http://2012.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=250&target=Nanhai2012.igem.org - User contributions [en]2024-03-28T18:10:44ZFrom 2012.igem.orgMediaWiki 1.16.0http://2012.igem.org/File:DEATH.pngFile:DEATH.png2012-10-27T03:59:56Z<p>Nanhai: </p>
<hr />
<div></div>Nanhaihttp://2012.igem.org/Team:WHU-ChinaTeam:WHU-China2012-10-27T00:24:36Z<p>Nanhai: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<body><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script><br />
function picObj(src, title, detail, href){<br />
this.src = src;<br />
this.title = title;<br />
this.detail = detail;<br />
this.href = href;<br />
}<br />
//*************************自定义数据部分*************************<br />
<br />
//定义菜单及侧边栏数据<br />
var menuObj = {<br />
Home : [<br />
{<br />
title : "<strong>What's new</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/e/e3/What%27s_new_first.png","Three advantages of the E.coslim", "Compared with traditional methods of losing weight, our E.coslim has three advantages: monitoring, high efficiency and long term efficiency.", "https://2012.igem.org/Team:WHU-China/Project?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/f/ff/Promoter_design.png", "Monitoring", "With two novel promoters, Pcar and PfadR, our E.coslim is able to sense the high calorie molecules and respond to them.", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#Pcar"),<br />
new picObj("http://partsregistry.org/wiki/images/f/ff/%E5%85%A8%E6%99%AF%E5%8A%A0%E6%AD%BB%E4%BA%A11.png", "Panorama of the Whole Project Scheme", "Four novel devices, Fatty Acid Degradation, Cellulose Synthesis, Colonization and Death to ensure high efficiency orchestrate calorie absorption and bacteria survival and make you slim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=3"),<br />
new picObj("https://static.igem.org/mediawiki/2012/0/09/%E8%83%96%E5%AD%90%E7%98%A6%E5%AD%90.png", "Long term efficiency of the E.coslim", "When viewed at macroscopic way, the E.coslim may have an advantage of long term efficiency,by regulating the human gut microbiota.And we have certified this by mathematical model.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=2")<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>Pathway Introduction</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/igem.org/8/82/Pathway_FattyAcid.png", "Fatty Acid Degradation", "Feel free to eat meat since the fat is all degraded by our E.coslim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=3"),<br />
new picObj("https://static.igem.org/mediawiki/igem.org/1/18/Pathway_Cellulose.png", "Cellulose Synthesis", "Transforming glucose into cellulose, the high-sugar food you eat will be turned into vegetables!", "https://2012.igem.org/Team:WHU-China/Project?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/e/ea/Device_three.png", "Colonization", "The magic molecule c-di-GMP enables E.coslim colonizing in the gut to better fulfill its magic function!", "https://2012.igem.org/Team:WHU-China/Project?catalog=5")<br />
]<br />
},<br />
<br />
{<br />
title : "<strong>Future Perspective</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/ab/%E5%8F%8C%E8%83%B6%E5%9B%8A2.jpg", "Two Capsule Design", "Capsule I, the E.coslim, makes you slim, while Capsule II, xylose, terminates the effects of the former.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/d/d2/Fpbody2.jpg", "In vitro experiment in a simulated intestine", "The gut microbiota and E.coslim will be inoculated in a simulated intestine, then the concentration measurement of each component will tell us whether E.coslim works as desired.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/8/85/%E5%B0%8F%E9%BC%A0%E5%AE%9E%E9%AA%8C02.jpg", "In vivo experiment in mice", "E.coslim will also be inoculated into mice and the culture-independent microbiome analysis will tell us the real situation in vivo.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0")<br />
]<br />
},<br />
<br />
<br />
<br />
{<br />
title : "<strong>Achievement</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/d/d1/Achievements_device_xia.png", "Devices", "This year, our project has focused on some of the hotspot issues, such as c-di-CMP, gut microbiota. In all we submitted 66 new biobricks and 39 of them have been proved to be effective.", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/c/ca/Achievements_1.png", "Biobicks we have improved", "In our project, we have improved the function of some biobricks,such as BBa_J54222, BBa_K188011 and BBa_R0051. ", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/f/f5/Achievements_2.png", "Novel promoter we designed", "As the existing promoter can not meet our demand, we designed two novel promoters Pcar and Pfad to achieve the goal. In addition, we also have set up a standard for promoter design.", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/2/27/Methods_we_improve.png", "Methods we improved", "In our project,we improved some traditional methods to measure the comsumption of fatty acids and production of cellulose, and also we developed a software named FANCY to detect the fluorescence intensity of single cell. ", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/7/79/Human_practice_xia.png", "Human Practice", "We have helped HUST iGEM team debug their project and mathematical model. We also did a survey on GMOs and publicized iGEM to the public.", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>About Us</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/a7/Whu-2012-1.jpg", "WHU-China 2012, I was there", "The Entrance of State Wuhan University", "https://2012.igem.org/Team:WHU-China/Team?catalog=1"),<br />
new picObj("https://static.igem.org/mediawiki/2012/2/23/Whu2012heying.jpg", "MIT, we're coming!", "Collge of Life Sciences of WHU", "https://2012.igem.org/Team:WHU-China/Team?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/4/43/Whu2012-2.jpg", "WHU-China, Hooray!", "Yuntai Mountain, Henan Province", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=5")<br />
]<br />
}<br />
],<br />
Team : [<br />
{<br />
title : '<strong>Members</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Instructors</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Team History</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About WHU</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About Our Lab</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Acknow-</br>ledgements</strong>',<br />
dir : []<br />
},<br />
<br />
],<br />
Project : [<br />
{<br />
title : '<strong>Description</strong>',<br />
dir : [<br />
<br />
]<br />
},<br />
{<br />
title : '<strong>Background</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Promoter Design</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device I: Fatty Acid Degradation</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device II: Cellulose Synthesis</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device III: Colonization</strong>',<br />
dir : []<br />
},<br />
],<br />
Modeling : [<br />
{<br />
title : '<strong>Future Perspectives</strong>',<br />
dir : []<br />
},<br />
<br />
{<br />
title : '<strong>Model I: Fatty Acid Degradation</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Model II: Microbiota Regulation</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Software Tool: FANCY</strong>',<br />
dir : []<br />
}<br />
],<br />
Notebooks : [<br />
{<br />
title : '<strong>Parts</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Safety</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Protocols</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Events</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Brain-</br>storming</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Gallery</strong>',<br />
dir : []<br />
}<br />
],<br />
HumanPractice : [<br />
{<br />
title : '<strong>Outline</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Questionaire Survey</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Publicity</strong>',<br />
dir : []<br />
}<br />
]<br />
}; <br />
//*************************自定义数据部分*************************<br />
</script><br />
<style type="text/css"><br />
/*<br />
* base css, DO NOT MODIFY!<br />
*/<br />
* {<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
font-family: "Verdana", sans-serif;<br />
color: #333;<br />
list-style: none;<br />
outline: none;<br />
resize: none;<br />
}<br />
html {<br />
overflow-y: scroll;<br />
}<br />
body {<br />
background: url("https://static.igem.org/mediawiki/2012/2/22/Body-bg.jpg") center center fixed;<br />
}<br />
a {<br />
text-decoration: none;<br />
}<br />
.clear {<br />
width: 0;<br />
height: 0;<br />
line-height: 0;<br />
display: block;<br />
clear: both;<br />
}<br />
<br />
/*<br />
* common css, include "header","footer"...<br />
*/<br />
div.center {<br />
width: 1000px;<br />
margin: 0 auto;<br />
position: relative;<br />
}<br />
div.header {<br />
width: 1000px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/1/12/Header-bg.png") no-repeat;<br />
position: relative;<br />
z-index: 50;<br />
}<br />
div.nav {<br />
position: absolute;<br />
height: 80px;<br />
top: 185px;<br />
left: 245px;<br />
}<br />
li.nav-outerLi {<br />
display: block;<br />
float: left;<br />
width: 80px;<br />
height: 80px;<br />
margin: 0 6px;<br />
cursor: pointer;<br />
}<br />
h2.nav-h21,h2.nav-h22,h2.nav-h23,h2.nav-h24,h2.nav-h25,h2.nav-h26 {<br />
display: block;<br />
background: url("https://static.igem.org/mediawiki/2012/9/91/Nav-tabs.png") no-repeat;<br />
width: 80px;<br />
height: 80px;<br />
background-position: 0 0;<br />
z-index: 150;<br />
position: relative;<br />
}<br />
h2.nav-h22 {<br />
background-position: -80px 0;<br />
}<br />
h2.nav-h23 {<br />
background-position: -160px 0;<br />
}<br />
h2.nav-h24 {<br />
background-position: -240px 0;<br />
}<br />
h2.nav-h25 {<br />
background-position: -320px 0;<br />
}<br />
h2.nav-h26 {<br />
background-position: -400px 0;<br />
}<br />
h2.nav-h21:hover {<br />
background-position: 0 -80px;<br />
}<br />
h2.nav-h22:hover {<br />
background-position: -80px -80px;<br />
}<br />
h2.nav-h23:hover {<br />
background-position: -160px -80px;<br />
}<br />
h2.nav-h24:hover {<br />
background-position: -240px -80px;<br />
}<br />
h2.nav-h25:hover {<br />
background-position: -320px -80px;<br />
}<br />
h2.nav-h26:hover {<br />
background-position: -400px -80px;<br />
}<br />
h2.nav-h21on {<br />
background-position: 0 -160px;<br />
}<br />
h2.nav-h22on {<br />
background-position: -80px -160px;<br />
}<br />
h2.nav-h23on {<br />
background-position: -160px -160px;<br />
}<br />
h2.nav-h24on {<br />
background-position: -240px -160px;<br />
}<br />
h2.nav-h25on {<br />
background-position: -320px -160px;<br />
}<br />
h2.nav-h26on {<br />
background-position: -400px -160px;<br />
}<br />
ul.nav-innerUl{<br />
position: absolute;<br />
top: 40px;<br />
padding-top: 40px;<br />
width: 76px;<br />
border-left: 2px solid #000;<br />
border-right: 2px solid #000;<br />
z-index: 140;<br />
display: none;<br />
}<br />
em.nav-libg{<br />
display: block;<br />
width: 96px;<br />
height: 11px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/48/Nav-libg.png');<br />
margin-left: -10px;<br />
}<br />
ul.nav-innerUl1{<br />
background: #fffaca;<br />
}<br />
ul.nav-innerUl2{<br />
background: #dedede;<br />
}<br />
ul.nav-innerUl3{<br />
background: #d9f0c9;<br />
}<br />
ul.nav-innerUl4{<br />
background: #f6e5ff;<br />
}<br />
ul.nav-innerUl5{<br />
background: #ebfcff;<br />
}<br />
ul.nav-innerUl6{<br />
background: #ffeee8;<br />
}<br />
li.nav-innerLi{<br />
font-size: 10px;<br />
line-height: 14px;<br />
padding: 3px 5px;<br />
}<br />
li.nav-innerLi:hover{<br />
background: #fff;<br />
}<br />
div.middle {<br />
width: 940px;<br />
background: #e6deb8;<br />
background: rgba(230,222,184,0.5);<br />
position: absolute;<br />
top: 300px;<br />
left: 30px;<br />
}<br />
div.aside {<br />
width: 160px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/b/b3/Aside-bg.png") no-repeat;<br />
margin-left: 20px;<br />
margin-top: 100px;<br />
float: left;<br />
padding: 20px;<br />
}<br />
ul.aside-outerUl {<br />
margin: 15px;<br />
}<br />
li.aside-outerLi {<br />
margin: 15px 0;<br />
background: #fff1a9;<br />
padding: 5px 10px;<br />
color: #725718;<br />
font-size: 16px;<br />
line-height: 24px;<br />
font-weight: bold;<br />
text-align: center;<br />
cursor: pointer;<br />
}<br />
li.aside-outerLi:hover {<br />
background: #fff8d3;<br />
}<br />
div.main {<br />
width: 640px;<br />
height: 400px;<br />
border: 5px solid #333;<br />
background: #fff;<br />
float: right;<br />
margin: 100px 30px 30px 0;<br />
}<br />
div.footer {<br />
}<br />
<br />
/*<br />
* picSlider Css<br />
*/<br />
#picSlider {<br />
width: 640px;<br />
height: 320px;<br />
}<br />
.momo {<br />
background: #000;<br />
}<br />
.momo .pic li {<br />
width: 100%;<br />
height: 100%;<br />
overflow: hidden;<br />
position: absolute;<br />
display: none;<br />
}<br />
.momo .txt li {<br />
position: absolute;<br />
padding: 5px 10px;<br />
z-index: 2;<br />
bottom: 0;<br />
height: 28px;<br />
background: #DBDBDB;<br />
display: none;<br />
}<br />
.momo .txt li a {<br />
display: block;<br />
position: relative;<br />
z-index: 1;<br />
color: #333;<br />
font-size: 12px;<br />
font-weight: bold;<br />
text-decoration: none;<br />
}<br />
.momo .num {<br />
position: absolute;<br />
z-index: 3;<br />
bottom: 5px;<br />
right: 5px;<br />
}<br />
.momo .num li {<br />
float: left;<br />
}<br />
.momo .num li a {<br />
color: #333;<br />
float: left;<br />
margin-left: 3px;<br />
width: 15px;<br />
height: 15px;<br />
line-height: 15px;<br />
*line-height: 14px;<br />
overflow: hidden;<br />
border: 1px solid #AEC1CC;<br />
text-align: center;<br />
cursor: pointer;<br />
background: #fff;<br />
text-decoration: none;<br />
}<br />
.momo .num li.current a, .momo .num li.hover a {<br />
color: #fff;<br />
background: #f60;<br />
-webkit-transition: all 0.4s;<br />
-moz-transition: all 0.4s;<br />
-o-transition: all 0.4s;<br />
}<br />
.momo_picSlider .txt li{<br />
width: 620px;<br />
}<br />
.momo_picSlider .txt li a{<br />
font-size: 16px;<br />
line-height: 24px;<br />
}<br />
#p-logo {<br />
display:none;<br />
}<br />
#top-section {<br />
height:0;<br />
border:none;<br />
}<br />
#search-controls {<br />
display:none;<br />
}<br />
#content {<br />
position:inherit;<br />
width:inherit;<br />
margin:0;<br />
padding:0;<br />
background:inherit;<br />
color:inherit;<br />
border:none;<br />
line-height:inherit;<br />
z-index:2;<br />
}<br />
.firstHeading {<br />
display:none;<br />
}<br />
#catlinks {<br />
display:none;<br />
}<br />
#footer-box {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#menubar ul li a {<br />
background:none;<br />
}<br />
#bodyContent h1,#bodyContent h2 {<br />
margin:0;<br />
border:0;<br />
padding: 0;<br />
}<br />
.left-menu:hover {<br />
background:none;<br />
}<br />
</style><br />
<div class="center"><br />
<div class="header"><br />
<div class="nav"><br />
<ul class="nav-outerUl"><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China"><h2 class="nav-h21 nav-h21on" title="Home"></h2></a><br />
<ul class="nav-innerUl nav-innerUl1" name="Home"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Team"><h2 class="nav-h22" title="Team"></h2></a><br />
<ul class="nav-innerUl nav-innerUl2" name="Team"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Project"><h2 class="nav-h23" title="Project"></h2></a><br />
<ul class="nav-innerUl nav-innerUl3" name="Project"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Modeling"><h2 class="nav-h24" title="Modeling"></h2></a><br />
<ul class="nav-innerUl nav-innerUl4" name="Modeling"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Notebooks"><h2 class="nav-h25" title="Notebooks"></h2></a><br />
<ul class="nav-innerUl nav-innerUl5" name="Notebooks"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/humanPractice"><h2 class="nav-h26" title="Human Practice"></h2></a><br />
<ul class="nav-innerUl nav-innerUl6" name="HumanPractice"></ul><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div class="middle"><br />
<div class="aside"><br />
<ul class="aside-outerUl"></ul><br />
</div><br />
<div class="main"></div><br />
<div class="clear"></div><br />
</div><br />
<div class="footer"></div><br />
</div><br />
<script src="http://www.yichengliu.com/code/igem/home.js"></script><br />
</body><br />
</html></div>Nanhaihttp://2012.igem.org/Team:WHU-ChinaTeam:WHU-China2012-10-27T00:21:53Z<p>Nanhai: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<body><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script><br />
function picObj(src, title, detail, href){<br />
this.src = src;<br />
this.title = title;<br />
this.detail = detail;<br />
this.href = href;<br />
}<br />
//*************************自定义数据部分*************************<br />
<br />
//定义菜单及侧边栏数据<br />
var menuObj = {<br />
Home : [<br />
{<br />
title : "<strong>What's new</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/e/e3/What%27s_new_first.png","Three advantages of the E.coslim", "Compared with traditional methods of losing weight, our E.coslim has three advantages: monitoring, high efficiency and long term efficiency.", "https://2012.igem.org/Team:WHU-China/Project?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/f/ff/Promoter_design.png", "Monitoring", "By designing two novel promoters, Pcar and PfadR, our E.coslim is able to sense the high calorie molecules and respond to them.", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#Pcar"),<br />
new picObj("http://partsregistry.org/wiki/images/f/ff/%E5%85%A8%E6%99%AF%E5%8A%A0%E6%AD%BB%E4%BA%A11.png", "Panorama of the Whole Project Scheme", "Four novel devices, Fatty Acid Degradation, Cellulose Synthesis, Colonization and Death to ensure high efficiency orchestrate calorie absorption and bacteria survival and make you slim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=3"),<br />
new picObj("https://static.igem.org/mediawiki/2012/0/09/%E8%83%96%E5%AD%90%E7%98%A6%E5%AD%90.png", "Long term efficiency of the E.coslim", "When viewed at macroscopic way, the E.coslim may have an advantage of long term efficiency,by regulating the human gut microbiota.And we have certified this by mathematical model.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=2")<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>Pathway Introduction</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/igem.org/8/82/Pathway_FattyAcid.png", "Fatty Acid Degradation", "Feel free to eat meat since the fat is all degraded by our E.coslim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=3"),<br />
new picObj("https://static.igem.org/mediawiki/igem.org/1/18/Pathway_Cellulose.png", "Cellulose Synthesis", "Transforming glucose into cellulose, the high-sugar food you eat will be turned into vegetables!", "https://2012.igem.org/Team:WHU-China/Project?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/e/ea/Device_three.png", "Colonization", "The magic molecule c-di-GMP enables E.coslim colonizing in the gut to better fulfill its magic function!", "https://2012.igem.org/Team:WHU-China/Project?catalog=5")<br />
]<br />
},<br />
<br />
{<br />
title : "<strong>Future Perspective</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/ab/%E5%8F%8C%E8%83%B6%E5%9B%8A2.jpg", "Two Capsule Design", "Capsule I, the E.coslim, makes you slim, while Capsule II, xylose, terminates the effects of the former.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/d/d2/Fpbody2.jpg", "In vitro experiment in a simulated intestine", "The gut microbiota and E.coslim will be inoculated in a simulated intestine, then the concentration measurement of each component will tell us whether E.coslim works as desired.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/8/85/%E5%B0%8F%E9%BC%A0%E5%AE%9E%E9%AA%8C02.jpg", "In vivo experiment in mice", "E.coslim will also be inoculated into mice and the culture-independent microbiome analysis will tell us the real situation in vivo.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0")<br />
]<br />
},<br />
<br />
<br />
<br />
{<br />
title : "<strong>Achievement</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/d/d1/Achievements_device_xia.png", "Devices", "This year, our project has focused on some of the hotspot issues, such as c-di-CMP, gut microbiota. In all we submitted 66 new biobricks and 39 of them have been proved to be effective.", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/c/ca/Achievements_1.png", "Biobicks we have improved", "In our project, we have improved the function of some biobricks,such as BBa_J54222, BBa_K188011 and BBa_R0051. ", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/f/f5/Achievements_2.png", "Novel promoter we designed", "As the existing promoter can not meet our demand, we designed two novel promoters Pcar and Pfad to achieve the goal. In addition, we also have set up a standard for promoter design.", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/2/27/Methods_we_improve.png", "Methods we improved", "In our project,we improved some traditional methods to measure the comsumption of fatty acids and production of cellulose, and also we developed a software named FANCY to detect the fluorescence intensity of single cell. ", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/7/79/Human_practice_xia.png", "Human Practice", "We have helped HUST iGEM team debug their project and mathematical model. We also did a survey on GMOs and publicized iGEM to the public.", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>About Us</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/a7/Whu-2012-1.jpg", "WHU-China 2012, I was there", "The Entrance of State Wuhan University", "https://2012.igem.org/Team:WHU-China/Team?catalog=1"),<br />
new picObj("https://static.igem.org/mediawiki/2012/2/23/Whu2012heying.jpg", "MIT, we're coming!", "Collge of Life Sciences of WHU", "https://2012.igem.org/Team:WHU-China/Team?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/4/43/Whu2012-2.jpg", "WHU-China, Hooray!", "Yuntai Mountain, Henan Province", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=5")<br />
]<br />
}<br />
],<br />
Team : [<br />
{<br />
title : '<strong>Members</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Instructors</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Team History</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About WHU</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About Our Lab</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Acknow-</br>ledgements</strong>',<br />
dir : []<br />
},<br />
<br />
],<br />
Project : [<br />
{<br />
title : '<strong>Description</strong>',<br />
dir : [<br />
<br />
]<br />
},<br />
{<br />
title : '<strong>Background</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Promoter Design</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device I: Fatty Acid Degradation</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device II: Cellulose Synthesis</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device III: Colonization</strong>',<br />
dir : []<br />
},<br />
],<br />
Modeling : [<br />
{<br />
title : '<strong>Future Perspectives</strong>',<br />
dir : []<br />
},<br />
<br />
{<br />
title : '<strong>Model I: Fatty Acid Degradation</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Model II: Microbiota Regulation</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Software Tool: FANCY</strong>',<br />
dir : []<br />
}<br />
],<br />
Notebooks : [<br />
{<br />
title : '<strong>Parts</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Safety</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Protocols</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Events</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Brain-</br>storming</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Gallery</strong>',<br />
dir : []<br />
}<br />
],<br />
HumanPractice : [<br />
{<br />
title : '<strong>Outline</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Questionaire Survey</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Publicity</strong>',<br />
dir : []<br />
}<br />
]<br />
}; <br />
//*************************自定义数据部分*************************<br />
</script><br />
<style type="text/css"><br />
/*<br />
* base css, DO NOT MODIFY!<br />
*/<br />
* {<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
font-family: "Verdana", sans-serif;<br />
color: #333;<br />
list-style: none;<br />
outline: none;<br />
resize: none;<br />
}<br />
html {<br />
overflow-y: scroll;<br />
}<br />
body {<br />
background: url("https://static.igem.org/mediawiki/2012/2/22/Body-bg.jpg") center center fixed;<br />
}<br />
a {<br />
text-decoration: none;<br />
}<br />
.clear {<br />
width: 0;<br />
height: 0;<br />
line-height: 0;<br />
display: block;<br />
clear: both;<br />
}<br />
<br />
/*<br />
* common css, include "header","footer"...<br />
*/<br />
div.center {<br />
width: 1000px;<br />
margin: 0 auto;<br />
position: relative;<br />
}<br />
div.header {<br />
width: 1000px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/1/12/Header-bg.png") no-repeat;<br />
position: relative;<br />
z-index: 50;<br />
}<br />
div.nav {<br />
position: absolute;<br />
height: 80px;<br />
top: 185px;<br />
left: 245px;<br />
}<br />
li.nav-outerLi {<br />
display: block;<br />
float: left;<br />
width: 80px;<br />
height: 80px;<br />
margin: 0 6px;<br />
cursor: pointer;<br />
}<br />
h2.nav-h21,h2.nav-h22,h2.nav-h23,h2.nav-h24,h2.nav-h25,h2.nav-h26 {<br />
display: block;<br />
background: url("https://static.igem.org/mediawiki/2012/9/91/Nav-tabs.png") no-repeat;<br />
width: 80px;<br />
height: 80px;<br />
background-position: 0 0;<br />
z-index: 150;<br />
position: relative;<br />
}<br />
h2.nav-h22 {<br />
background-position: -80px 0;<br />
}<br />
h2.nav-h23 {<br />
background-position: -160px 0;<br />
}<br />
h2.nav-h24 {<br />
background-position: -240px 0;<br />
}<br />
h2.nav-h25 {<br />
background-position: -320px 0;<br />
}<br />
h2.nav-h26 {<br />
background-position: -400px 0;<br />
}<br />
h2.nav-h21:hover {<br />
background-position: 0 -80px;<br />
}<br />
h2.nav-h22:hover {<br />
background-position: -80px -80px;<br />
}<br />
h2.nav-h23:hover {<br />
background-position: -160px -80px;<br />
}<br />
h2.nav-h24:hover {<br />
background-position: -240px -80px;<br />
}<br />
h2.nav-h25:hover {<br />
background-position: -320px -80px;<br />
}<br />
h2.nav-h26:hover {<br />
background-position: -400px -80px;<br />
}<br />
h2.nav-h21on {<br />
background-position: 0 -160px;<br />
}<br />
h2.nav-h22on {<br />
background-position: -80px -160px;<br />
}<br />
h2.nav-h23on {<br />
background-position: -160px -160px;<br />
}<br />
h2.nav-h24on {<br />
background-position: -240px -160px;<br />
}<br />
h2.nav-h25on {<br />
background-position: -320px -160px;<br />
}<br />
h2.nav-h26on {<br />
background-position: -400px -160px;<br />
}<br />
ul.nav-innerUl{<br />
position: absolute;<br />
top: 40px;<br />
padding-top: 40px;<br />
width: 76px;<br />
border-left: 2px solid #000;<br />
border-right: 2px solid #000;<br />
z-index: 140;<br />
display: none;<br />
}<br />
em.nav-libg{<br />
display: block;<br />
width: 96px;<br />
height: 11px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/48/Nav-libg.png');<br />
margin-left: -10px;<br />
}<br />
ul.nav-innerUl1{<br />
background: #fffaca;<br />
}<br />
ul.nav-innerUl2{<br />
background: #dedede;<br />
}<br />
ul.nav-innerUl3{<br />
background: #d9f0c9;<br />
}<br />
ul.nav-innerUl4{<br />
background: #f6e5ff;<br />
}<br />
ul.nav-innerUl5{<br />
background: #ebfcff;<br />
}<br />
ul.nav-innerUl6{<br />
background: #ffeee8;<br />
}<br />
li.nav-innerLi{<br />
font-size: 10px;<br />
line-height: 14px;<br />
padding: 3px 5px;<br />
}<br />
li.nav-innerLi:hover{<br />
background: #fff;<br />
}<br />
div.middle {<br />
width: 940px;<br />
background: #e6deb8;<br />
background: rgba(230,222,184,0.5);<br />
position: absolute;<br />
top: 300px;<br />
left: 30px;<br />
}<br />
div.aside {<br />
width: 160px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/b/b3/Aside-bg.png") no-repeat;<br />
margin-left: 20px;<br />
margin-top: 100px;<br />
float: left;<br />
padding: 20px;<br />
}<br />
ul.aside-outerUl {<br />
margin: 15px;<br />
}<br />
li.aside-outerLi {<br />
margin: 15px 0;<br />
background: #fff1a9;<br />
padding: 5px 10px;<br />
color: #725718;<br />
font-size: 16px;<br />
line-height: 24px;<br />
font-weight: bold;<br />
text-align: center;<br />
cursor: pointer;<br />
}<br />
li.aside-outerLi:hover {<br />
background: #fff8d3;<br />
}<br />
div.main {<br />
width: 640px;<br />
height: 400px;<br />
border: 5px solid #333;<br />
background: #fff;<br />
float: right;<br />
margin: 100px 30px 30px 0;<br />
}<br />
div.footer {<br />
}<br />
<br />
/*<br />
* picSlider Css<br />
*/<br />
#picSlider {<br />
width: 640px;<br />
height: 320px;<br />
}<br />
.momo {<br />
background: #000;<br />
}<br />
.momo .pic li {<br />
width: 100%;<br />
height: 100%;<br />
overflow: hidden;<br />
position: absolute;<br />
display: none;<br />
}<br />
.momo .txt li {<br />
position: absolute;<br />
padding: 5px 10px;<br />
z-index: 2;<br />
bottom: 0;<br />
height: 28px;<br />
background: #DBDBDB;<br />
display: none;<br />
}<br />
.momo .txt li a {<br />
display: block;<br />
position: relative;<br />
z-index: 1;<br />
color: #333;<br />
font-size: 12px;<br />
font-weight: bold;<br />
text-decoration: none;<br />
}<br />
.momo .num {<br />
position: absolute;<br />
z-index: 3;<br />
bottom: 5px;<br />
right: 5px;<br />
}<br />
.momo .num li {<br />
float: left;<br />
}<br />
.momo .num li a {<br />
color: #333;<br />
float: left;<br />
margin-left: 3px;<br />
width: 15px;<br />
height: 15px;<br />
line-height: 15px;<br />
*line-height: 14px;<br />
overflow: hidden;<br />
border: 1px solid #AEC1CC;<br />
text-align: center;<br />
cursor: pointer;<br />
background: #fff;<br />
text-decoration: none;<br />
}<br />
.momo .num li.current a, .momo .num li.hover a {<br />
color: #fff;<br />
background: #f60;<br />
-webkit-transition: all 0.4s;<br />
-moz-transition: all 0.4s;<br />
-o-transition: all 0.4s;<br />
}<br />
.momo_picSlider .txt li{<br />
width: 620px;<br />
}<br />
.momo_picSlider .txt li a{<br />
font-size: 16px;<br />
line-height: 24px;<br />
}<br />
#p-logo {<br />
display:none;<br />
}<br />
#top-section {<br />
height:0;<br />
border:none;<br />
}<br />
#search-controls {<br />
display:none;<br />
}<br />
#content {<br />
position:inherit;<br />
width:inherit;<br />
margin:0;<br />
padding:0;<br />
background:inherit;<br />
color:inherit;<br />
border:none;<br />
line-height:inherit;<br />
z-index:2;<br />
}<br />
.firstHeading {<br />
display:none;<br />
}<br />
#catlinks {<br />
display:none;<br />
}<br />
