, we would engineer our strains to be auxotrophic. We have spoken directly with Environment Canada representatives who confirmed our recombinant <i>S. oneidensis</i>-based biosensor is easily approvable for field deployment.</br><br />
<br />
<br>In addition, the electrochemical biosensor is an intellectually responsible pursuit: our project cannot foreseeably be used to cause people harm. In the spirit of democratic deliberation, the human practices component of our team seeks to account for others’ ethical concerns about our project. We have begun consulting with local citizens as well as public authorities in order to fully understand the possible impacts of our project. Our proposed system would be easy, cost-effective, and potentially usable on a global scale, demonstrating justice and fairness in its intended implementation. Additionally, the modularity of our biosensing platform allows it to be adapted to the needs of different communities, in order to best serve global populations and environments.</br><br />
</div><br />
<div class="twelve columns"><br />
<h6>References</h6><br />
Presidential Commission for the Study of Bioethical Issues. (2010). New directions: The ethics of synthetic biology and emerging technologies. Washington, D.C.: Presidential Commission for the Study of Bioethical Issues.<br />
</div><br />
</div><br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_hprac').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/hprac/cayuga_watershedTeam:Cornell/project/hprac/cayuga watershed2012-10-27T03:37:59Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6 style="margin-top:32px;">Human Practices</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/CEA">Comprehensive Environmental Assessment</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/bioethics">Bioethics</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/oil_sands">Oil Sands</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/cayuga_watershed">Cayuga Watershed</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/safety">Safety</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h2 class="centered">Application: Cayuga Watershed</h2><br />
</div><br />
</div><br />
<div class="row last-ele"><br />
<div class="twelve columns"><br />
<br><br />
We also focused on potential applications of our device in local areas. While upstate New York is not affected by oil sands toxicity, local groups are highly concerned with the possible implementation of hydrofracking in New York state, and any subsequent adverse effects. </br><br />
<br /><br />
In order to get a sense for the water monitoring needs in Ithaca, we spoke to a representative of the Community Science Institute, a volunteer-driven organization seeking to establish baselines for water quality in the Cayuga watershed. They are limited by the training necessary to operate laboratory equipment for chemical detection methods, manpower, viable sampling locations, and sampling frequency. They are also seriously limited by cost; it can cost $20 to detect one toxin in one discrete sample. A system such as ours, that only needs servicing twice a year, doesn’t require any special training for deployment of data collection, and is fairly cheap to implement, would be ideal for resource-limited situations where water quality databases are few and far between.<br />
<br /><br />
<br /><br />
In addition, we spoke to Bill Foster, a limnologist who conducts independent sampling of Cayuga Lake, about our device. He emphasized the importance of continuous sampling, because his own discrete sampling efforts were significantly affected by temporal fluctuations that made it hard to tease out long-term trends. He described the lake as a “bathtub,” in which fluctuations in water levels can affect contaminant levels at different depths. Our system addresses this with continuous monitoring, which can be used to distinguish daily and seasonal fluctuations from long-term trends.<br />
<br /><br />
<br /><br />
In the coming weeks, we will be meeting with representatives of the Coalition to Protect New York to get a better sense for the monitoring needs associated with hydrofracking, as well as concerns regarding the use of genetically modified strains in environmental applications. We have also submitted an abstract to the New York Water Environment Association’s Annual Conference, and hope to send a representative to this meeting to get feedback from a wide variety of water quality experts.<br />
<br><br><br />
Our project was designed to be modular; it is easily adaptable to sensing a wide variety of toxins and is housed in a rugged physical device that could be made to function in different environments and areas of the world. We believe that our project, while immediately applicable to areas affected by oil and gas extraction, is moreover a powerful platform for continuous water monitoring in a number of other situations, which we hope to explore in the future.<br />
</div><br />
</div><br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_hprac').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/hpracTeam:Cornell/project/hprac2012-10-27T03:32:19Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6 style="margin-top:32px;">Human Practices</h6><br />
</li><br />
<li class="divider"></li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/CEA">Comprehensive Environmental Assessment</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/bioethics">Bioethics</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/oil_sands">Oil Sands</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/cayuga_watershed">Cayuga Watershed</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/safety">Safety</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row" id="ugd-members"><br />
<div class="twelve columns"><br />
<h2 class="centered">Human Practices Overview</h2><br />
</div><br />
</div><br />
<div class="row last-ele"><br />
<br />
<h3>Beyond the Bench</h3><br />
This year, we set out with three main goals in mind:<br />
<ul><br />
<li>Assess the environmental risks associated with our project,</li><br />
<li>evaluate the applicability of our device to a variety of applications, and</li><br />
<li>educate the public about synthetic biology and how it pertains to everyday life.</li><br />
</ul><br />
To these ends, we adopted a novel approach to risk assessment and discussed our project in great detail with the Oil Sands Leadership Initiative, local water monitoring groups, environmental groups, scientific researchers and more. Please click the links to the left to explore!<br />
</div><br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_hprac').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/hpracTeam:Cornell/project/hprac2012-10-27T03:31:45Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6 style="margin-top:32px;">Human Practices</h6><br />
</li><br />
<li class="divider"></li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/CEA">Comprehensive Environmental Assessment</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/bioethics">Bioethics</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/oil_sands">Oil Sands</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/cayuga_watershed">Cayuga Watershed</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/safety">Safety</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row" id="ugd-members"><br />
<div class="twelve columns"><br />
<h2 class="centered">Human Practices Overview</h2><br />
</div><br />
</div><br />
<div class="row last-ele"><br />
<br />
<h3>Beyond the Bench</h3><br />
This year, we set out with three main goals in mind:<br />
<ul><br />
<li>Assess the environmental risks associated with our project,</li><br />
<li>evaluate the applicability of our device to a variety of applications, and</li><br />
<li>educate the public about synthetic biology and how it pertains to everyday life.</li><br />
</ul><br />
To these ends, we adopted a novel approach to risk assessment and discussed our project in great detail with the Oil Sands Leadership Initiative, local water monitoring groups, environmental groups, scientific researchers and more. <br />
</div><br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_hprac').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/hpracTeam:Cornell/project/hprac2012-10-27T03:30:50Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6 style="margin-top:32px;">Human Practices</h6><br />
</li><br />
<li class="divider"></li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/CEA">Comprehensive Environmental Assessment</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/bioethics">Bioethics</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/oil_sands">Oil Sands</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/cayuga_watershed">Cayuga Watershed</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/safety">Safety</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row" id="ugd-members"><br />
<div class="twelve columns"><br />
<h2 class="centered">Human Practices Overview</h2><br />
</div><br />
</div><br />
<div class="row last-ele"><br />
<br />
<br><br><br />
This year, we set out with three main goals in mind:<br />
<ul><br />
<li>Assess the environmental risks associated with our project,</li><br />
<li>evaluate the applicability of our device to a variety of applications, and</li><br />
<li>educate the public about synthetic biology and how it pertains to everyday life.</li><br />
</ul><br />
To these ends, we adopted a novel approach to risk assessment and discussed our project in great detail with the Oil Sands Leadership Initiative, local water monitoring groups, environmental groups, scientific researchers and more. <br />
</div><br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_hprac').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/hpracTeam:Cornell/project/hprac2012-10-27T03:30:22Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6 style="margin-top:32px;">Human Practices</h6><br />
</li><br />
<li class="divider"></li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/CEA">Comprehensive Environmental Assessment</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/bioethics">Bioethics</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/oil_sands">Oil Sands</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/cayuga_watershed">Cayuga Watershed</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/safety">Safety</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row" id="ugd-members"><br />
<div class="twelve columns"><br />
<h2 class="centered">Human Practices Overview</h2><br />
</div><br />
</div><br />
<div class="row last-ele"><br />
<br />
<br />
This year, we set out with three main goals in mind:<br />
<ul><br />
<li>Assess the environmental risks associated with our project,</li><br />
<li>evaluate the applicability of our device to a variety of applications, and</li><br />
<li>educate the public about synthetic biology and how it pertains to everyday life.</li><br />
</ul><br />
To these ends, we adopted a novel approach to risk assessment and discussed our project in great detail with the Oil Sands Leadership Initiative, local water monitoring groups, environmental groups, scientific researchers and more. <br />
</div><br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_hprac').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/hpracTeam:Cornell/project/hprac2012-10-27T03:29:47Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6 style="margin-top:32px;">Human Practices</h6><br />
</li><br />
<li class="divider"></li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/CEA">Comprehensive Environmental Assessment</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/bioethics">Bioethics</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/oil_sands">Oil Sands</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/cayuga_watershed">Cayuga Watershed</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/safety">Safety</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row" id="ugd-members"><br />
<div class="twelve columns"><br />
<h2 class="centered">Human Practices Overview</h2><br />
</div><br />
</div><br />
<div class="row last-ele"><br />
This year, we set out with three main goals in mind:<br />
<ul><br />
<li>Assess the environmental risks associated with our project,</li><br />
<li>evaluate the applicability of our device to a variety of applications, and</li><br />
<li>educate the public about synthetic biology and how it pertains to everyday life.</li><br />
</ul><br />
To these ends, we adopted a novel approach to risk assessment and discussed our project in great detail with the Oil Sands Leadership Initiative, local water monitoring groups, environmental groups, scientific researchers and more. <br />
</div><br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_hprac').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/wetlab/results/currentresponseTeam:Cornell/project/wetlab/results/currentresponse2012-10-27T03:15:00Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6>Wet Lab</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly">DNA Assembly</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/arsenic">Arsenic Reporter</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/naphthalene">Naphthalene Reporter</a><br />
</li><br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results">Testing &amp; Results</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/biobricks">BioBricks</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/transcription">Transcriptional Characterization</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/currentresponse">Current Response</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/protein">MtrB Protein Expression</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/nah_operon"><i>nah</i> Operon Expression</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/artificial_river_media">Artificial River Media</a><br />
</li><br />
<br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/future_work">Future Work</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/animation">Animation</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row" id="ugd-members"><br />
<div class="twelve columns"><br />
<h2 class="centered">Current Response</h2><br />
</div><br />
</div><br />
<div class="row" id="item1"><br />
<div class="nine columns"><br />
<h3>Overview of Characterization in Bioelectrochemical Systems</h3><br />
As described in the <a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a> section, <i>S. oneidensis</i> MR-1 is capable of shuttling electrons through the Mtr pathway to reduce extracellular metals because of the negative free energy change associated with these redox reactions. Thus, to encourage <i>Shewanella</i> to transfer electrons to an electrode, we poise the potential of an electrode in a three electrode system, controlled by a potentiostat, so that electron transfer is energetically favorable to the organism. In short, a potentiostat works by setting the potential of a working electrode (WE) with respect to a Ag/AgCl reference electrode (RE) by injecting current through a counter electrode (CE). (To read about how we made our own field-deployable potentiostats, read our <a href="https://2012.igem.org/Team:Cornell/project/drylab/components">drylab components</a> page.) These electrodes can be seen in the schematic representation of our single-compartment bioelectrochemical reactors shown to the right.<br />
<br><br><br />
Because we are interested in continuous monitoring of contaminants, we characterized the current response to analyte of all engineered strains by operating reactors in continuous flow setup such that steady-state current output could be reached. In general, all experiments were performed in bench-scale reactors provided by the Angenent Lab&#8212;with a constant fluid volume of 120 mL and a consistent electrode-surface area. All characterization experiments began at an analyte concentration of zero, while media was fed to the system at a constant rate of 18 mL/min. Once reached steady state was reached&#8212;for a period of greater than three system retention times&#8212;the analyte concentration in the feed tank was increased so that a new steady state&#8212;corresponding to the higher analyte concentration&#8212;could be reached. By iteratively repeating this process, we were able to characterize the current response of our reporter strains to either arsenic-containing compounds or naphthalene, as appropriate. <br />
<br><br><br />
After initial characterization of our arsenic- and naphthalene-sensing strains, <b>we have shown that our arsenic sensor works as expected</b>, producing higher levels of steady-state current in response to arsenite salts. However, more trials are needed in order to construct a reliable calibration curve.<br />
<br />
<br />
<br />
</div><br />
<br />
<div class="three columns" style="text-align:center;"><br />
<a href="https://static.igem.org/mediawiki/2012/b/b5/Reactor_SCH.png" rel="lightbox"><br />
<img src="https://static.igem.org/mediawiki/2012/1/1d/Reactor_SCH_250.png">Click to Enlarge</a><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<div class="row" id="item1"><br />
<div class="three columns" style="text-align:center;"><br />
<img style="margin-bottom:5px;" src="<br />
https://static.igem.org/mediawiki/2012/9/98/Cornell_pstat.jpg"><br />
Potentiostats <br />
</div><br />
<br />
<br />
<br />
<br />
<div class="nine columns"><br />
<h3>First Lessons Learned: Control Reactors</h3><br />
<br />
<br />
<br />
In order to enhance the field-deployability of our final device, we initially decided to feed our reactors with LB, since a very concentrated LB source fed at a low flow rate could sustain our field reactors for extended periods of time without taking up much physical space. However, upon setting up control reactors&#8212;both in batch and continuous flow operation&#8212;we discovered that wild type <i>S. oneidensis</i> MR-1 produced significantly less current when fed with LB than M4&#8212;a commonly used media for <i>Shewanella</i>-inoculated bioelectrochemical systems, as illustrated for batch operation by the figure below.<br><br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/1/1c/LBvM4_small.png"><br />
<h6> Fig. 1. Current production over time is plotted for batch reactors inoculated with wildtype <i>S. oneidensis</i> MR-1 growing on M4 media (blue) and LB media (green). Maximum current production from M4-fed <i>Shewanella</i> is much greater than that from LB-fed.</h6><br><br><br />
<br />
When operated in a continuous flow setup, we observed the steady state current production from an LB fed reactor to be within the background noise of the setupM4&#8212;<i>i.e.</i>, an un-incoluated reactor was indistinguishable from a reactor inoculated with wildtype <i>S. oneidensis</i> MR-1. Because of this, we chose to use M4 media for all future characterization experiments, since optimization of signal-to-noise ratio is essential in the development of any sensing system.<br />
<br />
</div><br />
</div><br />
<br />
<div class="row" id="item3"><br />
<br />
<div class="nine columns"><br />
<h3>Arsenic Sensing</h3><br />
We chose to initially characterize our arsenic-sensing <i>Shewanella</i> by dosing with sodium arsenite, since the organism's native arsenate reductase activity would introduce a confounding variable in part characterization. After this initial characterization , we have shown that current is, indeed, upregulated in response to our analyte of interest. However, we should emphasize that this data is preliminary: Because of the care we took to establish a thorough Standard Operation Procedure for the handling of arsenic, we only had time for a single characterization trial, shown below in Fig. 4. Additionally, we plan on characterizing in response to both arsenate salts (to determine whether arsenate reductase activity is indeed confounding) and antimonite (to estimate the likelyhood of false positives).<br />
<br />
<br />
<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/0/04/ARS_new2.png"><br />
<h6> Fig. 3. Current production over time is plotted for continuous flow reactors inoculated with our arsenic-sensing strain (JG700+p14k). Transient phases corresponding to arsenite concentrations of 100 &mu;M (blue) and 500 &mu;M (green)are shown. Before a potentiostat channel restart at time zero, basal current was recorded at approximately 4 &mu;A. We report induced current in percent of this basal response. </h6><br><br><br />
<br />
It is also important to point out that we have not normalized any data to a per-cell basis. Because we are interested in a field-deployable system that produces greater <i>absolute</i> current in response to analyte, we did not record either optical density or colony forming units over time. However, while not a rigorous, we have observed a visible decrease in biomass for increasing concentrations of arsenite&#8212;as would be expected. Therefore, it is likely that an a per-cell basis, our arsenic sensing strains produce much more current that Fig. 4 would suggest. We plan on repeating characterization experiments in response to arsenite&#8212;both to generate a reliable transfer function relating current to arsenite concentration and to better understand the relationship between specific growth rate and MtrB production as a function of analyte concentration.<br />
</div><br />
<br />
<div class="three columns"><br />
<img src="<br />
https://static.igem.org/mediawiki/2012/b/be/Cornell_reactor_real_square.jpg"></div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<div class="row" id="item4"><br />
<div class="three columns"><br />
<img src="https://static.igem.org/mediawiki/2012/a/aa/Cornell_inject.jpg"><br />
</div><br />
<div class="nine columns"><br />
<h3>Naphthalene &amp; Salicylate Sensing</h3><br />
<br />
Because we did not have time to confirm successful conjugation of our naphthalene-degrading plasmid into <i>Shewanella</i>, we focused our efforts on observing the response to salicylate of our naphthalene-sensing precursor strain (JG700 + pSAL). This strain contains the molecular machinery requisite to respond to salicylate, which&#8212;in our final system&#8212;is a metabolite produced as a result of naphthalene catabolism via the enzymes encoded by the <i>nah</i> operon. (To read more about our naphthalene sensor design, see our <a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/salicylate">DNA Assembly</a> page.) <br><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/6/60/SAME_I_invis_small.png"><br />
<h6> Fig. 3. Current production over time is plotted for continuous flow reactors inoculated with our salicylate reporter strain (blue) and wildtype <i>S. oneidensis</i> MR-1 (green). Both duration of transient period and value of saturating current are approximately equal for reactors corresponding to both strains. </h6><br><br><br />
<br />
<br />
<br />
As seen above, our un-induced salicylate sensing strain produces approximately the same steady state current as wildtype <i>Shewanella</i>, suggesting that leaky expression of MtrB from uninduced promoter activity is enough to saturate current output. This can be understood in terms of the complete Mtr pathway, since metal-reduction activity requires a functional complex of MtrA, MtrB, and MtrC&#8212;as described in the <a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a> section page. Since there is only so much MtrC and MtrA in the cell, increasing MtrB activity saturates as free MtrC and MtrA is sequestered and localized. <br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/8/80/Point3_invis_small.png"><br />
<h6> Fig. 4. Current production over time is plotted for continuous flow reactors inoculated with our salicylate reporter strain (blue) and wildtype <i>S. oneidensis</i> MR-1 (green). Both duration of transient period and value of saturating current are approximately equal for reactors corresponding to both strains. </h6><br><br><br />
<br />
<br />
<br />
</div><br />
</div><br />
<div class="row last-ele" id="item5"><br />
<div class="twelve columns"><br />
<h3>Ferrozine Assays</h3><br />
We are also in the process of conducting ferrozine assays to demonstrate the functionality of our reporter strains at the system level. This assay quantifies the reduction of iron (III) to iron (II), an energetically favorable process for <i>Shewanella</i> expressing the Mtr pathway. We will test each of our reporter strains at various analyte concentrations, incubated with iron(III) in an anaerobic environment for extended periods of time. Increased reduction of iron (III) is a proxy for increased current production in bioreactors, and can thus be used as a reliable indicator that our sensing strains are functioning at the system level.<br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/lightbox?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_wetlab').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/wetlab/results/currentresponseTeam:Cornell/project/wetlab/results/currentresponse2012-10-27T03:12:55Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6>Wet Lab</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly">DNA Assembly</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/arsenic">Arsenic Reporter</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/naphthalene">Naphthalene Reporter</a><br />
</li><br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results">Testing &amp; Results</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/biobricks">BioBricks</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/transcription">Transcriptional Characterization</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/currentresponse">Current Response</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/protein">MtrB Protein Expression</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/nah_operon"><i>nah</i> Operon Expression</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/artificial_river_media">Artificial River Media</a><br />
</li><br />
<br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/future_work">Future Work</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/animation">Animation</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row" id="ugd-members"><br />
<div class="twelve columns"><br />
<h2 class="centered">Current Response</h2><br />
</div><br />
</div><br />
<div class="row" id="item1"><br />
<div class="nine columns"><br />
<h3>Overview of Characterization in Bioelectrochemical Systems</h3><br />
As described in the <a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a> section, <i>S. oneidensis</i> MR-1 is capable of shuttling electrons through the Mtr pathway to reduce extracellular metals because of the negative free energy change associated with these redox reactions. Thus, to encourage <i>Shewanella</i> to transfer electrons to an electrode, we poise the potential of an electrode in a three electrode system, controlled by a potentiostat, so that electron transfer is energetically favorable to the organism. In short, a potentiostat works by setting the potential of a working electrode (WE) with respect to a Ag/AgCl reference electrode (RE) by injecting current through a counter electrode (CE). (To read about how we made our own field-deployable potentiostats, read our <a href="https://2012.igem.org/Team:Cornell/project/drylab/components">drylab components</a> page.) These electrodes can be seen in the schematic representation of our single-compartment bioelectrochemical reactors shown to the right.<br />
<br><br><br />
Because we are interested in continuous monitoring of contaminants, we characterized the current response to analyte of all engineered strains by operating reactors in continuous flow setup such that steady-state current output could be reached. In general, all experiments were performed in bench-scale reactors provided by the Angenent Lab&#8212;with a constant fluid volume of 120 mL and a consistent electrode-surface area. All characterization experiments began at an analyte concentration of zero, while media was fed to the system at a constant rate of 18 mL/min. Once reached steady state was reached&#8212;for a period of greater than three system retention times&#8212;the analyte concentration in the feed tank was increased so that a new steady state&#8212;corresponding to the higher analyte concentration&#8212;could be reached. By iteratively repeating this process, we were able to characterize the current response of our reporter strains to either arsenic-containing compounds or naphthalene, as appropriate. <br />
<br><br><br />
After initial characterization of our arsenic- and naphthalene-sensing strains, <b>we have shown that our arsenic sensor works as expected</b>, producing higher levels of steady-state current in response to arsenite salts. However, more trials are needed in order to construct a reliable calibration curve.<br />
<br />
<br />
<br />
</div><br />
<br />
<div class="three columns" style="text-align:center;"><br />
<a href="https://static.igem.org/mediawiki/2012/b/b5/Reactor_SCH.png" rel="lightbox"><br />
<img src="https://static.igem.org/mediawiki/2012/1/1d/Reactor_SCH_250.png">Click to Enlarge</a><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<div class="row" id="item1"><br />
<div class="three columns" style="text-align:center;"><br />
<img style="margin-bottom:5px;" src="<br />
https://static.igem.org/mediawiki/2012/9/98/Cornell_pstat.jpg"><br />
Potentiostats <br />
</div><br />
<br />
<br />
<br />
<br />
<div class="nine columns"><br />
<h3>First Lessons Learned: Control Reactors</h3><br />
<br />
<br />
<br />
In order to enhance the field-deployability of our final device, we initially decided to feed our reactors with LB, since a very concentrated LB source fed at a low flow rate could sustain our field reactors for extended periods of time without taking up much physical space. However, upon setting up control reactors&#8212;both in batch and continuous flow operation&#8212;we discovered that wild type <i>S. oneidensis</i> MR-1 produced significantly less current when fed with LB than M4&#8212;a commonly used media for <i>Shewanella</i>-inoculated bioelectrochemical systems, as illustrated for batch operation by the figure below.<br><br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/1/1c/LBvM4_small.png"><br />
<h6> Fig. 1. Current production over time is plotted for batch reactors inoculated with wildtype <i>S. oneidensis</i> MR-1 growing on M4 media (blue) and LB media (green). Maximum current production from M4-fed <i>Shewanella</i> is much greater than that from LB-fed.</h6><br><br><br />
<br />
When operated in a continuous flow setup, we observed the steady state current production from an LB fed reactor to be within the background noise of the setupM4&#8212;<i>i.e.</i>, an un-incoluated reactor was indistinguishable from a reactor inoculated with wildtype <i>S. oneidensis</i> MR-1. Because of this, we chose to use M4 media for all future characterization experiments, since optimization of signal-to-noise ratio is essential in the development of any sensing system.<br />
<br />
</div><br />
</div><br />
<br />
<div class="row" id="item3"><br />
<br />
<div class="nine columns"><br />
<h3>Arsenic Sensing</h3><br />
We chose to initially characterize our arsenic-sensing <i>Shewanella</i> by dosing with sodium arsenite, since the organism's native arsenate reductase activity would introduce a confounding variable in part characterization. After this initial characterization , we have shown that current is, indeed, upregulated in response to our analyte of interest. However, we should emphasize that this data is preliminary: Because of the care we took to establish a thorough Standard Operation Procedure for the handling of arsenic, we only had time for a single characterization trial, shown below in Fig. 4. Additionally, we plan on characterizing in response to both arsenate salts (to determine whether arsenate reductase activity is indeed confounding) and antimonite (to estimate the likelyhood of false positives).<br />
<br />
<br />
<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/0/04/ARS_new2.png"><br />
<h6> Fig. 3. Current production over time is plotted for continuous flow reactors inoculated with our arsenic-sensing strain (JG700+p14k). Transient phases corresponding to arsenite concentrations of 100 &mu;M (blue) and 500 &mu;M (green)are shown. Before a potentiostat channel restart at time zero, basal current was recorded at approximately 4 &mu;A. We report induced current in percent of this basal response. </h6><br><br><br />
<br />
It is also important to point out that we have not normalized any data to a per-cell basis. Because we are interested in a field-deployable system that produces greater <i>absolute</i> current in response to analyte, we did not record either optical density or colony forming units over time. However, while not a rigorous, we have observed a visible decrease in biomass for increasing concentrations of arsenite&#8212;as would be expected. Therefore, it is likely that an a per-cell basis, our arsenic sensing strains produce much more current that Fig. 4 would suggest. We plan on repeating characterization experiments in response to arsenite&#8212;both to generate a reliable transfer function relating current to arsenite concentration and to better understand the relationship between specific growth rate and MtrB production as a function of analyte concentration.<br />
</div><br />
<br />
<div class="three columns"><br />
<img src="<br />
https://static.igem.org/mediawiki/2012/b/be/Cornell_reactor_real_square.jpg"></div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<div class="row" id="item4"><br />
<div class="three columns"><br />
<img src="https://static.igem.org/mediawiki/2012/a/aa/Cornell_inject.jpg"><br />
</div><br />
<div class="nine columns"><br />
<h3>Naphthalene &amp; Salicylate Sensing</h3><br />
<br />
Because we did not have time to confirm successful conjugation of our naphthalene-degrading plasmid into <i>Shewanella</i>, we focused our efforts on observing the response to salicylate of our naphthalene-sensing precursor strain (JG700 + pSAL). This strain contains the molecular machinery requisite to respond to salicylate, which&#8212;in our final system&#8212;is a metabolite produced as a result of naphthalene catabolism via the enzymes encoded by the <i>nah</i> operon. (To read more about our naphthalene sensor design, see our <a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/salicylate">DNA Assembly</a> page.) <br><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/6/60/SAME_I_invis_small.png"><br />
<h6> Fig. 3. Current production over time is plotted for continuous flow reactors inoculated with our salicylate reporter strain (blue) and wildtype <i>S. oneidensis</i> MR-1 (green). Both duration of transient period and value of saturating current are approximately equal for reactors corresponding to both strains. </h6><br><br><br />
<br />
<br />
<br />
As seen above, our un-induced salicylate sensing strain produces approximately the same steady state current as wildtype <i>Shewanella</i>, suggesting that leaky expression of MtrB from uninduced promoter activity is enough to saturate current output. This can be understood in terms of the complete Mtr pathway, since metal-reduction activity requires a functional complex of MtrA, MtrB, and MtrC&#8212;as described in the <a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a> section page. Since there is only so much MtrC and MtrA in the cell, increasing MtrB activity saturates as free MtrC and MtrA is sequestered and localized. <br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/8/80/Point3_invis_small.png"><br />
<h6> Fig. 4. Current production over time is plotted for continuous flow reactors inoculated with our salicylate reporter strain (blue) and wildtype <i>S. oneidensis</i> MR-1 (green). Both duration of transient period and value of saturating current are approximately equal for reactors corresponding to both strains. </h6><br><br><br />
<br />
<br />
<br />
</div><br />
</div><br />
<div class="row last-ele" id="item5"><br />
<div class="twelve columns"><br />
<h3>Ferrozine Assays</h3><br />
We are also in the process of conducting ferrozine assays to demonstrate the functionality of our reporter strains at the system level. This assay quantifies the reduction of iron (III) to iron (II), an energetically favorable process for <i>Shewanella</i> expressing the Mtr pathway. We will test each of our reporter strains at various analyte concentrations, incubated with iron(III) in an anaerobic environment for extended periods of time. Increased reduction of iron (III) is a proxy for increased current production in bioreactors.<br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/lightbox?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_wetlab').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/wetlab/results/currentresponseTeam:Cornell/project/wetlab/results/currentresponse2012-10-27T03:03:26Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6>Wet Lab</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly">DNA Assembly</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/arsenic">Arsenic Reporter</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/naphthalene">Naphthalene Reporter</a><br />
</li><br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results">Testing &amp; Results</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/biobricks">BioBricks</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/transcription">Transcriptional Characterization</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/currentresponse">Current Response</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/protein">MtrB Protein Expression</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/nah_operon"><i>nah</i> Operon Expression</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/artificial_river_media">Artificial River Media</a><br />
</li><br />
<br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/future_work">Future Work</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/animation">Animation</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row" id="ugd-members"><br />
<div class="twelve columns"><br />
<h2 class="centered">Current Response</h2><br />
</div><br />
</div><br />
<div class="row" id="item1"><br />
<div class="nine columns"><br />
<h3>Overview of Characterization in Bioelectrochemical Systems</h3><br />
As described in the <a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a> section, <i>S. oneidensis</i> MR-1 is capable of shuttling electrons through the Mtr pathway to reduce extracellular metals because of the negative free energy change associated with these redox reactions. Thus, to encourage <i>Shewanella</i> to transfer electrons to an electrode, we poise the potential of an electrode in a three electrode system, controlled by a potentiostat, so that electron transfer is energetically favorable to the organism. In short, a potentiostat works by setting the potential of a working electrode (WE) with respect to a Ag/AgCl reference electrode (RE) by injecting current through a counter electrode (CE). (To read about how we made our own field-deployable potentiostats, read our <a href="https://2012.igem.org/Team:Cornell/project/drylab/components">drylab components</a> page.) These electrodes can be seen in the schematic representation of our single-compartment bioelectrochemical reactors shown to the right.<br />
<br><br><br />
Because we are interested in continuous monitoring of contaminants, we characterized the current response to analyte of all engineered strains by operating reactors in continuous flow setup such that steady-state current output could be reached. In general, all experiments were performed in bench-scale reactors provided by the Angenent Lab&#8212;with a constant fluid volume of 120 mL and a consistent electrode-surface area. All characterization experiments began at an analyte concentration of zero, while media was fed to the system at a constant rate of 18 mL/min. Once reached steady state was reached&#8212;for a period of greater than three system retention times&#8212;the analyte concentration in the feed tank was increased so that a new steady state&#8212;corresponding to the higher analyte concentration&#8212;could be reached. By iteratively repeating this process, we were able to characterize the current response of our reporter strains to either arsenic-containing compounds or naphthalene, as appropriate. <br />
<br><br><br />
After initial characterization of our arsenic- and naphthalene-sensing strains, <b>we have shown that our arsenic sensor works as expected</b>, producing higher levels of steady-state current in response to arsenite salts. However, more trials are needed in order to construct a reliable calibration curve.<br />
<br />
<br />
<br />
</div><br />
<br />
<div class="three columns" style="text-align:center;"><br />
<a href="https://static.igem.org/mediawiki/2012/b/b5/Reactor_SCH.png" rel="lightbox"><br />
<img src="https://static.igem.org/mediawiki/2012/1/1d/Reactor_SCH_250.png">Click to Enlarge</a><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<div class="row" id="item1"><br />
<div class="three columns" style="text-align:center;"><br />
<img style="margin-bottom:5px;" src="<br />
https://static.igem.org/mediawiki/2012/9/98/Cornell_pstat.jpg"><br />
Potentiostats <br />
</div><br />
<br />
<br />
<br />
<br />
<div class="nine columns"><br />
<h3>First Lessons Learned: Control Reactors</h3><br />
<br />
<br />
<br />
In order to enhance the field-deployability of our final device, we initially decided to feed our reactors with LB, since a very concentrated LB source fed at a low flow rate could sustain our field reactors for extended periods of time without taking up much physical space. However, upon setting up control reactors&#8212;both in batch and continuous flow operation&#8212;we discovered that wild type <i>S. oneidensis</i> MR-1 produced significantly less current when fed with LB than M4&#8212;a commonly used media for <i>Shewanella</i>-inoculated bioelectrochemical systems, as illustrated for batch operation by the figure below.<br><br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/1/1c/LBvM4_small.png"><br />
<h6> Fig. 1. Current production over time is plotted for batch reactors inoculated with wildtype <i>S. oneidensis</i> MR-1 growing on M4 media (blue) and LB media (green). Maximum current production from M4-fed <i>Shewanella</i> is much greater than that from LB-fed.</h6><br><br><br />
<br />
When operated in a continuous flow setup, we observed the steady state current production from an LB fed reactor to be within the background noise of the setupM4&#8212;<i>i.e.</i>, an un-incoluated reactor was indistinguishable from a reactor inoculated with wildtype <i>S. oneidensis</i> MR-1. Because of this, we chose to use M4 media for all future characterization experiments, since optimization of signal-to-noise ratio is essential in the development of any sensing system.<br />
<br />
</div><br />
</div><br />
<br />
<div class="row" id="item3"><br />
<br />
<div class="nine columns"><br />
<h3>Arsenic Sensing</h3><br />
We chose to initially characterize our arsenic-sensing <i>Shewanella</i> by dosing with sodium arsenite, since the organism's native arsenate reductase activity would introduce a confounding variable in part characterization. After this initial characterization , we have shown that current is, indeed, upregulated in response to our analyte of interest. However, we should emphasize that this data is preliminary: Because of the care we took to establish a thorough Standard Operation Procedure for the handling of arsenic, we only had time for a single characterization trial, shown below in Fig. 4. Additionally, we plan on characterizing in response to both arsenate salts (to determine whether arsenate reductase activity is indeed confounding) and antimonite (to estimate the likelyhood of false positives).<br />
<br />
<br />
<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/0/04/ARS_new2.png"><br />
<h6> Fig. 3. Current production over time is plotted for continuous flow reactors inoculated with our arsenic-sensing strain (JG700+p14k). Transient phases corresponding to arsenite concentrations of 100 &mu;M (blue) and 500 &mu;M (green)are shown. Before a potentiostat channel restart at time zero, basal current was recorded at approximately 4 &mu;A. We report induced current in percent of this basal response. </h6><br><br><br />
<br />
It is also important to point out that we have not normalized any data to a per-cell basis. Because we are interested in a field-deployable system that produces greater <i>absolute</i> current in response to analyte, we did not record either optical density or colony forming units over time. However, while not a rigorous, we have observed a visible decrease in biomass for increasing concentrations of arsenite&#8212;as would be expected. Therefore, it is likely that an a per-cell basis, our arsenic sensing strains produce much more current that Fig. 4 would suggest. We plan on repeating characterization experiments in response to arsenite&#8212;both to generate a reliable transfer function relating current to arsenite concentration and to better understand the relationship between specific growth rate and MtrB production as a function of analyte concentration.<br />
</div><br />
<br />
<div class="three columns"><br />
<img src="<br />
https://static.igem.org/mediawiki/2012/b/be/Cornell_reactor_real_square.jpg"></div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<div class="row" id="item4"><br />
<div class="three columns"><br />
<img src="https://static.igem.org/mediawiki/2012/a/aa/Cornell_inject.jpg"><br />
</div><br />
<div class="nine columns"><br />
<h3>Naphthalene &amp; Salicylate Sensing</h3><br />
<br />
Because we did not have time to confirm successful conjugation of our naphthalene-degrading plasmid into <i>Shewanella</i>, we focused our efforts on observing the response to salicylate of our naphthalene-sensing precursor strain (JG700 + pSAL). This strain contains the molecular machinery requisite to respond to salicylate, which&#8212;in our final system&#8212;is a metabolite produced as a result of naphthalene catabolism via the enzymes encoded by the <i>nah</i> operon. (To read more about our naphthalene sensor design, see our <a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/salicylate">DNA Assembly</a> page.) <br><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/6/60/SAME_I_invis_small.png"><br />
<h6> Fig. 3. Current production over time is plotted for continuous flow reactors inoculated with our salicylate reporter strain (blue) and wildtype <i>S. oneidensis</i> MR-1 (green). Both duration of transient period and value of saturating current are approximately equal for reactors corresponding to both strains. </h6><br><br><br />
<br />
<br />
<br />
As seen above, our un-induced salicylate sensing strain produces approximately the same steady state current as wildtype <i>Shewanella</i>, suggesting that leaky expression of MtrB from uninduced promoter activity is enough to saturate current output. This can be understood in terms of the complete Mtr pathway, since metal-reduction activity requires a functional complex of MtrA, MtrB, and MtrC&#8212;as described in the <a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a> section page. Since there is only so much MtrC and MtrA in the cell, increasing MtrB activity saturates as free MtrC and MtrA is sequestered and localized. <br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/8/80/Point3_invis_small.png"><br />
<h6> Fig. 4. Current production over time is plotted for continuous flow reactors inoculated with our salicylate reporter strain (blue) and wildtype <i>S. oneidensis</i> MR-1 (green). Both duration of transient period and value of saturating current are approximately equal for reactors corresponding to both strains. </h6><br><br><br />
<br />
<br />
<br />
</div><br />
</div><br />
<div class="row last-ele" id="item5"><br />
<div class="nine columns"><br />
<h3>Ferrozine Assays</h3><br />
<br />
</div><br />
<div class="three columns"><br />
<img src="https://static.igem.org/mediawiki/2012/a/aa/Cornell_inject.jpg"><br />
</div><br />
<br />
<br />
</div><br />
<br />
<br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/lightbox?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_wetlab').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/wetlab/results/currentresponseTeam:Cornell/project/wetlab/results/currentresponse2012-10-27T03:02:31Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6>Wet Lab</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly">DNA Assembly</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/arsenic">Arsenic Reporter</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/naphthalene">Naphthalene Reporter</a><br />
</li><br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results">Testing &amp; Results</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/biobricks">BioBricks</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/transcription">Transcriptional Characterization</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/currentresponse">Current Response</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/protein">MtrB Protein Expression</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/nah_operon"><i>nah</i> Operon Expression</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/artificial_river_media">Artificial River Media</a><br />
</li><br />
<br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/future_work">Future Work</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/animation">Animation</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row" id="ugd-members"><br />
<div class="twelve columns"><br />
<h2 class="centered">Current Response</h2><br />
</div><br />
</div><br />
<div class="row" id="item1"><br />
<div class="nine columns"><br />
<h3>Overview of Characterization in Bioelectrochemical Systems</h3><br />
As described in the <a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a> section, <i>S. oneidensis</i> MR-1 is capable of shuttling electrons through the Mtr pathway to reduce extracellular metals because of the negative free energy change associated with these redox reactions. Thus, to encourage <i>Shewanella</i> to transfer electrons to an electrode, we poise the potential of an electrode in a three electrode system, controlled by a potentiostat, so that electron transfer is energetically favorable to the organism. In short, a potentiostat works by setting the potential of a working electrode (WE) with respect to a Ag/AgCl reference electrode (RE) by injecting current through a counter electrode (CE). (To read about how we made our own field-deployable potentiostats, read our <a href="https://2012.igem.org/Team:Cornell/project/drylab/components">drylab components</a> page.) These electrodes can be seen in the schematic representation of our single-compartment bioelectrochemical reactors shown to the right.<br />
<br><br><br />
Because we are interested in continuous monitoring of contaminants, we characterized the current response to analyte of all engineered strains by operating reactors in continuous flow setup such that steady-state current output could be reached. In general, all experiments were performed in bench-scale reactors provided by the Angenent Lab&#8212;with a constant fluid volume of 120 mL and a consistent electrode-surface area. All characterization experiments began at an analyte concentration of zero, while media was fed to the system at a constant rate of 18 mL/min. Once reached steady state was reached&#8212;for a period of greater than three system retention times&#8212;the analyte concentration in the feed tank was increased so that a new steady state&#8212;corresponding to the higher analyte concentration&#8212;could be reached. By iteratively repeating this process, we were able to characterize the current response of our reporter strains to either arsenic-containing compounds or naphthalene, as appropriate. <br />