#footer-box {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#menubar ul li a {<br />
background:none;<br />
}<br />
#bodyContent h1,#bodyContent h2 {<br />
margin:0;<br />
border:0;<br />
padding: 0;<br />
}<br />
.left-menu:hover {<br />
background:none;<br />
}<br />
</style><br />
<div class="center"><br />
<div class="header"><br />
<div class="nav"><br />
<ul class="nav-outerUl"><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China"><h2 class="nav-h21 nav-h21on" title="Home"></h2></a><br />
<ul class="nav-innerUl nav-innerUl1" name="Home"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Team"><h2 class="nav-h22" title="Team"></h2></a><br />
<ul class="nav-innerUl nav-innerUl2" name="Team"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Project"><h2 class="nav-h23" title="Project"></h2></a><br />
<ul class="nav-innerUl nav-innerUl3" name="Project"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Modeling"><h2 class="nav-h24" title="Modeling"></h2></a><br />
<ul class="nav-innerUl nav-innerUl4" name="Modeling"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Notebooks"><h2 class="nav-h25" title="Notebooks"></h2></a><br />
<ul class="nav-innerUl nav-innerUl5" name="Notebooks"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/humanPractice"><h2 class="nav-h26" title="Human Practice"></h2></a><br />
<ul class="nav-innerUl nav-innerUl6" name="HumanPractice"></ul><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div class="middle"><br />
<div class="aside"><br />
<ul class="aside-outerUl"></ul><br />
</div><br />
<div class="main"></div><br />
<div class="clear"></div><br />
</div><br />
<div class="footer"></div><br />
</div><br />
<script src="http://www.yichengliu.com/code/igem/home.js"></script><br />
</body><br />
</html></div>Nanhaihttp://2012.igem.org/Team:WHU-ChinaTeam:WHU-China2012-10-27T00:05:09Z<p>Nanhai: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<body><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script><br />
function picObj(src, title, detail, href){<br />
this.src = src;<br />
this.title = title;<br />
this.detail = detail;<br />
this.href = href;<br />
}<br />
//*************************自定义数据部分*************************<br />
<br />
//定义菜单及侧边栏数据<br />
var menuObj = {<br />
Home : [<br />
{<br />
title : "<strong>What's new</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/e/e3/What%27s_new_first.png","Three advantages of the E.coslim", "Compared to traditional methods of losing weight, our E.coslim has three advantages: monitoring, high efficiency and long term efficiency.", "https://2012.igem.org/Team:WHU-China/Project?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/f/ff/Promoter_design.png", "Monitoring", "By designing two novel promoters, Pcar and PfadR, our E.coslim is able to sense the high calorie molecules and respond to them.", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#Pcar"),<br />
new picObj("http://partsregistry.org/wiki/images/f/ff/%E5%85%A8%E6%99%AF%E5%8A%A0%E6%AD%BB%E4%BA%A11.png", "Panorama of the Whole Project Scheme", "Four novel devices, Fatty Acid Degradation, Cellulose Synthesis, Colonization and Death to ensure high efficiency orchestrate calorie absorption and bacteria survival and make you slim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=3"),<br />
new picObj("https://static.igem.org/mediawiki/2012/0/09/%E8%83%96%E5%AD%90%E7%98%A6%E5%AD%90.png", "Long term efficiency of the E.coslim", "When viewed at macroscopic way, the E.coslim may have an advantage of long term efficiency,by regulating the human gut microbiota.And we have certified this by mathematical model.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=2")<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>Pathway Introduction</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/igem.org/8/82/Pathway_FattyAcid.png", "Fatty Acid Degradation", "Feel free to eat meat since the fat is all degraded by our E.coslim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=3"),<br />
new picObj("https://static.igem.org/mediawiki/igem.org/1/18/Pathway_Cellulose.png", "Cellulose Synthesis", "Transforming glucose into cellulose, the high-sugar food you eat will be turned into vegetables!", "https://2012.igem.org/Team:WHU-China/Project?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/e/ea/Device_three.png", "Colonization", "The magic molecule c-di-GMP enables E.coslim colonizing in the gut to better fulfill its magic function!", "https://2012.igem.org/Team:WHU-China/Project?catalog=5")<br />
]<br />
},<br />
<br />
{<br />
title : "<strong>Future Perspective</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/ab/%E5%8F%8C%E8%83%B6%E5%9B%8A2.jpg", "Two Capsule Design", "Capsule I, the E.coslim, makes you slim, while Capsule II, xylose, terminates the effects of the former.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/d/d2/Fpbody2.jpg", "In vitro experiment in a simulated intestine", "The gut microbiota and E.coslim will be inoculated in a simulated intestine, then the concentration measurement of each component will tell us whether E.coslim works as desired.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/8/85/%E5%B0%8F%E9%BC%A0%E5%AE%9E%E9%AA%8C02.jpg", "In vivo experiment in mice", "E.coslim will also be inoculated into mice and the culture-independent microbiome analysis will tell us the real situation in vivo.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0")<br />
]<br />
},<br />
<br />
<br />
<br />
{<br />
title : "<strong>Achievement</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/d/d1/Achievements_device_xia.png", "Devices", "This year, our project has focused on some of the hotspot issues, such as c-di-CMP, gut microbiota. In all we submitted 66 new biobricks and 39 of them have been proved to be effective.", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/c/ca/Achievements_1.png", "Biobicks we have improved", "In our project, we have improved the function of some biobricks,such as BBa_J54222, BBa_K188011 and BBa_R0051. ", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/f/f5/Achievements_2.png", "Novel promoter we designed", "As the existing promoter can not meet our demand, we designed two novel promoters Pcar and Pfad to achieve the goal. In addition, we also have set up a standard for promoter design.", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/2/27/Methods_we_improve.png", "Methods we improved", "In our project,we improved some traditional methods to measure the comsumption of fatty acids and production of cellulose, and also we developed a software named FANCY to detect the fluorescence intensity of single cell. ", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/7/79/Human_practice_xia.png", "Human Practice", "We have helped HUST iGEM team debug their project and mathematical model. We also did a survey on GMOs and publicized iGEM to the public.", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>About Us</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/a7/Whu-2012-1.jpg", "WHU-China 2012, I was there", "The Entrance of State Wuhan University", "https://2012.igem.org/Team:WHU-China/Team?catalog=1"),<br />
new picObj("https://static.igem.org/mediawiki/2012/2/23/Whu2012heying.jpg", "MIT, we're coming!", "Collge of Life Sciences of WHU", "https://2012.igem.org/Team:WHU-China/Team?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/4/43/Whu2012-2.jpg", "WHU-China, Hooray!", "Yuntai Mountain, Henan Province", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=5")<br />
]<br />
}<br />
],<br />
Team : [<br />
{<br />
title : '<strong>Members</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Instructors</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Team History</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About WHU</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About Our Lab</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Acknow-</br>ledgements</strong>',<br />
dir : []<br />
},<br />
<br />
],<br />
Project : [<br />
{<br />
title : '<strong>Description</strong>',<br />
dir : [<br />
<br />
]<br />
},<br />
{<br />
title : '<strong>Background</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Promoter Design</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device I: Fatty Acid Degradation</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device II: Cellulose Synthesis</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device III: Colonization</strong>',<br />
dir : []<br />
},<br />
],<br />
Modeling : [<br />
{<br />
title : '<strong>Future Perspectives</strong>',<br />
dir : []<br />
},<br />
<br />
{<br />
title : '<strong>Model I: Fatty Acid Degradation</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Model II: Microbiota Regulation</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Software Tool: FANCY</strong>',<br />
dir : []<br />
}<br />
],<br />
Notebooks : [<br />
{<br />
title : '<strong>Parts</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Safety</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Protocols</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Events</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Brain-</br>storming</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Gallery</strong>',<br />
dir : []<br />
}<br />
],<br />
HumanPractice : [<br />
{<br />
title : '<strong>Outline</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Questionaire Survey</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Publicity</strong>',<br />
dir : []<br />
}<br />
]<br />
}; <br />
//*************************自定义数据部分*************************<br />
</script><br />
<style type="text/css"><br />
/*<br />
* base css, DO NOT MODIFY!<br />
*/<br />
* {<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
font-family: "Verdana", sans-serif;<br />
color: #333;<br />
list-style: none;<br />
outline: none;<br />
resize: none;<br />
}<br />
html {<br />
overflow-y: scroll;<br />
}<br />
body {<br />
background: url("https://static.igem.org/mediawiki/2012/2/22/Body-bg.jpg") center center fixed;<br />
}<br />
a {<br />
text-decoration: none;<br />
}<br />
.clear {<br />
width: 0;<br />
height: 0;<br />
line-height: 0;<br />
display: block;<br />
clear: both;<br />
}<br />
<br />
/*<br />
* common css, include "header","footer"...<br />
*/<br />
div.center {<br />
width: 1000px;<br />
margin: 0 auto;<br />
position: relative;<br />
}<br />
div.header {<br />
width: 1000px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/1/12/Header-bg.png") no-repeat;<br />
position: relative;<br />
z-index: 50;<br />
}<br />
div.nav {<br />
position: absolute;<br />
height: 80px;<br />
top: 185px;<br />
left: 245px;<br />
}<br />
li.nav-outerLi {<br />
display: block;<br />
float: left;<br />
width: 80px;<br />
height: 80px;<br />
margin: 0 6px;<br />
cursor: pointer;<br />
}<br />
h2.nav-h21,h2.nav-h22,h2.nav-h23,h2.nav-h24,h2.nav-h25,h2.nav-h26 {<br />
display: block;<br />
background: url("https://static.igem.org/mediawiki/2012/9/91/Nav-tabs.png") no-repeat;<br />
width: 80px;<br />
height: 80px;<br />
background-position: 0 0;<br />
z-index: 150;<br />
position: relative;<br />
}<br />
h2.nav-h22 {<br />
background-position: -80px 0;<br />
}<br />
h2.nav-h23 {<br />
background-position: -160px 0;<br />
}<br />
h2.nav-h24 {<br />
background-position: -240px 0;<br />
}<br />
h2.nav-h25 {<br />
background-position: -320px 0;<br />
}<br />
h2.nav-h26 {<br />
background-position: -400px 0;<br />
}<br />
h2.nav-h21:hover {<br />
background-position: 0 -80px;<br />
}<br />
h2.nav-h22:hover {<br />
background-position: -80px -80px;<br />
}<br />
h2.nav-h23:hover {<br />
background-position: -160px -80px;<br />
}<br />
h2.nav-h24:hover {<br />
background-position: -240px -80px;<br />
}<br />
h2.nav-h25:hover {<br />
background-position: -320px -80px;<br />
}<br />
h2.nav-h26:hover {<br />
background-position: -400px -80px;<br />
}<br />
h2.nav-h21on {<br />
background-position: 0 -160px;<br />
}<br />
h2.nav-h22on {<br />
background-position: -80px -160px;<br />
}<br />
h2.nav-h23on {<br />
background-position: -160px -160px;<br />
}<br />
h2.nav-h24on {<br />
background-position: -240px -160px;<br />
}<br />
h2.nav-h25on {<br />
background-position: -320px -160px;<br />
}<br />
h2.nav-h26on {<br />
background-position: -400px -160px;<br />
}<br />
ul.nav-innerUl{<br />
position: absolute;<br />
top: 40px;<br />
padding-top: 40px;<br />
width: 76px;<br />
border-left: 2px solid #000;<br />
border-right: 2px solid #000;<br />
z-index: 140;<br />
display: none;<br />
}<br />
em.nav-libg{<br />
display: block;<br />
width: 96px;<br />
height: 11px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/48/Nav-libg.png');<br />
margin-left: -10px;<br />
}<br />
ul.nav-innerUl1{<br />
background: #fffaca;<br />
}<br />
ul.nav-innerUl2{<br />
background: #dedede;<br />
}<br />
ul.nav-innerUl3{<br />
background: #d9f0c9;<br />
}<br />
ul.nav-innerUl4{<br />
background: #f6e5ff;<br />
}<br />
ul.nav-innerUl5{<br />
background: #ebfcff;<br />
}<br />
ul.nav-innerUl6{<br />
background: #ffeee8;<br />
}<br />
li.nav-innerLi{<br />
font-size: 10px;<br />
line-height: 14px;<br />
padding: 3px 5px;<br />
}<br />
li.nav-innerLi:hover{<br />
background: #fff;<br />
}<br />
div.middle {<br />
width: 940px;<br />
background: #e6deb8;<br />
background: rgba(230,222,184,0.5);<br />
position: absolute;<br />
top: 300px;<br />
left: 30px;<br />
}<br />
div.aside {<br />
width: 160px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/b/b3/Aside-bg.png") no-repeat;<br />
margin-left: 20px;<br />
margin-top: 100px;<br />
float: left;<br />
padding: 20px;<br />
}<br />
ul.aside-outerUl {<br />
margin: 15px;<br />
}<br />
li.aside-outerLi {<br />
margin: 15px 0;<br />
background: #fff1a9;<br />
padding: 5px 10px;<br />
color: #725718;<br />
font-size: 16px;<br />
line-height: 24px;<br />
font-weight: bold;<br />
text-align: center;<br />
cursor: pointer;<br />
}<br />
li.aside-outerLi:hover {<br />
background: #fff8d3;<br />
}<br />
div.main {<br />
width: 640px;<br />
height: 400px;<br />
border: 5px solid #333;<br />
background: #fff;<br />
float: right;<br />
margin: 100px 30px 30px 0;<br />
}<br />
div.footer {<br />
}<br />
<br />
/*<br />
* picSlider Css<br />
*/<br />
#picSlider {<br />
width: 640px;<br />
height: 320px;<br />
}<br />
.momo {<br />
background: #000;<br />
}<br />
.momo .pic li {<br />
width: 100%;<br />
height: 100%;<br />
overflow: hidden;<br />
position: absolute;<br />
display: none;<br />
}<br />
.momo .txt li {<br />
position: absolute;<br />
padding: 5px 10px;<br />
z-index: 2;<br />
bottom: 0;<br />
height: 28px;<br />
background: #DBDBDB;<br />
display: none;<br />
}<br />
.momo .txt li a {<br />
display: block;<br />
position: relative;<br />
z-index: 1;<br />
color: #333;<br />
font-size: 12px;<br />
font-weight: bold;<br />
text-decoration: none;<br />
}<br />
.momo .num {<br />
position: absolute;<br />
z-index: 3;<br />
bottom: 5px;<br />
right: 5px;<br />
}<br />
.momo .num li {<br />
float: left;<br />
}<br />
.momo .num li a {<br />
color: #333;<br />
float: left;<br />
margin-left: 3px;<br />
width: 15px;<br />
height: 15px;<br />
line-height: 15px;<br />
*line-height: 14px;<br />
overflow: hidden;<br />
border: 1px solid #AEC1CC;<br />
text-align: center;<br />
cursor: pointer;<br />
background: #fff;<br />
text-decoration: none;<br />
}<br />
.momo .num li.current a, .momo .num li.hover a {<br />
color: #fff;<br />
background: #f60;<br />
-webkit-transition: all 0.4s;<br />
-moz-transition: all 0.4s;<br />
-o-transition: all 0.4s;<br />
}<br />
.momo_picSlider .txt li{<br />
width: 620px;<br />
}<br />
.momo_picSlider .txt li a{<br />
font-size: 16px;<br />
line-height: 24px;<br />
}<br />
#p-logo {<br />
display:none;<br />
}<br />
#top-section {<br />
height:0;<br />
border:none;<br />
}<br />
#search-controls {<br />
display:none;<br />
}<br />
#content {<br />
position:inherit;<br />
width:inherit;<br />
margin:0;<br />
padding:0;<br />
background:inherit;<br />
color:inherit;<br />
border:none;<br />
line-height:inherit;<br />
z-index:2;<br />
}<br />
.firstHeading {<br />
display:none;<br />
}<br />
#catlinks {<br />
display:none;<br />
}<br />
#footer-box {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#menubar ul li a {<br />
background:none;<br />
}<br />
#bodyContent h1,#bodyContent h2 {<br />
margin:0;<br />
border:0;<br />
padding: 0;<br />
}<br />
.left-menu:hover {<br />
background:none;<br />
}<br />
</style><br />
<div class="center"><br />
<div class="header"><br />
<div class="nav"><br />
<ul class="nav-outerUl"><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China"><h2 class="nav-h21 nav-h21on" title="Home"></h2></a><br />
<ul class="nav-innerUl nav-innerUl1" name="Home"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Team"><h2 class="nav-h22" title="Team"></h2></a><br />
<ul class="nav-innerUl nav-innerUl2" name="Team"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Project"><h2 class="nav-h23" title="Project"></h2></a><br />
<ul class="nav-innerUl nav-innerUl3" name="Project"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Modeling"><h2 class="nav-h24" title="Modeling"></h2></a><br />
<ul class="nav-innerUl nav-innerUl4" name="Modeling"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Notebooks"><h2 class="nav-h25" title="Notebooks"></h2></a><br />
<ul class="nav-innerUl nav-innerUl5" name="Notebooks"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/humanPractice"><h2 class="nav-h26" title="Human Practice"></h2></a><br />
<ul class="nav-innerUl nav-innerUl6" name="HumanPractice"></ul><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div class="middle"><br />
<div class="aside"><br />
<ul class="aside-outerUl"></ul><br />
</div><br />
<div class="main"></div><br />
<div class="clear"></div><br />
</div><br />
<div class="footer"></div><br />
</div><br />
<script src="http://www.yichengliu.com/code/igem/home.js"></script><br />
</body><br />
</html></div>Nanhaihttp://2012.igem.org/Team:WHU-ChinaTeam:WHU-China2012-10-27T00:03:08Z<p>Nanhai: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<body><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script><br />
function picObj(src, title, detail, href){<br />
this.src = src;<br />
this.title = title;<br />
this.detail = detail;<br />
this.href = href;<br />
}<br />
//*************************自定义数据部分*************************<br />
<br />
//定义菜单及侧边栏数据<br />
var menuObj = {<br />
Home : [<br />
{<br />
title : "<strong>What's new</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/e/e3/What%27s_new_first.png","Three advantages of the E.coslim", "Compared to traditional methods of losing weight, our E.coslim has three advantages: monitoring, high efficiency and long term efficiency.", "https://2012.igem.org/Team:WHU-China/Project?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/f/ff/Promoter_design.png", "Monitoring", "By designing two novel promoters, Pcar and PfadR, our E.coslim is able to sense the high calorie molecules and respond to them.", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#Pcar"),<br />
new picObj("http://partsregistry.org/wiki/images/f/ff/%E5%85%A8%E6%99%AF%E5%8A%A0%E6%AD%BB%E4%BA%A11.png", "Panorama of the Whole Project Scheme", "Four novel devices, Fatty Acid Degradation, Cellulose Synthesis, Colonization and Death to ensure high efficiency orchestrate calorie absorption and bacteria survival and make you slim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=3"),<br />
new picObj("https://static.igem.org/mediawiki/2012/0/09/%E8%83%96%E5%AD%90%E7%98%A6%E5%AD%90.png", "Long term efficiency of the E.coslim", "When viewed at macroscopic way, the E.coslim may have an advantage of long term efficiency,by regulating the human gut microbiota.And we have certified this by mathematical model.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=2")<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>Pathway Introduction</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/igem.org/8/82/Pathway_FattyAcid.png", "Fatty Acid Degradation", "Feel free to eat meat since the fat is all degraded by our E.coslim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=3"),<br />
new picObj("https://static.igem.org/mediawiki/igem.org/1/18/Pathway_Cellulose.png", "Cellulose Synthesis", "Transforming glucose into cellulose, the high-sugar food you eat will be turned into vegetables!", "https://2012.igem.org/Team:WHU-China/Project?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/e/ea/Device_three.png", "Colonization", "The magic molecule c-di-GMP enables E.coslim colonizing in the gut to better fulfill its magic function!", "https://2012.igem.org/Team:WHU-China/Project?catalog=5")<br />
]<br />
},<br />
<br />
{<br />
title : "<strong>Future Perspective</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/ab/%E5%8F%8C%E8%83%B6%E5%9B%8A2.jpg", "Two Capsule Design", "Capsule I, the E.coslim, makes you slim, while Capsule II, xylose, terminates the effects of the former.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/d/d2/Fpbody2.jpg", "In vitro experiment in a simulated intestine", "The gut microbiota and E.coslim will be inoculated in a simulated intestine, then the concentration measurement of each component will tell us whether E.coslim works as desired.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/8/85/%E5%B0%8F%E9%BC%A0%E5%AE%9E%E9%AA%8C02.jpg", "In vivo experiment in mice", "E.coslim will also be inoculated into mice and the culture-independent microbiome analysis will tell us the real situation in vivo.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0")<br />
]<br />
},<br />
<br />
<br />
<br />
{<br />
title : "<strong>Achievement</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/d/d1/Achievements_device_xia.png", "Devices", "This year,our project has focused on some of the hotspot issues,such as c-di-CMP ,gut microbiota. In all we submitted 66 new biobricks and 39 of them have been proved to be effective.", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/c/ca/Achievements_1.png", "Biobicks we have improved", "In our project, we have improved the function of some biobricks,such as BBa_J54222, BBa_K188011 and BBa_R0051. ", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/f/f5/Achievements_2.png", "Novel promoter we designed", "As the existing promoter can not meet our demand, we designed two novel promoters Pcar and Pfad to achieve the goal. In addition, we also have set up a standard for promoter design.", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/2/27/Methods_we_improve.png", "Methods we improved", "In our project,we improved some traditional methods to measure the comsumption of fatty acids and production of cellulose, and also we developed a software named FANCY to detect the fluorescence intensity of single cell. ", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/7/79/Human_practice_xia.png", "Human Practice", "We have helped HUST iGEM team debug their project and mathematical model. We also did a survey on GMOs and publicized iGEM to the public.", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>About Us</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/a7/Whu-2012-1.jpg", "WHU-China 2012, I was there", "The Entrance of State Wuhan University", "https://2012.igem.org/Team:WHU-China/Team?catalog=1"),<br />
new picObj("https://static.igem.org/mediawiki/2012/2/23/Whu2012heying.jpg", "MIT, we're coming!", "Collge of Life Sciences of WHU", "https://2012.igem.org/Team:WHU-China/Team?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/4/43/Whu2012-2.jpg", "WHU-China, Hooray!", "Yuntai Mountain, Henan Province", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=5")<br />
]<br />
}<br />
],<br />
Team : [<br />
{<br />
title : '<strong>Members</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Instructors</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Team History</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About WHU</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About Our Lab</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Acknow-</br>ledgements</strong>',<br />
dir : []<br />
},<br />
<br />
],<br />
Project : [<br />
{<br />
title : '<strong>Description</strong>',<br />
dir : [<br />
<br />
]<br />
},<br />
{<br />
title : '<strong>Background</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Promoter Design</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device I: Fatty Acid Degradation</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device II: Cellulose Synthesis</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device III: Colonization</strong>',<br />
dir : []<br />
},<br />
],<br />
Modeling : [<br />
{<br />
title : '<strong>Future Perspectives</strong>',<br />
dir : []<br />
},<br />
<br />
{<br />
title : '<strong>Model I: Fatty Acid Degradation</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Model II: Microbiota Regulation</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Software Tool: FANCY</strong>',<br />
dir : []<br />
}<br />
],<br />
Notebooks : [<br />
{<br />
title : '<strong>Parts</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Safety</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Protocols</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Events</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Brain-</br>storming</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Gallery</strong>',<br />
dir : []<br />
}<br />
],<br />
HumanPractice : [<br />
{<br />
title : '<strong>Outline</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Questionaire Survey</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Publicity</strong>',<br />
dir : []<br />
}<br />
]<br />
}; <br />
//*************************自定义数据部分*************************<br />
</script><br />
<style type="text/css"><br />
/*<br />
* base css, DO NOT MODIFY!<br />
*/<br />
* {<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
font-family: "Verdana", sans-serif;<br />
color: #333;<br />
list-style: none;<br />
outline: none;<br />
resize: none;<br />
}<br />
html {<br />
overflow-y: scroll;<br />
}<br />
body {<br />
background: url("https://static.igem.org/mediawiki/2012/2/22/Body-bg.jpg") center center fixed;<br />
}<br />
a {<br />
text-decoration: none;<br />
}<br />
.clear {<br />
width: 0;<br />
height: 0;<br />
line-height: 0;<br />
display: block;<br />
clear: both;<br />
}<br />
<br />
/*<br />
* common css, include "header","footer"...<br />
*/<br />
div.center {<br />
width: 1000px;<br />
margin: 0 auto;<br />
position: relative;<br />
}<br />
div.header {<br />
width: 1000px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/1/12/Header-bg.png") no-repeat;<br />
position: relative;<br />
z-index: 50;<br />
}<br />
div.nav {<br />
position: absolute;<br />
height: 80px;<br />
top: 185px;<br />
left: 245px;<br />
}<br />
li.nav-outerLi {<br />
display: block;<br />
float: left;<br />
width: 80px;<br />
height: 80px;<br />
margin: 0 6px;<br />
cursor: pointer;<br />
}<br />
h2.nav-h21,h2.nav-h22,h2.nav-h23,h2.nav-h24,h2.nav-h25,h2.nav-h26 {<br />
display: block;<br />
background: url("https://static.igem.org/mediawiki/2012/9/91/Nav-tabs.png") no-repeat;<br />
width: 80px;<br />
height: 80px;<br />
background-position: 0 0;<br />
z-index: 150;<br />
position: relative;<br />
}<br />
h2.nav-h22 {<br />
background-position: -80px 0;<br />
}<br />
h2.nav-h23 {<br />
background-position: -160px 0;<br />
}<br />
h2.nav-h24 {<br />
background-position: -240px 0;<br />
}<br />
h2.nav-h25 {<br />
background-position: -320px 0;<br />
}<br />
h2.nav-h26 {<br />
background-position: -400px 0;<br />
}<br />
h2.nav-h21:hover {<br />
background-position: 0 -80px;<br />
}<br />
h2.nav-h22:hover {<br />
background-position: -80px -80px;<br />
}<br />
h2.nav-h23:hover {<br />
background-position: -160px -80px;<br />
}<br />
h2.nav-h24:hover {<br />
background-position: -240px -80px;<br />
}<br />
h2.nav-h25:hover {<br />
background-position: -320px -80px;<br />
}<br />
h2.nav-h26:hover {<br />
background-position: -400px -80px;<br />
}<br />
h2.nav-h21on {<br />
background-position: 0 -160px;<br />
}<br />
h2.nav-h22on {<br />
background-position: -80px -160px;<br />
}<br />
h2.nav-h23on {<br />
background-position: -160px -160px;<br />
}<br />
h2.nav-h24on {<br />
background-position: -240px -160px;<br />
}<br />
h2.nav-h25on {<br />
background-position: -320px -160px;<br />
}<br />
h2.nav-h26on {<br />
background-position: -400px -160px;<br />
}<br />
ul.nav-innerUl{<br />
position: absolute;<br />
top: 40px;<br />
padding-top: 40px;<br />
width: 76px;<br />
border-left: 2px solid #000;<br />
border-right: 2px solid #000;<br />
z-index: 140;<br />
display: none;<br />
}<br />
em.nav-libg{<br />
display: block;<br />
width: 96px;<br />
height: 11px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/48/Nav-libg.png');<br />
margin-left: -10px;<br />
}<br />
ul.nav-innerUl1{<br />
background: #fffaca;<br />
}<br />
ul.nav-innerUl2{<br />
background: #dedede;<br />
}<br />
ul.nav-innerUl3{<br />
background: #d9f0c9;<br />
}<br />
ul.nav-innerUl4{<br />
background: #f6e5ff;<br />
}<br />
ul.nav-innerUl5{<br />
background: #ebfcff;<br />
}<br />
ul.nav-innerUl6{<br />
background: #ffeee8;<br />
}<br />
li.nav-innerLi{<br />
font-size: 10px;<br />
line-height: 14px;<br />
padding: 3px 5px;<br />
}<br />
li.nav-innerLi:hover{<br />
background: #fff;<br />
}<br />
div.middle {<br />
width: 940px;<br />
background: #e6deb8;<br />
background: rgba(230,222,184,0.5);<br />
position: absolute;<br />
top: 300px;<br />
left: 30px;<br />
}<br />
div.aside {<br />
width: 160px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/b/b3/Aside-bg.png") no-repeat;<br />
margin-left: 20px;<br />
margin-top: 100px;<br />
float: left;<br />
padding: 20px;<br />
}<br />
ul.aside-outerUl {<br />
margin: 15px;<br />
}<br />
li.aside-outerLi {<br />
margin: 15px 0;<br />
background: #fff1a9;<br />
padding: 5px 10px;<br />
color: #725718;<br />
font-size: 16px;<br />
line-height: 24px;<br />
font-weight: bold;<br />
text-align: center;<br />
cursor: pointer;<br />
}<br />
li.aside-outerLi:hover {<br />
background: #fff8d3;<br />
}<br />
div.main {<br />
width: 640px;<br />
height: 400px;<br />
border: 5px solid #333;<br />
background: #fff;<br />
float: right;<br />
margin: 100px 30px 30px 0;<br />
}<br />
div.footer {<br />
}<br />
<br />
/*<br />
* picSlider Css<br />
*/<br />
#picSlider {<br />
width: 640px;<br />
height: 320px;<br />
}<br />
.momo {<br />
background: #000;<br />
}<br />
.momo .pic li {<br />
width: 100%;<br />
height: 100%;<br />
overflow: hidden;<br />
position: absolute;<br />
display: none;<br />
}<br />
.momo .txt li {<br />
position: absolute;<br />
padding: 5px 10px;<br />
z-index: 2;<br />
bottom: 0;<br />
height: 28px;<br />
background: #DBDBDB;<br />
display: none;<br />
}<br />
.momo .txt li a {<br />
display: block;<br />
position: relative;<br />