<br><br><br />
After initial characterization of our arsenic- and naphthalene-sensing strains, <b>we have shown that our arsenic sensor works as expected</b>, producing higher levels of steady-state current in response to arsenite salts. However, more trials are needed in order to construct a reliable calibration curve.<br />
<br />
<br />
<br />
</div><br />
<br />
<div class="three columns" style="text-align:center;"><br />
<a href="https://static.igem.org/mediawiki/2012/b/b5/Reactor_SCH.png" rel="lightbox"><br />
<img src="https://static.igem.org/mediawiki/2012/1/1d/Reactor_SCH_250.png">Click to Enlarge</a><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<div class="row" id="item1"><br />
<div class="three columns" style="text-align:center;"><br />
<img style="margin-bottom:5px;" src="<br />
https://static.igem.org/mediawiki/2012/9/98/Cornell_pstat.jpg"><br />
Potentiostats <br />
</div><br />
<br />
<br />
<br />
<br />
<div class="nine columns"><br />
<h3>First Lessons Learned: Control Reactors</h3><br />
<br />
<br />
<br />
In order to enhance the field-deployability of our final device, we initially decided to feed our reactors with LB, since a very concentrated LB source fed at a low flow rate could sustain our field reactors for extended periods of time without taking up much physical space. However, upon setting up control reactors&#8212;both in batch and continuous flow operation&#8212;we discovered that wild type <i>S. oneidensis</i> MR-1 produced significantly less current when fed with LB than M4&#8212;a commonly used media for <i>Shewanella</i>-inoculated bioelectrochemical systems, as illustrated for batch operation by the figure below.<br><br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/1/1c/LBvM4_small.png"><br />
<h6> Fig. 1. Current production over time is plotted for batch reactors inoculated with wildtype <i>S. oneidensis</i> MR-1 growing on M4 media (blue) and LB media (green). Maximum current production from M4-fed <i>Shewanella</i> is much greater than that from LB-fed.</h6><br><br><br />
<br />
When operated in a continuous flow setup, we observed the steady state current production from an LB fed reactor to be within the background noise of the setupM4&#8212;<i>i.e.</i>, an un-incoluated reactor was indistinguishable from a reactor inoculated with wildtype <i>S. oneidensis</i> MR-1. Because of this, we chose to use M4 media for all future characterization experiments, since optimization of signal-to-noise ratio is essential in the development of any sensing system.<br />
<br />
</div><br />
</div><br />
<br />
<div class="row" id="item3"><br />
<br />
<div class="nine columns"><br />
<h3>Arsenic Sensing</h3><br />
We chose to initially characterize our arsenic-sensing <i>Shewanella</i> by dosing with sodium arsenite, since the organism's native arsenate reductase activity would introduce a confounding variable in part characterization. After this initial characterization , we have shown that current is, indeed, upregulated in response to our analyte of interest. However, we should emphasize that this data is preliminary: Because of the care we took to establish a thorough Standard Operation Procedure for the handling of arsenic, we only had time for a single characterization trial, shown below in Fig. 4. Additionally, we plan on characterizing in response to both arsenate salts (to determine whether arsenate reductase activity is indeed confounding) and antimonite (to estimate the likelyhood of false positives).<br />
<br />
<br />
<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/0/04/ARS_new2.png"><br />
<h6> Fig. 3. Current production over time is plotted for continuous flow reactors inoculated with our arsenic-sensing strain (JG700+p14k). Transient phases corresponding to arsenite concentrations of 100 &mu;M (blue) and 500 &mu;M (green)are shown. Before a potentiostat channel restart at time zero, basal current was recorded at approximately 4 &mu;A. We report induced current in percent of this basal response. </h6><br><br><br />
<br />
It is also important to point out that we have not normalized any data to a per-cell basis. Because we are interested in a field-deployable system that produces greater <i>absolute</i> current in response to analyte, we did not record either optical density or colony forming units over time. However, while not a rigorous, we have observed a visible decrease in biomass for increasing concentrations of arsenite&#8212;as would be expected. Therefore, it is likely that an a per-cell basis, our arsenic sensing strains produce much more current that Fig. 4 would suggest. We plan on repeating characterization experiments in response to arsenite&#8212;both to generate a reliable transfer function relating current to arsenite concentration and to better understand the relationship between specific growth rate and MtrB production as a function of analyte concentration.<br />
</div><br />
<br />
<div class="three columns"><br />
<img src="<br />
https://static.igem.org/mediawiki/2012/b/be/Cornell_reactor_real_square.jpg"></div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<div class="row" id="item4"><br />
<div class="three columns"><br />
<img src="https://static.igem.org/mediawiki/2012/a/aa/Cornell_inject.jpg"><br />
</div><br />
<div class="nine columns"><br />
<h3>Naphthalene &amp; Salicylate Sensing</h3><br />
<br />
Because we did not have time to confirm successful conjugation of our naphthalene-degrading plasmid into <i>Shewanella</i>, we focused our efforts on observing the response to salicylate of our naphthalene-sensing precursor strain (JG700 + pSAL). This strain contains the molecular machinery requisite to respond to salicylate, which&#8212;in our final system&#8212;is a metabolite produced as a result of naphthalene catabolism via the enzymes encoded by the <i>nah</i> operon. (To read more about our naphthalene sensor design, see our <a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/salicylate">DNA Assembly</a> page.) <br><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/6/60/SAME_I_invis_small.png"><br />
<h6> Fig. 3. Current production over time is plotted for continuous flow reactors inoculated with our salicylate reporter strain (blue) and wildtype <i>S. oneidensis</i> MR-1 (green). Both duration of transient period and value of saturating current are approximately equal for reactors corresponding to both strains. </h6><br><br><br />
<br />
<br />
<br />
As seen above, our un-induced salicylate sensing strain produces approximately the same steady state current as wildtype <i>Shewanella</i>, suggesting that leaky expression of MtrB from uninduced promoter activity is enough to saturate current output. This can be understood in terms of the complete Mtr pathway, since metal-reduction activity requires a functional complex of MtrA, MtrB, and MtrC&#8212;as described in the <a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a> section page. Since there is only so much MtrC and MtrA in the cell, increasing MtrB activity saturates as free MtrC and MtrA is sequestered and localized. <br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/8/80/Point3_invis_small.png"><br />
<h6> Fig. 4. Current production over time is plotted for continuous flow reactors inoculated with our salicylate reporter strain (blue) and wildtype <i>S. oneidensis</i> MR-1 (green). Both duration of transient period and value of saturating current are approximately equal for reactors corresponding to both strains. </h6><br><br><br />
<br />
<br />
<br />
</div><br />
<br />
<div class="row last-ele" id="item5"><br />
<div class="nine columns"><br />
<h3>Ferrozine Assays</h3><br />
<br />
</div><br />
<div class="three columns"><br />
<img src="https://static.igem.org/mediawiki/2012/a/aa/Cornell_inject.jpg"><br />
</div><br />
<br />
<br />
</div><br />
<br />
<br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/lightbox?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_wetlab').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/gallery/outreachTeam:Cornell/project/gallery/outreach2012-10-27T02:02:52Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6>Photo Galleries</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/gallery">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/gallery/device">The Device</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/gallery/drylab">Dry Lab</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/gallery/wetlab">Wet Lab</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/gallery/outreach">Outreach</a><br />
</li><br />
<br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h2 class="centered">Outreach Gallery</h2><br />
</div><br />
</div><br />
<div class="row last-ele"><br />
<div class="twelve columns"><br />
<ul class="block-grid four-up"><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/b/bd/Sciencenter_6_900.png" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/2/22/Sciencenter_6_small.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/4/44/Sciencenter_7.JPG" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/8/80/Sciencenter_7_small.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/e/e1/Sciencenter_8.JPG" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/7/71/Sciencenter_8_small.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/e/ed/Sciencenter_9.JPG" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/2/2c/Sciencenter_9_small.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/6/65/CIBT_2.JPG" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/9/98/CIBT_2_small.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/c/c2/PSP_4.JPG" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/2/25/Psp_4_small.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/e/ea/PSP_5.JPG" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/1/13/Psp_5_small.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/b/b2/Gallery1.png" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/e/e1/Gallery1crop.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/d/d9/Gallery2.png" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/f/f4/Gallery2crop.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/6/6f/Gallery3.png" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/e/eb/Gallery3crop.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/3/3d/Gallery4.png" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/c/ca/Gallery4crop.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/5/59/Gallery5.png" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/1/18/Gallery5crop.png"></a><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/lightbox?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_gallery').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/wetlab/results/transcriptionTeam:Cornell/project/wetlab/results/transcription2012-10-27T01:40:32Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6>Wet Lab</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly">DNA Assembly</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/arsenic">Arsenic Reporter</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/naphthalene">Naphthalene Reporter</a><br />
</li><br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results">Testing &amp; Results</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/biobricks">BioBricks</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/transcription">Transcriptional Characterization</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/currentresponse">Current Response</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/protein">MtrB Protein Expression</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/nah_operon"><i>nah</i> Operon Expression</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/artificial_river_media">Artificial River Media</a><br />
</li><br />
<br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/future_work">Future Work</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/animation">Animation</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h2 class="centered">Transcriptional Characterization</h2><br />
</div><br />
</div><br />
<div class="row"><br />
<div class="twelve columns"><br />
<br><br />
<h2> Fluorescence </h2><br />
In order to characterize promoter activity in response to arsenic and salicylate, we appended mRFP downstream of mtrB in our reporter parts. We used these constructs to test the level of promoter activity at increasing arsenic and salicylate concentrations. <br />
<h3>Control</h3><br />
To optimize experimental parameters and verify that fluorescence of <i>S. oneidensis</i> could be measured reliably, we began by measuring the fluorescence of mRFP with Anderson series promoters in <i>Shewanella oneidensis</i> MR-1. After adjusting the parameters of our tests to get a consistent response from control strains, we saw increasing relative fluorescence with increasing promoter strength. This suggests that the Anderson series constitutive promoters show similar activity in <i>S. oneidensis</i> as they do in <i>E. coli</i>.<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/9/9b/Fluorescence_controls.png"><br />
<font size="2"><b>mRFP fluorescence increases with increasing promoter strength.</b> Relative fluorescence of four strains, normalized to optical density, averaged over 8 replicates after a 16-hour incubation period. <i>S. oneidensis</i> with mtrB knocked out, and three strains of <i>S. oneidensis</i> expressing mRFP with Anderson series promoters strength 0.1, 0.7, and 1.0, were tested.</font><br />
</div><br />
</div><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h3>Arsenic</h3><br />
In order to determine if gene expression is increased in the presence of arsenic, we incubated our reporter strains with varying concentrations of either arsenite or arsenate and measured fluorescence using the BioTek Instruments Synergy™ HT Multi-Mode Microplate Reader. Trials were run using blank LB medium and <i>S. oneidensis</i> &Delta;mtrB as negative controls, while <i>S. oneidensis</i> &Delta;mtrB strains with Anderson promoters (0.1, 0.4, 1.0) upstream of mRFP were used as positive controls. Background fluorescence from LB was subtracted and fluorescence normalized to optical density in order to obtain relative fluorescence per cell mass. Fluorescence data for three replicates was averaged over time courses of 4.5 hours, after the cells had grown to a steady OD.<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/a/a7/FluorescenceArsenite1001.png"><br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/9/92/FluorescenceArsenate1001.png"><br />
<br />
<font size="2"><b>Arsenic reporter responds positively to arsenite, but not arsenate.</b> Preliminary data of relative fluorescence at 0, 10, 50, 100, and 500 µM of (a) arsenite, and (b) arsenate. Relative fluorescence is reported after normalization to optical density.</font><br />
<br />
<br><br><br />
<br />
Our preliminary data shows that as arsenite concentration is increased, relative fluorescence increases by over two-fold in both reporter strains! Our arsenic reporters are upregulating mRFP expression in response to arsenite, which suggests that mtrB transcription is also being upregulated.<br />
<br />
<br/><br><br />
<br />
However, our preliminary data from arsenate treatment shows no clear trend. As <i>S. oneidensis</i> has the native ability to reduce arsenates to arsenites, this may contribute to the lack of an obvious trend.<br />
<br />
<br/><br><br />
<br />
Because relative fluorescence is an average of only 3 replicates over 4.5 hour time courses, error bars are not included. We are currently continuing fluorescence assays to ensure statistical significance and to further define the dynamic range of our constructs.<br />
<br />
</div><br />
</div><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h3>Salicylate</h3><br />
<br />
Our fluorescence assays confirm that the salicylate reporter construct without a BamHI cut-site, SAL2, responds to salicylate in a range of 10-100 µM. As with tests characterizing response to arsenites and arsenates, we measured fluorescence while varying concentration of salicylate in LB medium.<br />
<br />
Trials were run using blank LB medium and <i>S. oneidensis</i> &Delta;mtrB as negative controls, while <i>S. oneidensis</i> &Delta;mtrB strains with Anderson promoters (0.1, 0.4, 1.0) upstream of mRFP were used as positive controls.<br />
Background fluorescence from LB was subtracted and fluorescence normalized to optical density in order to obtain relative fluorescence per cell mass. Fluorescence data for three replicates was averaged over a time course of 7.5 hours, after the cells had grown to a steady OD.<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/5/56/FluorescenceSalicylate930.png"><br />
<br />
<font size="2"><b>Salicylate reporter upregulates transcription of downstream genes in response to induction with salicylate.</b> Preliminary data of relative fluorescence of salicylate reporter in <i>S. oneidensis</i> at 0, 10, 100, and 500 µM of salicylate is shown. Relative fluorescence is reported after normalization to optical density.</font><br />
<br />
<br><br><br />
<br />
Preliminary data strongly suggests that SAL2 responds to salicylate at concentrations in the order of hundreds of µM. SAL2 fluorescence is averaged over 3 replicates in addition to averaging replicate individually over a time course of 7.5 hours. Error bars are excluded, pending additional replicates to ensure statistical significance. However, we are confident that our salicylate reporter is functioning as expected on the transcriptional level.<br />
</div><br />
</div><br />
<br />
<br><br><br />
<div class="row last-ele"><br />
<br />
<div class="nine columns"><br />
<h2>RT-qPCR</h2><br />
We are currently using two-step RT-qPCR to confirm that our engineered Shewanella strains respond to arsenic and naphthalene. Total RNA will be isolated using the E.Z.N.A.™ Bacterial RNA Isolation Kit from Omega bio-tek; cDNA will be synthesized using the qScript™ Flex cDNA Kit from Quanta Biosciences; and we are using the ABI ViiA7 platform along with the KAPA SYBR(R) FAST qPCR Kit from KAPA Biosystems. Our primers are as follows: <br />
<br><br><br />
FOR_enzA: CAGCCTTTTACCCAAGGTGA<br />
<br><br />
REV_enzA: CACGATTCGAGAGGGTGATT<br />
<br><br />
FOR_RecA: TTCCCCTCGACATTGTCATCATCGGA<br />
<br><br />
REV_RecA: AAGGGCGATAAAATTGGTCAAGGCCG<br />
<br><br />
3'_FOR_qPCR_mtrB: ACGCTCAATATCAAGCCACCGAGA<br />
<br><br />
3'_REV_qPCR_mtrB: TGTGCGGTGTAGTCATGGCTGT<br />
</div><br />
<div class="three columns"><br />
<img src="https://static.igem.org/mediawiki/2012/c/ce/Cornell12_Stock_4.jpg"><br />
</div><br />
</div><br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/lightbox?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_wetlab').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/hprac/CEATeam:Cornell/project/hprac/CEA2012-10-27T01:26:10Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6 style="margin-top:72px;">Human Practices</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac">Overview</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/CEA">Comprehensive Environmental Assessment</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/bioethics">Bioethics</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/oil_sands">Oil Sands</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/cayuga_watershed">Cayuga Watershed</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/safety">Safety</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row" id="ugd-members"><br />
<div class="twelve columns"><br />
<h2 class="centered">Comprehensive Environmental Assessment</h2><br />
</div><br />
</div><br />
<div class="row last-ele"><br />
<div class="twelve columns"><br />
<h3>Introduction to CEA</h3><br />
<br />
As scientists, we are often inclined to reduce complex procedures down to simple, step-by-step protocols. Assessing risk and evaluating environmental impact are no exception; our first instinct this year was to create a universal checklist of regulations that every environmental iGEM project could fulfill in order to ensure environmental safety, the idea being that we could easily and systematically find answers to questions of environmental safety in scientific literature. However, upon speaking with Dr. Christina Powers, a biologist at the US Environmental Protection Agency, and further exploring the concerns relating to our own project, we decided to adopt a new approach to issues of human practices: Comprehensive Environmental Assessment (CEA).<br />
</br><br />
<br>CEA differs from traditional methods of risk assessment by recognizing that risk assessment is fundamentally a decision-making process in which scientists, experts, and the public should be engaged. The goal is to foster transparent discussion and use collective judgment to evaluate limitations and trade-offs in order to arrive at holistic conclusions about the primary issues that researchers should address in their research planning.</br><br />
</div><br />
<div class="twelve columns"><br />
<h3>CEA &amp; Synthetic Biology</h3><br />
While the Environmental Protection Agency primarily uses the CEA approach for nanomaterials, the Woodrow Wilson International Center for Scholars in Washington, D.C., recently launched efforts to lay out a framework to apply CEA to synthetic biology. This groundbreaking project set out to assess the CEA approach’s relevance to synthetic biology, in anticipation of the growing demand for synthetic biology-based solutions to global issues. They arrived at the conclusion that scientists should focus on four major areas of risk assessment: altered physiology, competition and biodiversity, evolutionary prediction, and gene transfer.<br />
</br><br />
<br>The Woodrow Wilson Center’s Synthetic Biology Project recommended that CEA be applied to more developed projects that were approaching field deployment in order to evaluate it as a risk-assessment approach for synthetic biology at large. This is where we come in: can CEA be successfully used to evaluate the risks of our field-deployable device? What are its limitations? </br><br />
<br />
<br>We began by attempting to apply the Synthetic Biology Project’s modified guidelines for prioritizing research questions to our own project as it currently stands.</br><br />
<img src="https://static.igem.org/mediawiki/2012/5/5a/CEA.PNG" class="inline"><br />
Above is a simplified schematic of our risk assessment approach, as adapted from the Woodrow Wilson Center. We hope that this framework will prove useful to other environmental iGEM teams in the future.<br />
<br><br><br />
<h5>Altered Physiology</h5><br />
<br />
The current versions of our genetically modified strains have a membrane protein in the Mtr pathway for anaerobic respiration knocked out and complemented on a plasmid. They differ from wild-type <i>Shewanella oneidensis</i> MR-1 in that their capacity for anaerobic respiration is upregulated in the presence of analyte (arsenic or naphthalene). This plasmid appears to be producing mtrB in a fully functional form that successfully completes the anaerobic respiration pathway when induced. One important difference is that when uninduced, the bacteria loses much of its anaerobic respiratory activity, and must rely significantly more on aerobic respiration; this is further discussed below.<br />
<br />
<br>In addition, our salicylate reporter strain contains the nah operon, which allows the cells to constitutively degrade naphthalene into salicylate. Salicylate, a metabolic intermediate in the <i>Pseudomonas</i> strain from which the nah operon was taken, is less toxic to the environment than naphthalene. <i>P. putida</i> G7 can further degrade salicylate into a catechol, an edible carbon source using the sal operon; this second operon is not present in our cells, so our <i>Shewanella</i> strains are unable to actively degrade salicylate. This means that our cells cannot use naphthalene as a carbon source, a conclusion that is supported by our naphthalene growth assays. The effects of salicylate production on the cells appear to be negligible, but this should be further explored in future characterization work. </br><br />
<br />
<br>One of our future plans is to integrate our constructs into the chromosomes of our strains, in order to ensure that mtrB is not saturating at its uninduced, basal expression levels. This poses new questions: will chromosomal integration alter the expression patterns of this engineered pathway? Will it interfere with other functions of the cells? Functionality can be altered depending on the position of the construct within the chromosome. This is our first forthcoming research priority: determining any potential adverse effects of chromosomal integration, carrying it out, and thoroughly testing the functionality of our new engineered strains. </br><br />
<br />
<h5>Competition &amp; Biodiversity </h5><br />
A second concern is that engineered strains could possibly outcompete wild-type species in the environment and pose a threat to biodiversity. Our first line of defense against this possibility is physical containment: the inlet and outlet of our current prototype are equipped with 0.1 µm filters, effectively eliminating the possibility that our engineered strains may interact with natural organisms. However, imagine that there could be a mechanical error: physical breakage of the device, slight discrepancies in filter pore sizes, et cetera, that could leave a slim possibility that our strains could come into contact with natural species. What then?<br />
<br />
<br>To answer this question, we return to the altered physiology of our strains: the primary distinguishing characteristic to note is that the cells cannot carry out the wild-type levels of anaerobic respiration unless they are induced. This means that in situations where oxygen availability is limiting, and toxins are not highly prevalent, our strains are less able to compete than wild-type Shewanella; this is our second line of defense. <i>S. oneidensis</i> is native to freshwater ecosystems in our area, so our strains should not be disruptive to biodiversity. In addition, we have observed that inserting the nah operon into cells seems to significantly increase their doubling time, so our salicylate reporter strains would be even less able to compete than our arsenic reporters.</br><br />
<br />
<br>However, what happens in the case that oxygen availability is not limiting? It is probable that our current engineered strains would be able to survive and thrive in aerobic conditions, and live alongside wild-type <i>Shewanella</i>. We need a third line of defense for this situation, a modification that would prevent our strains from being able to survive outside of our physical device. For this, we propose auxotrophy: in a truly field-deployable device, we would use a strain that had a gene for a key metabolite knocked out, so that the strain would rely upon supplementation of this nutrient in order to survive. We would then supplement this metabolite inside of the device, so that our strains would function properly within our device. If the bacteria were to somehow escape, their functionality would be severely impaired by the lack of nutritional supplementation, and they would be quickly outcompeted by wild-type strains.</br><br />
<br />
<br>This brings to the table a second research priority for field-deployability: engineer an auxotrophic strain of <i>Shewanella</i> to contain our constructs, and ensure that the likelihood of survival without nutritional supplementation is very, very low. We would also need to ensure, from a practical standpoint, that auxotrophy would not interfere with any other aspects of the physiology of the cells.<br><br />
<br />
<br><br />
<h5>Evolutionary Prediction</h5> <br />
Due to the relatively simple nature of our reporter system, we find it highly unlikely that our strains could evolve to possess any dangerous function if somehow released into the wild. However, it is still possible that the promoter regions of our constructs could mutate and alter the expected patterns of promoter activity, or that the functionality of mtrB would be impaired by a deleterious mutation. The former possibility could serve to make the strain more genetically similar to the wild-type, and thus more able to compete; this presents us with another reason to pursue auxotrophy as a solution, basically in order to ensure that our strains are not alive for long enough for mutations to accumulate. <br />
</br><br />
<br />
<br>However, we would also need to conduct extensive testing to ensure that our strains remain functional and responsive to analyte for the full 6-month period.<br />
</br><br />
<br />
<p><br />
<h5>Gene Transfer</h5> <br />
Perhaps the most pressing concern with any synthetic biology project is the possibility of horizontal gene transfer from engineered to natural strains, and vice versa. Again, our first line of defense is physical containment, but barring that, what can we do to reduce the possibility that our strains would transfer unnatural functions to natural cells? The biggest shortcoming of our current system is that antibiotic resistance is used as a selective marker on our plasmids, thus allowing for the possibility that antibiotic resistance could be spread among natural populations via conjugation or passive transformation. While we could explore the possibility of using another form of auxotrophy as a selective marker on a plasmid, we believe that a more viable solution would be to eliminate the need for a selective pressure in the first place, namely by chromosomal integration. The transfer of chromosomal DNA is much less likely than the transfer of a plasmid, and, as mentioned above, chromosomal integration would solve other problems in the functionality of our reporters.<br />
</p><br />
</div><br />
<br />
<div class="twelve columns"><br />
<h3>Limitations of CEA</h3><br />
CEA allowed us to think about crucial future work for our project in order to make it suitable for field-deployability. However, in our interactions with environmental groups, public officials in water quality management, and industrial groups, we encountered several important questions that were not built into existing CEA framework. Assessing the suitability of a synthetic biology-based device extends far beyond practical environmental risk assessment, into regulatory and economic concerns. The Presidential Commission for the Study of Bioethical Issues (PCSBI) released a report in December 2010 regarding important considerations for the ethics of synthetic biology projects, not all of which are encompassed by the CEA framework. In addition, as we approach field-deployability, the economics of the device become essential to assessing its viability as a solution to real-world water monitoring needs. These ideas are further explored in the remainder of this section.<br />
</div><br />
<div class="twelve columns"><br />
<h3>References</h3><br />
Dana, G. V., Kuiken, T., Rejeski, D., &amp; Snow, A. A. (2012). Synthetic biology: Four steps to avoid a synthetic-biology disaster. <i>Nature, 483.</i> doi:10.1038/483029a</br><br />
<br>Powers, C. M., Dana, G., Gillespie, P., Gwinn, M. R., Hendren, C. O., Long, T. C., Wang, A., Davis, J. M. (2012). Comprehensive Environmental Assessment: A Meta-Assessment Approach. <i>Environ. Sci. Technol., 46,</i> 9202−9208. http://dx.doi.org/10.1021/es3023072</br><br />
<br>Synthetic Biology Project. (2011, July 28). Comprehensive Environmental Assessment and Its Application to Synthetic Biology Applications. Retrieved from http://www.synbioproject.org/events/archive/cea/</br><br />
<br />
</div><br />
</div><br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_hprac').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/hprac/CEATeam:Cornell/project/hprac/CEA2012-10-27T01:25:14Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6 style="margin-top:72px;">Human Practices</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac">Overview</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/CEA">Comprehensive Environmental Assessment</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/bioethics">Bioethics</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/oil_sands">Oil Sands</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/cayuga_watershed">Cayuga Watershed</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/safety">Safety</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row" id="ugd-members"><br />
<div class="twelve columns"><br />
<h2 class="centered">Comprehensive Environmental Assessment</h2><br />
</div><br />
</div><br />
<div class="row last-ele"><br />
<div class="twelve columns"><br />
<h3>Introduction to CEA</h3><br />
<br />
As scientists, we are often inclined to reduce complex procedures down to simple, step-by-step protocols. Assessing risk and evaluating environmental impact are no exception; our first instinct this year was to create a universal checklist of regulations that every environmental iGEM project could fulfill in order to ensure environmental safety, the idea being that we could easily and systematically find answers to questions of environmental safety in scientific literature. However, upon speaking with Dr. Christina Powers, a biologist at the US Environmental Protection Agency, and further exploring the concerns relating to our own project, we decided to adopt a new approach to issues of human practices: Comprehensive Environmental Assessment (CEA).<br />
</br><br />
<br>CEA differs from traditional methods of risk assessment by recognizing that risk assessment is fundamentally a decision-making process in which scientists, experts, and the public should be engaged. The goal is to foster transparent discussion and use collective judgment to evaluate limitations and trade-offs in order to arrive at holistic conclusions about the primary issues that researchers should address in their research planning.</br><br />
</div><br />
<div class="twelve columns"><br />
<h3>CEA &amp; Synthetic Biology</h3><br />
While the Environmental Protection Agency primarily uses the CEA approach for nanomaterials, the Woodrow Wilson International Center for Scholars in Washington, D.C., recently launched efforts to lay out a framework to apply CEA to synthetic biology. This groundbreaking project set out to assess the CEA approach’s relevance to synthetic biology, in anticipation of the growing demand for synthetic biology-based solutions to global issues. They arrived at the conclusion that scientists should focus on four major areas of risk assessment: altered physiology, competition and biodiversity, evolutionary prediction, and gene transfer.<br />
</br><br />
<br>The Woodrow Wilson Center’s Synthetic Biology Project recommended that CEA be applied to more developed projects that were approaching field deployment in order to evaluate it as a risk-assessment approach for synthetic biology at large. This is where we come in: can CEA be successfully used to evaluate the risks of our field-deployable device? What are its limitations? </br><br />
<br />
<br>We began by attempting to apply the Synthetic Biology Project’s modified guidelines for prioritizing research questions to our own project as it currently stands.</br><br />
<img src="https://static.igem.org/mediawiki/2012/5/5a/CEA.PNG" class="inline"><br />
Above is a simplified schematic of our risk assessment approach, as adapted from the Woodrow Wilson Center. We hope that this framework will prove useful to other environmental iGEM teams in the future.<br />
<h5>Altered Physiology</h5><br />
<br />
The current versions of our genetically modified strains have a membrane protein in the Mtr pathway for anaerobic respiration knocked out and complemented on a plasmid. They differ from wild-type <i>Shewanella oneidensis</i> MR-1 in that their capacity for anaerobic respiration is upregulated in the presence of analyte (arsenic or naphthalene). This plasmid appears to be producing mtrB in a fully functional form that successfully completes the anaerobic respiration pathway when induced. One important difference is that when uninduced, the bacteria loses much of its anaerobic respiratory activity, and must rely significantly more on aerobic respiration; this is further discussed below.<br />
<br />
<br>In addition, our salicylate reporter strain contains the nah operon, which allows the cells to constitutively degrade naphthalene into salicylate. Salicylate, a metabolic intermediate in the <i>Pseudomonas</i> strain from which the nah operon was taken, is less toxic to the environment than naphthalene. <i>P. putida</i> G7 can further degrade salicylate into a catechol, an edible carbon source using the sal operon; this second operon is not present in our cells, so our <i>Shewanella</i> strains are unable to actively degrade salicylate. This means that our cells cannot use naphthalene as a carbon source, a conclusion that is supported by our naphthalene growth assays. The effects of salicylate production on the cells appear to be negligible, but this should be further explored in future characterization work. </br><br />
<br />
<br>One of our future plans is to integrate our constructs into the chromosomes of our strains, in order to ensure that mtrB is not saturating at its uninduced, basal expression levels. This poses new questions: will chromosomal integration alter the expression patterns of this engineered pathway? Will it interfere with other functions of the cells? Functionality can be altered depending on the position of the construct within the chromosome. This is our first forthcoming research priority: determining any potential adverse effects of chromosomal integration, carrying it out, and thoroughly testing the functionality of our new engineered strains. </br><br />
<br />
<h5>Competition &amp; Biodiversity </h5><br />
A second concern is that engineered strains could possibly outcompete wild-type species in the environment and pose a threat to biodiversity. Our first line of defense against this possibility is physical containment: the inlet and outlet of our current prototype are equipped with 0.1 µm filters, effectively eliminating the possibility that our engineered strains may interact with natural organisms. However, imagine that there could be a mechanical error: physical breakage of the device, slight discrepancies in filter pore sizes, et cetera, that could leave a slim possibility that our strains could come into contact with natural species. What then?<br />
<br />
<br>To answer this question, we return to the altered physiology of our strains: the primary distinguishing characteristic to note is that the cells cannot carry out the wild-type levels of anaerobic respiration unless they are induced. This means that in situations where oxygen availability is limiting, and toxins are not highly prevalent, our strains are less able to compete than wild-type Shewanella; this is our second line of defense. <i>S. oneidensis</i> is native to freshwater ecosystems in our area, so our strains should not be disruptive to biodiversity. In addition, we have observed that inserting the nah operon into cells seems to significantly increase their doubling time, so our salicylate reporter strains would be even less able to compete than our arsenic reporters.</br><br />
<br />
<br>However, what happens in the case that oxygen availability is not limiting? It is probable that our current engineered strains would be able to survive and thrive in aerobic conditions, and live alongside wild-type <i>Shewanella</i>. We need a third line of defense for this situation, a modification that would prevent our strains from being able to survive outside of our physical device. For this, we propose auxotrophy: in a truly field-deployable device, we would use a strain that had a gene for a key metabolite knocked out, so that the strain would rely upon supplementation of this nutrient in order to survive. We would then supplement this metabolite inside of the device, so that our strains would function properly within our device. If the bacteria were to somehow escape, their functionality would be severely impaired by the lack of nutritional supplementation, and they would be quickly outcompeted by wild-type strains.</br><br />
<br />
<br>This brings to the table a second research priority for field-deployability: engineer an auxotrophic strain of <i>Shewanella</i> to contain our constructs, and ensure that the likelihood of survival without nutritional supplementation is very, very low. We would also need to ensure, from a practical standpoint, that auxotrophy would not interfere with any other aspects of the physiology of the cells.<br><br />
<br />
<br><br />
<h5>Evolutionary Prediction</h5> <br />
Due to the relatively simple nature of our reporter system, we find it highly unlikely that our strains could evolve to possess any dangerous function if somehow released into the wild. However, it is still possible that the promoter regions of our constructs could mutate and alter the expected patterns of promoter activity, or that the functionality of mtrB would be impaired by a deleterious mutation. The former possibility could serve to make the strain more genetically similar to the wild-type, and thus more able to compete; this presents us with another reason to pursue auxotrophy as a solution, basically in order to ensure that our strains are not alive for long enough for mutations to accumulate. <br />
</br><br />
<br />
<br>However, we would also need to conduct extensive testing to ensure that our strains remain functional and responsive to analyte for the full 6-month period.<br />
</br><br />
<br />
<p><br />
<h5>Gene Transfer</h5> <br />
Perhaps the most pressing concern with any synthetic biology project is the possibility of horizontal gene transfer from engineered to natural strains, and vice versa. Again, our first line of defense is physical containment, but barring that, what can we do to reduce the possibility that our strains would transfer unnatural functions to natural cells? The biggest shortcoming of our current system is that antibiotic resistance is used as a selective marker on our plasmids, thus allowing for the possibility that antibiotic resistance could be spread among natural populations via conjugation or passive transformation. While we could explore the possibility of using another form of auxotrophy as a selective marker on a plasmid, we believe that a more viable solution would be to eliminate the need for a selective pressure in the first place, namely by chromosomal integration. The transfer of chromosomal DNA is much less likely than the transfer of a plasmid, and, as mentioned above, chromosomal integration would solve other problems in the functionality of our reporters.<br />
</p><br />
</div><br />
<br />
<div class="twelve columns"><br />
<h3>Limitations of CEA</h3><br />
CEA allowed us to think about crucial future work for our project in order to make it suitable for field-deployability. However, in our interactions with environmental groups, public officials in water quality management, and industrial groups, we encountered several important questions that were not built into existing CEA framework. Assessing the suitability of a synthetic biology-based device extends far beyond practical environmental risk assessment, into regulatory and economic concerns. The Presidential Commission for the Study of Bioethical Issues (PCSBI) released a report in December 2010 regarding important considerations for the ethics of synthetic biology projects, not all of which are encompassed by the CEA framework. In addition, as we approach field-deployability, the economics of the device become essential to assessing its viability as a solution to real-world water monitoring needs. These ideas are further explored in the remainder of this section.<br />
</div><br />
<div class="twelve columns"><br />
<h3>References</h3><br />
Dana, G. V., Kuiken, T., Rejeski, D., &amp; Snow, A. A. (2012). Synthetic biology: Four steps to avoid a synthetic-biology disaster. <i>Nature, 483.</i> doi:10.1038/483029a</br><br />
<br>Powers, C. M., Dana, G., Gillespie, P., Gwinn, M. R., Hendren, C. O., Long, T. C., Wang, A., Davis, J. M. (2012). Comprehensive Environmental Assessment: A Meta-Assessment Approach. <i>Environ. Sci. Technol., 46,</i> 9202−9208. http://dx.doi.org/10.1021/es3023072</br><br />
<br>Synthetic Biology Project. (2011, July 28). Comprehensive Environmental Assessment and Its Application to Synthetic Biology Applications. Retrieved from http://www.synbioproject.org/events/archive/cea/</br><br />
<br />
</div><br />
</div><br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_hprac').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/wetlab/results/transcriptionTeam:Cornell/project/wetlab/results/transcription2012-10-27T01:06:47Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6>Wet Lab</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly">DNA Assembly</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/arsenic">Arsenic Reporter</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/naphthalene">Naphthalene Reporter</a><br />
</li><br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results">Testing &amp; Results</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/biobricks">BioBricks</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/transcription">Transcriptional Characterization</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/currentresponse">Current Response</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/protein">MtrB Protein Expression</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/nah_operon"><i>nah</i> Operon Expression</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/artificial_river_media">Artificial River Media</a><br />
</li><br />
<br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/future_work">Future Work</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/animation">Animation</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h2 class="centered">Transcriptional Characterization</h2><br />
</div><br />
</div><br />
<div class="row"><br />
<div class="twelve columns"><br />
<br><br />
<h2> Fluorescence </h2><br />
In order to characterize promoter activity in response to arsenic and salicylate, we appended mRFP downstream of mtrB in our reporter parts. We used these constructs to test the level of promoter activity at increasing arsenic and salicylate concentrations. <br />
<h3>Control</h3><br />
To optimize experimental parameters and verify that fluorescence of <i>S. oneidensis</i> could be measured reliably, we began by measuring the fluorescence of mRFP with Anderson series promoters in <i>Shewanella oneidensis</i> MR-1. After adjusting the parameters of our tests to get a consistent response from control strains, we saw increasing relative fluorescence with increasing promoter strength. This suggests that the Anderson series constitutive promoters show similar activity in <i>S. oneidensis</i> as they do in <i>E. coli</i>.<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/9/9b/Fluorescence_controls.png"><br />
<font size="2"><b>mRFP fluorescence increases with increasing promoter strength.</b> Relative fluorescence of four strains, normalized to optical density, averaged over 8 replicates after a 16-hour incubation period. <i>S. oneidensis</i> with mtrB knocked out, and three strains of <i>S. oneidensis</i> expressing mRFP with Anderson series promoters strength 0.1, 0.7, and 1.0, were tested.</font><br />
</div><br />
</div><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h3>Arsenic</h3><br />
In order to determine if gene expression is increased in the presence of arsenic, we incubated our reporter strains with varying concentrations of either arsenite or arsenate and measured fluorescence using the BioTek Instruments Synergy™ HT Multi-Mode Microplate Reader. Trials were run using blank LB medium and <i>S. oneidensis</i> &Delta;mtrB as negative controls, while <i>S. oneidensis</i> &Delta;mtrB strains with Anderson promoters (0.1, 0.4, 1.0) upstream of mRFP were used as positive controls. Background fluorescence from LB was subtracted and fluorescence normalized to optical density in order to obtain relative fluorescence per cell mass. Fluorescence data was averaged over a time course of 4.5 hours, after the cells had grown to a steady OD.<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/a/a7/FluorescenceArsenite1001.png"><br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/9/92/FluorescenceArsenate1001.png"><br />
<br />
<font size="2"><b>Arsenic reporter responds positively to arsenite, but not arsenate.</b> Preliminary data of relative fluorescence at 0, 10, 50, 100, and 500 µM of (a) arsenite, and (b) arsenate. Relative fluorescence is reported after normalization to optical density.</font><br />
<br />
<br><br><br />
<br />
Our preliminary data shows that as arsenite concentration is increased, relative fluorescence increases by over two-fold in both reporter strains! Therefore, our arsenic reporters are responding to arsenite.<br />
<br />
<br/><br/><br />
<br />
However, our preliminary data from arsenate treatment shows no clear trend. As <i>S. oneidensis</i> has the native ability to reduce arsenates to arsenites, this may contribute to the lack of an obvious trend.<br />
<br />
<br/><br/><br />
<br />
Because relative fluorescence is an average of only 3 replicates over 4.5 hour time courses, error bars are not included. We are currently continuing fluorescence assays to ensure statistical significance and to further define the dynamic range of our constructs.<br />
<br />
</div><br />
</div><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h3>Salicylate</h3><br />
<br />
Our fluorescence assays confirm that the salicylate reporter construct without a BamHI cut-site, SAL2, responds to salicylate in a range of 10-100 µM. As with tests characterizing response to arsenites and arsenates, we measured fluorescence while varying concentration of salicylate in LB medium.<br />
<br />
Trials were run using blank LB medium and JG700 as negative controls, while conjugated JG700 strains with Anderson promoters (0.1, 0.4, 1.0) upstream of mRFP were used as positive controls.<br />
Background fluorescence from LB was subtracted and fluorescence normalized to optical density in order to obtain relative fluorescence per cell mass. Fluorescence data was averaged over a time course of 7.5 hours, after the cells had grown to a steady OD.<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/5/56/FluorescenceSalicylate930.png"><br />
<br />
<font size="2">Preliminary data of relative fluorescence of salicylate reporter in <i>S. oneidensis</i> at 0, 10, 100, and 500 µM of salicylate. Relative fluorescence is reported after normalization to optical density.</font><br />
<br />
<br><br><br />
<br />
Preliminary data strongly suggests that SAL2 responds to salicylate at concentrations in the order of hundreds of µM. Additionally, comparison to fluorescence from the Anderson 0.1 promoter (not shown in graph) suggests that the induced promoter activity may have similar strength to 0.1 on the Anderson series scale.<br />
<br />
<br/><br/><br />
<br />
SAL2 fluorescence is averaged over 3 replicates in addition to averaging replicate individually over a time course of 7.5 hours. We are continuing to characterize our salicylate reporter strains.<br />
</div><br />
</div><br />
<br />
<br><br><br />
<div class="row last-ele"><br />
<br />
<div class="nine columns"><br />
<h2>RT-qPCR</h2><br />
We are currently using two-step RT-qPCR to confirm that our engineered Shewanella strains respond to arsenic and naphthalene. Total RNA will be isolated using the E.Z.N.A.™ Bacterial RNA Isolation Kit from Omega bio-tek; cDNA will be synthesized using the qScript™ Flex cDNA Kit from Quanta Biosciences; and we are using the ABI ViiA7 platform along with the KAPA SYBR(R) FAST qPCR Kit from KAPA Biosystems. Our primers are as follows: <br />
<br><br><br />
FOR_enzA: CAGCCTTTTACCCAAGGTGA<br />
<br><br />
REV_enzA: CACGATTCGAGAGGGTGATT<br />
<br><br />
FOR_RecA: TTCCCCTCGACATTGTCATCATCGGA<br />
<br><br />
REV_RecA: AAGGGCGATAAAATTGGTCAAGGCCG<br />