z-index: 1;<br />
color: #333;<br />
font-size: 12px;<br />
font-weight: bold;<br />
text-decoration: none;<br />
}<br />
.momo .num {<br />
position: absolute;<br />
z-index: 3;<br />
bottom: 5px;<br />
right: 5px;<br />
}<br />
.momo .num li {<br />
float: left;<br />
}<br />
.momo .num li a {<br />
color: #333;<br />
float: left;<br />
margin-left: 3px;<br />
width: 15px;<br />
height: 15px;<br />
line-height: 15px;<br />
*line-height: 14px;<br />
overflow: hidden;<br />
border: 1px solid #AEC1CC;<br />
text-align: center;<br />
cursor: pointer;<br />
background: #fff;<br />
text-decoration: none;<br />
}<br />
.momo .num li.current a, .momo .num li.hover a {<br />
color: #fff;<br />
background: #f60;<br />
-webkit-transition: all 0.4s;<br />
-moz-transition: all 0.4s;<br />
-o-transition: all 0.4s;<br />
}<br />
.momo_picSlider .txt li{<br />
width: 620px;<br />
}<br />
.momo_picSlider .txt li a{<br />
font-size: 16px;<br />
line-height: 24px;<br />
}<br />
#p-logo {<br />
display:none;<br />
}<br />
#top-section {<br />
height:0;<br />
border:none;<br />
}<br />
#search-controls {<br />
display:none;<br />
}<br />
#content {<br />
position:inherit;<br />
width:inherit;<br />
margin:0;<br />
padding:0;<br />
background:inherit;<br />
color:inherit;<br />
border:none;<br />
line-height:inherit;<br />
z-index:2;<br />
}<br />
.firstHeading {<br />
display:none;<br />
}<br />
#catlinks {<br />
display:none;<br />
}<br />
#footer-box {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#menubar ul li a {<br />
background:none;<br />
}<br />
#bodyContent h1,#bodyContent h2 {<br />
margin:0;<br />
border:0;<br />
padding: 0;<br />
}<br />
.left-menu:hover {<br />
background:none;<br />
}<br />
</style><br />
<div class="center"><br />
<div class="header"><br />
<div class="nav"><br />
<ul class="nav-outerUl"><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China"><h2 class="nav-h21 nav-h21on" title="Home"></h2></a><br />
<ul class="nav-innerUl nav-innerUl1" name="Home"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Team"><h2 class="nav-h22" title="Team"></h2></a><br />
<ul class="nav-innerUl nav-innerUl2" name="Team"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Project"><h2 class="nav-h23" title="Project"></h2></a><br />
<ul class="nav-innerUl nav-innerUl3" name="Project"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Modeling"><h2 class="nav-h24" title="Modeling"></h2></a><br />
<ul class="nav-innerUl nav-innerUl4" name="Modeling"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Notebooks"><h2 class="nav-h25" title="Notebooks"></h2></a><br />
<ul class="nav-innerUl nav-innerUl5" name="Notebooks"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/humanPractice"><h2 class="nav-h26" title="Human Practice"></h2></a><br />
<ul class="nav-innerUl nav-innerUl6" name="HumanPractice"></ul><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div class="middle"><br />
<div class="aside"><br />
<ul class="aside-outerUl"></ul><br />
</div><br />
<div class="main"></div><br />
<div class="clear"></div><br />
</div><br />
<div class="footer"></div><br />
</div><br />
<script src="http://www.yichengliu.com/code/igem/home.js"></script><br />
</body><br />
</html></div>Nanhaihttp://2012.igem.org/File:Achievements_device_xia.pngFile:Achievements device xia.png2012-10-27T00:02:22Z<p>Nanhai: </p>
<hr />
<div></div>Nanhaihttp://2012.igem.org/Team:WHU-ChinaTeam:WHU-China2012-10-26T23:56:37Z<p>Nanhai: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<body><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script><br />
function picObj(src, title, detail, href){<br />
this.src = src;<br />
this.title = title;<br />
this.detail = detail;<br />
this.href = href;<br />
}<br />
//*************************自定义数据部分*************************<br />
<br />
//定义菜单及侧边栏数据<br />
var menuObj = {<br />
Home : [<br />
{<br />
title : "<strong>What's new</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/e/e3/What%27s_new_first.png","Three advantages of the E.coslim", "Compared to traditional methods of losing weight, our E.coslim has three advantages: monitoring, high efficiency and long term efficiency.", "https://2012.igem.org/Team:WHU-China/Project?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/f/ff/Promoter_design.png", "Monitoring", "By designing two novel promoters, Pcar and PfadR, our E.coslim is able to sense the high calorie molecules and respond to them.", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#Pcar"),<br />
new picObj("http://partsregistry.org/wiki/images/f/ff/%E5%85%A8%E6%99%AF%E5%8A%A0%E6%AD%BB%E4%BA%A11.png", "Panorama of the Whole Project Scheme", "Four novel devices, Fatty Acid Degradation, Cellulose Synthesis, Colonization and Death to ensure high efficiency orchestrate calorie absorption and bacteria survival and make you slim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=3"),<br />
new picObj("https://static.igem.org/mediawiki/2012/0/09/%E8%83%96%E5%AD%90%E7%98%A6%E5%AD%90.png", "Long term efficiency of the E.coslim", "When viewed at macroscopic way, the E.coslim may have an advantage of long term efficiency,by regulating the human gut microbiota.And we have certified this by mathematical model.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=2")<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>Pathway Introduction</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/igem.org/8/82/Pathway_FattyAcid.png", "Fatty Acid Degradation", "Feel free to eat meat since the fat is all degraded by our E.coslim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=3"),<br />
new picObj("https://static.igem.org/mediawiki/igem.org/1/18/Pathway_Cellulose.png", "Cellulose Synthesis", "Transforming glucose into cellulose, the high-sugar food you eat will be turned into vegetables!", "https://2012.igem.org/Team:WHU-China/Project?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/e/ea/Device_three.png", "Colonization", "The magic molecule c-di-GMP enables E.coslim colonizing in the gut to better fulfill its magic function!", "https://2012.igem.org/Team:WHU-China/Project?catalog=5")<br />
]<br />
},<br />
<br />
{<br />
title : "<strong>Future Perspective</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/ab/%E5%8F%8C%E8%83%B6%E5%9B%8A2.jpg", "Two Capsule Design", "Capsule I, the E.coslim, makes you slim, while Capsule II, xylose, terminates the effects of the former.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/d/d2/Fpbody2.jpg", "In vitro experiment in a simulated intestine", "The gut microbiota and E.coslim will be inoculated in a simulated intestine, then the concentration measurement of each component will tell us whether E.coslim works as desired.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/8/85/%E5%B0%8F%E9%BC%A0%E5%AE%9E%E9%AA%8C02.jpg", "In vivo experiment in mice", "E.coslim will also be inoculated into mice and the culture-independent microbiome analysis will tell us the real situation in vivo.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0")<br />
]<br />
},<br />
<br />
<br />
<br />
{<br />
title : "<strong>Achievement</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/f/fd/Achievements_device.png", "Devices", "This year,our project has focused on some of the hotspot issues,such as c-di-CMP ,gut microbiota. In all we submitted 66 new biobricks and 39 of them have been proved to be effective.", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/c/ca/Achievements_1.png", "Biobicks we have improved", "In our project, we have improved the function of some biobricks,such as BBa_J54222, BBa_K188011 and BBa_R0051. ", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/f/f5/Achievements_2.png", "Novel promoter we designed", "As the existing promoter can not meet our demand, we designed two novel promoters Pcar and Pfad to achieve the goal. In addition, we also have set up a standard for promoter design.", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/2/27/Methods_we_improve.png", "Methods we improved", "In our project,we improved some traditional methods to measure the comsumption of fatty acids and production of cellulose, and also we developed a software named FANCY to detect the fluorescence intensity of single cell. ", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/7/79/Human_practice_xia.png", "Human Practice", "We have helped HUST iGEM team debug their project and mathematical model. We also did a survey on GMOs and publicized iGEM to the public.", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>About Us</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/a7/Whu-2012-1.jpg", "WHU-China 2012, I was there", "The Entrance of State Wuhan University", "https://2012.igem.org/Team:WHU-China/Team?catalog=1"),<br />
new picObj("https://static.igem.org/mediawiki/2012/2/23/Whu2012heying.jpg", "MIT, we're coming!", "Collge of Life Sciences of WHU", "https://2012.igem.org/Team:WHU-China/Team?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/4/43/Whu2012-2.jpg", "WHU-China, Hooray!", "Yuntai Mountain, Henan Province", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=5")<br />
]<br />
}<br />
],<br />
Team : [<br />
{<br />
title : '<strong>Members</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Instructors</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Team History</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About WHU</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About Our Lab</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Acknow-</br>ledgements</strong>',<br />
dir : []<br />
},<br />
<br />
],<br />
Project : [<br />
{<br />
title : '<strong>Description</strong>',<br />
dir : [<br />
<br />
]<br />
},<br />
{<br />
title : '<strong>Background</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Promoter Design</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device I: Fatty Acid Degradation</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device II: Cellulose Synthesis</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device III: Colonization</strong>',<br />
dir : []<br />
},<br />
],<br />
Modeling : [<br />
{<br />
title : '<strong>Future Perspectives</strong>',<br />
dir : []<br />
},<br />
<br />
{<br />
title : '<strong>Model I: Fatty Acid Degradation</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Model II: Microbiota Regulation</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Software Tool: FANCY</strong>',<br />
dir : []<br />
}<br />
],<br />
Notebooks : [<br />
{<br />
title : '<strong>Parts</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Safety</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Protocols</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Events</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Brain-</br>storming</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Gallery</strong>',<br />
dir : []<br />
}<br />
],<br />
HumanPractice : [<br />
{<br />
title : '<strong>Outline</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Questionaire Survey</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Publicity</strong>',<br />
dir : []<br />
}<br />
]<br />
}; <br />
//*************************自定义数据部分*************************<br />
</script><br />
<style type="text/css"><br />
/*<br />
* base css, DO NOT MODIFY!<br />
*/<br />
* {<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
font-family: "Verdana", sans-serif;<br />
color: #333;<br />
list-style: none;<br />
outline: none;<br />
resize: none;<br />
}<br />
html {<br />
overflow-y: scroll;<br />
}<br />
body {<br />
background: url("https://static.igem.org/mediawiki/2012/2/22/Body-bg.jpg") center center fixed;<br />
}<br />
a {<br />
text-decoration: none;<br />
}<br />
.clear {<br />
width: 0;<br />
height: 0;<br />
line-height: 0;<br />
display: block;<br />
clear: both;<br />
}<br />
<br />
/*<br />
* common css, include "header","footer"...<br />
*/<br />
div.center {<br />
width: 1000px;<br />
margin: 0 auto;<br />
position: relative;<br />
}<br />
div.header {<br />
width: 1000px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/1/12/Header-bg.png") no-repeat;<br />
position: relative;<br />
z-index: 50;<br />
}<br />
div.nav {<br />
position: absolute;<br />
height: 80px;<br />
top: 185px;<br />
left: 245px;<br />
}<br />
li.nav-outerLi {<br />
display: block;<br />
float: left;<br />
width: 80px;<br />
height: 80px;<br />
margin: 0 6px;<br />
cursor: pointer;<br />
}<br />
h2.nav-h21,h2.nav-h22,h2.nav-h23,h2.nav-h24,h2.nav-h25,h2.nav-h26 {<br />
display: block;<br />
background: url("https://static.igem.org/mediawiki/2012/9/91/Nav-tabs.png") no-repeat;<br />
width: 80px;<br />
height: 80px;<br />
background-position: 0 0;<br />
z-index: 150;<br />
position: relative;<br />
}<br />
h2.nav-h22 {<br />
background-position: -80px 0;<br />
}<br />
h2.nav-h23 {<br />
background-position: -160px 0;<br />
}<br />
h2.nav-h24 {<br />
background-position: -240px 0;<br />
}<br />
h2.nav-h25 {<br />
background-position: -320px 0;<br />
}<br />
h2.nav-h26 {<br />
background-position: -400px 0;<br />
}<br />
h2.nav-h21:hover {<br />
background-position: 0 -80px;<br />
}<br />
h2.nav-h22:hover {<br />
background-position: -80px -80px;<br />
}<br />
h2.nav-h23:hover {<br />
background-position: -160px -80px;<br />
}<br />
h2.nav-h24:hover {<br />
background-position: -240px -80px;<br />
}<br />
h2.nav-h25:hover {<br />
background-position: -320px -80px;<br />
}<br />
h2.nav-h26:hover {<br />
background-position: -400px -80px;<br />
}<br />
h2.nav-h21on {<br />
background-position: 0 -160px;<br />
}<br />
h2.nav-h22on {<br />
background-position: -80px -160px;<br />
}<br />
h2.nav-h23on {<br />
background-position: -160px -160px;<br />
}<br />
h2.nav-h24on {<br />
background-position: -240px -160px;<br />
}<br />
h2.nav-h25on {<br />
background-position: -320px -160px;<br />
}<br />
h2.nav-h26on {<br />
background-position: -400px -160px;<br />
}<br />
ul.nav-innerUl{<br />
position: absolute;<br />
top: 40px;<br />
padding-top: 40px;<br />
width: 76px;<br />
border-left: 2px solid #000;<br />
border-right: 2px solid #000;<br />
z-index: 140;<br />
display: none;<br />
}<br />
em.nav-libg{<br />
display: block;<br />
width: 96px;<br />
height: 11px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/48/Nav-libg.png');<br />
margin-left: -10px;<br />
}<br />
ul.nav-innerUl1{<br />
background: #fffaca;<br />
}<br />
ul.nav-innerUl2{<br />
background: #dedede;<br />
}<br />
ul.nav-innerUl3{<br />
background: #d9f0c9;<br />
}<br />
ul.nav-innerUl4{<br />
background: #f6e5ff;<br />
}<br />
ul.nav-innerUl5{<br />
background: #ebfcff;<br />
}<br />
ul.nav-innerUl6{<br />
background: #ffeee8;<br />
}<br />
li.nav-innerLi{<br />
font-size: 10px;<br />
line-height: 14px;<br />
padding: 3px 5px;<br />
}<br />
li.nav-innerLi:hover{<br />
background: #fff;<br />
}<br />
div.middle {<br />
width: 940px;<br />
background: #e6deb8;<br />
background: rgba(230,222,184,0.5);<br />
position: absolute;<br />
top: 300px;<br />
left: 30px;<br />
}<br />
div.aside {<br />
width: 160px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/b/b3/Aside-bg.png") no-repeat;<br />
margin-left: 20px;<br />
margin-top: 100px;<br />
float: left;<br />
padding: 20px;<br />
}<br />
ul.aside-outerUl {<br />
margin: 15px;<br />
}<br />
li.aside-outerLi {<br />
margin: 15px 0;<br />
background: #fff1a9;<br />
padding: 5px 10px;<br />
color: #725718;<br />
font-size: 16px;<br />
line-height: 24px;<br />
font-weight: bold;<br />
text-align: center;<br />
cursor: pointer;<br />
}<br />
li.aside-outerLi:hover {<br />
background: #fff8d3;<br />
}<br />
div.main {<br />
width: 640px;<br />
height: 400px;<br />
border: 5px solid #333;<br />
background: #fff;<br />
float: right;<br />
margin: 100px 30px 30px 0;<br />
}<br />
div.footer {<br />
}<br />
<br />
/*<br />
* picSlider Css<br />
*/<br />
#picSlider {<br />
width: 640px;<br />
height: 320px;<br />
}<br />
.momo {<br />
background: #000;<br />
}<br />
.momo .pic li {<br />
width: 100%;<br />
height: 100%;<br />
overflow: hidden;<br />
position: absolute;<br />
display: none;<br />
}<br />
.momo .txt li {<br />
position: absolute;<br />
padding: 5px 10px;<br />
z-index: 2;<br />
bottom: 0;<br />
height: 28px;<br />
background: #DBDBDB;<br />
display: none;<br />
}<br />
.momo .txt li a {<br />
display: block;<br />
position: relative;<br />
z-index: 1;<br />
color: #333;<br />
font-size: 12px;<br />
font-weight: bold;<br />
text-decoration: none;<br />
}<br />
.momo .num {<br />
position: absolute;<br />
z-index: 3;<br />
bottom: 5px;<br />
right: 5px;<br />
}<br />
.momo .num li {<br />
float: left;<br />
}<br />
.momo .num li a {<br />
color: #333;<br />
float: left;<br />
margin-left: 3px;<br />
width: 15px;<br />
height: 15px;<br />
line-height: 15px;<br />
*line-height: 14px;<br />
overflow: hidden;<br />
border: 1px solid #AEC1CC;<br />
text-align: center;<br />
cursor: pointer;<br />
background: #fff;<br />
text-decoration: none;<br />
}<br />
.momo .num li.current a, .momo .num li.hover a {<br />
color: #fff;<br />
background: #f60;<br />
-webkit-transition: all 0.4s;<br />
-moz-transition: all 0.4s;<br />
-o-transition: all 0.4s;<br />
}<br />
.momo_picSlider .txt li{<br />
width: 620px;<br />
}<br />
.momo_picSlider .txt li a{<br />
font-size: 16px;<br />
line-height: 24px;<br />
}<br />
#p-logo {<br />
display:none;<br />
}<br />
#top-section {<br />
height:0;<br />
border:none;<br />
}<br />
#search-controls {<br />
display:none;<br />
}<br />
#content {<br />
position:inherit;<br />
width:inherit;<br />
margin:0;<br />
padding:0;<br />
background:inherit;<br />
color:inherit;<br />
border:none;<br />
line-height:inherit;<br />
z-index:2;<br />
}<br />
.firstHeading {<br />
display:none;<br />
}<br />
#catlinks {<br />
display:none;<br />
}<br />
#footer-box {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#menubar ul li a {<br />
background:none;<br />
}<br />
#bodyContent h1,#bodyContent h2 {<br />
margin:0;<br />
border:0;<br />
padding: 0;<br />
}<br />
.left-menu:hover {<br />
background:none;<br />
}<br />
</style><br />
<div class="center"><br />
<div class="header"><br />
<div class="nav"><br />
<ul class="nav-outerUl"><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China"><h2 class="nav-h21 nav-h21on" title="Home"></h2></a><br />
<ul class="nav-innerUl nav-innerUl1" name="Home"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Team"><h2 class="nav-h22" title="Team"></h2></a><br />
<ul class="nav-innerUl nav-innerUl2" name="Team"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Project"><h2 class="nav-h23" title="Project"></h2></a><br />
<ul class="nav-innerUl nav-innerUl3" name="Project"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Modeling"><h2 class="nav-h24" title="Modeling"></h2></a><br />
<ul class="nav-innerUl nav-innerUl4" name="Modeling"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Notebooks"><h2 class="nav-h25" title="Notebooks"></h2></a><br />
<ul class="nav-innerUl nav-innerUl5" name="Notebooks"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/humanPractice"><h2 class="nav-h26" title="Human Practice"></h2></a><br />
<ul class="nav-innerUl nav-innerUl6" name="HumanPractice"></ul><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div class="middle"><br />
<div class="aside"><br />
<ul class="aside-outerUl"></ul><br />
</div><br />
<div class="main"></div><br />
<div class="clear"></div><br />
</div><br />
<div class="footer"></div><br />
</div><br />
<script src="http://www.yichengliu.com/code/igem/home.js"></script><br />
</body><br />
</html></div>Nanhaihttp://2012.igem.org/Team:WHU-ChinaTeam:WHU-China2012-10-26T23:56:04Z<p>Nanhai: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<body><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script><br />
function picObj(src, title, detail, href){<br />
this.src = src;<br />
this.title = title;<br />
this.detail = detail;<br />
this.href = href;<br />
}<br />
//*************************自定义数据部分*************************<br />
<br />
//定义菜单及侧边栏数据<br />
var menuObj = {<br />
Home : [<br />
{<br />
title : "<strong>What's new</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/e/e3/What%27s_new_first.png","Three advantages of the E.coslim", "Compared to traditional methods of losing weight, our E.coslim has three advantages: monitoring, high efficiency and long term efficiency.", "https://2012.igem.org/Team:WHU-China/Project?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/f/ff/Promoter_design.png", "Monitoring", "By designing two novel promoters, Pcar and PfadR, our E.coslim is able to sense the high calorie molecules and respond to them", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#Pcar"),<br />
new picObj("http://partsregistry.org/wiki/images/f/ff/%E5%85%A8%E6%99%AF%E5%8A%A0%E6%AD%BB%E4%BA%A11.png", "Panorama of the Whole Project Scheme", "Four novel devices, Fatty Acid Degradation, Cellulose Synthesis, Colonization and Death to ensure high efficiency orchestrate calorie absorption and bacteria survival and make you slim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=3"),<br />
new picObj("https://static.igem.org/mediawiki/2012/0/09/%E8%83%96%E5%AD%90%E7%98%A6%E5%AD%90.png", "Long term efficiency of the E.coslim", "When viewed at macroscopic way, the E.coslim may have an advantage of long term efficiency,by regulating the human gut microbiota.And we have certified this by mathematical model.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=2")<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>Pathway Introduction</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/igem.org/8/82/Pathway_FattyAcid.png", "Fatty Acid Degradation", "Feel free to eat meat since the fat is all degraded by our E.coslim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=3"),<br />
new picObj("https://static.igem.org/mediawiki/igem.org/1/18/Pathway_Cellulose.png", "Cellulose Synthesis", "Transforming glucose into cellulose, the high-sugar food you eat will be turned into vegetables!", "https://2012.igem.org/Team:WHU-China/Project?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/e/ea/Device_three.png", "Colonization", "The magic molecule c-di-GMP enables E.coslim colonizing in the gut to better fulfill its magic function!", "https://2012.igem.org/Team:WHU-China/Project?catalog=5")<br />
]<br />
},<br />
<br />
{<br />
title : "<strong>Future Perspective</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/ab/%E5%8F%8C%E8%83%B6%E5%9B%8A2.jpg", "Two Capsule Design", "Capsule I, the E.coslim, makes you slim, while Capsule II, xylose, terminates the effects of the former.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/d/d2/Fpbody2.jpg", "In vitro experiment in a simulated intestine", "The gut microbiota and E.coslim will be inoculated in a simulated intestine, then the concentration measurement of each component will tell us whether E.coslim works as desired.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/8/85/%E5%B0%8F%E9%BC%A0%E5%AE%9E%E9%AA%8C02.jpg", "In vivo experiment in mice", "E.coslim will also be inoculated into mice and the culture-independent microbiome analysis will tell us the real situation in vivo.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0")<br />
]<br />
},<br />
<br />
<br />
<br />
{<br />
title : "<strong>Achievement</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/f/fd/Achievements_device.png", "Devices", "This year,our project has focused on some of the hotspot issues,such as c-di-CMP ,gut microbiota. In all we submitted 66 new biobricks and 39 of them have been proved to be effective.", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/c/ca/Achievements_1.png", "Biobicks we have improved", "In our project, we have improved the function of some biobricks,such as BBa_J54222, BBa_K188011 and BBa_R0051. ", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/f/f5/Achievements_2.png", "Novel promoter we designed", "As the existing promoter can not meet our demand, we designed two novel promoters Pcar and Pfad to achieve the goal. In addition, we also have set up a standard for promoter design.", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/2/27/Methods_we_improve.png", "Methods we improved", "In our project,we improved some traditional methods to measure the comsumption of fatty acids and production of cellulose, and also we developed a software named FANCY to detect the fluorescence intensity of single cell. ", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/7/79/Human_practice_xia.png", "Human Practice", "We have helped HUST iGEM team debug their project and mathematical model. We also did a survey on GMOs and publicized iGEM to the public.", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>About Us</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/a7/Whu-2012-1.jpg", "WHU-China 2012, I was there", "The Entrance of State Wuhan University", "https://2012.igem.org/Team:WHU-China/Team?catalog=1"),<br />
new picObj("https://static.igem.org/mediawiki/2012/2/23/Whu2012heying.jpg", "MIT, we're coming!", "Collge of Life Sciences of WHU", "https://2012.igem.org/Team:WHU-China/Team?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/4/43/Whu2012-2.jpg", "WHU-China, Hooray!", "Yuntai Mountain, Henan Province", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=5")<br />
]<br />
}<br />
],<br />
Team : [<br />
{<br />
title : '<strong>Members</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Instructors</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Team History</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About WHU</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About Our Lab</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Acknow-</br>ledgements</strong>',<br />
dir : []<br />
},<br />
<br />
],<br />
Project : [<br />
{<br />
title : '<strong>Description</strong>',<br />
dir : [<br />
<br />
]<br />
},<br />
{<br />
title : '<strong>Background</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Promoter Design</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device I: Fatty Acid Degradation</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device II: Cellulose Synthesis</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device III: Colonization</strong>',<br />
dir : []<br />
},<br />
],<br />
Modeling : [<br />
{<br />
title : '<strong>Future Perspectives</strong>',<br />
dir : []<br />
},<br />
<br />
{<br />
title : '<strong>Model I: Fatty Acid Degradation</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Model II: Microbiota Regulation</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Software Tool: FANCY</strong>',<br />
dir : []<br />
}<br />
],<br />
Notebooks : [<br />
{<br />
title : '<strong>Parts</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Safety</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Protocols</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Events</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Brain-</br>storming</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Gallery</strong>',<br />
dir : []<br />
}<br />
],<br />
HumanPractice : [<br />
{<br />
title : '<strong>Outline</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Questionaire Survey</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Publicity</strong>',<br />
dir : []<br />
}<br />
]<br />
}; <br />
//*************************自定义数据部分*************************<br />
</script><br />
<style type="text/css"><br />
/*<br />
* base css, DO NOT MODIFY!<br />
*/<br />
* {<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
font-family: "Verdana", sans-serif;<br />
color: #333;<br />
list-style: none;<br />
outline: none;<br />
resize: none;<br />
}<br />
html {<br />
overflow-y: scroll;<br />
}<br />
body {<br />
background: url("https://static.igem.org/mediawiki/2012/2/22/Body-bg.jpg") center center fixed;<br />
}<br />
a {<br />
text-decoration: none;<br />
}<br />
.clear {<br />
width: 0;<br />
height: 0;<br />
line-height: 0;<br />
display: block;<br />
clear: both;<br />
}<br />
<br />
/*<br />
* common css, include "header","footer"...<br />
*/<br />
div.center {<br />
width: 1000px;<br />
margin: 0 auto;<br />
position: relative;<br />
}<br />
div.header {<br />
width: 1000px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/1/12/Header-bg.png") no-repeat;<br />
position: relative;<br />
z-index: 50;<br />
}<br />
div.nav {<br />
position: absolute;<br />
height: 80px;<br />
top: 185px;<br />
left: 245px;<br />
}<br />
li.nav-outerLi {<br />
display: block;<br />
float: left;<br />
width: 80px;<br />
height: 80px;<br />
margin: 0 6px;<br />
cursor: pointer;<br />
}<br />
h2.nav-h21,h2.nav-h22,h2.nav-h23,h2.nav-h24,h2.nav-h25,h2.nav-h26 {<br />
display: block;<br />
background: url("https://static.igem.org/mediawiki/2012/9/91/Nav-tabs.png") no-repeat;<br />
width: 80px;<br />
height: 80px;<br />
background-position: 0 0;<br />
z-index: 150;<br />
position: relative;<br />
}<br />
h2.nav-h22 {<br />
background-position: -80px 0;<br />
}<br />
h2.nav-h23 {<br />
background-position: -160px 0;<br />
}<br />
h2.nav-h24 {<br />
background-position: -240px 0;<br />
}<br />
h2.nav-h25 {<br />
background-position: -320px 0;<br />
}<br />
h2.nav-h26 {<br />
background-position: -400px 0;<br />
}<br />
h2.nav-h21:hover {<br />
background-position: 0 -80px;<br />
}<br />
h2.nav-h22:hover {<br />
background-position: -80px -80px;<br />
}<br />
h2.nav-h23:hover {<br />
background-position: -160px -80px;<br />
}<br />
h2.nav-h24:hover {<br />
background-position: -240px -80px;<br />
}<br />
h2.nav-h25:hover {<br />
background-position: -320px -80px;<br />
}<br />
h2.nav-h26:hover {<br />
background-position: -400px -80px;<br />
}<br />
h2.nav-h21on {<br />
background-position: 0 -160px;<br />
}<br />
h2.nav-h22on {<br />
background-position: -80px -160px;<br />
}<br />
h2.nav-h23on {<br />
background-position: -160px -160px;<br />
}<br />
h2.nav-h24on {<br />
background-position: -240px -160px;<br />
}<br />
h2.nav-h25on {<br />
background-position: -320px -160px;<br />
}<br />
h2.nav-h26on {<br />
background-position: -400px -160px;<br />
}<br />
ul.nav-innerUl{<br />
position: absolute;<br />
top: 40px;<br />
padding-top: 40px;<br />
width: 76px;<br />
border-left: 2px solid #000;<br />
border-right: 2px solid #000;<br />
z-index: 140;<br />
display: none;<br />
}<br />
em.nav-libg{<br />
display: block;<br />
width: 96px;<br />
height: 11px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/48/Nav-libg.png');<br />
margin-left: -10px;<br />
}<br />
ul.nav-innerUl1{<br />
background: #fffaca;<br />
}<br />
ul.nav-innerUl2{<br />
background: #dedede;<br />
}<br />
ul.nav-innerUl3{<br />
background: #d9f0c9;<br />
}<br />
ul.nav-innerUl4{<br />
background: #f6e5ff;<br />
}<br />
ul.nav-innerUl5{<br />
background: #ebfcff;<br />
}<br />
ul.nav-innerUl6{<br />
background: #ffeee8;<br />
}<br />
li.nav-innerLi{<br />
font-size: 10px;<br />
line-height: 14px;<br />