<br><br />
3'_FOR_qPCR_mtrB: ACGCTCAATATCAAGCCACCGAGA<br />
<br><br />
3'_REV_qPCR_mtrB: TGTGCGGTGTAGTCATGGCTGT<br />
</div><br />
<div class="three columns"><br />
<img src="https://static.igem.org/mediawiki/2012/c/ce/Cornell12_Stock_4.jpg"><br />
</div><br />
</div><br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/lightbox?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_wetlab').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/wetlab/results/transcriptionTeam:Cornell/project/wetlab/results/transcription2012-10-27T00:56:49Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6>Wet Lab</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly">DNA Assembly</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/arsenic">Arsenic Reporter</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/naphthalene">Naphthalene Reporter</a><br />
</li><br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results">Testing &amp; Results</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/biobricks">BioBricks</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/transcription">Transcriptional Characterization</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/currentresponse">Current Response</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/protein">MtrB Protein Expression</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/nah_operon"><i>nah</i> Operon Expression</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/artificial_river_media">Artificial River Media</a><br />
</li><br />
<br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/future_work">Future Work</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/animation">Animation</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h2 class="centered">Transcriptional Characterization</h2><br />
</div><br />
</div><br />
<div class="row"><br />
<div class="twelve columns"><br />
<br><br />
<h2> Fluorescence </h2><br />
In order to characterize promoter activity in response to arsenic and salicylate, we appended mRFP downstream of mtrB in our reporter parts. We used these constructs to test the level of promoter activity at increasing arsenic and salicylate concentrations. <br />
<h3>Control</h3><br />
To optimize experimental parameters and verify that fluorescence of <i>S. oneidensis</i> could be measured reliably, we began by measuring the fluorescence of mRFP with Anderson series promoters in <i>Shewanella oneidensis</i> MR-1. After adjusting the parameters of our tests to get a consistent response from control strains, we saw increasing relative fluorescence with increasing promoter strength. This suggests that the Anderson series constitutive promoters show similar activity in <i>S. oneidensis</i> as they do in <i>E. coli</i>.<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/9/9b/Fluorescence_controls.png"><br />
<font size="2"><b>mRFP fluorescence increases with increasing promoter strength.</b> Relative fluorescence of four strains, normalized to optical density, averaged over 8 replicates after a 16-hour incubation period. <i>S. oneidensis</i> with mtrB knocked out, and three strains of <i>S. oneidensis</i> expressing mRFP with Anderson series promoters strength 0.1, 0.7, and 1.0, were tested.</font><br />
</div><br />
</div><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h3>Arsenic</h3><br />
In order to determine if gene expression is increased in the presence of arsenic, we inoculated our growth medium with varying concentrations of either arsenite or arsenate and measured fluorescence using the BioTek Instruments Synergy™ HT Multi-Mode Microplate Reader. Trials were run using blank LB medium and JG700 as negative controls, while conjugated JG700 strains with Anderson promoters (0.1, 0.4, 1.0) upstream of mRFP were used as positive controls. Background fluorescence from LB was subtracted and fluorescence normalized to optical density in order to obtain relative fluorescence per cell mass. Fluorescence data was averaged over a time course of 4.5 hours, after the cells had grown to a steady OD.<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/a/a7/FluorescenceArsenite1001.png"><br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/9/92/FluorescenceArsenate1001.png"><br />
<br />
<font size="2">Preliminary data of relative fluorescence at 0, 10, 50, 100, and 500 µM of (a) arsenite, and (b) arsenate. Relative fluorescence is reported after normalization to optical density.</font><br />
<br />
<br><br><br />
<br />
Our preliminary data shows that as arsenite concentration is increased, relative fluorescence increases by over two-fold in both reporter strains! Therefore, our arsenic reporters are responding to arsenite.<br />
<br />
<br/><br/><br />
<br />
However, our preliminary data from arsenate treatment shows no clear trend. As <i>S. oneidensis</i> has the native ability to reduce arsenates to arsenites, this may contribute to the lack of an obvious trend.<br />
<br />
<br/><br/><br />
<br />
Because relative fluorescence is an average of only 3 replicates over 4.5 hour time courses, error bars are not included. We are currently continuing fluorescence assays to ensure statistical significance and to further define the dynamic range of our constructs.<br />
<br />
</div><br />
</div><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h3>Salicylate</h3><br />
<br />
Our fluorescence assays confirm that the salicylate reporter construct without a BamHI cut-site, SAL2, responds to salicylate in a range of 10-100 µM. As with tests characterizing response to arsenites and arsenates, we measured fluorescence while varying concentration of salicylate in LB medium.<br />
<br />
Trials were run using blank LB medium and JG700 as negative controls, while conjugated JG700 strains with Anderson promoters (0.1, 0.4, 1.0) upstream of mRFP were used as positive controls.<br />
Background fluorescence from LB was subtracted and fluorescence normalized to optical density in order to obtain relative fluorescence per cell mass. Fluorescence data was averaged over a time course of 7.5 hours, after the cells had grown to a steady OD.<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/5/56/FluorescenceSalicylate930.png"><br />
<br />
<font size="2">Preliminary data of relative fluorescence of salicylate reporter in <i>S. oneidensis</i> at 0, 10, 100, and 500 µM of salicylate. Relative fluorescence is reported after normalization to optical density.</font><br />
<br />
<br><br><br />
<br />
Preliminary data strongly suggests that SAL2 responds to salicylate at concentrations in the order of hundreds of µM. Additionally, comparison to fluorescence from the Anderson 0.1 promoter (not shown in graph) suggests that the induced promoter activity may have similar strength to 0.1 on the Anderson series scale.<br />
<br />
<br/><br/><br />
<br />
SAL2 fluorescence is averaged over 3 replicates in addition to averaging replicate individually over a time course of 7.5 hours. We are continuing to characterize our salicylate reporter strains.<br />
</div><br />
</div><br />
<br />
<br><br><br />
<div class="row last-ele"><br />
<br />
<div class="nine columns"><br />
<h2>RT-qPCR</h2><br />
We are currently using two-step RT-qPCR to confirm that our engineered Shewanella strains respond to arsenic and naphthalene. Total RNA will be isolated using the E.Z.N.A.™ Bacterial RNA Isolation Kit from Omega bio-tek; cDNA will be synthesized using the qScript™ Flex cDNA Kit from Quanta Biosciences; and we are using the ABI ViiA7 platform along with the KAPA SYBR(R) FAST qPCR Kit from KAPA Biosystems. Our primers are as follows: <br />
<br><br><br />
FOR_enzA: CAGCCTTTTACCCAAGGTGA<br />
<br><br />
REV_enzA: CACGATTCGAGAGGGTGATT<br />
<br><br />
FOR_RecA: TTCCCCTCGACATTGTCATCATCGGA<br />
<br><br />
REV_RecA: AAGGGCGATAAAATTGGTCAAGGCCG<br />
<br><br />
3'_FOR_qPCR_mtrB: ACGCTCAATATCAAGCCACCGAGA<br />
<br><br />
3'_REV_qPCR_mtrB: TGTGCGGTGTAGTCATGGCTGT<br />
</div><br />
<div class="three columns"><br />
<img src="https://static.igem.org/mediawiki/2012/c/ce/Cornell12_Stock_4.jpg"><br />
</div><br />
</div><br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/lightbox?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_wetlab').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/wetlab/resultsTeam:Cornell/project/wetlab/results2012-10-27T00:37:45Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6>Wet Lab</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly">DNA Assembly</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/arsenic">Arsenic Reporter</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/naphthalene">Naphthalene Reporter</a><br />
</li><br />
</ul><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results">Testing &amp; Results</a></li><li> <br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/biobricks">BioBricks</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/reactors">Reactors</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/transcription">Transcriptional Characterization</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/protein">MtrB Protein Expression</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/nah_operon"><i>nah</i> Operon Expression</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/artificial_river_media">Artificial River Media</a><br />
</li><br />
<br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/future_work">Future Work</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/animation">Animation</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h2 class="centered">Results</h2><br />
</div><br />
</div><br />
<div class="row"><br />
<div class="three columns"><br />
<img src="https://static.igem.org/mediawiki/2012/d/d4/Foodtank.jpg"><br />
</div><br />
<div class="nine columns"><br />
<h3>Transcriptional Characterization</h3><br />
After constructing our reporters, we first wanted to verify that they operated on a transcriptional level in <i>S. oneidensis</i>. Our transcriptional characterization consisted of fluorescence testing and RT-qPCR. <br />
<br><br><br />
In order to conduct fluorescence characterization, we appended mRFP downstream of mtrB in our arsenic and salicylate reporters. We then measured the relative fluorescence of the reporters when induced with different concentrations of arsenic and salicylate, respectively. Both showed increased fluorescence in response to increased analyte, strongly suggesting transcriptional upregulation of mRFP and therefore of upstream mtrB. <br />
<br><br><br />
We are also in the process of conducting real-time quantitative PCR, as a more direct method of demonstrating transcriptional upregulation of mtrB in response to analyte.<br />
</div><br />
</div><br />
<div class="row"><br />
<div class="nine columns"><br />
<h3>Current Response</h3><br />
Encouraged by our positive results from fluorescence characterization, we moved forward with testing our reporter strains in bioreactors. We demonstrated that our arsenic reporter strain functions at the system level: current is upregulated in response to increasing arsenite concentration. However, leaky expression in our salicylate reporter strain saturated current response at basal levels, an issue we plan to address in the future.<br />
<br><br><br />
As a proxy to current production, we are also conducting ferrozine assays, which measure how much iron (III) is reduced to iron (II) by extracellular electron shuttling. This is a high-throughput method of assessing the relative functionality of our reporter strains at a system level.<br />
</div><br />
<div class="three columns"><br />
<img src="https://static.igem.org/mediawiki/2012/4/43/Syntheticriver.jpg"><br />
</div><br />
</div> <br />
<div class="row"><br />
<div class="three columns"><br />
<img src="https://static.igem.org/mediawiki/2012/4/43/Syntheticriver.jpg"><br />
</div><br />
<div class="nine columns"><br />
<h3>MtrB Protein Expression</h3><br />
In addition to characterization at the transcriptional and whole-system levels, we also want to verify that MtrB, our protein of interest, is being expressed at higher levels when the reporters are induced with analyte. To this end, we are in the process of conducting Western blots. <br />
</div><br />
</div><br />
<div class="row"><br />
<div class="nine columns"><br />
<h3><i>nah</i> Operon Expression</h3><br />
To test the functionality of our third major construct, the <i>nah</i> operon, we are currently conducting tests on the biosynthesis of indigo by naphthalene dioxygenase, an enzyme encoded in the <i>nah</i> operon. <br />
</div><br />
<div class="three columns"><br />
<img src="https://static.igem.org/mediawiki/2012/4/43/Syntheticriver.jpg"><br />
</div><br />
</div><br />
<div class="row last-ele"><br />
<div class="three columns"><br />
<img src="https://static.igem.org/mediawiki/2012/4/43/Syntheticriver.jpg"><br />
</div><br />
<div class="nine columns"><br />
<h3>Artificial River Media</h3><br />
As a practical consideration for the deployment of our device, we attempted to develop a minimal growth medium that could be highly concentrated in the food tanks of our final device, and fed to the cells at a low flow rate. Our results suggest that our strains could be sustained on a steady flow of 2% (w/v) sodium lactate solution. <br />
</div><br />
</div><br />
</div><br />
</div><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/lightbox?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_wetlab').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/wetlab/results/transcriptionTeam:Cornell/project/wetlab/results/transcription2012-10-26T23:08:21Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6>Wet Lab</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly">DNA Assembly</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/arsenic">Arsenic Reporter</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/naphthalene">Naphthalene Reporter</a><br />
</li><br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results">Testing &amp; Results</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/biobricks">BioBricks</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/reactors">Reactors</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/transcription">Transcriptional Characterization</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/protein">MtrB Protein Expression</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/nah_operon"><i>nah</i> Operon Expression</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/artificial_river_media">Artificial River Media</a><br />
</li><br />
<br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/future_work">Future Work</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/animation">Animation</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h2 class="centered">Transcriptional Characterization</h2><br />
</div><br />
</div><br />
<div class="row"><br />
<div class="twelve columns"><br />
<br><br />
<h2> Fluorescence </h2><br />
In order to characterize promoter activity in response to arsenic and salicylate, we appended mRFP downstream of mtrB in our reporter parts. We used these constructs to test the level of promoter activity at increasing arsenic and salicylate concentrations. <br />
<h3>Control</h3><br />
In order to optimize experimental parameters, we began by measuring the fluorescence of mRFP with Anderson series promoters in <i>Shewanella oneidensis</i> MR-1. After adjusting the parameters of our tests to get a consistent response from control strains, we saw increasing relative fluorescence with increasing promoter strength. This suggests that the Anderson series constitutive promoters show similar activity in <i>S. oneidensis</i> as they do in <i>E. coli</i>.<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/9/9b/Fluorescence_controls.png"><br />
<font size="2">Relative fluorescence of four strains, normalized to optical density, averaged over 8 replicates after a 16-hour incubation period. <i>S. oneidensis</i> with mtrB knocked out, and three strains of <i>S. oneidensis</i> expressing mRFP with Anderson series promoters strength 0.1, 0.7, and 1.0, were tested. mRFP fluorescence increases with increasing promoter strength.</font><br />
</div><br />
</div><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h3>Arsenic</h3><br />
In order to determine if gene expression is increased in the presence of arsenic, we inoculated our growth medium with varying concentrations of either arsenite or arsenate and measured fluorescence using the BioTek Instruments Synergy™ HT Multi-Mode Microplate Reader. Trials were run using blank LB medium and JG700 as negative controls, while conjugated JG700 strains with Anderson promoters (0.1, 0.4, 1.0) upstream of mRFP were used as positive controls. Background fluorescence from LB was subtracted and fluorescence normalized to optical density in order to obtain relative fluorescence per cell mass. Fluorescence data was averaged over a time course of 4.5 hours, after the cells had grown to a steady OD.<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/a/a7/FluorescenceArsenite1001.png"><br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/9/92/FluorescenceArsenate1001.png"><br />
<br />
<font size="2">Preliminary data of relative fluorescence at 0, 10, 50, 100, and 500 µM of (a) arsenite, and (b) arsenate. Relative fluorescence is reported after normalization to optical density.</font><br />
<br />
<br><br><br />
<br />
Our preliminary data shows that as arsenite concentration is increased, relative fluorescence increases by over two-fold in both reporter strains! Therefore, our arsenic reporters are responding to arsenite.<br />
<br />
<br/><br/><br />
<br />
However, our preliminary data from arsenate treatment shows no clear trend. As <i>S. oneidensis</i> has the native ability to reduce arsenates to arsenites, this may contribute to the lack of an obvious trend.<br />
<br />
<br/><br/><br />
<br />
Because relative fluorescence is an average of only 3 replicates over 4.5 hour time courses, error bars are not included. We are currently continuing fluorescence assays to ensure statistical significance and to further define the dynamic range of our constructs.<br />
<br />
</div><br />
</div><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h3>Salicylate</h3><br />
<br />
Our fluorescence assays confirm that the salicylate reporter construct without a BamHI cut-site, SAL2, responds to salicylate in a range of 10-100 µM. As with tests characterizing response to arsenites and arsenates, we measured fluorescence while varying concentration of salicylate in LB medium.<br />
<br />
Trials were run using blank LB medium and JG700 as negative controls, while conjugated JG700 strains with Anderson promoters (0.1, 0.4, 1.0) upstream of mRFP were used as positive controls.<br />
Background fluorescence from LB was subtracted and fluorescence normalized to optical density in order to obtain relative fluorescence per cell mass. Fluorescence data was averaged over a time course of 7.5 hours, after the cells had grown to a steady OD.<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/5/56/FluorescenceSalicylate930.png"><br />
<br />
<font size="2">Preliminary data of relative fluorescence of salicylate reporter in <i>S. oneidensis</i> at 0, 10, 100, and 500 µM of salicylate. Relative fluorescence is reported after normalization to optical density.</font><br />
<br />
<br><br><br />
<br />
Preliminary data strongly suggests that SAL2 responds to salicylate at concentrations in the order of hundreds of µM. Additionally, comparison to fluorescence from the Anderson 0.1 promoter (not shown in graph) suggests that the induced promoter activity may have similar strength to 0.1 on the Anderson series scale.<br />
<br />
<br/><br/><br />
<br />
SAL2 fluorescence is averaged over 3 replicates in addition to averaging replicate individually over a time course of 7.5 hours. We are continuing to characterize our salicylate reporter strains.<br />
</div><br />
</div><br />
<br />
<br><br><br />
<div class="row last-ele"><br />
<br />
<div class="nine columns"><br />
<h2>RT-qPCR</h2><br />
We are currently using two-step RT-qPCR to confirm that our engineered Shewanella strains respond to arsenic and naphthalene. Total RNA will be isolated using the E.Z.N.A.™ Bacterial RNA Isolation Kit from Omega bio-tek; cDNA will be synthesized using the qScript™ Flex cDNA Kit from Quanta Biosciences; and we are using the ABI ViiA7 platform along with the KAPA SYBR(R) FAST qPCR Kit from KAPA Biosystems. Our primers are as follows: <br />
<br><br><br />
FOR_enzA: CAGCCTTTTACCCAAGGTGA<br />
<br><br />
REV_enzA: CACGATTCGAGAGGGTGATT<br />
<br><br />
FOR_RecA: TTCCCCTCGACATTGTCATCATCGGA<br />
<br><br />
REV_RecA: AAGGGCGATAAAATTGGTCAAGGCCG<br />
<br><br />
3'_FOR_qPCR_mtrB: ACGCTCAATATCAAGCCACCGAGA<br />
<br><br />
3'_REV_qPCR_mtrB: TGTGCGGTGTAGTCATGGCTGT<br />
</div><br />
<div class="three columns"><br />
<img src="https://static.igem.org/mediawiki/2012/c/ce/Cornell12_Stock_4.jpg"><br />
</div><br />
</div><br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/lightbox?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_wetlab').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/File:FluorescenceSalicylate930.pngFile:FluorescenceSalicylate930.png2012-10-26T23:06:49Z<p>S.Sureka: uploaded a new version of &quot;File:FluorescenceSalicylate930.png&quot;</p>
<hr />
<div></div>S.Surekahttp://2012.igem.org/File:FluorescenceArsenate1001.pngFile:FluorescenceArsenate1001.png2012-10-26T23:02:33Z<p>S.Sureka: uploaded a new version of &quot;File:FluorescenceArsenate1001.png&quot;</p>
<hr />
<div></div>S.Surekahttp://2012.igem.org/File:FluorescenceArsenite1001.pngFile:FluorescenceArsenite1001.png2012-10-26T23:00:21Z<p>S.Sureka: uploaded a new version of &quot;File:FluorescenceArsenite1001.png&quot;</p>
<hr />
<div></div>S.Surekahttp://2012.igem.org/File:FluorescenceArsenite1001.pngFile:FluorescenceArsenite1001.png2012-10-26T22:58:04Z<p>S.Sureka: uploaded a new version of &quot;File:FluorescenceArsenite1001.png&quot;</p>
<hr />
<div></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/wetlab/results/transcriptionTeam:Cornell/project/wetlab/results/transcription2012-10-26T22:54:28Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6>Wet Lab</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly">DNA Assembly</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/arsenic">Arsenic Reporter</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/naphthalene">Naphthalene Reporter</a><br />
</li><br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results">Testing &amp; Results</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/biobricks">BioBricks</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/reactors">Reactors</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/transcription">Transcriptional Characterization</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/protein">MtrB Protein Expression</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/nah_operon"><i>nah</i> Operon Expression</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/artificial_river_media">Artificial River Media</a><br />
</li><br />
<br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/future_work">Future Work</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/animation">Animation</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h2 class="centered">Transcriptional Characterization</h2><br />
</div><br />
</div><br />
<div class="row"><br />
<div class="twelve columns"><br />
<br><br />
<h2> Fluorescence </h2><br />
In order to characterize promoter activity in response to arsenic and salicylate, we appended mRFP downstream of mtrB in our reporter parts. We used these constructs to test the level of promoter activity at increasing arsenic and salicylate concentrations. <br />
<h3>Control</h3><br />
In order to optimize experimental parameters, we began by measuring the fluorescence of mRFP with Anderson series promoters in <i>Shewanella oneidensis</i> MR-1. After adjusting the parameters of our tests to get a consistent response from control strains, we saw increasing relative fluorescence with increasing promoter strength. This suggests that the Anderson series constitutive promoters show similar activity in <i>S. oneidensis</i> as they do in <i>E. coli</i>.<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/9/9b/Fluorescence_controls.png"><br />
<font size="2">Relative fluorescence of four strains, normalized to optical density, averaged over 8 replicates after a 16-hour incubation period. <i>S. oneidensis</i> with mtrB knocked out, and three strains of <i>S. oneidensis</i> expressing mRFP with Anderson series promoters strength 0.1, 0.7, and 1.0, were tested. mRFP fluorescence increases with increasing promoter strength.</font><br />
</div><br />
</div><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h3>Arsenic</h3><br />
In order to determine if gene expression is increased in the presence of arsenic, we inoculated our growth medium with varying concentrations of either arsenite or arsenate and measured fluorescence using the BioTek Instruments Synergy™ HT Multi-Mode Microplate Reader. Trials were run using blank LB medium and JG700 as negative controls, while conjugated JG700 strains with Anderson promoters (0.1, 0.4, 1.0) upstream of mRFP were used as positive controls. Background fluorescence from LB was subtracted and fluorescence normalized to optical density in order to obtain relative fluorescence per cell mass. Fluorescence data was averaged over a time course of 4.5 hours, after the cells had grown to a steady OD.<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/a/a7/FluorescenceArsenite1001.png"><br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/thumb/9/92/FluorescenceArsenate1001.png/800px-FluorescenceArsenate1001.png"><br />
<br />
<font size="2">Preliminary data of relative fluorescence at 0, 10, 50, 100, and 500 µM of (a) arsenite, and (b) arsenate. Relative fluorescence is reported after normalization to optical density.</font><br />
<br />
<br><br><br />
<br />
Our preliminary data shows that as arsenite concentration is increased, relative fluorescence increases by over two-fold in both reporter strains! Therefore, our arsenic reporters are responding to arsenite.<br />
<br />
<br/><br/><br />
<br />
However, our preliminary data from arsenate treatment shows no clear trend. As <i>S. oneidensis</i> has the native ability to reduce arsenates to arsenites, this may contribute to the lack of an obvious trend.<br />
<br />
<br/><br/><br />
<br />
Because relative fluorescence is an average of only 3 replicates over 4.5 hour time courses, error bars are not included. We are currently continuing fluorescence assays to ensure statistical significance and to further define the dynamic range of our constructs.<br />
<br />
</div><br />
</div><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h3>Salicylate</h3><br />
<br />
Our fluorescence assays confirm that the salicylate reporter construct without a BamHI cut-site, SAL2, responds to salicylate in a range of 10-100 µM. As with tests characterizing response to arsenites and arsenates, we measured fluorescence while varying concentration of salicylate in LB medium.<br />
<br />
Trials were run using blank LB medium and JG700 as negative controls, while conjugated JG700 strains with Anderson promoters (0.1, 0.4, 1.0) upstream of mRFP were used as positive controls.<br />
Background fluorescence from LB was subtracted and fluorescence normalized to optical density in order to obtain relative fluorescence per cell mass. Fluorescence data was averaged over a time course of 7.5 hours, after the cells had grown to a steady OD.<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/thumb/5/56/FluorescenceSalicylate930.png/800px-FluorescenceSalicylate930.png"><br />
<br />
<font size="2">Preliminary data of relative fluorescence at 1, 10, 100, and 500 µM of salicylate. Relative fluorescence is reported after normalization to optical density.</font><br />
<br />
<br><br><br />
<br />
Preliminary data strongly suggests that SAL2 responds to salicylate at concentrations in the order of hundreds of µM. Additionally, comparison to fluorescence from the Anderson 0.1 promoter (not shown in graph) suggests that the induced promoter activity may have similar strength to 0.1 on the Anderson series scale.<br />
<br />
<br/><br/><br />
<br />
SAL2 fluorescence is averaged over 3 replicates in addition to averaging replicate individually over a time course of 7.5 hours. We are continuing to characterize our salicylate reporter strains.<br />
</div><br />
</div><br />
<br />
<br><br><br />
<div class="row last-ele"><br />
<br />
<div class="nine columns"><br />
<h2>RT-qPCR</h2><br />
We are currently using two-step RT-qPCR to confirm that our engineered Shewanella strains respond to arsenic and naphthalene. Total RNA will be isolated using the E.Z.N.A.™ Bacterial RNA Isolation Kit from Omega bio-tek; cDNA will be synthesized using the qScript™ Flex cDNA Kit from Quanta Biosciences; and we are using the ABI ViiA7 platform along with the KAPA SYBR(R) FAST qPCR Kit from KAPA Biosystems. Our primers are as follows: <br />
<br><br><br />
FOR_enzA: CAGCCTTTTACCCAAGGTGA<br />
<br><br />
REV_enzA: CACGATTCGAGAGGGTGATT<br />
<br><br />
FOR_RecA: TTCCCCTCGACATTGTCATCATCGGA<br />
<br><br />
REV_RecA: AAGGGCGATAAAATTGGTCAAGGCCG<br />
<br><br />
3'_FOR_qPCR_mtrB: ACGCTCAATATCAAGCCACCGAGA<br />
<br><br />
3'_REV_qPCR_mtrB: TGTGCGGTGTAGTCATGGCTGT<br />
</div><br />
<div class="three columns"><br />
<img src="https://static.igem.org/mediawiki/2012/c/ce/Cornell12_Stock_4.jpg"><br />
</div><br />
</div><br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/lightbox?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_wetlab').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/File:FluorescenceArsenite1001.pngFile:FluorescenceArsenite1001.png2012-10-26T22:50:07Z<p>S.Sureka: uploaded a new version of &quot;File:FluorescenceArsenite1001.png&quot;</p>
<hr />
<div></div>S.Surekahttp://2012.igem.org/File:FluorescenceArsenite1001.pngFile:FluorescenceArsenite1001.png2012-10-26T22:47:51Z<p>S.Sureka: uploaded a new version of &quot;File:FluorescenceArsenite1001.png&quot;</p>
<hr />
<div></div>S.Surekahttp://2012.igem.org/File:FluorescenceArsenite1001.pngFile:FluorescenceArsenite1001.png2012-10-26T22:46:03Z<p>S.Sureka: uploaded a new version of &quot;File:FluorescenceArsenite1001.png&quot;</p>
<hr />
<div></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/wetlab/results/transcriptionTeam:Cornell/project/wetlab/results/transcription2012-10-26T22:30:30Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6>Wet Lab</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly">DNA Assembly</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/arsenic">Arsenic Reporter</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/naphthalene">Naphthalene Reporter</a><br />
</li><br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results">Testing &amp; Results</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/biobricks">BioBricks</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/reactors">Reactors</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/transcription">Transcriptional Characterization</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/protein">MtrB Protein Expression</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/nah_operon"><i>nah</i> Operon Expression</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/artificial_river_media">Artificial River Media</a><br />
</li><br />
<br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/future_work">Future Work</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/animation">Animation</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h2 class="centered">Transcriptional Characterization</h2><br />
</div><br />
</div><br />
<div class="row"><br />
<div class="twelve columns"><br />
<br><br />
<h2> Fluorescence </h2><br />
In order to characterize promoter activity in response to arsenic and salicylate, we appended mRFP downstream of mtrB in our reporter parts. We used these constructs to test the level of promoter activity at increasing arsenic and salicylate concentrations. <br />
<h3>Control</h3><br />
In order to optimize experimental parameters, we began by measuring the fluorescence of mRFP with Anderson series promoters in <i>Shewanella oneidensis</i> MR-1. After adjusting the parameters of our tests to get a consistent response from control strains, we saw increasing relative fluorescence with increasing promoter strength. This suggests that the Anderson series constitutive promoters show similar activity in <i>S. oneidensis</i> as they do in <i>E. coli</i>.<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/9/9b/Fluorescence_controls.png"><br />
<font size="2">Relative fluorescence of four strains, normalized to optical density, averaged over 8 replicates after a 16-hour incubation period. <i>S. oneidensis</i> with mtrB knocked out, and three strains of <i>S. oneidensis</i> expressing mRFP with Anderson series promoters strength 0.1, 0.7, and 1.0, were tested. mRFP fluorescence increases with increasing promoter strength.</font><br />
</div><br />
</div><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h3>Arsenic</h3><br />
In order to determine if gene expression is increased in the presence of arsenic, we inoculated our growth medium with varying concentrations of either arsenite or arsenate and measured fluorescence using the BioTek Instruments Synergy™ HT Multi-Mode Microplate Reader. Trials were run using blank LB medium and JG700 as negative controls, while conjugated JG700 strains with Anderson promoters (0.1, 0.4, 1.0) upstream of mRFP were used as positive controls. Background fluorescence from LB was subtracted and fluorescence normalized to optical density in order to obtain relative fluorescence per cell mass. Fluorescence data was averaged over a time course of 4.5 hours, after the cells had grown to a steady OD.<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/thumb/a/a7/FluorescenceArsenite1001.png/800px-FluorescenceArsenite1001.png"><br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/thumb/9/92/FluorescenceArsenate1001.png/800px-FluorescenceArsenate1001.png"><br />
<br />
<font size="2">Preliminary data of relative fluorescence at 0, 10, 50, 100, and 500 µM of (a) arsenite, and (b) arsenate. Relative fluorescence is reported after normalization to optical density.</font><br />
<br />
<br><br><br />
<br />
Our preliminary data shows that as arsenite concentration is increased, relative fluorescence increases by over two-fold in both reporter strains! Therefore, our arsenic reporters are responding to arsenite.<br />
<br />
<br/><br/><br />
<br />
However, our preliminary data from arsenate treatment shows no clear trend. As <i>S. oneidensis</i> has the native ability to reduce arsenates to arsenites, this may contribute to the lack of an obvious trend.<br />
<br />
<br/><br/><br />
<br />
Because relative fluorescence is an average of only 3 replicates over 4.5 hour time courses, error bars are not included. We are currently continuing fluorescence assays to ensure statistical significance and to further define the dynamic range of our constructs.<br />
<br />
</div><br />
</div><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h3>Salicylate</h3><br />
<br />
Our fluorescence assays confirm that the salicylate reporter construct without a BamHI cut-site, SAL2, responds to salicylate in a range of 10-100 µM. As with tests characterizing response to arsenites and arsenates, we measured fluorescence while varying concentration of salicylate in LB medium.<br />
<br />
Trials were run using blank LB medium and JG700 as negative controls, while conjugated JG700 strains with Anderson promoters (0.1, 0.4, 1.0) upstream of mRFP were used as positive controls.<br />
Background fluorescence from LB was subtracted and fluorescence normalized to optical density in order to obtain relative fluorescence per cell mass. Fluorescence data was averaged over a time course of 7.5 hours, after the cells had grown to a steady OD.<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/thumb/5/56/FluorescenceSalicylate930.png/800px-FluorescenceSalicylate930.png"><br />
<br />
<font size="2">Preliminary data of relative fluorescence at 1, 10, 100, and 500 µM of salicylate. Relative fluorescence is reported after normalization to optical density.</font><br />
<br />
<br><br><br />
<br />
Preliminary data strongly suggests that SAL2 responds to salicylate at concentrations in the order of hundreds of µM. Additionally, comparison to fluorescence from the Anderson 0.1 promoter (not shown in graph) suggests that the induced promoter activity may have similar strength to 0.1 on the Anderson series scale.<br />
<br />
<br/><br/><br />
<br />
SAL2 fluorescence is averaged over 3 replicates in addition to averaging replicate individually over a time course of 7.5 hours. We are continuing to characterize our salicylate reporter strains.<br />
</div><br />
</div><br />
<br />
<br><br><br />
<div class="row last-ele"><br />
<br />
<div class="nine columns"><br />
<h2>RT-qPCR</h2><br />
We are currently using two-step RT-qPCR to confirm that our engineered Shewanella strains respond to arsenic and naphthalene. Total RNA will be isolated using the E.Z.N.A.™ Bacterial RNA Isolation Kit from Omega bio-tek; cDNA will be synthesized using the qScript™ Flex cDNA Kit from Quanta Biosciences; and we are using the ABI ViiA7 platform along with the KAPA SYBR(R) FAST qPCR Kit from KAPA Biosystems. Our primers are as follows: <br />
<br><br><br />
FOR_enzA: CAGCCTTTTACCCAAGGTGA<br />
<br><br />
REV_enzA: CACGATTCGAGAGGGTGATT<br />
<br><br />
FOR_RecA: TTCCCCTCGACATTGTCATCATCGGA<br />
<br><br />
REV_RecA: AAGGGCGATAAAATTGGTCAAGGCCG<br />
<br><br />
3'_FOR_qPCR_mtrB: ACGCTCAATATCAAGCCACCGAGA<br />
<br><br />
3'_REV_qPCR_mtrB: TGTGCGGTGTAGTCATGGCTGT<br />
</div><br />
<div class="three columns"><br />
<img src="https://static.igem.org/mediawiki/2012/c/ce/Cornell12_Stock_4.jpg"><br />
</div><br />
</div><br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/lightbox?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_wetlab').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/wetlab/results/transcriptionTeam:Cornell/project/wetlab/results/transcription2012-10-26T22:27:16Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6>Wet Lab</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly">DNA Assembly</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/arsenic">Arsenic Reporter</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/naphthalene">Naphthalene Reporter</a><br />
</li><br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results">Testing &amp; Results</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/biobricks">BioBricks</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/reactors">Reactors</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/transcription">Transcriptional Characterization</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/protein">MtrB Protein Expression</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/nah_operon"><i>nah</i> Operon Expression</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/artificial_river_media">Artificial River Media</a><br />
</li><br />
<br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/future_work">Future Work</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/animation">Animation</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h2 class="centered">Transcriptional Characterization</h2><br />
</div><br />
</div><br />
<div class="row"><br />
<div class="twelve columns"><br />
<br><br />
<h2> Fluorescence </h2><br />
In order to characterize promoter activity in response to arsenic and salicylate, we appended mRFP downstream of mtrB in our reporter parts. We used these constructs to test the level of promoter activity at increasing arsenic and salicylate concentrations. <br />
<h3>Control</h3><br />
In order to optimize experimental parameters, we began by measuring the fluorescence of mRFP with Anderson series promoters in <i>Shewanella oneidensis</i> MR-1. After adjusting the parameters of our tests to get a consistent response from control strains, we saw increasing relative fluorescence with increasing promoter strength. This suggests that the Anderson series constitutive promoters show similar activity in <i>S. oneidensis</i> as they do in <i>E. coli</i>.<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/9/9b/Fluorescence_controls.png"><br />
<font size="2">Relative fluorescence of four strains, normalized to optical density, averaged over 8 replicates after steady OD was reached and cells were in stationary phase. <i>S. oneidensis</i> with mtrB knocked out, and three strains of <i>S. oneidensis</i> expressing mRFP with Anderson series promoters strength 0.1, 0.7, and 1.0, were tested. mRFP fluorescence increases with increasing promoter strength.</font><br />
</div><br />
</div><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h3>Arsenic</h3><br />
In order to determine if gene expression is increased in the presence of arsenic, we inoculated our growth medium with varying concentrations of either arsenite or arsenate and measured fluorescence using the BioTek Instruments Synergy™ HT Multi-Mode Microplate Reader. Trials were run using blank LB medium and JG700 as negative controls, while conjugated JG700 strains with Anderson promoters (0.1, 0.4, 1.0) upstream of mRFP were used as positive controls. Background fluorescence from LB was subtracted and fluorescence normalized to optical density in order to obtain relative fluorescence per cell mass. Fluorescence data was averaged over a time course of 4.5 hours, after the cells had grown to a steady OD.<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/thumb/a/a7/FluorescenceArsenite1001.png/800px-FluorescenceArsenite1001.png"><br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/thumb/9/92/FluorescenceArsenate1001.png/800px-FluorescenceArsenate1001.png"><br />
<br />
<font size="2">Preliminary data of relative fluorescence at 0, 10, 50, 100, and 500 µM of (a) arsenite, and (b) arsenate. Relative fluorescence is reported after normalization to optical density.</font><br />
<br />
<br><br><br />
<br />
Our preliminary data shows that as arsenite concentration is increased, relative fluorescence increases by over two-fold in both reporter strains! Therefore, our arsenic reporters are responding to arsenite.<br />
<br />
<br/><br/><br />
<br />
However, our preliminary data from arsenate treatment shows no clear trend. As <i>S. oneidensis</i> has the native ability to reduce arsenates to arsenites, this may contribute to the lack of an obvious trend.<br />
<br />
<br/><br/><br />
<br />
Because relative fluorescence is an average of only 3 replicates over 4.5 hour time courses, error bars are not included. We are currently continuing fluorescence assays to ensure statistical significance and to further define the dynamic range of our constructs.<br />
<br />
</div><br />
</div><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h3>Salicylate</h3><br />
<br />
Our fluorescence assays confirm that the salicylate reporter construct without a BamHI cut-site, SAL2, responds to salicylate in a range of 10-100 µM. As with tests characterizing response to arsenites and arsenates, we measured fluorescence while varying concentration of salicylate in LB medium.<br />
<br />
Trials were run using blank LB medium and JG700 as negative controls, while conjugated JG700 strains with Anderson promoters (0.1, 0.4, 1.0) upstream of mRFP were used as positive controls.<br />
Background fluorescence from LB was subtracted and fluorescence normalized to optical density in order to obtain relative fluorescence per cell mass. Fluorescence data was averaged over a time course of 7.5 hours, after the cells had grown to a steady OD.<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/thumb/5/56/FluorescenceSalicylate930.png/800px-FluorescenceSalicylate930.png"><br />
<br />
<font size="2">Preliminary data of relative fluorescence at 1, 10, 100, and 500 µM of salicylate. Relative fluorescence is reported after normalization to optical density.</font><br />
<br />
<br><br><br />
<br />
Preliminary data strongly suggests that SAL2 responds to salicylate at concentrations in the order of hundreds of µM. Additionally, comparison to fluorescence from the Anderson 0.1 promoter (not shown in graph) suggests that the induced promoter activity may have similar strength to 0.1 on the Anderson series scale.<br />
<br />
<br/><br/><br />
<br />
SAL2 fluorescence is averaged over 3 replicates in addition to averaging replicate individually over a time course of 7.5 hours. We are continuing to characterize our salicylate reporter strains.<br />
</div><br />
</div><br />
<br />
<br><br><br />
<div class="row last-ele"><br />
<br />
<div class="nine columns"><br />
<h2>RT-qPCR</h2><br />
We are currently using two-step RT-qPCR to confirm that our engineered Shewanella strains respond to arsenic and naphthalene. Total RNA will be isolated using the E.Z.N.A.™ Bacterial RNA Isolation Kit from Omega bio-tek; cDNA will be synthesized using the qScript™ Flex cDNA Kit from Quanta Biosciences; and we are using the ABI ViiA7 platform along with the KAPA SYBR(R) FAST qPCR Kit from KAPA Biosystems. Our primers are as follows: <br />
<br><br><br />
FOR_enzA: CAGCCTTTTACCCAAGGTGA<br />
<br><br />
REV_enzA: CACGATTCGAGAGGGTGATT<br />
<br><br />
FOR_RecA: TTCCCCTCGACATTGTCATCATCGGA<br />
<br><br />
REV_RecA: AAGGGCGATAAAATTGGTCAAGGCCG<br />
<br><br />
3'_FOR_qPCR_mtrB: ACGCTCAATATCAAGCCACCGAGA<br />
<br><br />
3'_REV_qPCR_mtrB: TGTGCGGTGTAGTCATGGCTGT<br />
</div><br />
<div class="three columns"><br />
<img src="https://static.igem.org/mediawiki/2012/c/ce/Cornell12_Stock_4.jpg"><br />
</div><br />
</div><br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/lightbox?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_wetlab').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/wetlab/results/transcriptionTeam:Cornell/project/wetlab/results/transcription2012-10-26T22:23:05Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6>Wet Lab</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly">DNA Assembly</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/arsenic">Arsenic Reporter</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/naphthalene">Naphthalene Reporter</a><br />
</li><br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results">Testing &amp; Results</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/biobricks">BioBricks</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/reactors">Reactors</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/transcription">Transcriptional Characterization</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/protein">MtrB Protein Expression</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/nah_operon"><i>nah</i> Operon Expression</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/artificial_river_media">Artificial River Media</a><br />
</li><br />
<br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/future_work">Future Work</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/animation">Animation</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h2 class="centered">Transcriptional Characterization</h2><br />
</div><br />
</div><br />
<div class="row"><br />
<div class="twelve columns"><br />
<br><br />
<h2> Fluorescence </h2><br />
In order to characterize promoter activity in response to arsenic and salicylate, we appended mRFP downstream of mtrB in our reporter parts. We used these constructs to test the level of promoter activity at increasing arsenic and salicylate concentrations. <br />
<h3>Control</h3><br />
In order to optimize experimental parameters, we began by measuring the fluorescence of mRFP with Anderson series promoters in <i>Shewanella oneidensis</i> MR-1. After adjusting the parameters of our tests to get a consistent response from control strains, we saw increasing relative fluorescence with increasing promoter strength. This suggests that the Anderson series constitutive promoters show similar activity in <i>S. oneidensis</i> as they do in <i>E. coli</i>.<br />
<img class="inline" width="650" align="middle" src="https://static.igem.org/mediawiki/2012/9/9b/Fluorescence_controls.png"><br />
<br><br />
<font size="2">Relative fluorescence of four strains, normalized to optical density, averaged over 8 replicates after steady OD was reached and cells were in stationary phase. <i>S. oneidensis</i> with mtrB knocked out, and three strains of <i>S. oneidensis</i> expressing mRFP with Anderson series promoters strength 0.1, 0.7, and 1.0, were tested. mRFP fluorescence increases with increasing promoter strength.</font><br />
</div><br />
</div><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h3>Arsenic</h3><br />
In order to determine if gene expression is increased in the presence of arsenic, we inoculated our growth medium with varying concentrations of either arsenite or arsenate and measured fluorescence using the BioTek Instruments Synergy™ HT Multi-Mode Microplate Reader. Trials were run using blank LB medium and JG700 as negative controls, while conjugated JG700 strains with Anderson promoters (0.1, 0.4, 1.0) upstream of mRFP were used as positive controls. Background fluorescence from LB was subtracted and fluorescence normalized to optical density in order to obtain relative fluorescence per cell mass. Fluorescence data was averaged over a time course of 4.5 hours, after the cells had grown to a steady OD.<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/thumb/a/a7/FluorescenceArsenite1001.png/800px-FluorescenceArsenite1001.png"><br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/thumb/9/92/FluorescenceArsenate1001.png/800px-FluorescenceArsenate1001.png"><br />
<br />
<font size="2">Preliminary data of relative fluorescence at 0, 10, 50, 100, and 500 µM of (a) arsenite, and (b) arsenate. Relative fluorescence is reported after normalization to optical density.</font><br />
<br />
<br><br><br />
<br />
Our preliminary data shows that as arsenite concentration is increased, relative fluorescence increases by over two-fold in both reporter strains! Therefore, our arsenic reporters are responding to arsenite.<br />
<br />
<br/><br/><br />
<br />
However, our preliminary data from arsenate treatment shows no clear trend. As <i>S. oneidensis</i> has the native ability to reduce arsenates to arsenites, this may contribute to the lack of an obvious trend.<br />
<br />
<br/><br/><br />
<br />
Because relative fluorescence is an average of only 3 replicates over 4.5 hour time courses, error bars are not included. We are currently continuing fluorescence assays to ensure statistical significance and to further define the dynamic range of our constructs.<br />
<br />
</div><br />
</div><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h3>Salicylate</h3><br />
<br />
Our fluorescence assays confirm that the salicylate reporter construct without a BamHI cut-site, SAL2, responds to salicylate in a range of 10-100 µM. As with tests characterizing response to arsenites and arsenates, we measured fluorescence while varying concentration of salicylate in LB medium.<br />
<br />
Trials were run using blank LB medium and JG700 as negative controls, while conjugated JG700 strains with Anderson promoters (0.1, 0.4, 1.0) upstream of mRFP were used as positive controls.<br />
Background fluorescence from LB was subtracted and fluorescence normalized to optical density in order to obtain relative fluorescence per cell mass. Fluorescence data was averaged over a time course of 7.5 hours, after the cells had grown to a steady OD.<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/thumb/5/56/FluorescenceSalicylate930.png/800px-FluorescenceSalicylate930.png"><br />
<br />
<font size="2">Preliminary data of relative fluorescence at 1, 10, 100, and 500 µM of salicylate. Relative fluorescence is reported after normalization to optical density.</font><br />
<br />
<br><br><br />
<br />