padding: 3px 5px;<br />
}<br />
li.nav-innerLi:hover{<br />
background: #fff;<br />
}<br />
div.middle {<br />
width: 940px;<br />
background: #e6deb8;<br />
background: rgba(230,222,184,0.5);<br />
position: absolute;<br />
top: 300px;<br />
left: 30px;<br />
}<br />
div.aside {<br />
width: 160px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/b/b3/Aside-bg.png") no-repeat;<br />
margin-left: 20px;<br />
margin-top: 100px;<br />
float: left;<br />
padding: 20px;<br />
}<br />
ul.aside-outerUl {<br />
margin: 15px;<br />
}<br />
li.aside-outerLi {<br />
margin: 15px 0;<br />
background: #fff1a9;<br />
padding: 5px 10px;<br />
color: #725718;<br />
font-size: 16px;<br />
line-height: 24px;<br />
font-weight: bold;<br />
text-align: center;<br />
cursor: pointer;<br />
}<br />
li.aside-outerLi:hover {<br />
background: #fff8d3;<br />
}<br />
div.main {<br />
width: 640px;<br />
height: 400px;<br />
border: 5px solid #333;<br />
background: #fff;<br />
float: right;<br />
margin: 100px 30px 30px 0;<br />
}<br />
div.footer {<br />
}<br />
<br />
/*<br />
* picSlider Css<br />
*/<br />
#picSlider {<br />
width: 640px;<br />
height: 320px;<br />
}<br />
.momo {<br />
background: #000;<br />
}<br />
.momo .pic li {<br />
width: 100%;<br />
height: 100%;<br />
overflow: hidden;<br />
position: absolute;<br />
display: none;<br />
}<br />
.momo .txt li {<br />
position: absolute;<br />
padding: 5px 10px;<br />
z-index: 2;<br />
bottom: 0;<br />
height: 28px;<br />
background: #DBDBDB;<br />
display: none;<br />
}<br />
.momo .txt li a {<br />
display: block;<br />
position: relative;<br />
z-index: 1;<br />
color: #333;<br />
font-size: 12px;<br />
font-weight: bold;<br />
text-decoration: none;<br />
}<br />
.momo .num {<br />
position: absolute;<br />
z-index: 3;<br />
bottom: 5px;<br />
right: 5px;<br />
}<br />
.momo .num li {<br />
float: left;<br />
}<br />
.momo .num li a {<br />
color: #333;<br />
float: left;<br />
margin-left: 3px;<br />
width: 15px;<br />
height: 15px;<br />
line-height: 15px;<br />
*line-height: 14px;<br />
overflow: hidden;<br />
border: 1px solid #AEC1CC;<br />
text-align: center;<br />
cursor: pointer;<br />
background: #fff;<br />
text-decoration: none;<br />
}<br />
.momo .num li.current a, .momo .num li.hover a {<br />
color: #fff;<br />
background: #f60;<br />
-webkit-transition: all 0.4s;<br />
-moz-transition: all 0.4s;<br />
-o-transition: all 0.4s;<br />
}<br />
.momo_picSlider .txt li{<br />
width: 620px;<br />
}<br />
.momo_picSlider .txt li a{<br />
font-size: 16px;<br />
line-height: 24px;<br />
}<br />
#p-logo {<br />
display:none;<br />
}<br />
#top-section {<br />
height:0;<br />
border:none;<br />
}<br />
#search-controls {<br />
display:none;<br />
}<br />
#content {<br />
position:inherit;<br />
width:inherit;<br />
margin:0;<br />
padding:0;<br />
background:inherit;<br />
color:inherit;<br />
border:none;<br />
line-height:inherit;<br />
z-index:2;<br />
}<br />
.firstHeading {<br />
display:none;<br />
}<br />
#catlinks {<br />
display:none;<br />
}<br />
#footer-box {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#menubar ul li a {<br />
background:none;<br />
}<br />
#bodyContent h1,#bodyContent h2 {<br />
margin:0;<br />
border:0;<br />
padding: 0;<br />
}<br />
.left-menu:hover {<br />
background:none;<br />
}<br />
</style><br />
<div class="center"><br />
<div class="header"><br />
<div class="nav"><br />
<ul class="nav-outerUl"><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China"><h2 class="nav-h21 nav-h21on" title="Home"></h2></a><br />
<ul class="nav-innerUl nav-innerUl1" name="Home"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Team"><h2 class="nav-h22" title="Team"></h2></a><br />
<ul class="nav-innerUl nav-innerUl2" name="Team"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Project"><h2 class="nav-h23" title="Project"></h2></a><br />
<ul class="nav-innerUl nav-innerUl3" name="Project"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Modeling"><h2 class="nav-h24" title="Modeling"></h2></a><br />
<ul class="nav-innerUl nav-innerUl4" name="Modeling"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Notebooks"><h2 class="nav-h25" title="Notebooks"></h2></a><br />
<ul class="nav-innerUl nav-innerUl5" name="Notebooks"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/humanPractice"><h2 class="nav-h26" title="Human Practice"></h2></a><br />
<ul class="nav-innerUl nav-innerUl6" name="HumanPractice"></ul><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div class="middle"><br />
<div class="aside"><br />
<ul class="aside-outerUl"></ul><br />
</div><br />
<div class="main"></div><br />
<div class="clear"></div><br />
</div><br />
<div class="footer"></div><br />
</div><br />
<script src="http://www.yichengliu.com/code/igem/home.js"></script><br />
</body><br />
</html></div>Nanhaihttp://2012.igem.org/File:What%27s_new_first.pngFile:What's new first.png2012-10-26T23:55:22Z<p>Nanhai: </p>
<hr />
<div></div>Nanhaihttp://2012.igem.org/File:Human_practice_xia.pngFile:Human practice xia.png2012-10-26T23:54:41Z<p>Nanhai: </p>
<hr />
<div></div>Nanhaihttp://2012.igem.org/File:Methods_we_improve.pngFile:Methods we improve.png2012-10-26T23:53:11Z<p>Nanhai: </p>
<hr />
<div></div>Nanhaihttp://2012.igem.org/Team:WHU-ChinaTeam:WHU-China2012-10-26T23:39:34Z<p>Nanhai: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<body><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script><br />
function picObj(src, title, detail, href){<br />
this.src = src;<br />
this.title = title;<br />
this.detail = detail;<br />
this.href = href;<br />
}<br />
//*************************自定义数据部分*************************<br />
<br />
//定义菜单及侧边栏数据<br />
var menuObj = {<br />
Home : [<br />
{<br />
title : "<strong>What's new</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/b/be/What%27s_new.png","Three advantages of the E.coslim", "Compared to traditional methods of losing weight, our E.coslim has three advantages: monitoring, high efficiency and long term efficiency.", "https://2012.igem.org/Team:WHU-China/Project?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/f/ff/Promoter_design.png", "Monitoring", "By designing two novel promoters, Pcar and PfadR, our E.coslim is able to sense the high calorie molecules and respond to them", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#Pcar"),<br />
new picObj("http://partsregistry.org/wiki/images/f/ff/%E5%85%A8%E6%99%AF%E5%8A%A0%E6%AD%BB%E4%BA%A11.png", "Panorama of the Whole Project Scheme", "Four novel devices, Fatty Acid Degradation, Cellulose Synthesis, Colonization and Death to ensure high efficiency orchestrate calorie absorption and bacteria survival and make you slim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=3"),<br />
new picObj("https://static.igem.org/mediawiki/2012/0/09/%E8%83%96%E5%AD%90%E7%98%A6%E5%AD%90.png", "Long term efficiency of the E.coslim", "When viewed at macroscopic way, the E.coslim may have an advantage of long term efficiency,by regulating the human gut microbiota.And we have certified this by mathematical model.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=2")<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>Pathway Introduction</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/igem.org/8/82/Pathway_FattyAcid.png", "Fatty Acid Degradation", "Feel free to eat meat since the fat is all degraded by our E.coslim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=3"),<br />
new picObj("https://static.igem.org/mediawiki/igem.org/1/18/Pathway_Cellulose.png", "Cellulose Synthesis", "Transforming glucose into cellulose, the high-sugar food you eat will be turned into vegetables!", "https://2012.igem.org/Team:WHU-China/Project?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/e/ea/Device_three.png", "Colonization", "The magic molecule c-di-GMP enables E.coslim colonizing in the gut to better fulfill its magic function!", "https://2012.igem.org/Team:WHU-China/Project?catalog=5")<br />
]<br />
},<br />
<br />
{<br />
title : "<strong>Future Perspective</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/ab/%E5%8F%8C%E8%83%B6%E5%9B%8A2.jpg", "Two Capsule Design", "Capsule I, the E.coslim, makes you slim, while Capsule II, xylose, terminates the effects of the former.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/d/d2/Fpbody2.jpg", "In vitro experiment in a simulated intestine", "The gut microbiota and E.coslim will be inoculated in a simulated intestine, then the concentration measurement of each component will tell us whether E.coslim works as desired.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/8/85/%E5%B0%8F%E9%BC%A0%E5%AE%9E%E9%AA%8C02.jpg", "In vivo experiment in mice", "E.coslim will also be inoculated into mice and the culture-independent microbiome analysis will tell us the real situation in vivo.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0")<br />
]<br />
},<br />
<br />
<br />
<br />
{<br />
title : "<strong>Achievement</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/f/fd/Achievements_device.png", "Devices", "This year,our project has focused on some of the hotspot issues,such as c-di-CMP ,gut microbiota. In all we submitted 66 new biobricks and 39 of them have been proved to be effective.", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/c/ca/Achievements_1.png", "Biobicks we have improved", "In our project, we have improved the function of some biobricks,such as BBa_J54222, BBa_K188011 and BBa_R0051. ", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/f/f5/Achievements_2.png", "Novel promoter we designed", "Novel promoter we designed", "As the existing promoter can not meet our demand, we designed two novel promoters Pcar and Pfad to achieve the goal. In addition, we also have set up a standard for promoter design.", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/2/2c/Achievements2.png", "Methods we improved", "In our project,we improved some traditional methods to measure the comsumption of fatty acids and production of cellulose, and also we developed a software named FANCY to detect the fluorescence intensity of single cell. ", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/b/b0/Achievements_human.png", "Human Practice", "We have helped HUST iGEM team debug their project and mathematical model. We also did a survey on GMOs and publicized iGEM to the public.", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>About Us</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/a7/Whu-2012-1.jpg", "WHU-China 2012, I was there", "The Entrance of State Wuhan University", "https://2012.igem.org/Team:WHU-China/Team?catalog=1"),<br />
new picObj("https://static.igem.org/mediawiki/2012/2/23/Whu2012heying.jpg", "MIT, we're coming!", "Collge of Life Sciences of WHU", "https://2012.igem.org/Team:WHU-China/Team?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/4/43/Whu2012-2.jpg", "WHU-China, Hooray!", "Yuntai Mountain, Henan Province", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=5")<br />
]<br />
}<br />
],<br />
Team : [<br />
{<br />
title : '<strong>Members</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Instructors</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Team History</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About WHU</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About Our Lab</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Acknow-</br>ledgements</strong>',<br />
dir : []<br />
},<br />
<br />
],<br />
Project : [<br />
{<br />
title : '<strong>Description</strong>',<br />
dir : [<br />
<br />
]<br />
},<br />
{<br />
title : '<strong>Background</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Promoter Design</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device I: Fatty Acid Degradation</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device II: Cellulose Synthesis</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device III: Colonization</strong>',<br />
dir : []<br />
},<br />
],<br />
Modeling : [<br />
{<br />
title : '<strong>Future Perspectives</strong>',<br />
dir : []<br />
},<br />
<br />
{<br />
title : '<strong>Model I: Fatty Acid Degradation</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Model II: Microbiota Regulation</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Software Tool: FANCY</strong>',<br />
dir : []<br />
}<br />
],<br />
Notebooks : [<br />
{<br />
title : '<strong>Parts</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Safety</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Protocols</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Events</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Brain-</br>storming</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Gallery</strong>',<br />
dir : []<br />
}<br />
],<br />
HumanPractice : [<br />
{<br />
title : '<strong>Outline</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Questionaire Survey</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Publicity</strong>',<br />
dir : []<br />
}<br />
]<br />
}; <br />
//*************************自定义数据部分*************************<br />
</script><br />
<style type="text/css"><br />
/*<br />
* base css, DO NOT MODIFY!<br />
*/<br />
* {<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
font-family: "Verdana", sans-serif;<br />
color: #333;<br />
list-style: none;<br />
outline: none;<br />
resize: none;<br />
}<br />
html {<br />
overflow-y: scroll;<br />
}<br />
body {<br />
background: url("https://static.igem.org/mediawiki/2012/2/22/Body-bg.jpg") center center fixed;<br />
}<br />
a {<br />
text-decoration: none;<br />
}<br />
.clear {<br />
width: 0;<br />
height: 0;<br />
line-height: 0;<br />
display: block;<br />
clear: both;<br />
}<br />
<br />
/*<br />
* common css, include "header","footer"...<br />
*/<br />
div.center {<br />
width: 1000px;<br />
margin: 0 auto;<br />
position: relative;<br />
}<br />
div.header {<br />
width: 1000px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/1/12/Header-bg.png") no-repeat;<br />
position: relative;<br />
z-index: 50;<br />
}<br />
div.nav {<br />
position: absolute;<br />
height: 80px;<br />
top: 185px;<br />
left: 245px;<br />
}<br />
li.nav-outerLi {<br />
display: block;<br />
float: left;<br />
width: 80px;<br />
height: 80px;<br />
margin: 0 6px;<br />
cursor: pointer;<br />
}<br />
h2.nav-h21,h2.nav-h22,h2.nav-h23,h2.nav-h24,h2.nav-h25,h2.nav-h26 {<br />
display: block;<br />
background: url("https://static.igem.org/mediawiki/2012/9/91/Nav-tabs.png") no-repeat;<br />
width: 80px;<br />
height: 80px;<br />
background-position: 0 0;<br />
z-index: 150;<br />
position: relative;<br />
}<br />
h2.nav-h22 {<br />
background-position: -80px 0;<br />
}<br />
h2.nav-h23 {<br />
background-position: -160px 0;<br />
}<br />
h2.nav-h24 {<br />
background-position: -240px 0;<br />
}<br />
h2.nav-h25 {<br />
background-position: -320px 0;<br />
}<br />
h2.nav-h26 {<br />
background-position: -400px 0;<br />
}<br />
h2.nav-h21:hover {<br />
background-position: 0 -80px;<br />
}<br />
h2.nav-h22:hover {<br />
background-position: -80px -80px;<br />
}<br />
h2.nav-h23:hover {<br />
background-position: -160px -80px;<br />
}<br />
h2.nav-h24:hover {<br />
background-position: -240px -80px;<br />
}<br />
h2.nav-h25:hover {<br />
background-position: -320px -80px;<br />
}<br />
h2.nav-h26:hover {<br />
background-position: -400px -80px;<br />
}<br />
h2.nav-h21on {<br />
background-position: 0 -160px;<br />
}<br />
h2.nav-h22on {<br />
background-position: -80px -160px;<br />
}<br />
h2.nav-h23on {<br />
background-position: -160px -160px;<br />
}<br />
h2.nav-h24on {<br />
background-position: -240px -160px;<br />
}<br />
h2.nav-h25on {<br />
background-position: -320px -160px;<br />
}<br />
h2.nav-h26on {<br />
background-position: -400px -160px;<br />
}<br />
ul.nav-innerUl{<br />
position: absolute;<br />
top: 40px;<br />
padding-top: 40px;<br />
width: 76px;<br />
border-left: 2px solid #000;<br />
border-right: 2px solid #000;<br />
z-index: 140;<br />
display: none;<br />
}<br />
em.nav-libg{<br />
display: block;<br />
width: 96px;<br />
height: 11px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/48/Nav-libg.png');<br />
margin-left: -10px;<br />
}<br />
ul.nav-innerUl1{<br />
background: #fffaca;<br />
}<br />
ul.nav-innerUl2{<br />
background: #dedede;<br />
}<br />
ul.nav-innerUl3{<br />
background: #d9f0c9;<br />
}<br />
ul.nav-innerUl4{<br />
background: #f6e5ff;<br />
}<br />
ul.nav-innerUl5{<br />
background: #ebfcff;<br />
}<br />
ul.nav-innerUl6{<br />
background: #ffeee8;<br />
}<br />
li.nav-innerLi{<br />
font-size: 10px;<br />
line-height: 14px;<br />
padding: 3px 5px;<br />
}<br />
li.nav-innerLi:hover{<br />
background: #fff;<br />
}<br />
div.middle {<br />
width: 940px;<br />
background: #e6deb8;<br />
background: rgba(230,222,184,0.5);<br />
position: absolute;<br />
top: 300px;<br />
left: 30px;<br />
}<br />
div.aside {<br />
width: 160px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/b/b3/Aside-bg.png") no-repeat;<br />
margin-left: 20px;<br />
margin-top: 100px;<br />
float: left;<br />
padding: 20px;<br />
}<br />
ul.aside-outerUl {<br />
margin: 15px;<br />
}<br />
li.aside-outerLi {<br />
margin: 15px 0;<br />
background: #fff1a9;<br />
padding: 5px 10px;<br />
color: #725718;<br />
font-size: 16px;<br />
line-height: 24px;<br />
font-weight: bold;<br />
text-align: center;<br />
cursor: pointer;<br />
}<br />
li.aside-outerLi:hover {<br />
background: #fff8d3;<br />
}<br />
div.main {<br />
width: 640px;<br />
height: 400px;<br />
border: 5px solid #333;<br />
background: #fff;<br />
float: right;<br />
margin: 100px 30px 30px 0;<br />
}<br />
div.footer {<br />
}<br />
<br />
/*<br />
* picSlider Css<br />
*/<br />
#picSlider {<br />
width: 640px;<br />
height: 320px;<br />
}<br />
.momo {<br />
background: #000;<br />
}<br />
.momo .pic li {<br />
width: 100%;<br />
height: 100%;<br />
overflow: hidden;<br />
position: absolute;<br />
display: none;<br />
}<br />
.momo .txt li {<br />
position: absolute;<br />
padding: 5px 10px;<br />
z-index: 2;<br />
bottom: 0;<br />
height: 28px;<br />
background: #DBDBDB;<br />
display: none;<br />
}<br />
.momo .txt li a {<br />
display: block;<br />
position: relative;<br />
z-index: 1;<br />
color: #333;<br />
font-size: 12px;<br />
font-weight: bold;<br />
text-decoration: none;<br />
}<br />
.momo .num {<br />
position: absolute;<br />
z-index: 3;<br />
bottom: 5px;<br />
right: 5px;<br />
}<br />
.momo .num li {<br />
float: left;<br />
}<br />
.momo .num li a {<br />
color: #333;<br />
float: left;<br />
margin-left: 3px;<br />
width: 15px;<br />
height: 15px;<br />
line-height: 15px;<br />
*line-height: 14px;<br />
overflow: hidden;<br />
border: 1px solid #AEC1CC;<br />
text-align: center;<br />
cursor: pointer;<br />
background: #fff;<br />
text-decoration: none;<br />
}<br />
.momo .num li.current a, .momo .num li.hover a {<br />
color: #fff;<br />
background: #f60;<br />
-webkit-transition: all 0.4s;<br />
-moz-transition: all 0.4s;<br />
-o-transition: all 0.4s;<br />
}<br />
.momo_picSlider .txt li{<br />
width: 620px;<br />
}<br />
.momo_picSlider .txt li a{<br />
font-size: 16px;<br />
line-height: 24px;<br />
}<br />
#p-logo {<br />
display:none;<br />
}<br />
#top-section {<br />
height:0;<br />
border:none;<br />
}<br />
#search-controls {<br />
display:none;<br />
}<br />
#content {<br />
position:inherit;<br />
width:inherit;<br />
margin:0;<br />
padding:0;<br />
background:inherit;<br />
color:inherit;<br />
border:none;<br />
line-height:inherit;<br />
z-index:2;<br />
}<br />
.firstHeading {<br />
display:none;<br />
}<br />
#catlinks {<br />
display:none;<br />
}<br />
#footer-box {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#menubar ul li a {<br />
background:none;<br />
}<br />
#bodyContent h1,#bodyContent h2 {<br />
margin:0;<br />
border:0;<br />
padding: 0;<br />
}<br />
.left-menu:hover {<br />
background:none;<br />
}<br />
</style><br />
<div class="center"><br />
<div class="header"><br />
<div class="nav"><br />
<ul class="nav-outerUl"><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China"><h2 class="nav-h21 nav-h21on" title="Home"></h2></a><br />
<ul class="nav-innerUl nav-innerUl1" name="Home"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Team"><h2 class="nav-h22" title="Team"></h2></a><br />
<ul class="nav-innerUl nav-innerUl2" name="Team"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Project"><h2 class="nav-h23" title="Project"></h2></a><br />
<ul class="nav-innerUl nav-innerUl3" name="Project"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Modeling"><h2 class="nav-h24" title="Modeling"></h2></a><br />
<ul class="nav-innerUl nav-innerUl4" name="Modeling"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Notebooks"><h2 class="nav-h25" title="Notebooks"></h2></a><br />
<ul class="nav-innerUl nav-innerUl5" name="Notebooks"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/humanPractice"><h2 class="nav-h26" title="Human Practice"></h2></a><br />
<ul class="nav-innerUl nav-innerUl6" name="HumanPractice"></ul><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div class="middle"><br />
<div class="aside"><br />
<ul class="aside-outerUl"></ul><br />
</div><br />
<div class="main"></div><br />
<div class="clear"></div><br />
</div><br />
<div class="footer"></div><br />
</div><br />
<script src="http://www.yichengliu.com/code/igem/home.js"></script><br />
</body><br />
</html></div>Nanhaihttp://2012.igem.org/Team:WHU-ChinaTeam:WHU-China2012-10-26T23:27:12Z<p>Nanhai: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<body><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script><br />
function picObj(src, title, detail, href){<br />
this.src = src;<br />
this.title = title;<br />
this.detail = detail;<br />
this.href = href;<br />
}<br />
//*************************自定义数据部分*************************<br />
<br />
//定义菜单及侧边栏数据<br />
var menuObj = {<br />
Home : [<br />
{<br />
title : "<strong>What's new</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/b/be/What%27s_new.png","Three advantages of the E.coslim", "Compared to traditional methods of losing weight, our E.coslim has three advantages: monitoring, high efficiency and long term efficiency.", "https://2012.igem.org/Team:WHU-China/Project?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/f/ff/Promoter_design.png", "Pcar and PfadR", "By inserting CRP and FadR binding site to overlap with the -10 region of constitutive promoter, we have successfully made two novel promoter Pcar and PfadR. Pcar is able to be induced by glucose, while PfadR is able to be induced by fatty acids.", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#Pcar"),<br />
new picObj("http://partsregistry.org/wiki/images/f/ff/%E5%85%A8%E6%99%AF%E5%8A%A0%E6%AD%BB%E4%BA%A11.png", "Panorama of the Whole Project Scheme", "Four novel devices, Fatty Acid Degradation, Cellulose Synthesis, Colonization and Death to ensure high efficiency orchestrate calorie absorption and bacteria survival and make you slim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#PfadR"),<br />
new picObj("https://static.igem.org/mediawiki/2012/0/09/%E8%83%96%E5%AD%90%E7%98%A6%E5%AD%90.png", "Long term efficiency of the E.coslim", "When viewed at macroscopic way, the E.coslim may have an advantage of long term efficiency,by regulating the human gut microbiota.And we have certified this by mathematical model.", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#PfadR")<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>Pathway Introduction</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/igem.org/8/82/Pathway_FattyAcid.png", "Fatty Acid Degradation", "Feel free to eat meat since the fat is all degraded by our E.coslim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=3"),<br />
new picObj("https://static.igem.org/mediawiki/igem.org/1/18/Pathway_Cellulose.png", "Cellulose Synthesis", "Transforming glucose into cellulose, the high-sugar food you eat will be turned into vegetables!", "https://2012.igem.org/Team:WHU-China/Project?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/e/ea/Device_three.png", "Colonization", "The magic molecule c-di-GMP enables E.coslim colonizing in the gut to better fulfill its magic function!", "https://2012.igem.org/Team:WHU-China/Project?catalog=5")<br />
]<br />
},<br />
<br />
{<br />
title : "<strong>Future Perspective</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/ab/%E5%8F%8C%E8%83%B6%E5%9B%8A2.jpg", "Two Capsule Design", "Capsule I, the E.coslim, makes you slim, while Capsule II, xylose, terminates the effects of the former.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/d/d2/Fpbody2.jpg", "In vitro experiment in a simulated intestine", "The gut microbiota and E.coslim will be inoculated in a simulated intestine, then the concentration measurement of each component will tell us whether E.coslim works as desired.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/8/85/%E5%B0%8F%E9%BC%A0%E5%AE%9E%E9%AA%8C02.jpg", "In vivo experiment in mice", "E.coslim will also be inoculated into mice and the culture-independent microbiome analysis will tell us the real situation in vivo.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0")<br />
]<br />
},<br />
<br />
<br />
<br />
{<br />
title : "<strong>Achievement</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/f/fd/Achievements_device.png", "Devices", "This year,our project has focused on some of the hotspot issues,such as c-di-CMP ,gut microbiota. In all we submitted 66 new biobricks and 39 of them have been proved to be effective.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/c/ca/Achievements_1.png", "Biobicks we have improved", "In our project, we have improved the function of some biobricks,such as BBa_J54222, BBa_K188011 and BBa_R0051. ", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/f/f5/Achievements_2.png", "Novel promoter we designed", "Novel promoter we designed", "As the existing promoter can not meet our demand, we designed two novel promoters Pcar and Pfad to achieve the goal. In addition, we also have set up a standard for promoter design.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/2/2c/Achievements2.png", "Methods we improved", "In our project,we improved some traditional methods to measure the comsumption of fatty acids and production of cellulose, and also we developed a software named FANCY to detect the fluorescence intensity of single cell. ", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/b/b0/Achievements_human.png", "Human Practice", "We have helped HUST iGEM team debug their project and mathematical model. We also did a survey on GMOs and publicized iGEM to the public.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>About Us</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/a7/Whu-2012-1.jpg", "WHU-China 2012, I was there", "The Entrance of State Wuhan University", "https://2012.igem.org/Team:WHU-China/Team?catalog=1"),<br />
new picObj("https://static.igem.org/mediawiki/2012/2/23/Whu2012heying.jpg", "MIT, we're coming!", "Collge of Life Sciences of WHU", "https://2012.igem.org/Team:WHU-China/Team?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/4/43/Whu2012-2.jpg", "WHU-China, Hooray!", "Yuntai Mountain, Henan Province", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=5")<br />
]<br />
}<br />
],<br />
Team : [<br />
{<br />
title : '<strong>Members</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Instructors</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Team History</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About WHU</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About Our Lab</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Acknow-</br>ledgements</strong>',<br />
dir : []<br />
},<br />
<br />
],<br />
Project : [<br />
{<br />
title : '<strong>Description</strong>',<br />
dir : [<br />
<br />
]<br />
},<br />
{<br />
title : '<strong>Background</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Promoter Design</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device I: Fatty Acid Degradation</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device II: Cellulose Synthesis</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device III: Colonization</strong>',<br />
dir : []<br />
},<br />
],<br />
Modeling : [<br />
{<br />
title : '<strong>Future Perspectives</strong>',<br />
dir : []<br />
},<br />
<br />
{<br />
title : '<strong>Model I: Fatty Acid Degradation</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Model II: Microbiota Regulation</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Software Tool: FANCY</strong>',<br />
dir : []<br />
}<br />
],<br />
Notebooks : [<br />
{<br />
title : '<strong>Parts</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Safety</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Protocols</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Events</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Brain-</br>storming</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Gallery</strong>',<br />
dir : []<br />
}<br />
],<br />
HumanPractice : [<br />
{<br />
title : '<strong>Outline</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Questionaire Survey</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Publicity</strong>',<br />
dir : []<br />
}<br />
]<br />
}; <br />
//*************************自定义数据部分*************************<br />
</script><br />
<style type="text/css"><br />
/*<br />
* base css, DO NOT MODIFY!<br />
*/<br />
* {<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
font-family: "Verdana", sans-serif;<br />
color: #333;<br />
list-style: none;<br />
outline: none;<br />
resize: none;<br />
}<br />
html {<br />
overflow-y: scroll;<br />
}<br />
body {<br />
background: url("https://static.igem.org/mediawiki/2012/2/22/Body-bg.jpg") center center fixed;<br />
}<br />
a {<br />
text-decoration: none;<br />
}<br />
.clear {<br />
width: 0;<br />
height: 0;<br />
line-height: 0;<br />
display: block;<br />
clear: both;<br />
}<br />
<br />
/*<br />
* common css, include "header","footer"...<br />
*/<br />
div.center {<br />
width: 1000px;<br />
margin: 0 auto;<br />
position: relative;<br />
}<br />
div.header {<br />
width: 1000px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/1/12/Header-bg.png") no-repeat;<br />
position: relative;<br />
z-index: 50;<br />
}<br />
div.nav {<br />
position: absolute;<br />
height: 80px;<br />
top: 185px;<br />
left: 245px;<br />
}<br />
li.nav-outerLi {<br />
display: block;<br />
float: left;<br />
width: 80px;<br />
height: 80px;<br />
margin: 0 6px;<br />
cursor: pointer;<br />
}<br />
h2.nav-h21,h2.nav-h22,h2.nav-h23,h2.nav-h24,h2.nav-h25,h2.nav-h26 {<br />
display: block;<br />
background: url("https://static.igem.org/mediawiki/2012/9/91/Nav-tabs.png") no-repeat;<br />
width: 80px;<br />
height: 80px;<br />
background-position: 0 0;<br />
z-index: 150;<br />
position: relative;<br />
}<br />
h2.nav-h22 {<br />
background-position: -80px 0;<br />
}<br />
h2.nav-h23 {<br />
background-position: -160px 0;<br />
}<br />
h2.nav-h24 {<br />
background-position: -240px 0;<br />
}<br />
h2.nav-h25 {<br />
background-position: -320px 0;<br />
}<br />
h2.nav-h26 {<br />
background-position: -400px 0;<br />
}<br />
h2.nav-h21:hover {<br />
background-position: 0 -80px;<br />
}<br />
h2.nav-h22:hover {<br />
background-position: -80px -80px;<br />
}<br />
h2.nav-h23:hover {<br />
background-position: -160px -80px;<br />
}<br />
h2.nav-h24:hover {<br />
background-position: -240px -80px;<br />
}<br />
h2.nav-h25:hover {<br />
background-position: -320px -80px;<br />
}<br />
h2.nav-h26:hover {<br />
background-position: -400px -80px;<br />
}<br />
h2.nav-h21on {<br />
background-position: 0 -160px;<br />
}<br />
h2.nav-h22on {<br />
background-position: -80px -160px;<br />
}<br />
h2.nav-h23on {<br />
background-position: -160px -160px;<br />
}<br />
h2.nav-h24on {<br />
background-position: -240px -160px;<br />
}<br />
h2.nav-h25on {<br />
background-position: -320px -160px;<br />
}<br />
h2.nav-h26on {<br />
background-position: -400px -160px;<br />
}<br />
ul.nav-innerUl{<br />
position: absolute;<br />
top: 40px;<br />
padding-top: 40px;<br />
width: 76px;<br />
border-left: 2px solid #000;<br />
border-right: 2px solid #000;<br />
z-index: 140;<br />
display: none;<br />
}<br />
em.nav-libg{<br />
display: block;<br />
width: 96px;<br />
height: 11px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/48/Nav-libg.png');<br />
margin-left: -10px;<br />
}<br />
ul.nav-innerUl1{<br />
background: #fffaca;<br />
}<br />
ul.nav-innerUl2{<br />
background: #dedede;<br />
}<br />
ul.nav-innerUl3{<br />
background: #d9f0c9;<br />
}<br />
ul.nav-innerUl4{<br />
background: #f6e5ff;<br />
}<br />
ul.nav-innerUl5{<br />
background: #ebfcff;<br />
}<br />
ul.nav-innerUl6{<br />
background: #ffeee8;<br />
}<br />
li.nav-innerLi{<br />
font-size: 10px;<br />
line-height: 14px;<br />
padding: 3px 5px;<br />
}<br />
li.nav-innerLi:hover{<br />
background: #fff;<br />
}<br />
div.middle {<br />
width: 940px;<br />
background: #e6deb8;<br />
background: rgba(230,222,184,0.5);<br />
position: absolute;<br />
top: 300px;<br />
left: 30px;<br />
}<br />
div.aside {<br />
width: 160px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/b/b3/Aside-bg.png") no-repeat;<br />
margin-left: 20px;<br />
margin-top: 100px;<br />
float: left;<br />
padding: 20px;<br />
}<br />
ul.aside-outerUl {<br />
margin: 15px;<br />
}<br />
li.aside-outerLi {<br />
margin: 15px 0;<br />
background: #fff1a9;<br />
padding: 5px 10px;<br />
color: #725718;<br />
font-size: 16px;<br />
line-height: 24px;<br />
font-weight: bold;<br />
text-align: center;<br />
cursor: pointer;<br />
}<br />
li.aside-outerLi:hover {<br />
background: #fff8d3;<br />
}<br />
div.main {<br />
width: 640px;<br />
height: 400px;<br />
border: 5px solid #333;<br />
background: #fff;<br />
float: right;<br />
margin: 100px 30px 30px 0;<br />
}<br />
div.footer {<br />
}<br />
<br />
/*<br />
* picSlider Css<br />
*/<br />
#picSlider {<br />
width: 640px;<br />
height: 320px;<br />
}<br />
.momo {<br />
background: #000;<br />
}<br />
.momo .pic li {<br />
width: 100%;<br />
height: 100%;<br />
overflow: hidden;<br />
position: absolute;<br />
display: none;<br />
}<br />
.momo .txt li {<br />
position: absolute;<br />
padding: 5px 10px;<br />
z-index: 2;<br />
bottom: 0;<br />
height: 28px;<br />
background: #DBDBDB;<br />
display: none;<br />
}<br />
.momo .txt li a {<br />
display: block;<br />
position: relative;<br />
z-index: 1;<br />
color: #333;<br />
font-size: 12px;<br />
font-weight: bold;<br />
text-decoration: none;<br />
}<br />
.momo .num {<br />
position: absolute;<br />
z-index: 3;<br />
bottom: 5px;<br />
right: 5px;<br />
}<br />
.momo .num li {<br />
float: left;<br />
}<br />
.momo .num li a {<br />
color: #333;<br />
float: left;<br />
margin-left: 3px;<br />
width: 15px;<br />
height: 15px;<br />
line-height: 15px;<br />
*line-height: 14px;<br />
overflow: hidden;<br />
border: 1px solid #AEC1CC;<br />
text-align: center;<br />
cursor: pointer;<br />
background: #fff;<br />
text-decoration: none;<br />
}<br />
.momo .num li.current a, .momo .num li.hover a {<br />
color: #fff;<br />
background: #f60;<br />
-webkit-transition: all 0.4s;<br />
-moz-transition: all 0.4s;<br />
-o-transition: all 0.4s;<br />
}<br />
.momo_picSlider .txt li{<br />
width: 620px;<br />
}<br />
.momo_picSlider .txt li a{<br />
font-size: 16px;<br />
line-height: 24px;<br />
}<br />
#p-logo {<br />
display:none;<br />
}<br />
#top-section {<br />
height:0;<br />
border:none;<br />
}<br />
#search-controls {<br />
display:none;<br />
}<br />
#content {<br />
position:inherit;<br />
width:inherit;<br />
margin:0;<br />
padding:0;<br />
background:inherit;<br />
color:inherit;<br />
border:none;<br />
line-height:inherit;<br />
z-index:2;<br />
}<br />
.firstHeading {<br />
display:none;<br />
}<br />
#catlinks {<br />
display:none;<br />
}<br />
#footer-box {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#menubar ul li a {<br />
background:none;<br />
}<br />
#bodyContent h1,#bodyContent h2 {<br />
margin:0;<br />
border:0;<br />
padding: 0;<br />
}<br />
.left-menu:hover {<br />
background:none;<br />
}<br />
</style><br />
<div class="center"><br />
<div class="header"><br />
<div class="nav"><br />
<ul class="nav-outerUl"><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China"><h2 class="nav-h21 nav-h21on" title="Home"></h2></a><br />
<ul class="nav-innerUl nav-innerUl1" name="Home"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Team"><h2 class="nav-h22" title="Team"></h2></a><br />
<ul class="nav-innerUl nav-innerUl2" name="Team"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Project"><h2 class="nav-h23" title="Project"></h2></a><br />
<ul class="nav-innerUl nav-innerUl3" name="Project"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Modeling"><h2 class="nav-h24" title="Modeling"></h2></a><br />
<ul class="nav-innerUl nav-innerUl4" name="Modeling"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Notebooks"><h2 class="nav-h25" title="Notebooks"></h2></a><br />
<ul class="nav-innerUl nav-innerUl5" name="Notebooks"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/humanPractice"><h2 class="nav-h26" title="Human Practice"></h2></a><br />
<ul class="nav-innerUl nav-innerUl6" name="HumanPractice"></ul><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div class="middle"><br />
<div class="aside"><br />
<ul class="aside-outerUl"></ul><br />
</div><br />
<div class="main"></div><br />
<div class="clear"></div><br />
</div><br />
<div class="footer"></div><br />
</div><br />
<script src="http://www.yichengliu.com/code/igem/home.js"></script><br />
</body><br />
</html></div>Nanhaihttp://2012.igem.org/Team:WHU-ChinaTeam:WHU-China2012-10-26T23:22:08Z<p>Nanhai: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<body><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script><br />
function picObj(src, title, detail, href){<br />
this.src = src;<br />
this.title = title;<br />
this.detail = detail;<br />
this.href = href;<br />
}<br />
//*************************自定义数据部分*************************<br />
<br />
//定义菜单及侧边栏数据<br />
var menuObj = {<br />
Home : [<br />
{<br />
title : "<strong>What's new</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/b/be/What%27s_new.png", "Three advantages of the E.coslim", "Three advantages of the E.coslim", "Compared to traditional methods of losing weight, our E.coslim has three advantages: monitoring, high efficiency and long term efficiency.", "https://2012.igem.org/Team:WHU-China/Project?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/f/ff/Promoter_design.png", "Pcar and PfadR", "By inserting CRP and FadR binding site to overlap with the -10 region of constitutive promoter, we have successfully made two novel promoter Pcar and PfadR. Pcar is able to be induced by glucose, while PfadR is able to be induced by fatty acids.", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#Pcar"),<br />
new picObj("http://partsregistry.org/wiki/images/f/ff/%E5%85%A8%E6%99%AF%E5%8A%A0%E6%AD%BB%E4%BA%A11.png", "Panorama of the Whole Project Scheme", "Four novel devices, Fatty Acid Degradation, Cellulose Synthesis, Colonization and Death to ensure high efficiency orchestrate calorie absorption and bacteria survival and make you slim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#PfadR"),<br />
new picObj("https://static.igem.org/mediawiki/2012/0/09/%E8%83%96%E5%AD%90%E7%98%A6%E5%AD%90.png", "Long term efficiency of the E.coslim", "When viewed at macroscopic way, the E.coslim may have an advantage of long term efficiency,by regulating the human gut microbiota.And we have certified this by mathematical model.", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#PfadR")<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>Pathway Introduction</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/igem.org/8/82/Pathway_FattyAcid.png", "Fatty Acid Degradation", "Feel free to eat meat since the fat is all degraded by our E.coslim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=3"),<br />
new picObj("https://static.igem.org/mediawiki/igem.org/1/18/Pathway_Cellulose.png", "Cellulose Synthesis", "Transforming glucose into cellulose, the high-sugar food you eat will be turned into vegetables!", "https://2012.igem.org/Team:WHU-China/Project?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/e/ea/Device_three.png", "Colonization", "The magic molecule c-di-GMP enables E.coslim colonizing in the gut to better fulfill its magic function!", "https://2012.igem.org/Team:WHU-China/Project?catalog=5")<br />
]<br />
},<br />
<br />
{<br />
title : "<strong>Future Perspective</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/ab/%E5%8F%8C%E8%83%B6%E5%9B%8A2.jpg", "Two Capsule Design", "Capsule I, the E.coslim, makes you slim, while Capsule II, xylose, terminates the effects of the former.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/d/d2/Fpbody2.jpg", "In vitro experiment in a simulated intestine", "The gut microbiota and E.coslim will be inoculated in a simulated intestine, then the concentration measurement of each component will tell us whether E.coslim works as desired.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/8/85/%E5%B0%8F%E9%BC%A0%E5%AE%9E%E9%AA%8C02.jpg", "In vivo experiment in mice", "E.coslim will also be inoculated into mice and the culture-independent microbiome analysis will tell us the real situation in vivo.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0")<br />
]<br />
},<br />
<br />
<br />
<br />
{<br />
title : "<strong>Achievement</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/f/fd/Achievements_device.png", "Devices", "This year,our project has focused on some of the hotspot issues,such as c-di-CMP ,gut microbiota. In all we submitted 66 new biobricks and 39 of them have been proved to be effective.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/c/ca/Achievements_1.png", "Biobicks we have improved", "In our project, we have improved the function of some biobricks,such as BBa_J54222, BBa_K188011 and BBa_R0051. ", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/f/f5/Achievements_2.png", "Novel promoter we designed", "Novel promoter we designed", "As the existing promoter can not meet our demand, we designed two novel promoters Pcar and Pfad to achieve the goal. In addition, we also have set up a standard for promoter design.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/2/2c/Achievements2.png", "Methods we improved", "In our project,we improved some traditional methods to measure the comsumption of fatty acids and production of cellulose, and also we developed a software named FANCY to detect the fluorescence intensity of single cell. ", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/b/b0/Achievements_human.png", "Human Practice", "We have helped HUST iGEM team debug their project and mathematical model. We also did a survey on GMOs and publicized iGEM to the public.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>About Us</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/a7/Whu-2012-1.jpg", "WHU-China 2012, I was there", "The Entrance of State Wuhan University", "https://2012.igem.org/Team:WHU-China/Team?catalog=1"),<br />
new picObj("https://static.igem.org/mediawiki/2012/2/23/Whu2012heying.jpg", "MIT, we're coming!", "Collge of Life Sciences of WHU", "https://2012.igem.org/Team:WHU-China/Team?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/4/43/Whu2012-2.jpg", "WHU-China, Hooray!", "Yuntai Mountain, Henan Province", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=5")<br />
]<br />
}<br />
],<br />
Team : [<br />
{<br />
title : '<strong>Members</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Instructors</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Team History</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About WHU</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About Our Lab</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Acknow-</br>ledgements</strong>',<br />
dir : []<br />
},<br />
<br />
],<br />
Project : [<br />
{<br />
title : '<strong>Description</strong>',<br />
dir : [<br />
<br />
]<br />
},<br />
{<br />
title : '<strong>Background</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Promoter Design</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device I: Fatty Acid Degradation</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device II: Cellulose Synthesis</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device III: Colonization</strong>',<br />
dir : []<br />
},<br />
],<br />
Modeling : [<br />
{<br />
title : '<strong>Future Perspectives</strong>',<br />
dir : []<br />
},<br />
<br />
{<br />
title : '<strong>Model I: Fatty Acid Degradation</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Model II: Microbiota Regulation</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Software Tool: FANCY</strong>',<br />
dir : []<br />
}<br />
],<br />
Notebooks : [<br />
{<br />
title : '<strong>Parts</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Safety</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Protocols</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Events</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Brain-</br>storming</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Gallery</strong>',<br />
dir : []<br />
}<br />
],<br />
HumanPractice : [<br />
{<br />
title : '<strong>Outline</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Questionaire Survey</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Publicity</strong>',<br />
dir : []<br />
}<br />
]<br />
}; <br />
//*************************自定义数据部分*************************<br />
</script><br />
<style type="text/css"><br />
/*<br />
* base css, DO NOT MODIFY!<br />
*/<br />
* {<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
font-family: "Verdana", sans-serif;<br />
color: #333;<br />
list-style: none;<br />
outline: none;<br />
resize: none;<br />
}<br />
html {<br />
overflow-y: scroll;<br />
}<br />
body {<br />
background: url("https://static.igem.org/mediawiki/2012/2/22/Body-bg.jpg") center center fixed;<br />
}<br />
a {<br />
text-decoration: none;<br />
}<br />
.clear {<br />
width: 0;<br />
height: 0;<br />
line-height: 0;<br />
display: block;<br />
clear: both;<br />
}<br />
<br />
/*<br />
* common css, include "header","footer"...<br />
*/<br />
div.center {<br />
width: 1000px;<br />
margin: 0 auto;<br />
position: relative;<br />
}<br />
div.header {<br />
width: 1000px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/1/12/Header-bg.png") no-repeat;<br />
position: relative;<br />
z-index: 50;<br />
}<br />
div.nav {<br />
position: absolute;<br />
height: 80px;<br />
top: 185px;<br />
left: 245px;<br />
}<br />
li.nav-outerLi {<br />
display: block;<br />
float: left;<br />
width: 80px;<br />
height: 80px;<br />
margin: 0 6px;<br />
cursor: pointer;<br />
}<br />
h2.nav-h21,h2.nav-h22,h2.nav-h23,h2.nav-h24,h2.nav-h25,h2.nav-h26 {<br />
display: block;<br />
background: url("https://static.igem.org/mediawiki/2012/9/91/Nav-tabs.png") no-repeat;<br />
width: 80px;<br />
height: 80px;<br />
background-position: 0 0;<br />
z-index: 150;<br />
position: relative;<br />
}<br />
h2.nav-h22 {<br />
background-position: -80px 0;<br />
}<br />
h2.nav-h23 {<br />
background-position: -160px 0;<br />
}<br />
h2.nav-h24 {<br />
background-position: -240px 0;<br />
}<br />
h2.nav-h25 {<br />
background-position: -320px 0;<br />
}<br />
h2.nav-h26 {<br />
background-position: -400px 0;<br />
}<br />
h2.nav-h21:hover {<br />
background-position: 0 -80px;<br />
}<br />
h2.nav-h22:hover {<br />
background-position: -80px -80px;<br />
}<br />
h2.nav-h23:hover {<br />
background-position: -160px -80px;<br />
}<br />
h2.nav-h24:hover {<br />
background-position: -240px -80px;<br />
}<br />
h2.nav-h25:hover {<br />
background-position: -320px -80px;<br />
}<br />
h2.nav-h26:hover {<br />
background-position: -400px -80px;<br />
}<br />
h2.nav-h21on {<br />
background-position: 0 -160px;<br />
}<br />
h2.nav-h22on {<br />
background-position: -80px -160px;<br />
}<br />
h2.nav-h23on {<br />
background-position: -160px -160px;<br />
}<br />
h2.nav-h24on {<br />
background-position: -240px -160px;<br />
}<br />
h2.nav-h25on {<br />
background-position: -320px -160px;<br />
}<br />
h2.nav-h26on {<br />
background-position: -400px -160px;<br />
}<br />
ul.nav-innerUl{<br />
position: absolute;<br />
top: 40px;<br />
padding-top: 40px;<br />
width: 76px;<br />
border-left: 2px solid #000;<br />
border-right: 2px solid #000;<br />
z-index: 140;<br />
display: none;<br />
}<br />
em.nav-libg{<br />
display: block;<br />
width: 96px;<br />
height: 11px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/48/Nav-libg.png');<br />
margin-left: -10px;<br />
}<br />
ul.nav-innerUl1{<br />
background: #fffaca;<br />
}<br />
ul.nav-innerUl2{<br />
background: #dedede;<br />
}<br />
ul.nav-innerUl3{<br />
background: #d9f0c9;<br />
}<br />
ul.nav-innerUl4{<br />
background: #f6e5ff;<br />
}<br />
ul.nav-innerUl5{<br />
background: #ebfcff;<br />
}<br />
ul.nav-innerUl6{<br />
background: #ffeee8;<br />
}<br />
li.nav-innerLi{<br />
font-size: 10px;<br />
line-height: 14px;<br />
padding: 3px 5px;<br />
}<br />
li.nav-innerLi:hover{<br />
background: #fff;<br />
}<br />
div.middle {<br />
width: 940px;<br />
background: #e6deb8;<br />
background: rgba(230,222,184,0.5);<br />
position: absolute;<br />
top: 300px;<br />
left: 30px;<br />
}<br />
div.aside {<br />
width: 160px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/b/b3/Aside-bg.png") no-repeat;<br />
margin-left: 20px;<br />
margin-top: 100px;<br />
float: left;<br />
padding: 20px;<br />
}<br />
ul.aside-outerUl {<br />
margin: 15px;<br />
}<br />
li.aside-outerLi {<br />
margin: 15px 0;<br />
background: #fff1a9;<br />
padding: 5px 10px;<br />
color: #725718;<br />
font-size: 16px;<br />
line-height: 24px;<br />
font-weight: bold;<br />
text-align: center;<br />
cursor: pointer;<br />
}<br />
li.aside-outerLi:hover {<br />
background: #fff8d3;<br />
}<br />
div.main {<br />
width: 640px;<br />
height: 400px;<br />
border: 5px solid #333;<br />
background: #fff;<br />
float: right;<br />
margin: 100px 30px 30px 0;<br />
}<br />
div.footer {<br />
}<br />
<br />
/*<br />
* picSlider Css<br />
*/<br />
#picSlider {<br />
width: 640px;<br />
height: 320px;<br />
}<br />
.momo {<br />
background: #000;<br />
}<br />
.momo .pic li {<br />
width: 100%;<br />
height: 100%;<br />
overflow: hidden;<br />
position: absolute;<br />
display: none;<br />
}<br />
.momo .txt li {<br />
position: absolute;<br />
padding: 5px 10px;<br />
z-index: 2;<br />
bottom: 0;<br />
height: 28px;<br />
background: #DBDBDB;<br />
display: none;<br />
}<br />
.momo .txt li a {<br />
display: block;<br />
position: relative;<br />
z-index: 1;<br />
color: #333;<br />
font-size: 12px;<br />
font-weight: bold;<br />
text-decoration: none;<br />
}<br />
.momo .num {<br />
position: absolute;<br />
z-index: 3;<br />
bottom: 5px;<br />
right: 5px;<br />
}<br />
.momo .num li {<br />
float: left;<br />
}<br />
.momo .num li a {<br />
color: #333;<br />
float: left;<br />
margin-left: 3px;<br />
width: 15px;<br />
height: 15px;<br />
line-height: 15px;<br />
*line-height: 14px;<br />
overflow: hidden;<br />
border: 1px solid #AEC1CC;<br />
text-align: center;<br />
cursor: pointer;<br />
background: #fff;<br />
text-decoration: none;<br />
}<br />
.momo .num li.current a, .momo .num li.hover a {<br />
color: #fff;<br />
background: #f60;<br />
-webkit-transition: all 0.4s;<br />
-moz-transition: all 0.4s;<br />
-o-transition: all 0.4s;<br />
}<br />
.momo_picSlider .txt li{<br />
width: 620px;<br />
}<br />
.momo_picSlider .txt li a{<br />
font-size: 16px;<br />
line-height: 24px;<br />
}<br />
#p-logo {<br />
display:none;<br />
}<br />
#top-section {<br />
height:0;<br />
border:none;<br />
}<br />
#search-controls {<br />
display:none;<br />
}<br />
#content {<br />
position:inherit;<br />
width:inherit;<br />
margin:0;<br />
padding:0;<br />
background:inherit;<br />
color:inherit;<br />
border:none;<br />
line-height:inherit;<br />
z-index:2;<br />
}<br />
.firstHeading {<br />
display:none;<br />
}<br />
#catlinks {<br />
display:none;<br />
}<br />
#footer-box {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#menubar ul li a {<br />
background:none;<br />
}<br />
#bodyContent h1,#bodyContent h2 {<br />
margin:0;<br />
border:0;<br />
padding: 0;<br />
}<br />
.left-menu:hover {<br />
background:none;<br />
}<br />
</style><br />
<div class="center"><br />
<div class="header"><br />
<div class="nav"><br />
<ul class="nav-outerUl"><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China"><h2 class="nav-h21 nav-h21on" title="Home"></h2></a><br />
<ul class="nav-innerUl nav-innerUl1" name="Home"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Team"><h2 class="nav-h22" title="Team"></h2></a><br />
<ul class="nav-innerUl nav-innerUl2" name="Team"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Project"><h2 class="nav-h23" title="Project"></h2></a><br />
<ul class="nav-innerUl nav-innerUl3" name="Project"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Modeling"><h2 class="nav-h24" title="Modeling"></h2></a><br />
<ul class="nav-innerUl nav-innerUl4" name="Modeling"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Notebooks"><h2 class="nav-h25" title="Notebooks"></h2></a><br />
<ul class="nav-innerUl nav-innerUl5" name="Notebooks"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/humanPractice"><h2 class="nav-h26" title="Human Practice"></h2></a><br />
<ul class="nav-innerUl nav-innerUl6" name="HumanPractice"></ul><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div class="middle"><br />
<div class="aside"><br />
<ul class="aside-outerUl"></ul><br />
</div><br />
<div class="main"></div><br />
<div class="clear"></div><br />
</div><br />
<div class="footer"></div><br />
</div><br />
<script src="http://www.yichengliu.com/code/igem/home.js"></script><br />
</body><br />
</html></div>Nanhaihttp://2012.igem.org/Team:WHU-ChinaTeam:WHU-China2012-10-26T23:13:44Z<p>Nanhai: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<body><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script><br />
function picObj(src, title, detail, href){<br />
this.src = src;<br />
this.title = title;<br />
this.detail = detail;<br />
this.href = href;<br />
}<br />
//*************************自定义数据部分*************************<br />
<br />
//定义菜单及侧边栏数据<br />
var menuObj = {<br />
Home : [<br />
{<br />
title : "<strong>What's new</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/b/be/What%27s_new.png", "Three advantages of the E.coslim", "Three advantages of the E.coslim", "Compared to traditional methods of losing weight, our E.coslim has three advantages: monitoring, high efficiency and long term efficiency.", "https://2012.igem.org/Team:WHU-China/Project?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/f/ff/Promoter_design.png", "Pcar and PfadR", "By inserting CRP and FadR binding site to overlap with the -10 region of constitutive promoter, we have successfully made two novel promoter Pcar and PfadR. Pcar is able to be induced by glucose, while PfadR is able to be induced by fatty acids.", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#Pcar"),<br />
new picObj("http://partsregistry.org/wiki/images/f/ff/%E5%85%A8%E6%99%AF%E5%8A%A0%E6%AD%BB%E4%BA%A11.png", "Panorama of the Whole Project Scheme", "Four novel devices, Fatty Acid Degradation, Cellulose Synthesis, Colonization and Death to ensure high efficiency orchestrate calorie absorption and bacteria survival and make you slim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#PfadR"),<br />
new picObj("https://static.igem.org/mediawiki/2012/0/09/%E8%83%96%E5%AD%90%E7%98%A6%E5%AD%90.png", "Long term efficiency of the E.coslim", "When viewed at macroscopic way, the E.coslim may have an advantage of long term efficiency,by regulating the human gut microbiota.And we have certified this by mathematical model.", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#PfadR")<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>Pathway Introduction</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/igem.org/8/82/Pathway_FattyAcid.png", "Fatty Acid Degradation", "Feel free to eat meat since the fat is all degraded by our E.coslim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=3"),<br />
new picObj("https://static.igem.org/mediawiki/igem.org/1/18/Pathway_Cellulose.png", "Cellulose Synthesis", "Transforming glucose into cellulose, the high-sugar food you eat will be turned into vegetables!", "https://2012.igem.org/Team:WHU-China/Project?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/e/ea/Device_three.png", "Colonization", "The magic molecule c-di-GMP enables E.coslim colonizing in the gut to better fulfill its magic function!", "https://2012.igem.org/Team:WHU-China/Project?catalog=5")<br />
]<br />
},<br />
<br />
{<br />
title : "<strong>Future Perspective</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/ab/%E5%8F%8C%E8%83%B6%E5%9B%8A2.jpg", "Two Capsule Design", "Capsule I, the E.coslim, makes you slim, while Capsule II, xylose, terminates the effects of the former.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/d/d2/Fpbody2.jpg", "In vitro experiment in a simulated intestine", "The gut microbiota and E.coslim will be inoculated in a simulated intestine, then the concentration measurement of each component will tell us whether E.coslim works as desired.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/8/85/%E5%B0%8F%E9%BC%A0%E5%AE%9E%E9%AA%8C02.jpg", "In vivo experiment in mice", "E.coslim will also be inoculated into mice and the culture-independent microbiome analysis will tell us the real situation in vivo.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0")<br />
]<br />
},<br />
<br />
<br />
<br />
{<br />
title : "<strong>Achievement</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/c/ca/Achievements_1.png", "Biobicks we have improved", "In our project,we have improved the function of some biobricks,such as BBa_J54222,BBa_K188011 and BBa_R0051.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/f/f5/Achievements_2.png", "Novel promoter we designed", "Because no such promoter which can meet our demand exists in the nature, we designed two novel promoter Pcar and PfadR to achieve the goal.In addition, we also have set up a standard for promoter design. ", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/3/31/Achievements_methods.png", "Methods we improved", "In our project,we improved some traditional method to measure fatty acids and cellulose, and also we developped a software named FANCY to detect the fluorescence intensity of single cell", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/b/b0/Achievements_human.png", "Human Practice", "We have helped another iGEM team to debug their project and mathematical model,also we did a survey on GMOs and publisized iGEM to the public ", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/a/ac/Achievements_5.png", "Devices", "This year,our project has focused on some of the the hot-button issues,such as c-di-CMP ,gut microbiota and so on. At last, we submitted 66 new biobricks", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>About Us</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/a7/Whu-2012-1.jpg", "WHU-China 2012, I was there", "The Entrance of State Wuhan University", "https://2012.igem.org/Team:WHU-China/Team?catalog=1"),<br />
new picObj("https://static.igem.org/mediawiki/2012/2/23/Whu2012heying.jpg", "MIT, we're coming!", "Collge of Life Sciences of WHU", "https://2012.igem.org/Team:WHU-China/Team?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/4/43/Whu2012-2.jpg", "WHU-China, Hooray!", "Yuntai Mountain, Henan Province", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=5")<br />
]<br />
}<br />
],<br />
Team : [<br />
{<br />
title : '<strong>Members</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Instructors</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Team History</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About WHU</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About Our Lab</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Acknow-</br>ledgements</strong>',<br />
dir : []<br />
},<br />
<br />
],<br />
Project : [<br />
{<br />
title : '<strong>Description</strong>',<br />
dir : [<br />
<br />
]<br />
},<br />
{<br />
title : '<strong>Background</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Promoter Design</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device I: Fatty Acid Degradation</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device II: Cellulose Synthesis</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device III: Colonization</strong>',<br />
dir : []<br />
},<br />
],<br />
Modeling : [<br />
{<br />
title : '<strong>Future Perspectives</strong>',<br />
dir : []<br />
},<br />
<br />
{<br />
title : '<strong>Model I: Fatty Acid Degradation</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Model II: Microbiota Regulation</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Software Tool: FANCY</strong>',<br />
dir : []<br />
}<br />
],<br />
Notebooks : [<br />
{<br />
title : '<strong>Parts</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Safety</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Protocols</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Events</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Brain-</br>storming</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Gallery</strong>',<br />
dir : []<br />
}<br />
],<br />
HumanPractice : [<br />
{<br />