Preliminary data strongly suggests that SAL2 responds to salicylate at concentrations in the order of hundreds of µM. Additionally, comparison to fluorescence from the Anderson 0.1 promoter (not shown in graph) suggests that the induced promoter activity may have similar strength to 0.1 on the Anderson series scale.<br />
<br />
<br/><br/><br />
<br />
SAL2 fluorescence is averaged over 3 replicates in addition to averaging replicate individually over a time course of 7.5 hours. We are continuing to characterize our salicylate reporter strains.<br />
</div><br />
</div><br />
<br />
<br><br><br />
<div class="row last-ele"><br />
<br />
<div class="nine columns"><br />
<h2>RT-qPCR</h2><br />
We are currently using two-step RT-qPCR to confirm that our engineered Shewanella strains respond to arsenic and naphthalene. Total RNA will be isolated using the E.Z.N.A.™ Bacterial RNA Isolation Kit from Omega bio-tek; cDNA will be synthesized using the qScript™ Flex cDNA Kit from Quanta Biosciences; and we are using the ABI ViiA7 platform along with the KAPA SYBR(R) FAST qPCR Kit from KAPA Biosystems. Our primers are as follows: <br />
<br><br><br />
FOR_enzA: CAGCCTTTTACCCAAGGTGA<br />
<br><br />
REV_enzA: CACGATTCGAGAGGGTGATT<br />
<br><br />
FOR_RecA: TTCCCCTCGACATTGTCATCATCGGA<br />
<br><br />
REV_RecA: AAGGGCGATAAAATTGGTCAAGGCCG<br />
<br><br />
3'_FOR_qPCR_mtrB: ACGCTCAATATCAAGCCACCGAGA<br />
<br><br />
3'_REV_qPCR_mtrB: TGTGCGGTGTAGTCATGGCTGT<br />
</div><br />
<div class="three columns"><br />
<img src="https://static.igem.org/mediawiki/2012/c/ce/Cornell12_Stock_4.jpg"><br />
</div><br />
</div><br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/lightbox?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_wetlab').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/File:Fluorescence_controls.pngFile:Fluorescence controls.png2012-10-26T22:20:20Z<p>S.Sureka: uploaded a new version of &quot;File:Fluorescence controls.png&quot;</p>
<hr />
<div></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/wetlab/results/transcriptionTeam:Cornell/project/wetlab/results/transcription2012-10-26T22:13:01Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6>Wet Lab</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly">DNA Assembly</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/arsenic">Arsenic Reporter</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/naphthalene">Naphthalene Reporter</a><br />
</li><br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results">Testing &amp; Results</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/biobricks">BioBricks</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/reactors">Reactors</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/transcription">Transcriptional Characterization</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/protein">MtrB Protein Expression</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/nah_operon"><i>nah</i> Operon Expression</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/artificial_river_media">Artificial River Media</a><br />
</li><br />
<br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/future_work">Future Work</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/animation">Animation</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h2 class="centered">Transcriptional Characterization</h2><br />
</div><br />
</div><br />
<div class="row"><br />
<div class="twelve columns"><br />
<br><br />
<h2> Fluorescence </h2><br />
In order to characterize promoter activity in response to arsenic and salicylate, we appended mRFP downstream of mtrB in our reporter parts. We used these constructs to test the level of promoter activity at increasing arsenic and salicylate concentrations. <br />
<h3>Control</h3><br />
In order to optimize experimental parameters, we began by measuring the fluorescence of mRFP with Anderson series promoters in <i>Shewanella oneidensis</i> MR-1. After adjusting the parameters of our tests to get a consistent response from control strains, we saw increasing relative fluorescence with increasing promoter strength. This suggests that the Anderson series constitutive promoters show similar activity in <i>S. oneidensis</i> as they do in <i>E. coli</i>.<br />
<img class="inline" width="650" align="middle" src="https://static.igem.org/mediawiki/2012/9/9b/Fluorescence_controls.png"><br />
<br><br />
<font size="2">Relative fluorescence of four strains, normalized to optical density, averaged over 8 replicates after steady OD was reached and cells were in stationary phase. <i>S. oneidensis</i> with mtrB knocked out, and three strains of <i>S. oneidensis</i> expressing mRFP with Anderson series promoters strength 0.1, 0.7, and 1.0, were tested. mRFP fluorescence increases with increasing promoter strength.</font><br />
</div><br />
</div><br />
<div class="row"><br />
<div class="nine columns"><br />
<h3>Arsenic</h3><br />
In order to determine if gene expression is increased in the presence of arsenic, we inoculated our growth medium with varying concentrations of either arsenite or arsenate and measured fluorescence using the BioTek Instruments Synergy™ HT Multi-Mode Microplate Reader. Trials were run using blank LB medium and JG700 as negative controls, while conjugated JG700 strains with Anderson promoters (0.1, 0.4, 1.0) upstream of mRFP were used as positive controls. Background fluorescence from LB was subtracted and fluorescence normalized to optical density in order to obtain relative fluorescence per cell mass. Fluorescence data was averaged over a time course of 4.5 hours, after the cells had grown to a steady OD.<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/thumb/a/a7/FluorescenceArsenite1001.png/800px-FluorescenceArsenite1001.png"><br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/thumb/9/92/FluorescenceArsenate1001.png/800px-FluorescenceArsenate1001.png"><br />
<br />
<font size="2">Preliminary data of relative fluorescence at 0, 10, 50, 100, and 500 µM of (a) arsenite, and (b) arsenate. Relative fluorescence is reported after normalization to optical density.</font><br />
<br />
<br><br><br />
<br />
Our preliminary data shows that as arsenite concentration is increased, relative fluorescence increases by over two-fold in both reporter strains! Therefore, our arsenic reporters are responding to arsenite.<br />
<br />
<br/><br/><br />
<br />
However, our preliminary data from arsenate treatment shows no clear trend. As <i>S. oneidensis</i> has the native ability to reduce arsenates to arsenites, this may contribute to the lack of an obvious trend.<br />
<br />
<br/><br/><br />
<br />
Because relative fluorescence is an average of only 3 replicates over 4.5 hour time courses, error bars are not included. We are currently continuing fluorescence assays to ensure statistical significance and to further define the dynamic range of our constructs.<br />
<br />
</div><br />
<div class="three columns"><br />
<img src="https://static.igem.org/mediawiki/2012/2/20/Cornell12_Stock_5.jpg"><br />
</div><br />
</div><br />
<div class="row"><br />
<div class="three columns"><br />
<img src="https://static.igem.org/mediawiki/2012/d/d8/Cornell12_Stock_17.jpg"><br />
</div><br />
<div class="nine columns"><br />
<h3>Salicylate</h3><br />
<br />
Our fluorescence assays confirm that the salicylate reporter construct without a BamHI cut-site, SAL2, responds to salicylate in a range of 10-100 µM. As with tests characterizing response to arsenites and arsenates, we measured fluorescence while varying concentration of salicylate in LB medium.<br />
<br />
Trials were run using blank LB medium and JG700 as negative controls, while conjugated JG700 strains with Anderson promoters (0.1, 0.4, 1.0) upstream of mRFP were used as positive controls.<br />
Background fluorescence from LB was subtracted and fluorescence normalized to optical density in order to obtain relative fluorescence per cell mass. Fluorescence data was averaged over a time course of 7.5 hours, after the cells had grown to a steady OD.<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/thumb/5/56/FluorescenceSalicylate930.png/800px-FluorescenceSalicylate930.png"><br />
<br />
<font size="2">Preliminary data of relative fluorescence at 1, 10, 100, and 500 µM of salicylate. Relative fluorescence is reported after normalization to optical density.</font><br />
<br />
<br><br><br />
<br />
Preliminary data strongly suggests that SAL2 responds to salicylate at concentrations in the order of hundreds of µM. Additionally, comparison to fluorescence from the Anderson 0.1 promoter (not shown in graph) suggests that the induced promoter activity may have similar strength to 0.1 on the Anderson series scale.<br />
<br />
<br/><br/><br />
<br />
SAL2 fluorescence is averaged over 3 replicates in addition to averaging replicate individually over a time course of 7.5 hours. We are continuing to characterize our salicylate reporter strains.<br />
</div><br />
</div><br />
<br />
<br><br><br />
<div class="row last-ele"><br />
<br />
<div class="nine columns"><br />
<h2>RT-qPCR</h2><br />
We are currently using two-step RT-qPCR to confirm that our engineered Shewanella strains respond to arsenic and naphthalene. Total RNA will be isolated using the E.Z.N.A.™ Bacterial RNA Isolation Kit from Omega bio-tek; cDNA will be synthesized using the qScript™ Flex cDNA Kit from Quanta Biosciences; and we are using the ABI ViiA7 platform along with the KAPA SYBR(R) FAST qPCR Kit from KAPA Biosystems. Our primers are as follows: <br />
<br><br><br />
FOR_enzA: CAGCCTTTTACCCAAGGTGA<br />
<br><br />
REV_enzA: CACGATTCGAGAGGGTGATT<br />
<br><br />
FOR_RecA: TTCCCCTCGACATTGTCATCATCGGA<br />
<br><br />
REV_RecA: AAGGGCGATAAAATTGGTCAAGGCCG<br />
<br><br />
3'_FOR_qPCR_mtrB: ACGCTCAATATCAAGCCACCGAGA<br />
<br><br />
3'_REV_qPCR_mtrB: TGTGCGGTGTAGTCATGGCTGT<br />
</div><br />
<div class="three columns"><br />
<img src="https://static.igem.org/mediawiki/2012/c/ce/Cornell12_Stock_4.jpg"><br />
</div><br />
</div><br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/lightbox?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_wetlab').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/File:Fluorescence_controls.pngFile:Fluorescence controls.png2012-10-26T22:12:00Z<p>S.Sureka: </p>
<hr />
<div></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/gallery/outreachTeam:Cornell/project/gallery/outreach2012-10-26T21:07:52Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6>Photo Galleries</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/gallery">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/gallery/device">The Device</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/gallery/drylab">Dry Lab</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/gallery/wetlab">Wet Lab</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/gallery/outreach">Outreach</a><br />
</li><br />
<br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h2 class="centered">Outreach Gallery</h2><br />
</div><br />
</div><br />
<div class="row last-ele"><br />
<div class="twelve columns"><br />
<ul class="block-grid four-up"><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/b/bd/Sciencenter_6_900.png" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/2/22/Sciencenter_6_small.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/4/44/Sciencenter_7.JPG" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/8/80/Sciencenter_7_small.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/e/e1/Sciencenter_8.JPG" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/7/71/Sciencenter_8_small.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/e/ed/Sciencenter_9.JPG" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/2/2c/Sciencenter_9_small.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/6/65/CIBT_2.JPG" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/9/98/CIBT_2_small.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/c/c2/PSP_4.JPG" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/2/25/Psp_4_small.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/e/ea/PSP_5.JPG" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/1/13/Psp_5_small.png"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/41969e" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/41969e"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/abbe92" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/abbe92"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/574731" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/574731"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/7d41c8" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/7d41c8"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/432174" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/432174"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/a34e1d" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/a34e1d"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/1bd1e0" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/1bd1e0"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/3c7f9c" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/3c7f9c"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/9e2117" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/9e2117"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/cc3c32" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/cc3c32"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/2b752e" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/2b752e"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/e215e6" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/e215e6"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/d2dd94" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/d2dd94"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/2c20ad" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/2c20ad"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/442ab1" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/442ab1"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/442ab1" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/442ab1"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/ed0030" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/ed0030"></a><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/lightbox?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_gallery').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/File:Sciencenter_6_900.pngFile:Sciencenter 6 900.png2012-10-26T21:07:35Z<p>S.Sureka: </p>
<hr />
<div></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/gallery/outreachTeam:Cornell/project/gallery/outreach2012-10-26T21:01:31Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6>Photo Galleries</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/gallery">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/gallery/device">The Device</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/gallery/drylab">Dry Lab</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/gallery/wetlab">Wet Lab</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/gallery/outreach">Outreach</a><br />
</li><br />
<br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h2 class="centered">Outreach Gallery</h2><br />
</div><br />
</div><br />
<div class="row last-ele"><br />
<div class="twelve columns"><br />
<ul class="block-grid four-up"><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/a/aa/Sciencenter_6.JPG" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/2/22/Sciencenter_6_small.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/4/44/Sciencenter_7.JPG" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/8/80/Sciencenter_7_small.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/e/e1/Sciencenter_8.JPG" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/7/71/Sciencenter_8_small.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/e/ed/Sciencenter_9.JPG" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/2/2c/Sciencenter_9_small.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/6/65/CIBT_2.JPG" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/9/98/CIBT_2_small.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/c/c2/PSP_4.JPG" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/2/25/Psp_4_small.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/e/ea/PSP_5.JPG" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/1/13/Psp_5_small.png"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/41969e" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/41969e"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/abbe92" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/abbe92"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/574731" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/574731"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/7d41c8" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/7d41c8"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/432174" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/432174"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/a34e1d" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/a34e1d"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/1bd1e0" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/1bd1e0"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/3c7f9c" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/3c7f9c"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/9e2117" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/9e2117"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/cc3c32" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/cc3c32"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/2b752e" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/2b752e"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/e215e6" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/e215e6"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/d2dd94" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/d2dd94"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/2c20ad" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/2c20ad"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/442ab1" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/442ab1"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/442ab1" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/442ab1"></a><br />
</li><br />
<li><br />
<a href="http://placehold.it/900x600/ed0030" rel="lightbox[outreach]"><img src="http://placehold.it/250x250/ed0030"></a><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/lightbox?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_gallery').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/File:Psp_5_small.pngFile:Psp 5 small.png2012-10-26T21:00:21Z<p>S.Sureka: </p>
<hr />
<div></div>S.Surekahttp://2012.igem.org/File:Psp_4_small.pngFile:Psp 4 small.png2012-10-26T20:55:22Z<p>S.Sureka: </p>
<hr />
<div></div>S.Surekahttp://2012.igem.org/File:Sciencenter_6_small.pngFile:Sciencenter 6 small.png2012-10-26T20:51:16Z<p>S.Sureka: </p>
<hr />
<div></div>S.Surekahttp://2012.igem.org/File:Sciencenter_7_small.pngFile:Sciencenter 7 small.png2012-10-26T20:48:48Z<p>S.Sureka: </p>
<hr />
<div></div>S.Surekahttp://2012.igem.org/File:Sciencenter_8_small.pngFile:Sciencenter 8 small.png2012-10-26T20:45:14Z<p>S.Sureka: </p>
<hr />
<div></div>S.Surekahttp://2012.igem.org/File:Sciencenter_9_small.pngFile:Sciencenter 9 small.png2012-10-26T20:41:55Z<p>S.Sureka: </p>
<hr />
<div></div>S.Surekahttp://2012.igem.org/File:CIBT_2_small.pngFile:CIBT 2 small.png2012-10-26T20:37:56Z<p>S.Sureka: </p>
<hr />
<div></div>S.Surekahttp://2012.igem.org/Team:Cornell/projectTeam:Cornell/project2012-10-25T23:50:26Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row main-image"><br />
<div class="twelve columns"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/a/ad/WINNER_1000_350.jpg" /><br />
<br />
<br />
</div><br />
<br />
<div class="twelve columns"> <br />
<br />
To view more images of SAFE BET, <a href="https://2012.igem.org/Team:Cornell/project/gallery">click here</a>.<br />
</div><br />
</div><br />
<div class="row" style="margin-top:20px;"><br />
<div class="eight columns"><br />
<div class="row"><br />
<div class="eleven centered columns panel"><br />
<h3 class="centered" style="margin:0px"> We have developed a novel biosensor intended for continuous monitoring of water quality in areas affected by oil and gas extraction.</h3><br />
</div><br />
</div><br />
<div class="row" style="margin-top:20px;"><br />
<div class="twelve columns"><br />
Canadian oil sands are a vast oil reserve that, given rising prices of petroleum, are an attractive alternative to traditional sources of crude oil. However, there are numerous public health and environmental concerns regarding the oil sands extraction process. One environmental concern is the contamination of Canadian watersheds by seepage from tailings ponds. To better monitor this issue, we have engineered a novel biosensing platform with the electroactive bacterial species ''Shewanella oneidensis'' MR-1, which has the unique capability to directly transfer electrons to solid-state electrodes. We exploit this feature by genetically manipulating S. oneidensis MR-1 to upregulate its metal-reduction capacity in the presence of analyte to generate direct current output in a whole-cell biosensor. Our goal is to develop a fully autonomous electrochemical biosensor that complements the current oil sands monitoring system by providing real-time data over extended periods of time. Furthermore, our device will circumvent the costs and complications of producing and maintaining photodiode circuits used for data acquisition in bioluminescent reporter systems by instead producing a direct electrical output. While our platform is adaptable to sensing a wide range of analytes, we will initially focus on arsenic-containing compounds and naphthalene,a polycyclic aromatic hydrocarbon (PAH) – known contaminants of oil sands tailings ponds. We believe that our biosensor will be a valuable tool for remote,continuous, and long-term monitoring of pollutants in rivers and key watersheds.<br />
</div><br />
</div><br />
<div class="row" style="margin-top:20px;"><br />
<div class="ten columns centered"><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/overview/oil_sands">What are the Oil Sands?</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/overview/oil_extraction">How is oil extracted from Oil Sands?</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/overview/environmental_concerns">Environmental Concerns</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/overview/health_effects">Health Effects from Water Contaminated with Arsenic<br />
and Naphthalene</a><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
<div class="four columns"><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h4 class="centered">Wet Lab</h4><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly"><br />
DNA Assembly</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/arsenic">Arsenic Reporter</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/naphthalene">Naphthalene Reporter</a><br />
</li><br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Cornell/project/wetlab/results"><br />
Testing &amp; Results</a><br />
<ul><br />
<li> <a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/biobricks">BioBricks</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/reactors">Reactors</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/transcription">Transcriptional Characterization</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/protein">MtrB Protein Expression</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/nah_operon"><i>nah</i> Operon Expression</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/artificial_river_media">Artificial River Media </a><br />
</li><br />
<br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/future_work">Future work</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/drylab/animation">Animation</a><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h4 class="centered">Dry Lab</h4><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/drylab">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/drylab/specifications">Specifications</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/drylab/design">Design</a><br />
</li><br />
<li> Modeling<br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/drylab/modeling/deployment">Deployment</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/drylab/modeling/time_response">Time Response</a><br />
</li><br />
</li><br />
</ul><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/drylab/gallery">Gallery</a><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h4 class="centered">Human Practices</h4><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/CEA">Comprehensive Environmental Assessment</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/bioethics">Bioethics</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/oil_sands">Application: Oil Sands</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/cayuga_watershed">Application: Cayuga Watershed</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/safety">Safety Overview</a><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('#homepage-slideshow').orbit({<br />
animation : 'horizontal-push', // fade, horizontal-slide, vertical-slide, horizontal-push<br />
animationSpeed : 800, // how fast animtions are<br />
timer : true, // true or false to have the timer<br />
resetTimerOnClick : false, // true resets the timer instead of pausing slideshow progress<br />
advanceSpeed : 8000, // if timer is enabled, time between transitions<br />
pauseOnHover : false, // if you hover pauses the slider<br />
startClockOnMouseOut : false, // if clock should start on MouseOut<br />
startClockOnMouseOutAfter : 1000, // how long after MouseOut should the timer start again<br />
directionalNav : true, // manual advancing directional navs<br />
captions : false, // do you want captions?<br />
captionAnimation : 'fade', // fade, slideOpen, none<br />
captionAnimationSpeed : 400, // if so how quickly should they animate in<br />
bullets : true, // true or false to activate the bullet navigation<br />
bulletThumbs : false, // thumbnails for the bullets<br />