title : '<strong>Outline</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Questionaire Survey</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Publicity</strong>',<br />
dir : []<br />
}<br />
]<br />
}; <br />
//*************************自定义数据部分*************************<br />
</script><br />
<style type="text/css"><br />
/*<br />
* base css, DO NOT MODIFY!<br />
*/<br />
* {<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
font-family: "Verdana", sans-serif;<br />
color: #333;<br />
list-style: none;<br />
outline: none;<br />
resize: none;<br />
}<br />
html {<br />
overflow-y: scroll;<br />
}<br />
body {<br />
background: url("https://static.igem.org/mediawiki/2012/2/22/Body-bg.jpg") center center fixed;<br />
}<br />
a {<br />
text-decoration: none;<br />
}<br />
.clear {<br />
width: 0;<br />
height: 0;<br />
line-height: 0;<br />
display: block;<br />
clear: both;<br />
}<br />
<br />
/*<br />
* common css, include "header","footer"...<br />
*/<br />
div.center {<br />
width: 1000px;<br />
margin: 0 auto;<br />
position: relative;<br />
}<br />
div.header {<br />
width: 1000px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/1/12/Header-bg.png") no-repeat;<br />
position: relative;<br />
z-index: 50;<br />
}<br />
div.nav {<br />
position: absolute;<br />
height: 80px;<br />
top: 185px;<br />
left: 245px;<br />
}<br />
li.nav-outerLi {<br />
display: block;<br />
float: left;<br />
width: 80px;<br />
height: 80px;<br />
margin: 0 6px;<br />
cursor: pointer;<br />
}<br />
h2.nav-h21,h2.nav-h22,h2.nav-h23,h2.nav-h24,h2.nav-h25,h2.nav-h26 {<br />
display: block;<br />
background: url("https://static.igem.org/mediawiki/2012/9/91/Nav-tabs.png") no-repeat;<br />
width: 80px;<br />
height: 80px;<br />
background-position: 0 0;<br />
z-index: 150;<br />
position: relative;<br />
}<br />
h2.nav-h22 {<br />
background-position: -80px 0;<br />
}<br />
h2.nav-h23 {<br />
background-position: -160px 0;<br />
}<br />
h2.nav-h24 {<br />
background-position: -240px 0;<br />
}<br />
h2.nav-h25 {<br />
background-position: -320px 0;<br />
}<br />
h2.nav-h26 {<br />
background-position: -400px 0;<br />
}<br />
h2.nav-h21:hover {<br />
background-position: 0 -80px;<br />
}<br />
h2.nav-h22:hover {<br />
background-position: -80px -80px;<br />
}<br />
h2.nav-h23:hover {<br />
background-position: -160px -80px;<br />
}<br />
h2.nav-h24:hover {<br />
background-position: -240px -80px;<br />
}<br />
h2.nav-h25:hover {<br />
background-position: -320px -80px;<br />
}<br />
h2.nav-h26:hover {<br />
background-position: -400px -80px;<br />
}<br />
h2.nav-h21on {<br />
background-position: 0 -160px;<br />
}<br />
h2.nav-h22on {<br />
background-position: -80px -160px;<br />
}<br />
h2.nav-h23on {<br />
background-position: -160px -160px;<br />
}<br />
h2.nav-h24on {<br />
background-position: -240px -160px;<br />
}<br />
h2.nav-h25on {<br />
background-position: -320px -160px;<br />
}<br />
h2.nav-h26on {<br />
background-position: -400px -160px;<br />
}<br />
ul.nav-innerUl{<br />
position: absolute;<br />
top: 40px;<br />
padding-top: 40px;<br />
width: 76px;<br />
border-left: 2px solid #000;<br />
border-right: 2px solid #000;<br />
z-index: 140;<br />
display: none;<br />
}<br />
em.nav-libg{<br />
display: block;<br />
width: 96px;<br />
height: 11px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/48/Nav-libg.png');<br />
margin-left: -10px;<br />
}<br />
ul.nav-innerUl1{<br />
background: #fffaca;<br />
}<br />
ul.nav-innerUl2{<br />
background: #dedede;<br />
}<br />
ul.nav-innerUl3{<br />
background: #d9f0c9;<br />
}<br />
ul.nav-innerUl4{<br />
background: #f6e5ff;<br />
}<br />
ul.nav-innerUl5{<br />
background: #ebfcff;<br />
}<br />
ul.nav-innerUl6{<br />
background: #ffeee8;<br />
}<br />
li.nav-innerLi{<br />
font-size: 10px;<br />
line-height: 14px;<br />
padding: 3px 5px;<br />
}<br />
li.nav-innerLi:hover{<br />
background: #fff;<br />
}<br />
div.middle {<br />
width: 940px;<br />
background: #e6deb8;<br />
background: rgba(230,222,184,0.5);<br />
position: absolute;<br />
top: 300px;<br />
left: 30px;<br />
}<br />
div.aside {<br />
width: 160px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/b/b3/Aside-bg.png") no-repeat;<br />
margin-left: 20px;<br />
margin-top: 100px;<br />
float: left;<br />
padding: 20px;<br />
}<br />
ul.aside-outerUl {<br />
margin: 15px;<br />
}<br />
li.aside-outerLi {<br />
margin: 15px 0;<br />
background: #fff1a9;<br />
padding: 5px 10px;<br />
color: #725718;<br />
font-size: 16px;<br />
line-height: 24px;<br />
font-weight: bold;<br />
text-align: center;<br />
cursor: pointer;<br />
}<br />
li.aside-outerLi:hover {<br />
background: #fff8d3;<br />
}<br />
div.main {<br />
width: 640px;<br />
height: 400px;<br />
border: 5px solid #333;<br />
background: #fff;<br />
float: right;<br />
margin: 100px 30px 30px 0;<br />
}<br />
div.footer {<br />
}<br />
<br />
/*<br />
* picSlider Css<br />
*/<br />
#picSlider {<br />
width: 640px;<br />
height: 320px;<br />
}<br />
.momo {<br />
background: #000;<br />
}<br />
.momo .pic li {<br />
width: 100%;<br />
height: 100%;<br />
overflow: hidden;<br />
position: absolute;<br />
display: none;<br />
}<br />
.momo .txt li {<br />
position: absolute;<br />
padding: 5px 10px;<br />
z-index: 2;<br />
bottom: 0;<br />
height: 28px;<br />
background: #DBDBDB;<br />
display: none;<br />
}<br />
.momo .txt li a {<br />
display: block;<br />
position: relative;<br />
z-index: 1;<br />
color: #333;<br />
font-size: 12px;<br />
font-weight: bold;<br />
text-decoration: none;<br />
}<br />
.momo .num {<br />
position: absolute;<br />
z-index: 3;<br />
bottom: 5px;<br />
right: 5px;<br />
}<br />
.momo .num li {<br />
float: left;<br />
}<br />
.momo .num li a {<br />
color: #333;<br />
float: left;<br />
margin-left: 3px;<br />
width: 15px;<br />
height: 15px;<br />
line-height: 15px;<br />
*line-height: 14px;<br />
overflow: hidden;<br />
border: 1px solid #AEC1CC;<br />
text-align: center;<br />
cursor: pointer;<br />
background: #fff;<br />
text-decoration: none;<br />
}<br />
.momo .num li.current a, .momo .num li.hover a {<br />
color: #fff;<br />
background: #f60;<br />
-webkit-transition: all 0.4s;<br />
-moz-transition: all 0.4s;<br />
-o-transition: all 0.4s;<br />
}<br />
.momo_picSlider .txt li{<br />
width: 620px;<br />
}<br />
.momo_picSlider .txt li a{<br />
font-size: 16px;<br />
line-height: 24px;<br />
}<br />
#p-logo {<br />
display:none;<br />
}<br />
#top-section {<br />
height:0;<br />
border:none;<br />
}<br />
#search-controls {<br />
display:none;<br />
}<br />
#content {<br />
position:inherit;<br />
width:inherit;<br />
margin:0;<br />
padding:0;<br />
background:inherit;<br />
color:inherit;<br />
border:none;<br />
line-height:inherit;<br />
z-index:2;<br />
}<br />
.firstHeading {<br />
display:none;<br />
}<br />
#catlinks {<br />
display:none;<br />
}<br />
#footer-box {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#menubar ul li a {<br />
background:none;<br />
}<br />
#bodyContent h1,#bodyContent h2 {<br />
margin:0;<br />
border:0;<br />
padding: 0;<br />
}<br />
.left-menu:hover {<br />
background:none;<br />
}<br />
</style><br />
<div class="center"><br />
<div class="header"><br />
<div class="nav"><br />
<ul class="nav-outerUl"><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China"><h2 class="nav-h21 nav-h21on" title="Home"></h2></a><br />
<ul class="nav-innerUl nav-innerUl1" name="Home"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Team"><h2 class="nav-h22" title="Team"></h2></a><br />
<ul class="nav-innerUl nav-innerUl2" name="Team"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Project"><h2 class="nav-h23" title="Project"></h2></a><br />
<ul class="nav-innerUl nav-innerUl3" name="Project"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Modeling"><h2 class="nav-h24" title="Modeling"></h2></a><br />
<ul class="nav-innerUl nav-innerUl4" name="Modeling"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Notebooks"><h2 class="nav-h25" title="Notebooks"></h2></a><br />
<ul class="nav-innerUl nav-innerUl5" name="Notebooks"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/humanPractice"><h2 class="nav-h26" title="Human Practice"></h2></a><br />
<ul class="nav-innerUl nav-innerUl6" name="HumanPractice"></ul><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div class="middle"><br />
<div class="aside"><br />
<ul class="aside-outerUl"></ul><br />
</div><br />
<div class="main"></div><br />
<div class="clear"></div><br />
</div><br />
<div class="footer"></div><br />
</div><br />
<script src="http://www.yichengliu.com/code/igem/home.js"></script><br />
</body><br />
</html></div>Nanhaihttp://2012.igem.org/Team:WHU-ChinaTeam:WHU-China2012-10-26T23:04:17Z<p>Nanhai: Undo revision 291535 by Nanhai (talk)</p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<body><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script><br />
function picObj(src, title, detail, href){<br />
this.src = src;<br />
this.title = title;<br />
this.detail = detail;<br />
this.href = href;<br />
}<br />
//*************************自定义数据部分*************************<br />
<br />
//定义菜单及侧边栏数据<br />
var menuObj = {<br />
Home : [<br />
{<br />
title : "<strong>What's new</strong>",<br />
picArray : [new picObj("http://partsregistry.org/wiki/images/f/ff/%E5%85%A8%E6%99%AF%E5%8A%A0%E6%AD%BB%E4%BA%A11.png", "Panorama of the Whole Project Scheme", "Four novel devices, Fatty Acid Degradation, Cellulose Synthesis, Colonization and Death to ensure high efficiency orchestrate calorie absorption and bacteria survival and make you slim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/d/d9/A_picture_of_Pcar.png", "Pcar: Promoter of CRP As a Repressor", "By inserting CRP-binding site to overlap with the -10 region of a constitutive promoter, Pcar is able to be induced by glucose, while CRP serves as a repressor rather than an activator.", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#Pcar"),<br />
new picObj("https://static.igem.org/mediawiki/2012/3/37/Pfadr_picture.png", "PfadR: Synthesized promoter regulated solely by fatty acid", "With tandem FadR binding site, PfadR is able to be repressed solely by fatty acid.", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#PfadR"),<br />
new picObj("https://static.igem.org/mediawiki/2012/0/09/%E8%83%96%E5%AD%90%E7%98%A6%E5%AD%90.png", "Long term efficiency of the E.coslim", "When viewed at macroscopic way, the E.coslim may have an advantage of long term efficiency,by regulating the human gut microbiota.And we have certified this by mathematical model", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#PfadR")<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>Pathway Introduction</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/igem.org/8/82/Pathway_FattyAcid.png", "Fatty Acid Degradation", "Feel free to eat meat since the fat is all degraded by our E.coslim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=3"),<br />
new picObj("https://static.igem.org/mediawiki/igem.org/1/18/Pathway_Cellulose.png", "Cellulose Synthesis", "Transforming glucose into cellulose, the high-sugar food you eat will be turned into vegetables!", "https://2012.igem.org/Team:WHU-China/Project?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/e/ea/Device_three.png", "Colonization", "The magic molecule c-di-GMP enables E.coslim colonizing in the gut to better fulfill its magic function!", "https://2012.igem.org/Team:WHU-China/Project?catalog=5")<br />
]<br />
},<br />
<br />
{<br />
title : "<strong>Future Perspective</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/ab/%E5%8F%8C%E8%83%B6%E5%9B%8A2.jpg", "Two Capsule Design", "Capsule I, the E.coslim, makes you slim, while Capsule II, xylose, terminates the effects of the former.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/d/d2/Fpbody2.jpg", "In vitro experiment in a simulated intestine", "The gut microbiota and E.coslim will be inoculated in a simulated intestine, then the concentration measurement of each component will tell us whether E.coslim works as desired.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/8/85/%E5%B0%8F%E9%BC%A0%E5%AE%9E%E9%AA%8C02.jpg", "In vivo experiment in mice", "E.coslim will also be inoculated into mice and the culture-independent microbiome analysis will tell us the real situation in vivo.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0")<br />
]<br />
},<br />
<br />
<br />
<br />
{<br />
title : "<strong>Achievement</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/c/ca/Achievements_1.png", "Biobicks we have improved", "In our project,we have improved the function of some biobricks,such as BBa_J54222,BBa_K188011 and BBa_R0051.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/f/f5/Achievements_2.png", "Novel promoter we designed", "Because no such promoter which can meet our demand exists in the nature, we designed two novel promoter Pcar and PfadR to achieve the goal.In addition, we also have set up a standard for promoter design. ", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/3/31/Achievements_methods.png", "Methods we improved", "In our project,we improved some traditional method to measure fatty acids and cellulose, and also we developped a software named FANCY to detect the fluorescence intensity of single cell", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/b/b0/Achievements_human.png", "Human Practice", "We have helped another iGEM team to debug their project and mathematical model,also we did a survey on GMOs and publisized iGEM to the public ", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/a/ac/Achievements_5.png", "Devices", "This year,our project has focused on some of the the hot-button issues,such as c-di-CMP ,gut microbiota and so on. At last, we submitted 66 new biobricks", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>About Us</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/a7/Whu-2012-1.jpg", "WHU-China 2012, I was there", "The Entrance of State Wuhan University", "https://2012.igem.org/Team:WHU-China/Team?catalog=1"),<br />
new picObj("https://static.igem.org/mediawiki/2012/2/23/Whu2012heying.jpg", "MIT, we're coming!", "Collge of Life Sciences of WHU", "https://2012.igem.org/Team:WHU-China/Team?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/4/43/Whu2012-2.jpg", "WHU-China, Hooray!", "Yuntai Mountain, Henan Province", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=5")<br />
]<br />
}<br />
],<br />
Team : [<br />
{<br />
title : '<strong>Members</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Instructors</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Team History</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About WHU</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About Our Lab</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Acknow-</br>ledgements</strong>',<br />
dir : []<br />
},<br />
<br />
],<br />
Project : [<br />
{<br />
title : '<strong>Description</strong>',<br />
dir : [<br />
<br />
]<br />
},<br />
{<br />
title : '<strong>Background</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Promoter Design</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device I: Fatty Acid Degradation</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device II: Cellulose Synthesis</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device III: Colonization</strong>',<br />
dir : []<br />
},<br />
],<br />
Modeling : [<br />
{<br />
title : '<strong>Future Perspectives</strong>',<br />
dir : []<br />
},<br />
<br />
{<br />
title : '<strong>Model I: Fatty Acid Degradation</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Model II: Microbiota Regulation</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Software Tool: FANCY</strong>',<br />
dir : []<br />
}<br />
],<br />
Notebooks : [<br />
{<br />
title : '<strong>Parts</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Safety</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Protocols</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Events</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Brain-</br>storming</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Gallery</strong>',<br />
dir : []<br />
}<br />
],<br />
HumanPractice : [<br />
{<br />
title : '<strong>Outline</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Questionaire Survey</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Publicity</strong>',<br />
dir : []<br />
}<br />
]<br />
}; <br />
//*************************自定义数据部分*************************<br />
</script><br />
<style type="text/css"><br />
/*<br />
* base css, DO NOT MODIFY!<br />
*/<br />
* {<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
font-family: "Verdana", sans-serif;<br />
color: #333;<br />
list-style: none;<br />
outline: none;<br />
resize: none;<br />
}<br />
html {<br />
overflow-y: scroll;<br />
}<br />
body {<br />
background: url("https://static.igem.org/mediawiki/2012/2/22/Body-bg.jpg") center center fixed;<br />
}<br />
a {<br />
text-decoration: none;<br />
}<br />
.clear {<br />
width: 0;<br />
height: 0;<br />
line-height: 0;<br />
display: block;<br />
clear: both;<br />
}<br />
<br />
/*<br />
* common css, include "header","footer"...<br />
*/<br />
div.center {<br />
width: 1000px;<br />
margin: 0 auto;<br />
position: relative;<br />
}<br />
div.header {<br />
width: 1000px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/1/12/Header-bg.png") no-repeat;<br />
position: relative;<br />
z-index: 50;<br />
}<br />
div.nav {<br />
position: absolute;<br />
height: 80px;<br />
top: 185px;<br />
left: 245px;<br />
}<br />
li.nav-outerLi {<br />
display: block;<br />
float: left;<br />
width: 80px;<br />
height: 80px;<br />
margin: 0 6px;<br />
cursor: pointer;<br />
}<br />
h2.nav-h21,h2.nav-h22,h2.nav-h23,h2.nav-h24,h2.nav-h25,h2.nav-h26 {<br />
display: block;<br />
background: url("https://static.igem.org/mediawiki/2012/9/91/Nav-tabs.png") no-repeat;<br />
width: 80px;<br />
height: 80px;<br />
background-position: 0 0;<br />
z-index: 150;<br />
position: relative;<br />
}<br />
h2.nav-h22 {<br />
background-position: -80px 0;<br />
}<br />
h2.nav-h23 {<br />
background-position: -160px 0;<br />
}<br />
h2.nav-h24 {<br />
background-position: -240px 0;<br />
}<br />
h2.nav-h25 {<br />
background-position: -320px 0;<br />
}<br />
h2.nav-h26 {<br />
background-position: -400px 0;<br />
}<br />
h2.nav-h21:hover {<br />
background-position: 0 -80px;<br />
}<br />
h2.nav-h22:hover {<br />
background-position: -80px -80px;<br />
}<br />
h2.nav-h23:hover {<br />
background-position: -160px -80px;<br />
}<br />
h2.nav-h24:hover {<br />
background-position: -240px -80px;<br />
}<br />
h2.nav-h25:hover {<br />
background-position: -320px -80px;<br />
}<br />
h2.nav-h26:hover {<br />
background-position: -400px -80px;<br />
}<br />
h2.nav-h21on {<br />
background-position: 0 -160px;<br />
}<br />
h2.nav-h22on {<br />
background-position: -80px -160px;<br />
}<br />
h2.nav-h23on {<br />
background-position: -160px -160px;<br />
}<br />
h2.nav-h24on {<br />
background-position: -240px -160px;<br />
}<br />
h2.nav-h25on {<br />
background-position: -320px -160px;<br />
}<br />
h2.nav-h26on {<br />
background-position: -400px -160px;<br />
}<br />
ul.nav-innerUl{<br />
position: absolute;<br />
top: 40px;<br />
padding-top: 40px;<br />
width: 76px;<br />
border-left: 2px solid #000;<br />
border-right: 2px solid #000;<br />
z-index: 140;<br />
display: none;<br />
}<br />
em.nav-libg{<br />
display: block;<br />
width: 96px;<br />
height: 11px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/48/Nav-libg.png');<br />
margin-left: -10px;<br />
}<br />
ul.nav-innerUl1{<br />
background: #fffaca;<br />
}<br />
ul.nav-innerUl2{<br />
background: #dedede;<br />
}<br />
ul.nav-innerUl3{<br />
background: #d9f0c9;<br />
}<br />
ul.nav-innerUl4{<br />
background: #f6e5ff;<br />
}<br />
ul.nav-innerUl5{<br />
background: #ebfcff;<br />
}<br />
ul.nav-innerUl6{<br />
background: #ffeee8;<br />
}<br />
li.nav-innerLi{<br />
font-size: 10px;<br />
line-height: 14px;<br />
padding: 3px 5px;<br />
}<br />
li.nav-innerLi:hover{<br />
background: #fff;<br />
}<br />
div.middle {<br />
width: 940px;<br />
background: #e6deb8;<br />
background: rgba(230,222,184,0.5);<br />
position: absolute;<br />
top: 300px;<br />
left: 30px;<br />
}<br />
div.aside {<br />
width: 160px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/b/b3/Aside-bg.png") no-repeat;<br />
margin-left: 20px;<br />
margin-top: 100px;<br />
float: left;<br />
padding: 20px;<br />
}<br />
ul.aside-outerUl {<br />
margin: 15px;<br />
}<br />
li.aside-outerLi {<br />
margin: 15px 0;<br />
background: #fff1a9;<br />
padding: 5px 10px;<br />
color: #725718;<br />
font-size: 16px;<br />
line-height: 24px;<br />
font-weight: bold;<br />
text-align: center;<br />
cursor: pointer;<br />
}<br />
li.aside-outerLi:hover {<br />
background: #fff8d3;<br />
}<br />
div.main {<br />
width: 640px;<br />
height: 400px;<br />
border: 5px solid #333;<br />
background: #fff;<br />
float: right;<br />
margin: 100px 30px 30px 0;<br />
}<br />
div.footer {<br />
}<br />
<br />
/*<br />
* picSlider Css<br />
*/<br />
#picSlider {<br />
width: 640px;<br />
height: 320px;<br />
}<br />
.momo {<br />
background: #000;<br />
}<br />
.momo .pic li {<br />
width: 100%;<br />
height: 100%;<br />
overflow: hidden;<br />
position: absolute;<br />
display: none;<br />
}<br />
.momo .txt li {<br />
position: absolute;<br />
padding: 5px 10px;<br />
z-index: 2;<br />
bottom: 0;<br />
height: 28px;<br />
background: #DBDBDB;<br />
display: none;<br />
}<br />
.momo .txt li a {<br />
display: block;<br />
position: relative;<br />
z-index: 1;<br />
color: #333;<br />
font-size: 12px;<br />
font-weight: bold;<br />
text-decoration: none;<br />
}<br />
.momo .num {<br />
position: absolute;<br />
z-index: 3;<br />
bottom: 5px;<br />
right: 5px;<br />
}<br />
.momo .num li {<br />
float: left;<br />
}<br />
.momo .num li a {<br />
color: #333;<br />
float: left;<br />
margin-left: 3px;<br />
width: 15px;<br />
height: 15px;<br />
line-height: 15px;<br />
*line-height: 14px;<br />
overflow: hidden;<br />
border: 1px solid #AEC1CC;<br />
text-align: center;<br />
cursor: pointer;<br />
background: #fff;<br />
text-decoration: none;<br />
}<br />
.momo .num li.current a, .momo .num li.hover a {<br />
color: #fff;<br />
background: #f60;<br />
-webkit-transition: all 0.4s;<br />
-moz-transition: all 0.4s;<br />
-o-transition: all 0.4s;<br />
}<br />
.momo_picSlider .txt li{<br />
width: 620px;<br />
}<br />
.momo_picSlider .txt li a{<br />
font-size: 16px;<br />
line-height: 24px;<br />
}<br />
#p-logo {<br />
display:none;<br />
}<br />
#top-section {<br />
height:0;<br />
border:none;<br />
}<br />
#search-controls {<br />
display:none;<br />
}<br />
#content {<br />
position:inherit;<br />
width:inherit;<br />
margin:0;<br />
padding:0;<br />
background:inherit;<br />
color:inherit;<br />
border:none;<br />
line-height:inherit;<br />
z-index:2;<br />
}<br />
.firstHeading {<br />
display:none;<br />
}<br />
#catlinks {<br />
display:none;<br />
}<br />
#footer-box {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#menubar ul li a {<br />
background:none;<br />
}<br />
#bodyContent h1,#bodyContent h2 {<br />
margin:0;<br />
border:0;<br />
padding: 0;<br />
}<br />
.left-menu:hover {<br />
background:none;<br />
}<br />
</style><br />
<div class="center"><br />
<div class="header"><br />
<div class="nav"><br />
<ul class="nav-outerUl"><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China"><h2 class="nav-h21 nav-h21on" title="Home"></h2></a><br />
<ul class="nav-innerUl nav-innerUl1" name="Home"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Team"><h2 class="nav-h22" title="Team"></h2></a><br />
<ul class="nav-innerUl nav-innerUl2" name="Team"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Project"><h2 class="nav-h23" title="Project"></h2></a><br />
<ul class="nav-innerUl nav-innerUl3" name="Project"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Modeling"><h2 class="nav-h24" title="Modeling"></h2></a><br />
<ul class="nav-innerUl nav-innerUl4" name="Modeling"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Notebooks"><h2 class="nav-h25" title="Notebooks"></h2></a><br />
<ul class="nav-innerUl nav-innerUl5" name="Notebooks"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/humanPractice"><h2 class="nav-h26" title="Human Practice"></h2></a><br />
<ul class="nav-innerUl nav-innerUl6" name="HumanPractice"></ul><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div class="middle"><br />
<div class="aside"><br />
<ul class="aside-outerUl"></ul><br />
</div><br />
<div class="main"></div><br />
<div class="clear"></div><br />
</div><br />
<div class="footer"></div><br />
</div><br />
<script src="http://www.yichengliu.com/code/igem/home.js"></script><br />
</body><br />
</html></div>Nanhaihttp://2012.igem.org/Team:WHU-ChinaTeam:WHU-China2012-10-26T23:03:13Z<p>Nanhai: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<body><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script><br />
function picObj(src, title, detail, href){<br />
this.src = src;<br />
this.title = title;<br />
this.detail = detail;<br />
this.href = href;<br />
}<br />
//*************************自定义数据部分*************************<br />
<br />
//定义菜单及侧边栏数据<br />
var menuObj = {<br />
Home : [<br />
{<br />
title : "<strong>What's new</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/b/be/What%27s_new.png", "Three advantages of the E.coslim", "Compared to traditional methods of losing weight, our E.coslim has three advantages: monitoring, high efficiency and long term efficiency ", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#Pcar"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/f/ff/Promoter_design.png", "Pcar and PfadR", "By inserting CRP and FadR binding site to overlap with the -10 region of constitutive promoter, we have successfully made two novel promoter Pcar and PfadR. Pcar is able to be induced by glucose, while PfadR is able to be induced by fatty acids.", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#Pcar"),<br />
<br />
new picObj("http://partsregistry.org/wiki/images/f/ff/%E5%85%A8%E6%99%AF%E5%8A%A0%E6%AD%BB%E4%BA%A11.png", "Panorama of the Whole Project Scheme", "Four novel devices, Fatty Acid Degradation, Cellulose Synthesis, Colonization and Death to ensure high efficiency orchestrate calorie absorption and bacteria survival and make you slim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/0/09/%E8%83%96%E5%AD%90%E7%98%A6%E5%AD%90.png", "Long term efficiency of the E.coslim", "When viewed at macroscopic way, the E.coslim may have an advantage of long term efficiency,by regulating the human gut microbiota.And we have certified this by mathematical model", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#PfadR")<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>Pathway Introduction</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/igem.org/8/82/Pathway_FattyAcid.png", "Fatty Acid Degradation", "Feel free to eat meat since the fat is all degraded by our E.coslim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=3"),<br />
new picObj("https://static.igem.org/mediawiki/igem.org/1/18/Pathway_Cellulose.png", "Cellulose Synthesis", "Transforming glucose into cellulose, the high-sugar food you eat will be turned into vegetables!", "https://2012.igem.org/Team:WHU-China/Project?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/e/ea/Device_three.png", "Colonization", "The magic molecule c-di-GMP enables E.coslim colonizing in the gut to better fulfill its magic function!", "https://2012.igem.org/Team:WHU-China/Project?catalog=5")<br />
]<br />
},<br />
<br />
{<br />
title : "<strong>Future Perspective</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/ab/%E5%8F%8C%E8%83%B6%E5%9B%8A2.jpg", "Two Capsule Design", "Capsule I, the E.coslim, makes you slim, while Capsule II, xylose, terminates the effects of the former.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/d/d2/Fpbody2.jpg", "In vitro experiment in a simulated intestine", "The gut microbiota and E.coslim will be inoculated in a simulated intestine, then the concentration measurement of each component will tell us whether E.coslim works as desired.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/8/85/%E5%B0%8F%E9%BC%A0%E5%AE%9E%E9%AA%8C02.jpg", "In vivo experiment in mice", "E.coslim will also be inoculated into mice and the culture-independent microbiome analysis will tell us the real situation in vivo.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0")<br />
]<br />
},<br />
<br />
<br />
<br />
{<br />
title : "<strong>Achievement</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/f/fd/Achievements_device.png", "Devices", "This year,our project has focused on some of the hotspot issues,such as c-di-CMP ,gut microbiota. In all we submitted 66 new biobricks and 39 of them have been proved to be effective. For detailed information, click <a href="https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0">Here</a>.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/c/ca/Achievements_1.png", "Biobicks we have improved", "In our project, we have improved the function of some biobricks,such as BBa_J54222, BBa_K188011 and BBa_R0051. For detailed information, click <a href="https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0">Here</a>.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/f/f5/Achievements_2.png", "Novel promoter we designed", "As the existing promoter can not meet our demand, we designed two novel promoters Pcar and Pfad to achieve the goal. In addition, we also have set up a standard for promoter design. For detailed information, click <a href="https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0">Here</a>.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/2/2c/Achievements2.png", "Methods we improved", "In our project,we improved some traditional methods to measure the comsumption of fatty acids and production of cellulose, and also we developed a software named FANCY to detect the fluorescence intensity of single cell. For detailed information, click <a href="https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0">Here</a>.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/b/b0/Achievements_human.png", "Human Practice", "We have helped HUST iGEM team debug their project and mathematical model. We also did a survey on GMOs and publicized iGEM to the public. For detailed information, click <a href="https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0">Here</a>. ", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0")<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>About Us</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/a7/Whu-2012-1.jpg", "WHU-China 2012, I was there", "The Entrance of State Wuhan University", "https://2012.igem.org/Team:WHU-China/Team?catalog=1"),<br />