bulletThumbLocation : '', // location from this file where thumbs will be<br />
afterSlideChange : function() {<br />
}, // empty function<br />
fluid : true // or set a aspect ratio for content slides (ex: '4x3')<br />
});<br />
$('li.pg-project').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/hprac/safetyTeam:Cornell/project/hprac/safety2012-10-25T23:20:21Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6 style="margin-top:32px;">Human Practices</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/CEA">Comprehensive Environmental Assessment</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/bioethics">Bioethics</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/oil_sands">Oil Sands</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/cayuga_watershed">Cayuga Watershed</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/safety">Safety</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h2 class="centered">Safety Overview</h2><br />
</div><br />
</div><br />
<div class="row last-ele"><br />
<div class="twelve columns"><br />
<h3>Safe Practices in the Lab</h3><br />
Our team conducted our work on the Cornell University campus, in the Biomedical Engineering Instructional Lab in Weill Hall, as well as in the <a href="http://angenent.bee.cornell.edu/molecularlab.html" target="_blank">Angenent Lab</a> in the Department of Biological &amp; Environmental Engineering in Riley-Robb Hall. All work was conducted in a biosafety level (BSL) 1 laboratory: this means that the strains we are using (<i>Escherichia coli</i> DH5a and WM3064, <i>Shewanella oneidensis</i> MR-1 and JG700, and <i>Pseudomonas putida</i>) are non-pathogenic and well-characterized. Before gaining access to the lab space, team members were required to:<br />
<br><br><br />
<ol><br />
<li>complete chemical waste disposal training,</li> <br />
<li>attend an orientation with Todd Pfeiffer, the Weill Hall Facilities Director, regarding the Cornell Environmental Health &amp; Safety guidelines, and </li><br />
<li>receive specific training from <a href="http://www.bme.cornell.edu/people/adj-profile.cfm?netid=sda4"> Dr. Shivaun Archer</a>, the manager of the BME Instructional Lab, for the equipment in the lab.</li><br />
</ol><br />
Our standard lab practices were in compliance with the World Health Organization’s Biosafety Level 1 <a href="http://www.who.int/csr/resources/publications/biosafety/Biosafety7.pdf" target="_blank">guidelines</a>. Many of our basic lab practices are described below. <br />
<br><br><br />
<ul><br />
<li>Researchers were required to wear gloves while in the lab space, and to remove one glove when going into lab common areas. </li><br />
<li>No gloves were allowed to leave the lab space, and no food or drink was allowed into the lab space. </li><br />
<li>Within Weill Hall, microbiological samples were transported only via the internal service elevator, to avoid contamination of public areas.</li> <br />
<li>Any materials transported between the two on-campus lab spaces were held in secondary containment during transport. </li><br />
<li>All flammable liquids were kept in a flammable storage cabinet.</li><br />
<li>The lab contained distinct waste containers for general waste, biohazard waste, biohazard sharps, and non-biohazard broken glassware.</li><br />
<li>Liquid bacterial waste was treated with bleach before being discharged into sanitary sewage.</li><br />
<li>Benchtops were decontaminated with ethanol before and after lab work was conducted. Tools that came into contact with bacteria were soaked in ethanol and flame-treated before and after use.</li><br />
<li>An autoclave was used to decontaminate growth media, glassware, tubes, pipette tips, etc. All lab members were trained in proper autoclave use by the Weill Hall Facilities Director in order to avoid dangers to researcher safety.</li><br />
<li>An emergency shower, eyewash, and first aid kit were available withing the lab space in case of emergency.</li><br />
<li>Lab notebooks were maintained in a taped-off no-glove area.</li><br />
</ul><br />
Safety procedures specific to our project, in addition to best microbial practices, were followed during testing with arsenic and naphthalene. We modified EH&amp;S standard operating procedures for <a href="https://static.igem.org/mediawiki/2012/d/d7/Sodium_Arsenite_SOP.pdf" target="_blank">arsenites</a>, <a href="https://static.igem.org/mediawiki/2012/3/37/Sodium_hydrogen_arsenate_heptahydrate_SOP.pdf" target="_blank">arsenates</a>, and <a href="https://static.igem.org/mediawiki/2012/c/ca/Naphthalene_SOP.pdf" target="_blank">naphthalene</a> for our specific experimental needs. Most importantly, all work with arsenic and naphthalene was conducted by team members wearing appropriate PPE in a taped-off, designated area, and with equipment labeled as arsenic- or naphthalene-contaminated. Waste was collected separately, labeled appropriately as a cancer-hazard and disposed of through the Cornell EH&amp;S.<br />
<br><br><br />
Similar precautions were taken in working with Ethidium Bromide - all EtBr-staining was done in designated boxes, and in taped off areas used only for running and staining gels. Gels were visualized on a UV light box protected from EtBr contamination using saran wrap, which could be easily disposed of in the biohazard bin rather than risking ineffective decontamination of the UV light box. Team members were protected from exposure to UV rays with a UV shield. Facial shields were also available for use when needed.<br />
<br><br><br />
Material Safety Data Sheets for these three hazardous compounds, as well as all other hazardous compounds used in the lab, were readily available in a binder in the lab space, as well as in the team’s shared online file folder.<br />
<br><br><br />
<h5>Is there a local biosafety group, committee, or review board at your institution?</h5><br />
Yes, <a href="http://sp.ehs.cornell.edu/Pages/Home.aspx" target="_blank">Cornell University Environmental Health &amp; Safety</a> oversees safe procedures in on-campus laboratory research. The Cornell EH&amp;S mandates training required of researchers before they can gain access to lab spaces. Through the EH&amp;S, all team members took a required course on Chemical Waste Disposal.<br />
<br><br><br />
<h5>If yes, what does your local biosafety group think about your project?</h5><br />
We have been in contact with the EH&amp;S at our university about best practices for testing with arsenic. We have consulted them about disposal of carcinogenic wastes, as well as about how to keep researchers safe by using secondary containment and designated equipment. The EH&amp;S has expressed satisfaction that our standard operating protocols and waste disposal plan will ensure researcher safety, as well as public safety. <br />
<br><br><br />
</div><br />
<div class="twelve columns"><br />
<h3>Safety Concerns for Our Project</h3><br />
We are working with biosafety level 1 organisms - ''Escherichia coli'' DH5α and WM3064 (a conjugation-enabled DAP auxotroph), ''Shewanella oneidensis'' MR-1 and JG700 (an mtrB knockout strain), and ''Pseudomonas putida''. None of these strains pose a threat to researcher or public health before modification. The pathways that we are modifying in ''S. oneidensis'' JG700 are natural pathways already found in ''Shewanella'' and ''Pseudomonas'', so they do not raise any safety concerns. As our project aims to detect the unwanted presence of toxic compounds in the environment, our device could not easily be used to negatively impact the public or the environment, and thus does not pose any foreseeable biosecurity risk. <br />
<br><br><br />
<h5>Would any of your project ideas raise safety issues in terms of:</h5><br />
<h6>researcher safety,</h6><br />
As we were working at BSL 1, the primary concern in terms of researcher safety was testing with our toxins of interest. Please see safe lab practices and standard operating procedures for arsenic and naphthalene, above.<br />
<br><br><br />
<h6>public safety,</h6><br />
Again, our project itself could not be easily used to negatively impact the public. However, even when a research project does not pose a security threat, the conducting of research too must be done in a way that protects public interests and safety. All bacteria and waste were disposed of properly, in biohazard bags and through the Cornell EH&amp;S, rather than in common garbage cans, or decontaminated with bleach before being poured down the drain.<br />
<br>Additionally, in order to make our biosensor field-deployable, i.e. suitable for placement in water that will be drinking water, our device includes a thorough effluent filtration system to prevent the escape of our modified strains into the environment. We’re using a safe species and safe modifications that would not pose any foreseeable threat to native species or biodiversity. Finally, though our current selective pressure on our engineered strains is antibiotic resistance, the final device would use strains that were auxotrophs for some essential nutrient or that have our genetic modifications integrated into the bacterial chromosome; this would avoid the possibility of conferring antibiotic resistance to harmful bacterial strains in water. In the case of auxotrophic selection, our strain would be mutated such that it is an auxotroph for two essential nutrients: one of these nutrients would be provided in the media, so that the strain could only survive inside our bioreactors. Selective pressure for the plasmid would then be maintained through the second essential nutrient, which the plasmid would enable the bacteria to synthesize.<br />
<br><br><br />
<h6>or environmental safety?</h6><br />
We do not foresee any adverse effects of deploying our device in natural streams and lakes. As detailed above, we have thought carefully about how to prevent our modified strains from getting into the environment. However, because we are knocking out mtrB - an essential component of ''S. oneidensis''’s respiration pathway - and putting its production under the control of an inducible promotor, it is likely that our modified strains would be less able to compete than the wild type organisms already in the lake. If our parts were to lose their function, through mutation or other means, the most likely outcome would be that our strains would lose their capacity for facultative anaerobic respiration entirely, again leaving them less able to compete with wild-type ''Shewanella''. There is the concern that antibiotic resistance could be horizontally transferred to other organisms in the wild, if our strain were to be released into the wild. This could again be addressed by selecting for strains auxotrophically.<br />
<br><br><br />
<h5>Do any of the new BioBrick parts (or devices) that you made this year raise any safety issues?</h5> <br />
The only safety issue associated with our new BioBrick parts is researcher safety in testing the parts. We have documented our standard operating procedures above, which other teams can reference if they want to use our parts, or test other parts using arsenic or naphthalene.<br />
<br><br><br />
We are also conducting extensive tests to assess the functionality of our BioBrick parts, to ensure that they behave as expected under different conditions.<br />
<br><br><br />
</div><br />
<div class="twelve columns"><br />
<h3>Safety Concerns for iGEM Competition</h3><br />
<h5>Do you have any other ideas how to deal with safety issues that could be useful for future iGEM competitions? How could parts, devices and systems be made even safer through biosafety engineering?</h5> <br />
While our team is fortunate enough to have a biosafety group readily available for on-campus consultation, we recognize that many other teams may not have comparable biosafety resources available to them. In addition to the documentation by teams of their own safe practices, which can be used by other teams as references, more explicit safety guidelines, a “safety checklist” for instance, could be provided by the iGEM competition itself. One possibility is a checklist that rates a given lab from “unsafe” to “very safe” based on the number of safety provisions satisfied by the user filling out the checklist - rather like the Internet sites which assess the strength of inputted passwords.<br />
<br><br><br />
Many of the safety concerns we expressed above are the same concerns that many other iGEM teams also face. Mainly, the prominent use of antibiotic resistance in the construction and retention, via selective pressure, of novel genetic circuits poses a continued risk to public health due to the possibility of conferred antibiotic resistance. While the genes of antibiotic resistance can be carefully controlled in the lab setting, for any device to be used in a real-world setting, this possibility of horizontally transferring antibiotic resistance must be addressed. With this in mind, future iGEM teams should make an effort, where possible, to transition to other forms of selective pressures, such as limited growth media.<br />
<br><br />
</div><br />
</div><br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_safety').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/hprac/safetyTeam:Cornell/project/hprac/safety2012-10-25T23:19:51Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6 style="margin-top:32px;">Human Practices</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/CEA">Comprehensive Environmental Assessment</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/bioethics">Bioethics</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/oil_sands">Oil Sands</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/cayuga_watershed">Cayuga Watershed</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/safety">Safety</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h2 class="centered">Safety Overview</h2><br />
</div><br />
</div><br />
<div class="row last-ele"><br />
<div class="twelve columns"><br />
<h3>Safe Practices in the Lab</h3><br />
Our team conducted our work on the Cornell University campus, in the Biomedical Engineering Instructional Lab in Weill Hall, as well as in the <a href="http://angenent.bee.cornell.edu/molecularlab.html" target="_blank">Angenent Lab</a> in the Department of Biological &amp; Environmental Engineering in Riley-Robb Hall. All work was conducted in a biosafety level (BSL) 1 laboratory: this means that the strains we are using (<i>Escherichia coli</i> DH5a and WM3064, <i>Shewanella oneidensis</i> MR-1 and JG700, and <i>Pseudomonas putida</i>) are non-pathogenic and well-characterized. Before gaining access to the lab space, team members were required to:<br />
<br><br><br />
<ol><br />
<li>complete chemical waste disposal training,</li> <br />
<li>attend an orientation with Todd Pfeiffer, the Weill Hall Facilities Director, regarding the Cornell Environmental Health &amp; Safety guidelines, and </li><br />
<li>receive specific training from <a href="http://www.bme.cornell.edu/people/adj-profile.cfm?netid=sda4"> Dr. Shivaun Archer</a>, the manager of the BME Instructional Lab, for the equipment in the lab.</li><br />
</ol><br />
Our standard lab practices were in compliance with the World Health Organization’s Biosafety Level 1 <a href="http://www.who.int/csr/resources/publications/biosafety/Biosafety7.pdf" target="_blank">guidelines</a>. Many of our basic lab practices are described below. <br />
<br><br><br />
<ul><br />
<li>Researchers were required to wear gloves while in the lab space, and to remove one glove when going into lab common areas. </li><br />
<li>No gloves were allowed to leave the lab space, and no food or drink was allowed into the lab space. </li><br />
<li>Within Weill Hall, microbiological samples were transported only via the internal service elevator, to avoid contamination of public areas.</li> <br />
<li>Any materials transported between the two on-campus lab spaces were held in secondary containment during transport. </li><br />
<li>All flammable liquids were kept in a flammable storage cabinet.</li><br />
<li>The lab contained distinct waste containers for general waste, biohazard waste, biohazard sharps, and non-biohazard broken glassware.</li><br />
<li>Liquid bacterial waste was treated with bleach before being discharged into sanitary sewage.</li><br />
<li>Benchtops were decontaminated with ethanol before and after lab work was conducted. Tools that came into contact with bacteria were soaked in ethanol and flame-treated before and after use.</li><br />
<li>An autoclave was used to decontaminate growth media, glassware, tubes, pipette tips, etc. All lab members were trained in proper autoclave use by the Weill Hall Facilities Director in order to avoid dangers to researcher safety.</li><br />
<li>An emergency shower, eyewash, and first aid kit were available withing the lab space in case of emergency.</li><br />
<li>Lab notebooks were maintained in a taped-off no-glove area.</li><br />
</ul><br />
<br><br />
Safety procedures specific to our project, in addition to best microbial practices, were followed during testing with arsenic and naphthalene. We modified EH&amp;S standard operating procedures for <a href="https://static.igem.org/mediawiki/2012/d/d7/Sodium_Arsenite_SOP.pdf" target="_blank">arsenites</a>, <a href="https://static.igem.org/mediawiki/2012/3/37/Sodium_hydrogen_arsenate_heptahydrate_SOP.pdf" target="_blank">arsenates</a>, and <a href="https://static.igem.org/mediawiki/2012/c/ca/Naphthalene_SOP.pdf" target="_blank">naphthalene</a> for our specific experimental needs. Most importantly, all work with arsenic and naphthalene was conducted by team members wearing appropriate PPE in a taped-off, designated area, and with equipment labeled as arsenic- or naphthalene-contaminated. Waste was collected separately, labeled appropriately as a cancer-hazard and disposed of through the Cornell EH&amp;S.<br />
<br><br><br />
Similar precautions were taken in working with Ethidium Bromide - all EtBr-staining was done in designated boxes, and in taped off areas used only for running and staining gels. Gels were visualized on a UV light box protected from EtBr contamination using saran wrap, which could be easily disposed of in the biohazard bin rather than risking ineffective decontamination of the UV light box. Team members were protected from exposure to UV rays with a UV shield. Facial shields were also available for use when needed.<br />
<br><br><br />
Material Safety Data Sheets for these three hazardous compounds, as well as all other hazardous compounds used in the lab, were readily available in a binder in the lab space, as well as in the team’s shared online file folder.<br />
<br><br><br />
<h5>Is there a local biosafety group, committee, or review board at your institution?</h5><br />
Yes, <a href="http://sp.ehs.cornell.edu/Pages/Home.aspx" target="_blank">Cornell University Environmental Health &amp; Safety</a> oversees safe procedures in on-campus laboratory research. The Cornell EH&amp;S mandates training required of researchers before they can gain access to lab spaces. Through the EH&amp;S, all team members took a required course on Chemical Waste Disposal.<br />
<br><br><br />
<h5>If yes, what does your local biosafety group think about your project?</h5><br />
We have been in contact with the EH&amp;S at our university about best practices for testing with arsenic. We have consulted them about disposal of carcinogenic wastes, as well as about how to keep researchers safe by using secondary containment and designated equipment. The EH&amp;S has expressed satisfaction that our standard operating protocols and waste disposal plan will ensure researcher safety, as well as public safety. <br />
<br><br><br />
</div><br />
<div class="twelve columns"><br />
<h3>Safety Concerns for Our Project</h3><br />
We are working with biosafety level 1 organisms - ''Escherichia coli'' DH5α and WM3064 (a conjugation-enabled DAP auxotroph), ''Shewanella oneidensis'' MR-1 and JG700 (an mtrB knockout strain), and ''Pseudomonas putida''. None of these strains pose a threat to researcher or public health before modification. The pathways that we are modifying in ''S. oneidensis'' JG700 are natural pathways already found in ''Shewanella'' and ''Pseudomonas'', so they do not raise any safety concerns. As our project aims to detect the unwanted presence of toxic compounds in the environment, our device could not easily be used to negatively impact the public or the environment, and thus does not pose any foreseeable biosecurity risk. <br />
<br><br><br />
<h5>Would any of your project ideas raise safety issues in terms of:</h5><br />
<h6>researcher safety,</h6><br />
As we were working at BSL 1, the primary concern in terms of researcher safety was testing with our toxins of interest. Please see safe lab practices and standard operating procedures for arsenic and naphthalene, above.<br />
<br><br><br />
<h6>public safety,</h6><br />
Again, our project itself could not be easily used to negatively impact the public. However, even when a research project does not pose a security threat, the conducting of research too must be done in a way that protects public interests and safety. All bacteria and waste were disposed of properly, in biohazard bags and through the Cornell EH&amp;S, rather than in common garbage cans, or decontaminated with bleach before being poured down the drain.<br />
<br>Additionally, in order to make our biosensor field-deployable, i.e. suitable for placement in water that will be drinking water, our device includes a thorough effluent filtration system to prevent the escape of our modified strains into the environment. We’re using a safe species and safe modifications that would not pose any foreseeable threat to native species or biodiversity. Finally, though our current selective pressure on our engineered strains is antibiotic resistance, the final device would use strains that were auxotrophs for some essential nutrient or that have our genetic modifications integrated into the bacterial chromosome; this would avoid the possibility of conferring antibiotic resistance to harmful bacterial strains in water. In the case of auxotrophic selection, our strain would be mutated such that it is an auxotroph for two essential nutrients: one of these nutrients would be provided in the media, so that the strain could only survive inside our bioreactors. Selective pressure for the plasmid would then be maintained through the second essential nutrient, which the plasmid would enable the bacteria to synthesize.<br />
<br><br><br />
<h6>or environmental safety?</h6><br />
We do not foresee any adverse effects of deploying our device in natural streams and lakes. As detailed above, we have thought carefully about how to prevent our modified strains from getting into the environment. However, because we are knocking out mtrB - an essential component of ''S. oneidensis''’s respiration pathway - and putting its production under the control of an inducible promotor, it is likely that our modified strains would be less able to compete than the wild type organisms already in the lake. If our parts were to lose their function, through mutation or other means, the most likely outcome would be that our strains would lose their capacity for facultative anaerobic respiration entirely, again leaving them less able to compete with wild-type ''Shewanella''. There is the concern that antibiotic resistance could be horizontally transferred to other organisms in the wild, if our strain were to be released into the wild. This could again be addressed by selecting for strains auxotrophically.<br />
<br><br><br />
<h5>Do any of the new BioBrick parts (or devices) that you made this year raise any safety issues?</h5> <br />
The only safety issue associated with our new BioBrick parts is researcher safety in testing the parts. We have documented our standard operating procedures above, which other teams can reference if they want to use our parts, or test other parts using arsenic or naphthalene.<br />
<br><br><br />
We are also conducting extensive tests to assess the functionality of our BioBrick parts, to ensure that they behave as expected under different conditions.<br />
<br><br><br />
</div><br />
<div class="twelve columns"><br />
<h3>Safety Concerns for iGEM Competition</h3><br />
<h5>Do you have any other ideas how to deal with safety issues that could be useful for future iGEM competitions? How could parts, devices and systems be made even safer through biosafety engineering?</h5> <br />
While our team is fortunate enough to have a biosafety group readily available for on-campus consultation, we recognize that many other teams may not have comparable biosafety resources available to them. In addition to the documentation by teams of their own safe practices, which can be used by other teams as references, more explicit safety guidelines, a “safety checklist” for instance, could be provided by the iGEM competition itself. One possibility is a checklist that rates a given lab from “unsafe” to “very safe” based on the number of safety provisions satisfied by the user filling out the checklist - rather like the Internet sites which assess the strength of inputted passwords.<br />
<br><br><br />
Many of the safety concerns we expressed above are the same concerns that many other iGEM teams also face. Mainly, the prominent use of antibiotic resistance in the construction and retention, via selective pressure, of novel genetic circuits poses a continued risk to public health due to the possibility of conferred antibiotic resistance. While the genes of antibiotic resistance can be carefully controlled in the lab setting, for any device to be used in a real-world setting, this possibility of horizontally transferring antibiotic resistance must be addressed. With this in mind, future iGEM teams should make an effort, where possible, to transition to other forms of selective pressures, such as limited growth media.<br />
<br><br />
</div><br />
</div><br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_safety').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Sureka