new picObj("https://static.igem.org/mediawiki/2012/2/23/Whu2012heying.jpg", "MIT, we're coming!", "Collge of Life Sciences of WHU", "https://2012.igem.org/Team:WHU-China/Team?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/4/43/Whu2012-2.jpg", "WHU-China, Hooray!", "Yuntai Mountain, Henan Province", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=5")<br />
]<br />
}<br />
],<br />
Team : [<br />
{<br />
title : '<strong>Members</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Instructors</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Team History</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About WHU</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About Our Lab</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Acknow-</br>ledgements</strong>',<br />
dir : []<br />
},<br />
<br />
],<br />
Project : [<br />
{<br />
title : '<strong>Description</strong>',<br />
dir : [<br />
<br />
]<br />
},<br />
{<br />
title : '<strong>Background</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Promoter Design</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device I: Fatty Acid Degradation</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device II: Cellulose Synthesis</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device III: Colonization</strong>',<br />
dir : []<br />
},<br />
],<br />
Modeling : [<br />
{<br />
title : '<strong>Future Perspectives</strong>',<br />
dir : []<br />
},<br />
<br />
{<br />
title : '<strong>Model I: Fatty Acid Degradation</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Model II: Microbiota Regulation</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Software Tool: FANCY</strong>',<br />
dir : []<br />
}<br />
],<br />
Notebooks : [<br />
{<br />
title : '<strong>Parts</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Safety</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Protocols</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Events</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Brain-</br>storming</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Gallery</strong>',<br />
dir : []<br />
}<br />
],<br />
HumanPractice : [<br />
{<br />
title : '<strong>Outline</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Questionaire Survey</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Publicity</strong>',<br />
dir : []<br />
}<br />
]<br />
}; <br />
//*************************自定义数据部分*************************<br />
</script><br />
<style type="text/css"><br />
/*<br />
* base css, DO NOT MODIFY!<br />
*/<br />
* {<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
font-family: "Verdana", sans-serif;<br />
color: #333;<br />
list-style: none;<br />
outline: none;<br />
resize: none;<br />
}<br />
html {<br />
overflow-y: scroll;<br />
}<br />
body {<br />
background: url("https://static.igem.org/mediawiki/2012/2/22/Body-bg.jpg") center center fixed;<br />
}<br />
a {<br />
text-decoration: none;<br />
}<br />
.clear {<br />
width: 0;<br />
height: 0;<br />
line-height: 0;<br />
display: block;<br />
clear: both;<br />
}<br />
<br />
/*<br />
* common css, include "header","footer"...<br />
*/<br />
div.center {<br />
width: 1000px;<br />
margin: 0 auto;<br />
position: relative;<br />
}<br />
div.header {<br />
width: 1000px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/1/12/Header-bg.png") no-repeat;<br />
position: relative;<br />
z-index: 50;<br />
}<br />
div.nav {<br />
position: absolute;<br />
height: 80px;<br />
top: 185px;<br />
left: 245px;<br />
}<br />
li.nav-outerLi {<br />
display: block;<br />
float: left;<br />
width: 80px;<br />
height: 80px;<br />
margin: 0 6px;<br />
cursor: pointer;<br />
}<br />
h2.nav-h21,h2.nav-h22,h2.nav-h23,h2.nav-h24,h2.nav-h25,h2.nav-h26 {<br />
display: block;<br />
background: url("https://static.igem.org/mediawiki/2012/9/91/Nav-tabs.png") no-repeat;<br />
width: 80px;<br />
height: 80px;<br />
background-position: 0 0;<br />
z-index: 150;<br />
position: relative;<br />
}<br />
h2.nav-h22 {<br />
background-position: -80px 0;<br />
}<br />
h2.nav-h23 {<br />
background-position: -160px 0;<br />
}<br />
h2.nav-h24 {<br />
background-position: -240px 0;<br />
}<br />
h2.nav-h25 {<br />
background-position: -320px 0;<br />
}<br />
h2.nav-h26 {<br />
background-position: -400px 0;<br />
}<br />
h2.nav-h21:hover {<br />
background-position: 0 -80px;<br />
}<br />
h2.nav-h22:hover {<br />
background-position: -80px -80px;<br />
}<br />
h2.nav-h23:hover {<br />
background-position: -160px -80px;<br />
}<br />
h2.nav-h24:hover {<br />
background-position: -240px -80px;<br />
}<br />
h2.nav-h25:hover {<br />
background-position: -320px -80px;<br />
}<br />
h2.nav-h26:hover {<br />
background-position: -400px -80px;<br />
}<br />
h2.nav-h21on {<br />
background-position: 0 -160px;<br />
}<br />
h2.nav-h22on {<br />
background-position: -80px -160px;<br />
}<br />
h2.nav-h23on {<br />
background-position: -160px -160px;<br />
}<br />
h2.nav-h24on {<br />
background-position: -240px -160px;<br />
}<br />
h2.nav-h25on {<br />
background-position: -320px -160px;<br />
}<br />
h2.nav-h26on {<br />
background-position: -400px -160px;<br />
}<br />
ul.nav-innerUl{<br />
position: absolute;<br />
top: 40px;<br />
padding-top: 40px;<br />
width: 76px;<br />
border-left: 2px solid #000;<br />
border-right: 2px solid #000;<br />
z-index: 140;<br />
display: none;<br />
}<br />
em.nav-libg{<br />
display: block;<br />
width: 96px;<br />
height: 11px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/48/Nav-libg.png');<br />
margin-left: -10px;<br />
}<br />
ul.nav-innerUl1{<br />
background: #fffaca;<br />
}<br />
ul.nav-innerUl2{<br />
background: #dedede;<br />
}<br />
ul.nav-innerUl3{<br />
background: #d9f0c9;<br />
}<br />
ul.nav-innerUl4{<br />
background: #f6e5ff;<br />
}<br />
ul.nav-innerUl5{<br />
background: #ebfcff;<br />
}<br />
ul.nav-innerUl6{<br />
background: #ffeee8;<br />
}<br />
li.nav-innerLi{<br />
font-size: 10px;<br />
line-height: 14px;<br />
padding: 3px 5px;<br />
}<br />
li.nav-innerLi:hover{<br />
background: #fff;<br />
}<br />
div.middle {<br />
width: 940px;<br />
background: #e6deb8;<br />
background: rgba(230,222,184,0.5);<br />
position: absolute;<br />
top: 300px;<br />
left: 30px;<br />
}<br />
div.aside {<br />
width: 160px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/b/b3/Aside-bg.png") no-repeat;<br />
margin-left: 20px;<br />
margin-top: 100px;<br />
float: left;<br />
padding: 20px;<br />
}<br />
ul.aside-outerUl {<br />
margin: 15px;<br />
}<br />
li.aside-outerLi {<br />
margin: 15px 0;<br />
background: #fff1a9;<br />
padding: 5px 10px;<br />
color: #725718;<br />
font-size: 16px;<br />
line-height: 24px;<br />
font-weight: bold;<br />
text-align: center;<br />
cursor: pointer;<br />
}<br />
li.aside-outerLi:hover {<br />
background: #fff8d3;<br />
}<br />
div.main {<br />
width: 640px;<br />
height: 400px;<br />
border: 5px solid #333;<br />
background: #fff;<br />
float: right;<br />
margin: 100px 30px 30px 0;<br />
}<br />
div.footer {<br />
}<br />
<br />
/*<br />
* picSlider Css<br />
*/<br />
#picSlider {<br />
width: 640px;<br />
height: 320px;<br />
}<br />
.momo {<br />
background: #000;<br />
}<br />
.momo .pic li {<br />
width: 100%;<br />
height: 100%;<br />
overflow: hidden;<br />
position: absolute;<br />
display: none;<br />
}<br />
.momo .txt li {<br />
position: absolute;<br />
padding: 5px 10px;<br />
z-index: 2;<br />
bottom: 0;<br />
height: 28px;<br />
background: #DBDBDB;<br />
display: none;<br />
}<br />
.momo .txt li a {<br />
display: block;<br />
position: relative;<br />
z-index: 1;<br />
color: #333;<br />
font-size: 12px;<br />
font-weight: bold;<br />
text-decoration: none;<br />
}<br />
.momo .num {<br />
position: absolute;<br />
z-index: 3;<br />
bottom: 5px;<br />
right: 5px;<br />
}<br />
.momo .num li {<br />
float: left;<br />
}<br />
.momo .num li a {<br />
color: #333;<br />
float: left;<br />
margin-left: 3px;<br />
width: 15px;<br />
height: 15px;<br />
line-height: 15px;<br />
*line-height: 14px;<br />
overflow: hidden;<br />
border: 1px solid #AEC1CC;<br />
text-align: center;<br />
cursor: pointer;<br />
background: #fff;<br />
text-decoration: none;<br />
}<br />
.momo .num li.current a, .momo .num li.hover a {<br />
color: #fff;<br />
background: #f60;<br />
-webkit-transition: all 0.4s;<br />
-moz-transition: all 0.4s;<br />
-o-transition: all 0.4s;<br />
}<br />
.momo_picSlider .txt li{<br />
width: 620px;<br />
}<br />
.momo_picSlider .txt li a{<br />
font-size: 16px;<br />
line-height: 24px;<br />
}<br />
#p-logo {<br />
display:none;<br />
}<br />
#top-section {<br />
height:0;<br />
border:none;<br />
}<br />
#search-controls {<br />
display:none;<br />
}<br />
#content {<br />
position:inherit;<br />
width:inherit;<br />
margin:0;<br />
padding:0;<br />
background:inherit;<br />
color:inherit;<br />
border:none;<br />
line-height:inherit;<br />
z-index:2;<br />
}<br />
.firstHeading {<br />
display:none;<br />
}<br />
#catlinks {<br />
display:none;<br />
}<br />
#footer-box {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#menubar ul li a {<br />
background:none;<br />
}<br />
#bodyContent h1,#bodyContent h2 {<br />
margin:0;<br />
border:0;<br />
padding: 0;<br />
}<br />
.left-menu:hover {<br />
background:none;<br />
}<br />
</style><br />
<div class="center"><br />
<div class="header"><br />
<div class="nav"><br />
<ul class="nav-outerUl"><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China"><h2 class="nav-h21 nav-h21on" title="Home"></h2></a><br />
<ul class="nav-innerUl nav-innerUl1" name="Home"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Team"><h2 class="nav-h22" title="Team"></h2></a><br />
<ul class="nav-innerUl nav-innerUl2" name="Team"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Project"><h2 class="nav-h23" title="Project"></h2></a><br />
<ul class="nav-innerUl nav-innerUl3" name="Project"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Modeling"><h2 class="nav-h24" title="Modeling"></h2></a><br />
<ul class="nav-innerUl nav-innerUl4" name="Modeling"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Notebooks"><h2 class="nav-h25" title="Notebooks"></h2></a><br />
<ul class="nav-innerUl nav-innerUl5" name="Notebooks"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/humanPractice"><h2 class="nav-h26" title="Human Practice"></h2></a><br />
<ul class="nav-innerUl nav-innerUl6" name="HumanPractice"></ul><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div class="middle"><br />
<div class="aside"><br />
<ul class="aside-outerUl"></ul><br />
</div><br />
<div class="main"></div><br />
<div class="clear"></div><br />
</div><br />
<div class="footer"></div><br />
</div><br />
<script src="http://www.yichengliu.com/code/igem/home.js"></script><br />
</body><br />
</html></div>Nanhaihttp://2012.igem.org/Team:WHU-ChinaTeam:WHU-China2012-10-26T22:45:09Z<p>Nanhai: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<body><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script><br />
function picObj(src, title, detail, href){<br />
this.src = src;<br />
this.title = title;<br />
this.detail = detail;<br />
this.href = href;<br />
}<br />
//*************************自定义数据部分*************************<br />
<br />
//定义菜单及侧边栏数据<br />
var menuObj = {<br />
Home : [<br />
{<br />
title : "<strong>What's new</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/b/be/What%27s_new.png", "Three advantages of the E.coslim", "Compared to traditional methods of losing weight, our E.coslim has three advantages: monitoring, high efficiency and long term efficiency ", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#Pcar"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/f/ff/Promoter_design.png", "Pcar and PfadR", "By inserting CRP and FadR binding site to overlap with the -10 region of constitutive promoter, we have successfully made two novel promoter Pcar and PfadR. Pcar is able to be induced by glucose, while PfadR is able to be induced by fatty acids.", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#Pcar"),<br />
<br />
new picObj("http://partsregistry.org/wiki/images/f/ff/%E5%85%A8%E6%99%AF%E5%8A%A0%E6%AD%BB%E4%BA%A11.png", "Panorama of the Whole Project Scheme", "Four novel devices, Fatty Acid Degradation, Cellulose Synthesis, Colonization and Death to ensure high efficiency orchestrate calorie absorption and bacteria survival and make you slim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/0/09/%E8%83%96%E5%AD%90%E7%98%A6%E5%AD%90.png", "Long term efficiency of the E.coslim", "When viewed at macroscopic way, the E.coslim may have an advantage of long term efficiency,by regulating the human gut microbiota.And we have certified this by mathematical model", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#PfadR")<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>Pathway Introduction</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/igem.org/8/82/Pathway_FattyAcid.png", "Fatty Acid Degradation", "Feel free to eat meat since the fat is all degraded by our E.coslim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=3"),<br />
new picObj("https://static.igem.org/mediawiki/igem.org/1/18/Pathway_Cellulose.png", "Cellulose Synthesis", "Transforming glucose into cellulose, the high-sugar food you eat will be turned into vegetables!", "https://2012.igem.org/Team:WHU-China/Project?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/e/ea/Device_three.png", "Colonization", "The magic molecule c-di-GMP enables E.coslim colonizing in the gut to better fulfill its magic function!", "https://2012.igem.org/Team:WHU-China/Project?catalog=5")<br />
]<br />
},<br />
<br />
{<br />
title : "<strong>Future Perspective</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/ab/%E5%8F%8C%E8%83%B6%E5%9B%8A2.jpg", "Two Capsule Design", "Capsule I, the E.coslim, makes you slim, while Capsule II, xylose, terminates the effects of the former.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/d/d2/Fpbody2.jpg", "In vitro experiment in a simulated intestine", "The gut microbiota and E.coslim will be inoculated in a simulated intestine, then the concentration measurement of each component will tell us whether E.coslim works as desired.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/8/85/%E5%B0%8F%E9%BC%A0%E5%AE%9E%E9%AA%8C02.jpg", "In vivo experiment in mice", "E.coslim will also be inoculated into mice and the culture-independent microbiome analysis will tell us the real situation in vivo.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0")<br />
]<br />
},<br />
<br />
<br />
<br />
{<br />
title : "<strong>Achievement</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/f/fd/Achievements_device.png", "Devices", "This year,our project has focused on some of the the hot-button issues,such as c-di-CMP, gut microbiota and so on. At last, we submitted 66 new biobricks. For detailed information, click <a href="https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0">Here</a>.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/c/ca/Achievements_1.png", "Biobicks we have improved", "In our project, we have improved the function of some biobricks,such as BBa_J54222, BBa_K188011 and BBa_R0051. For detailed information, click <a href="https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0">Here</a>.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/f/f5/Achievements_2.png", "Novel promoter we designed", "As the existing promoter can not meet our demand, we designed two novel promoters Pcar and Pfad to achieve the goal. In addition, we also have set up a standard for promoter design. For detailed information, click <a href="https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0">Here</a>.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/2/2c/Achievements2.png", "Methods we improved", "In our project,we improved some traditional methods to measure the comsumption of fatty acids and production of cellulose, and also we developed a software named FANCY to detect the fluorescence intensity of single cell. For detailed information, click <a href="https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0">Here</a>.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/b/b0/Achievements_human.png", "Human Practice", "We have helped HUST iGEM team debug their project and mathematical model. We also did a survey on GMOs and publicized iGEM to the public. For detailed information, click <a href="https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0">Here</a>. ", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0")<br />
<br />
]<br />
},<br />
<br />
{<br />
title : "<strong>About Us</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/a7/Whu-2012-1.jpg", "WHU-China 2012, I was there", "The Entrance of State Wuhan University", "https://2012.igem.org/Team:WHU-China/Team?catalog=1"),<br />
new picObj("https://static.igem.org/mediawiki/2012/2/23/Whu2012heying.jpg", "MIT, we're coming!", "Collge of Life Sciences of WHU", "https://2012.igem.org/Team:WHU-China/Team?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/4/43/Whu2012-2.jpg", "WHU-China, Hooray!", "Yuntai Mountain, Henan Province", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=5")<br />
]<br />
}<br />
],<br />
Team : [<br />
{<br />
title : '<strong>Members</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Instructors</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Team History</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About WHU</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About Our Lab</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Acknow-</br>ledgements</strong>',<br />
dir : []<br />
},<br />
<br />
],<br />
Project : [<br />
{<br />
title : '<strong>Description</strong>',<br />
dir : [<br />
<br />
]<br />
},<br />
{<br />
title : '<strong>Background</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Promoter Design</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device I: Fatty Acid Degradation</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device II: Cellulose Synthesis</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device III: Colonization</strong>',<br />
dir : []<br />
},<br />
],<br />
Modeling : [<br />
{<br />
title : '<strong>Future Perspectives</strong>',<br />
dir : []<br />
},<br />
<br />
{<br />
title : '<strong>Model I: Fatty Acid Degradation</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Model II: Microbiota Regulation</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Software Tool: FANCY</strong>',<br />
dir : []<br />
}<br />
],<br />
Notebooks : [<br />
{<br />
title : '<strong>Parts</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Safety</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Protocols</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Events</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Brain-</br>storming</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Gallery</strong>',<br />
dir : []<br />
}<br />
],<br />
HumanPractice : [<br />
{<br />
title : '<strong>Outline</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Questionaire Survey</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Publicity</strong>',<br />
dir : []<br />
}<br />
]<br />
}; <br />
//*************************自定义数据部分*************************<br />
</script><br />
<style type="text/css"><br />
/*<br />
* base css, DO NOT MODIFY!<br />
*/<br />
* {<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
font-family: "Verdana", sans-serif;<br />
color: #333;<br />
list-style: none;<br />
outline: none;<br />
resize: none;<br />
}<br />
html {<br />
overflow-y: scroll;<br />
}<br />
body {<br />
background: url("https://static.igem.org/mediawiki/2012/2/22/Body-bg.jpg") center center fixed;<br />
}<br />
a {<br />
text-decoration: none;<br />
}<br />
.clear {<br />
width: 0;<br />
height: 0;<br />
line-height: 0;<br />
display: block;<br />
clear: both;<br />
}<br />
<br />
/*<br />
* common css, include "header","footer"...<br />
*/<br />
div.center {<br />
width: 1000px;<br />
margin: 0 auto;<br />
position: relative;<br />
}<br />
div.header {<br />
width: 1000px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/1/12/Header-bg.png") no-repeat;<br />
position: relative;<br />
z-index: 50;<br />
}<br />
div.nav {<br />
position: absolute;<br />
height: 80px;<br />
top: 185px;<br />
left: 245px;<br />
}<br />
li.nav-outerLi {<br />
display: block;<br />
float: left;<br />
width: 80px;<br />
height: 80px;<br />
margin: 0 6px;<br />
cursor: pointer;<br />
}<br />
h2.nav-h21,h2.nav-h22,h2.nav-h23,h2.nav-h24,h2.nav-h25,h2.nav-h26 {<br />
display: block;<br />
background: url("https://static.igem.org/mediawiki/2012/9/91/Nav-tabs.png") no-repeat;<br />
width: 80px;<br />
height: 80px;<br />
background-position: 0 0;<br />
z-index: 150;<br />
position: relative;<br />
}<br />
h2.nav-h22 {<br />
background-position: -80px 0;<br />
}<br />
h2.nav-h23 {<br />
background-position: -160px 0;<br />
}<br />
h2.nav-h24 {<br />
background-position: -240px 0;<br />
}<br />
h2.nav-h25 {<br />
background-position: -320px 0;<br />
}<br />
h2.nav-h26 {<br />
background-position: -400px 0;<br />
}<br />
h2.nav-h21:hover {<br />
background-position: 0 -80px;<br />
}<br />
h2.nav-h22:hover {<br />
background-position: -80px -80px;<br />
}<br />
h2.nav-h23:hover {<br />
background-position: -160px -80px;<br />
}<br />
h2.nav-h24:hover {<br />
background-position: -240px -80px;<br />
}<br />
h2.nav-h25:hover {<br />
background-position: -320px -80px;<br />
}<br />
h2.nav-h26:hover {<br />
background-position: -400px -80px;<br />
}<br />
h2.nav-h21on {<br />
background-position: 0 -160px;<br />
}<br />
h2.nav-h22on {<br />
background-position: -80px -160px;<br />
}<br />
h2.nav-h23on {<br />
background-position: -160px -160px;<br />
}<br />
h2.nav-h24on {<br />
background-position: -240px -160px;<br />
}<br />
h2.nav-h25on {<br />
background-position: -320px -160px;<br />
}<br />
h2.nav-h26on {<br />
background-position: -400px -160px;<br />
}<br />
ul.nav-innerUl{<br />
position: absolute;<br />
top: 40px;<br />
padding-top: 40px;<br />
width: 76px;<br />
border-left: 2px solid #000;<br />
border-right: 2px solid #000;<br />
z-index: 140;<br />
display: none;<br />
}<br />
em.nav-libg{<br />
display: block;<br />
width: 96px;<br />
height: 11px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/48/Nav-libg.png');<br />
margin-left: -10px;<br />
}<br />
ul.nav-innerUl1{<br />
background: #fffaca;<br />
}<br />
ul.nav-innerUl2{<br />
background: #dedede;<br />
}<br />
ul.nav-innerUl3{<br />
background: #d9f0c9;<br />
}<br />
ul.nav-innerUl4{<br />
background: #f6e5ff;<br />
}<br />
ul.nav-innerUl5{<br />
background: #ebfcff;<br />
}<br />
ul.nav-innerUl6{<br />
background: #ffeee8;<br />
}<br />
li.nav-innerLi{<br />
font-size: 10px;<br />
line-height: 14px;<br />
padding: 3px 5px;<br />
}<br />
li.nav-innerLi:hover{<br />
background: #fff;<br />
}<br />
div.middle {<br />
width: 940px;<br />
background: #e6deb8;<br />
background: rgba(230,222,184,0.5);<br />
position: absolute;<br />
top: 300px;<br />
left: 30px;<br />
}<br />
div.aside {<br />
width: 160px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/b/b3/Aside-bg.png") no-repeat;<br />
margin-left: 20px;<br />
margin-top: 100px;<br />
float: left;<br />
padding: 20px;<br />
}<br />
ul.aside-outerUl {<br />
margin: 15px;<br />
}<br />
li.aside-outerLi {<br />
margin: 15px 0;<br />
background: #fff1a9;<br />
padding: 5px 10px;<br />
color: #725718;<br />
font-size: 16px;<br />
line-height: 24px;<br />
font-weight: bold;<br />
text-align: center;<br />
cursor: pointer;<br />
}<br />
li.aside-outerLi:hover {<br />
background: #fff8d3;<br />
}<br />
div.main {<br />
width: 640px;<br />
height: 400px;<br />
border: 5px solid #333;<br />
background: #fff;<br />
float: right;<br />
margin: 100px 30px 30px 0;<br />
}<br />
div.footer {<br />
}<br />
<br />
/*<br />
* picSlider Css<br />
*/<br />
#picSlider {<br />
width: 640px;<br />
height: 320px;<br />
}<br />
.momo {<br />
background: #000;<br />
}<br />
.momo .pic li {<br />
width: 100%;<br />
height: 100%;<br />
overflow: hidden;<br />
position: absolute;<br />
display: none;<br />
}<br />
.momo .txt li {<br />
position: absolute;<br />
padding: 5px 10px;<br />
z-index: 2;<br />
bottom: 0;<br />
height: 28px;<br />
background: #DBDBDB;<br />
display: none;<br />
}<br />
.momo .txt li a {<br />
display: block;<br />
position: relative;<br />
z-index: 1;<br />
color: #333;<br />
font-size: 12px;<br />
font-weight: bold;<br />
text-decoration: none;<br />
}<br />
.momo .num {<br />
position: absolute;<br />
z-index: 3;<br />
bottom: 5px;<br />
right: 5px;<br />
}<br />
.momo .num li {<br />
float: left;<br />
}<br />
.momo .num li a {<br />
color: #333;<br />
float: left;<br />
margin-left: 3px;<br />
width: 15px;<br />
height: 15px;<br />
line-height: 15px;<br />
*line-height: 14px;<br />
overflow: hidden;<br />
border: 1px solid #AEC1CC;<br />
text-align: center;<br />
cursor: pointer;<br />
background: #fff;<br />
text-decoration: none;<br />
}<br />
.momo .num li.current a, .momo .num li.hover a {<br />
color: #fff;<br />
background: #f60;<br />
-webkit-transition: all 0.4s;<br />
-moz-transition: all 0.4s;<br />
-o-transition: all 0.4s;<br />
}<br />
.momo_picSlider .txt li{<br />
width: 620px;<br />
}<br />
.momo_picSlider .txt li a{<br />
font-size: 16px;<br />
line-height: 24px;<br />
}<br />
#p-logo {<br />
display:none;<br />
}<br />
#top-section {<br />
height:0;<br />
border:none;<br />
}<br />
#search-controls {<br />
display:none;<br />
}<br />
#content {<br />
position:inherit;<br />
width:inherit;<br />
margin:0;<br />
padding:0;<br />
background:inherit;<br />
color:inherit;<br />
border:none;<br />
line-height:inherit;<br />
z-index:2;<br />
}<br />
.firstHeading {<br />
display:none;<br />
}<br />
#catlinks {<br />
display:none;<br />
}<br />
#footer-box {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#menubar ul li a {<br />
background:none;<br />
}<br />
#bodyContent h1,#bodyContent h2 {<br />
margin:0;<br />
border:0;<br />
padding: 0;<br />
}<br />
.left-menu:hover {<br />
background:none;<br />
}<br />
</style><br />
<div class="center"><br />
<div class="header"><br />
<div class="nav"><br />
<ul class="nav-outerUl"><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China"><h2 class="nav-h21 nav-h21on" title="Home"></h2></a><br />
<ul class="nav-innerUl nav-innerUl1" name="Home"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Team"><h2 class="nav-h22" title="Team"></h2></a><br />
<ul class="nav-innerUl nav-innerUl2" name="Team"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Project"><h2 class="nav-h23" title="Project"></h2></a><br />
<ul class="nav-innerUl nav-innerUl3" name="Project"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Modeling"><h2 class="nav-h24" title="Modeling"></h2></a><br />
<ul class="nav-innerUl nav-innerUl4" name="Modeling"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Notebooks"><h2 class="nav-h25" title="Notebooks"></h2></a><br />
<ul class="nav-innerUl nav-innerUl5" name="Notebooks"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/humanPractice"><h2 class="nav-h26" title="Human Practice"></h2></a><br />
<ul class="nav-innerUl nav-innerUl6" name="HumanPractice"></ul><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div class="middle"><br />
<div class="aside"><br />
<ul class="aside-outerUl"></ul><br />
</div><br />
<div class="main"></div><br />
<div class="clear"></div><br />
</div><br />
<div class="footer"></div><br />
</div><br />
<script src="http://www.yichengliu.com/code/igem/home.js"></script><br />
</body><br />
</html></div>Nanhaihttp://2012.igem.org/Team:WHU-ChinaTeam:WHU-China2012-10-26T22:35:18Z<p>Nanhai: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<body><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script><br />
function picObj(src, title, detail, href){<br />
this.src = src;<br />
this.title = title;<br />
this.detail = detail;<br />
this.href = href;<br />
}<br />
//*************************自定义数据部分*************************<br />
<br />
//定义菜单及侧边栏数据<br />
var menuObj = {<br />
Home : [<br />
{<br />
title : "<strong>What's new</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/b/be/What%27s_new.png", "Three advantages of the E.coslim", "Compared to traditional methods of losing weight, our E.coslim has three advantages: monitoring, high efficiency and long term efficiency ", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#Pcar"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/f/ff/Promoter_design.png", "Pcar and PfadR", "By inserting CRP and FadR binding site to overlap with the -10 region of constitutive promoter, we have successfully made two novel promoter Pcar and PfadR. Pcar is able to be induced by glucose, while PfadR is able to be induced by fatty acids.", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#Pcar"),<br />
<br />
new picObj("http://partsregistry.org/wiki/images/f/ff/%E5%85%A8%E6%99%AF%E5%8A%A0%E6%AD%BB%E4%BA%A11.png", "Panorama of the Whole Project Scheme", "Four novel devices, Fatty Acid Degradation, Cellulose Synthesis, Colonization and Death to ensure high efficiency orchestrate calorie absorption and bacteria survival and make you slim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/0/09/%E8%83%96%E5%AD%90%E7%98%A6%E5%AD%90.png", "Long term efficiency of the E.coslim", "When viewed at macroscopic way, the E.coslim may have an advantage of long term efficiency,by regulating the human gut microbiota.And we have certified this by mathematical model", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#PfadR")<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>Pathway Introduction</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/igem.org/8/82/Pathway_FattyAcid.png", "Fatty Acid Degradation", "Feel free to eat meat since the fat is all degraded by our E.coslim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=3"),<br />
new picObj("https://static.igem.org/mediawiki/igem.org/1/18/Pathway_Cellulose.png", "Cellulose Synthesis", "Transforming glucose into cellulose, the high-sugar food you eat will be turned into vegetables!", "https://2012.igem.org/Team:WHU-China/Project?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/e/ea/Device_three.png", "Colonization", "The magic molecule c-di-GMP enables E.coslim colonizing in the gut to better fulfill its magic function!", "https://2012.igem.org/Team:WHU-China/Project?catalog=5")<br />
]<br />
},<br />
<br />
{<br />
title : "<strong>Future Perspective</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/ab/%E5%8F%8C%E8%83%B6%E5%9B%8A2.jpg", "Two Capsule Design", "Capsule I, the E.coslim, makes you slim, while Capsule II, xylose, terminates the effects of the former.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/d/d2/Fpbody2.jpg", "In vitro experiment in a simulated intestine", "The gut microbiota and E.coslim will be inoculated in a simulated intestine, then the concentration measurement of each component will tell us whether E.coslim works as desired.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/8/85/%E5%B0%8F%E9%BC%A0%E5%AE%9E%E9%AA%8C02.jpg", "In vivo experiment in mice", "E.coslim will also be inoculated into mice and the culture-independent microbiome analysis will tell us the real situation in vivo.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0")<br />
]<br />
},<br />
<br />
<br />
<br />
{<br />
title : "<strong>Achievement</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/f/fd/Achievements_device.png", "Devices", "This year,our project has focused on some of the the hot-button issues,such as c-di-CMP, gut microbiota and so on. At last, we submitted 66 new biobricks. For detailed information, click <a href="https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0">Here</a>.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/c/ca/Achievements_1.png", "Biobicks we have improved", "In our project, we have improved the function of some biobricks,such as BBa_J54222, BBa_K188011 and BBa_R0051. For detailed information, click <a href="https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0">Here</a>.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/f/f5/Achievements_2.png", "Novel promoter we designed", "Because no such promoter which can meet our demand exists in the nature, we designed two novel promoter Pcar and PfadR to achieve the goal.In addition, we also have set up a standard for promoter design. For detailed information, click <a href="https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0">Here</a>.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/2/2c/Achievements2.png", "Methods we improved", "In our project,we improved some traditional method to measure fatty acids and cellulose, and also we developped a software named FANCY to detect the fluorescence intensity of single cell. For detailed information, click <a href="https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0">Here</a>.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/b/b0/Achievements_human.png", "Human Practice", "We have helped another iGEM team to debug their project and mathematical model,also we did a survey on GMOs and publisized iGEM to the public. For detailed information, click <a href="https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0">Here</a>. ", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0")<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>About Us</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/a7/Whu-2012-1.jpg", "WHU-China 2012, I was there", "The Entrance of State Wuhan University", "https://2012.igem.org/Team:WHU-China/Team?catalog=1"),<br />
new picObj("https://static.igem.org/mediawiki/2012/2/23/Whu2012heying.jpg", "MIT, we're coming!", "Collge of Life Sciences of WHU", "https://2012.igem.org/Team:WHU-China/Team?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/4/43/Whu2012-2.jpg", "WHU-China, Hooray!", "Yuntai Mountain, Henan Province", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=5")<br />
]<br />
}<br />
],<br />
Team : [<br />
{<br />
title : '<strong>Members</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Instructors</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Team History</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About WHU</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About Our Lab</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Acknow-</br>ledgements</strong>',<br />
dir : []<br />
},<br />
<br />
],<br />
Project : [<br />
{<br />
title : '<strong>Description</strong>',<br />
dir : [<br />
<br />
]<br />
},<br />
{<br />
title : '<strong>Background</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Promoter Design</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device I: Fatty Acid Degradation</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device II: Cellulose Synthesis</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device III: Colonization</strong>',<br />
dir : []<br />
},<br />
],<br />
Modeling : [<br />
{<br />
title : '<strong>Future Perspectives</strong>',<br />
dir : []<br />
},<br />
<br />
{<br />
title : '<strong>Model I: Fatty Acid Degradation</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Model II: Microbiota Regulation</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Software Tool: FANCY</strong>',<br />
dir : []<br />
}<br />
],<br />
Notebooks : [<br />
{<br />
title : '<strong>Parts</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Safety</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Protocols</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Events</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Brain-</br>storming</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Gallery</strong>',<br />
dir : []<br />
}<br />
],<br />
HumanPractice : [<br />
{<br />
title : '<strong>Outline</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Questionaire Survey</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Publicity</strong>',<br />
dir : []<br />
}<br />
]<br />
}; <br />
//*************************自定义数据部分*************************<br />
</script><br />
<style type="text/css"><br />
/*<br />
* base css, DO NOT MODIFY!<br />
*/<br />
* {<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
font-family: "Verdana", sans-serif;<br />
color: #333;<br />
list-style: none;<br />
outline: none;<br />
resize: none;<br />
}<br />
html {<br />
overflow-y: scroll;<br />
}<br />
body {<br />
background: url("https://static.igem.org/mediawiki/2012/2/22/Body-bg.jpg") center center fixed;<br />
}<br />
a {<br />
text-decoration: none;<br />
}<br />
.clear {<br />
width: 0;<br />
height: 0;<br />
line-height: 0;<br />
display: block;<br />
clear: both;<br />
}<br />
<br />
/*<br />
* common css, include "header","footer"...<br />
*/<br />
div.center {<br />
width: 1000px;<br />
margin: 0 auto;<br />
position: relative;<br />
}<br />
div.header {<br />
width: 1000px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/1/12/Header-bg.png") no-repeat;<br />
position: relative;<br />
z-index: 50;<br />
}<br />
div.nav {<br />
position: absolute;<br />
height: 80px;<br />
top: 185px;<br />
left: 245px;<br />
}<br />
li.nav-outerLi {<br />
display: block;<br />
float: left;<br />
width: 80px;<br />
height: 80px;<br />
margin: 0 6px;<br />
cursor: pointer;<br />
}<br />
h2.nav-h21,h2.nav-h22,h2.nav-h23,h2.nav-h24,h2.nav-h25,h2.nav-h26 {<br />
display: block;<br />
background: url("https://static.igem.org/mediawiki/2012/9/91/Nav-tabs.png") no-repeat;<br />
width: 80px;<br />
height: 80px;<br />
background-position: 0 0;<br />
z-index: 150;<br />
position: relative;<br />
}<br />
h2.nav-h22 {<br />
background-position: -80px 0;<br />
}<br />
h2.nav-h23 {<br />
background-position: -160px 0;<br />
}<br />
h2.nav-h24 {<br />
background-position: -240px 0;<br />
}<br />
h2.nav-h25 {<br />
background-position: -320px 0;<br />
}<br />
h2.nav-h26 {<br />
background-position: -400px 0;<br />
}<br />
h2.nav-h21:hover {<br />
background-position: 0 -80px;<br />
}<br />
h2.nav-h22:hover {<br />
background-position: -80px -80px;<br />
}<br />
h2.nav-h23:hover {<br />
background-position: -160px -80px;<br />
}<br />
h2.nav-h24:hover {<br />
background-position: -240px -80px;<br />
}<br />
h2.nav-h25:hover {<br />
background-position: -320px -80px;<br />
}<br />
h2.nav-h26:hover {<br />
background-position: -400px -80px;<br />
}<br />
h2.nav-h21on {<br />
background-position: 0 -160px;<br />
}<br />
h2.nav-h22on {<br />
background-position: -80px -160px;<br />
}<br />
h2.nav-h23on {<br />
background-position: -160px -160px;<br />
}<br />
h2.nav-h24on {<br />
background-position: -240px -160px;<br />
}<br />
h2.nav-h25on {<br />
background-position: -320px -160px;<br />
}<br />
h2.nav-h26on {<br />
background-position: -400px -160px;<br />
}<br />
ul.nav-innerUl{<br />
position: absolute;<br />
top: 40px;<br />
padding-top: 40px;<br />
width: 76px;<br />
border-left: 2px solid #000;<br />
border-right: 2px solid #000;<br />
z-index: 140;<br />
display: none;<br />
}<br />
em.nav-libg{<br />
display: block;<br />
width: 96px;<br />
height: 11px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/48/Nav-libg.png');<br />
margin-left: -10px;<br />
}<br />
ul.nav-innerUl1{<br />
background: #fffaca;<br />
}<br />
ul.nav-innerUl2{<br />
background: #dedede;<br />
}<br />
ul.nav-innerUl3{<br />
background: #d9f0c9;<br />
}<br />
ul.nav-innerUl4{<br />
background: #f6e5ff;<br />
}<br />
ul.nav-innerUl5{<br />
background: #ebfcff;<br />
}<br />
ul.nav-innerUl6{<br />
background: #ffeee8;<br />
}<br />
li.nav-innerLi{<br />
font-size: 10px;<br />
line-height: 14px;<br />
padding: 3px 5px;<br />
}<br />
li.nav-innerLi:hover{<br />
background: #fff;<br />
}<br />
div.middle {<br />
width: 940px;<br />
background: #e6deb8;<br />
background: rgba(230,222,184,0.5);<br />
position: absolute;<br />
top: 300px;<br />
left: 30px;<br />
}<br />
div.aside {<br />
width: 160px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/b/b3/Aside-bg.png") no-repeat;<br />
margin-left: 20px;<br />
margin-top: 100px;<br />
float: left;<br />
padding: 20px;<br />
}<br />
ul.aside-outerUl {<br />
margin: 15px;<br />
}<br />
li.aside-outerLi {<br />
margin: 15px 0;<br />
background: #fff1a9;<br />
padding: 5px 10px;<br />
color: #725718;<br />
font-size: 16px;<br />
line-height: 24px;<br />
font-weight: bold;<br />
text-align: center;<br />
cursor: pointer;<br />
}<br />
li.aside-outerLi:hover {<br />
background: #fff8d3;<br />
}<br />
div.main {<br />
width: 640px;<br />
height: 400px;<br />
border: 5px solid #333;<br />
background: #fff;<br />
float: right;<br />
margin: 100px 30px 30px 0;<br />
}<br />
div.footer {<br />
}<br />
<br />
/*<br />
* picSlider Css<br />
*/<br />
#picSlider {<br />
width: 640px;<br />
height: 320px;<br />
}<br />
.momo {<br />
background: #000;<br />
}<br />
.momo .pic li {<br />
width: 100%;<br />
height: 100%;<br />
overflow: hidden;<br />
position: absolute;<br />
display: none;<br />
}<br />
.momo .txt li {<br />
position: absolute;<br />
padding: 5px 10px;<br />
z-index: 2;<br />
bottom: 0;<br />
height: 28px;<br />
background: #DBDBDB;<br />
display: none;<br />
}<br />
.momo .txt li a {<br />
display: block;<br />
position: relative;<br />
z-index: 1;<br />
color: #333;<br />
font-size: 12px;<br />
font-weight: bold;<br />
text-decoration: none;<br />
}<br />
.momo .num {<br />
position: absolute;<br />
z-index: 3;<br />
bottom: 5px;<br />
right: 5px;<br />
}<br />
.momo .num li {<br />
float: left;<br />
}<br />
.momo .num li a {<br />
color: #333;<br />
float: left;<br />
margin-left: 3px;<br />
width: 15px;<br />
height: 15px;<br />
line-height: 15px;<br />
*line-height: 14px;<br />
overflow: hidden;<br />
border: 1px solid #AEC1CC;<br />
text-align: center;<br />
cursor: pointer;<br />
background: #fff;<br />
text-decoration: none;<br />
}<br />
.momo .num li.current a, .momo .num li.hover a {<br />
color: #fff;<br />
background: #f60;<br />
-webkit-transition: all 0.4s;<br />
-moz-transition: all 0.4s;<br />
-o-transition: all 0.4s;<br />
}<br />
.momo_picSlider .txt li{<br />
width: 620px;<br />
}<br />
.momo_picSlider .txt li a{<br />
font-size: 16px;<br />
line-height: 24px;<br />
}<br />
#p-logo {<br />
display:none;<br />
}<br />
#top-section {<br />
height:0;<br />
border:none;<br />
}<br />
#search-controls {<br />
display:none;<br />
}<br />
#content {<br />
position:inherit;<br />
width:inherit;<br />
margin:0;<br />
padding:0;<br />
background:inherit;<br />
color:inherit;<br />
border:none;<br />
line-height:inherit;<br />
z-index:2;<br />
}<br />
.firstHeading {<br />
display:none;<br />
}<br />
#catlinks {<br />
display:none;<br />
}<br />
#footer-box {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#menubar ul li a {<br />
background:none;<br />
}<br />
#bodyContent h1,#bodyContent h2 {<br />
margin:0;<br />
border:0;<br />
padding: 0;<br />
}<br />
.left-menu:hover {<br />
background:none;<br />
}<br />
</style><br />
<div class="center"><br />
<div class="header"><br />
<div class="nav"><br />
<ul class="nav-outerUl"><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China"><h2 class="nav-h21 nav-h21on" title="Home"></h2></a><br />
<ul class="nav-innerUl nav-innerUl1" name="Home"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Team"><h2 class="nav-h22" title="Team"></h2></a><br />
<ul class="nav-innerUl nav-innerUl2" name="Team"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Project"><h2 class="nav-h23" title="Project"></h2></a><br />
<ul class="nav-innerUl nav-innerUl3" name="Project"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Modeling"><h2 class="nav-h24" title="Modeling"></h2></a><br />
<ul class="nav-innerUl nav-innerUl4" name="Modeling"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Notebooks"><h2 class="nav-h25" title="Notebooks"></h2></a><br />
<ul class="nav-innerUl nav-innerUl5" name="Notebooks"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/humanPractice"><h2 class="nav-h26" title="Human Practice"></h2></a><br />
<ul class="nav-innerUl nav-innerUl6" name="HumanPractice"></ul><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div class="middle"><br />
<div class="aside"><br />
<ul class="aside-outerUl"></ul><br />
</div><br />
<div class="main"></div><br />
<div class="clear"></div><br />
</div><br />
<div class="footer"></div><br />
</div><br />
<script src="http://www.yichengliu.com/code/igem/home.js"></script><br />
</body><br />
</html></div>Nanhaihttp://2012.igem.org/Team:WHU-ChinaTeam:WHU-China2012-10-26T22:31:17Z<p>Nanhai: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<body><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script><br />
function picObj(src, title, detail, href){<br />
this.src = src;<br />
this.title = title;<br />
this.detail = detail;<br />
this.href = href;<br />
}<br />
//*************************自定义数据部分*************************<br />
<br />
//定义菜单及侧边栏数据<br />
var menuObj = {<br />
Home : [<br />
{<br />
title : "<strong>What's new</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/b/be/What%27s_new.png", "Three advantages of the E.coslim", "Compared to traditional methods of losing weight, our E.coslim has three advantages: monitoring, high efficiency and long term efficiency ", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#Pcar"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/f/ff/Promoter_design.png", "Pcar and PfadR", "By inserting CRP and FadR binding site to overlap with the -10 region of constitutive promoter, we have successfully made two novel promoter Pcar and PfadR. Pcar is able to be induced by glucose, while PfadR is able to be induced by fatty acids.", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#Pcar"),<br />
<br />
new picObj("http://partsregistry.org/wiki/images/f/ff/%E5%85%A8%E6%99%AF%E5%8A%A0%E6%AD%BB%E4%BA%A11.png", "Panorama of the Whole Project Scheme", "Four novel devices, Fatty Acid Degradation, Cellulose Synthesis, Colonization and Death to ensure high efficiency orchestrate calorie absorption and bacteria survival and make you slim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/0/09/%E8%83%96%E5%AD%90%E7%98%A6%E5%AD%90.png", "Long term efficiency of the E.coslim", "When viewed at macroscopic way, the E.coslim may have an advantage of long term efficiency,by regulating the human gut microbiota.And we have certified this by mathematical model", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#PfadR")<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>Pathway Introduction</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/igem.org/8/82/Pathway_FattyAcid.png", "Fatty Acid Degradation", "Feel free to eat meat since the fat is all degraded by our E.coslim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=3"),<br />
new picObj("https://static.igem.org/mediawiki/igem.org/1/18/Pathway_Cellulose.png", "Cellulose Synthesis", "Transforming glucose into cellulose, the high-sugar food you eat will be turned into vegetables!", "https://2012.igem.org/Team:WHU-China/Project?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/e/ea/Device_three.png", "Colonization", "The magic molecule c-di-GMP enables E.coslim colonizing in the gut to better fulfill its magic function!", "https://2012.igem.org/Team:WHU-China/Project?catalog=5")<br />
]<br />
},<br />
<br />
{<br />
title : "<strong>Future Perspective</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/ab/%E5%8F%8C%E8%83%B6%E5%9B%8A2.jpg", "Two Capsule Design", "Capsule I, the E.coslim, makes you slim, while Capsule II, xylose, terminates the effects of the former.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/d/d2/Fpbody2.jpg", "In vitro experiment in a simulated intestine", "The gut microbiota and E.coslim will be inoculated in a simulated intestine, then the concentration measurement of each component will tell us whether E.coslim works as desired.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/8/85/%E5%B0%8F%E9%BC%A0%E5%AE%9E%E9%AA%8C02.jpg", "In vivo experiment in mice", "E.coslim will also be inoculated into mice and the culture-independent microbiome analysis will tell us the real situation in vivo.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0")<br />
]<br />
},<br />
<br />
<br />
<br />
{<br />
title : "<strong>Achievement</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/f/fd/Achievements_device.png", "Devices", "This year,our project has focused on some of the the hot-button issues,such as c-di-CMP, gut microbiota and so on. At last, we submitted 66 new biobricks. For detailed information, click <a href="https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0">Here</a>. ", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/c/ca/Achievements_1.png", "Biobicks we have improved", "In our project, we have improved the function of some biobricks,such as BBa_J54222, BBa_K188011 and BBa_R0051. For detailed information, click <a href="https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0">Here</a>.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/f/f5/Achievements_2.png", "Novel promoter we designed", "Because no such promoter which can meet our demand exists in the nature, we designed two novel promoter Pcar and PfadR to achieve the goal.In addition, we also have set up a standard for promoter design. For detailed information, click <a href="https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0">Here</a>.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/2/2c/Achievements2.png", "Methods we improved", "In our project,we improved some traditional method to measure fatty acids and cellulose, and also we developped a software named FANCY to detect the fluorescence intensity of single cell. For detailed information, click <a href="https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0">Here</a>.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/b/b0/Achievements_human.png", "Human Practice", "We have helped another iGEM team to debug their project and mathematical model,also we did a survey on GMOs and publisized iGEM to the public. For detailed information, click <a href="https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0">Here</a>. ", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>About Us</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/a7/Whu-2012-1.jpg", "WHU-China 2012, I was there", "The Entrance of State Wuhan University", "https://2012.igem.org/Team:WHU-China/Team?catalog=1"),<br />
new picObj("https://static.igem.org/mediawiki/2012/2/23/Whu2012heying.jpg", "MIT, we're coming!", "Collge of Life Sciences of WHU", "https://2012.igem.org/Team:WHU-China/Team?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/4/43/Whu2012-2.jpg", "WHU-China, Hooray!", "Yuntai Mountain, Henan Province", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=5")<br />
]<br />
}<br />
],<br />
Team : [<br />
{<br />
title : '<strong>Members</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Instructors</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Team History</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About WHU</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About Our Lab</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Acknow-</br>ledgements</strong>',<br />
dir : []<br />
},<br />
<br />
],<br />
Project : [<br />
{<br />
title : '<strong>Description</strong>',<br />
dir : [<br />
<br />
]<br />
},<br />
{<br />
title : '<strong>Background</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Promoter Design</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device I: Fatty Acid Degradation</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device II: Cellulose Synthesis</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device III: Colonization</strong>',<br />
dir : []<br />
},<br />
],<br />
Modeling : [<br />
{<br />
title : '<strong>Future Perspectives</strong>',<br />
dir : []<br />
},<br />
<br />
{<br />
title : '<strong>Model I: Fatty Acid Degradation</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Model II: Microbiota Regulation</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Software Tool: FANCY</strong>',<br />
dir : []<br />
}<br />
],<br />
Notebooks : [<br />
{<br />
title : '<strong>Parts</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Safety</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Protocols</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Events</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Brain-</br>storming</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Gallery</strong>',<br />
dir : []<br />
}<br />
],<br />
HumanPractice : [<br />
{<br />
title : '<strong>Outline</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Questionaire Survey</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Publicity</strong>',<br />
dir : []<br />
}<br />
]<br />
}; <br />
//*************************自定义数据部分*************************<br />
</script><br />
<style type="text/css"><br />
/*<br />
* base css, DO NOT MODIFY!<br />
*/<br />
* {<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
font-family: "Verdana", sans-serif;<br />
color: #333;<br />
list-style: none;<br />
outline: none;<br />
resize: none;<br />
}<br />
html {<br />
overflow-y: scroll;<br />
}<br />
body {<br />
background: url("https://static.igem.org/mediawiki/2012/2/22/Body-bg.jpg") center center fixed;<br />
}<br />
a {<br />
text-decoration: none;<br />
}<br />
.clear {<br />
width: 0;<br />
height: 0;<br />
line-height: 0;<br />
display: block;<br />
clear: both;<br />
}<br />
<br />
/*<br />
* common css, include "header","footer"...<br />
*/<br />
div.center {<br />
width: 1000px;<br />
margin: 0 auto;<br />
position: relative;<br />
}<br />
div.header {<br />
width: 1000px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/1/12/Header-bg.png") no-repeat;<br />
position: relative;<br />
z-index: 50;<br />
}<br />
div.nav {<br />
position: absolute;<br />
height: 80px;<br />
top: 185px;<br />
left: 245px;<br />
}<br />
li.nav-outerLi {<br />
display: block;<br />
float: left;<br />
width: 80px;<br />
height: 80px;<br />
margin: 0 6px;<br />
cursor: pointer;<br />
}<br />
h2.nav-h21,h2.nav-h22,h2.nav-h23,h2.nav-h24,h2.nav-h25,h2.nav-h26 {<br />
display: block;<br />
background: url("https://static.igem.org/mediawiki/2012/9/91/Nav-tabs.png") no-repeat;<br />
width: 80px;<br />
height: 80px;<br />
background-position: 0 0;<br />
z-index: 150;<br />
position: relative;<br />
}<br />
h2.nav-h22 {<br />
background-position: -80px 0;<br />
}<br />
h2.nav-h23 {<br />
background-position: -160px 0;<br />
}<br />
h2.nav-h24 {<br />
background-position: -240px 0;<br />
}<br />
h2.nav-h25 {<br />
background-position: -320px 0;<br />
}<br />
h2.nav-h26 {<br />
background-position: -400px 0;<br />
}<br />
h2.nav-h21:hover {<br />
background-position: 0 -80px;<br />
}<br />
h2.nav-h22:hover {<br />
background-position: -80px -80px;<br />
}<br />
h2.nav-h23:hover {<br />
background-position: -160px -80px;<br />
}<br />
h2.nav-h24:hover {<br />
background-position: -240px -80px;<br />
}<br />
h2.nav-h25:hover {<br />
background-position: -320px -80px;<br />
}<br />
h2.nav-h26:hover {<br />
background-position: -400px -80px;<br />
}<br />
h2.nav-h21on {<br />
background-position: 0 -160px;<br />
}<br />
h2.nav-h22on {<br />
background-position: -80px -160px;<br />
}<br />
h2.nav-h23on {<br />
background-position: -160px -160px;<br />
}<br />
h2.nav-h24on {<br />
background-position: -240px -160px;<br />
}<br />
h2.nav-h25on {<br />
background-position: -320px -160px;<br />
}<br />
h2.nav-h26on {<br />
background-position: -400px -160px;<br />
}<br />
ul.nav-innerUl{<br />
position: absolute;<br />
top: 40px;<br />
padding-top: 40px;<br />
width: 76px;<br />
border-left: 2px solid #000;<br />
border-right: 2px solid #000;<br />
z-index: 140;<br />
display: none;<br />
}<br />
em.nav-libg{<br />
display: block;<br />
width: 96px;<br />
height: 11px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/48/Nav-libg.png');<br />
margin-left: -10px;<br />
}<br />
ul.nav-innerUl1{<br />
background: #fffaca;<br />
}<br />
ul.nav-innerUl2{<br />
background: #dedede;<br />
}<br />
ul.nav-innerUl3{<br />
background: #d9f0c9;<br />
}<br />
ul.nav-innerUl4{<br />
background: #f6e5ff;<br />
}<br />
ul.nav-innerUl5{<br />
background: #ebfcff;<br />
}<br />
ul.nav-innerUl6{<br />
background: #ffeee8;<br />
}<br />
li.nav-innerLi{<br />
font-size: 10px;<br />
line-height: 14px;<br />
padding: 3px 5px;<br />
}<br />
li.nav-innerLi:hover{<br />
background: #fff;<br />
}<br />
div.middle {<br />
width: 940px;<br />
background: #e6deb8;<br />
background: rgba(230,222,184,0.5);<br />
position: absolute;<br />
top: 300px;<br />
left: 30px;<br />
}<br />
div.aside {<br />
width: 160px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/b/b3/Aside-bg.png") no-repeat;<br />
margin-left: 20px;<br />
margin-top: 100px;<br />
float: left;<br />
padding: 20px;<br />
}<br />
ul.aside-outerUl {<br />
margin: 15px;<br />
}<br />
li.aside-outerLi {<br />
margin: 15px 0;<br />
background: #fff1a9;<br />
padding: 5px 10px;<br />
color: #725718;<br />
font-size: 16px;<br />
line-height: 24px;<br />
font-weight: bold;<br />
text-align: center;<br />
cursor: pointer;<br />
}<br />
li.aside-outerLi:hover {<br />
background: #fff8d3;<br />
}<br />
div.main {<br />
width: 640px;<br />
height: 400px;<br />
border: 5px solid #333;<br />
background: #fff;<br />
float: right;<br />
margin: 100px 30px 30px 0;<br />
}<br />
div.footer {<br />
}<br />
<br />
/*<br />
* picSlider Css<br />
*/<br />
#picSlider {<br />
width: 640px;<br />
height: 320px;<br />
}<br />
.momo {<br />
background: #000;<br />
}<br />
.momo .pic li {<br />
width: 100%;<br />
height: 100%;<br />
overflow: hidden;<br />
position: absolute;<br />
display: none;<br />
}<br />
.momo .txt li {<br />
position: absolute;<br />
padding: 5px 10px;<br />
z-index: 2;<br />
bottom: 0;<br />
height: 28px;<br />
background: #DBDBDB;<br />
display: none;<br />
}<br />
.momo .txt li a {<br />
display: block;<br />
position: relative;<br />
z-index: 1;<br />
color: #333;<br />
font-size: 12px;<br />
font-weight: bold;<br />
text-decoration: none;<br />
}<br />
.momo .num {<br />
position: absolute;<br />
z-index: 3;<br />
bottom: 5px;<br />
right: 5px;<br />
}<br />
.momo .num li {<br />
float: left;<br />
}<br />
.momo .num li a {<br />
color: #333;<br />
float: left;<br />
margin-left: 3px;<br />
width: 15px;<br />
height: 15px;<br />
line-height: 15px;<br />
*line-height: 14px;<br />
overflow: hidden;<br />
border: 1px solid #AEC1CC;<br />
text-align: center;<br />
cursor: pointer;<br />
background: #fff;<br />
text-decoration: none;<br />
}<br />
.momo .num li.current a, .momo .num li.hover a {<br />
color: #fff;<br />
background: #f60;<br />
-webkit-transition: all 0.4s;<br />
-moz-transition: all 0.4s;<br />
-o-transition: all 0.4s;<br />
}<br />
.momo_picSlider .txt li{<br />
width: 620px;<br />
}<br />
.momo_picSlider .txt li a{<br />
font-size: 16px;<br />
line-height: 24px;<br />
}<br />
#p-logo {<br />
display:none;<br />
}<br />
#top-section {<br />
height:0;<br />
border:none;<br />
}<br />
#search-controls {<br />
display:none;<br />
}<br />
#content {<br />
position:inherit;<br />
width:inherit;<br />
margin:0;<br />
padding:0;<br />
background:inherit;<br />
color:inherit;<br />
border:none;<br />
line-height:inherit;<br />
z-index:2;<br />
}<br />
.firstHeading {<br />
display:none;<br />
}<br />
#catlinks {<br />
display:none;<br />
}<br />
#footer-box {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#menubar ul li a {<br />
background:none;<br />
}<br />
#bodyContent h1,#bodyContent h2 {<br />
margin:0;<br />
border:0;<br />
padding: 0;<br />
}<br />
.left-menu:hover {<br />
background:none;<br />
}<br />
</style><br />
<div class="center"><br />
<div class="header"><br />
<div class="nav"><br />
<ul class="nav-outerUl"><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China"><h2 class="nav-h21 nav-h21on" title="Home"></h2></a><br />
<ul class="nav-innerUl nav-innerUl1" name="Home"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Team"><h2 class="nav-h22" title="Team"></h2></a><br />
<ul class="nav-innerUl nav-innerUl2" name="Team"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Project"><h2 class="nav-h23" title="Project"></h2></a><br />
<ul class="nav-innerUl nav-innerUl3" name="Project"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Modeling"><h2 class="nav-h24" title="Modeling"></h2></a><br />
<ul class="nav-innerUl nav-innerUl4" name="Modeling"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Notebooks"><h2 class="nav-h25" title="Notebooks"></h2></a><br />
<ul class="nav-innerUl nav-innerUl5" name="Notebooks"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/humanPractice"><h2 class="nav-h26" title="Human Practice"></h2></a><br />
<ul class="nav-innerUl nav-innerUl6" name="HumanPractice"></ul><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div class="middle"><br />
<div class="aside"><br />
<ul class="aside-outerUl"></ul><br />
</div><br />
<div class="main"></div><br />
<div class="clear"></div><br />
</div><br />
<div class="footer"></div><br />
</div><br />
<script src="http://www.yichengliu.com/code/igem/home.js"></script><br />
</body><br />
</html></div>Nanhaihttp://2012.igem.org/File:Achievements2.pngFile:Achievements2.png2012-10-26T22:30:28Z<p>Nanhai: </p>
<hr />
<div></div>Nanhaihttp://2012.igem.org/File:Promoter_design.pngFile:Promoter design.png2012-10-26T22:22:50Z<p>Nanhai: </p>
<hr />
<div></div>Nanhaihttp://2012.igem.org/File:What%27s_new.pngFile:What's new.png2012-10-26T22:14:54Z<p>Nanhai: </p>
<hr />
<div></div>Nanhaihttp://2012.igem.org/File:Achievements_device.pngFile:Achievements device.png2012-10-26T22:05:52Z<p>Nanhai: </p>
<hr />
<div></div>Nanhaihttp://2012.igem.org/Team:WHU-ChinaTeam:WHU-China2012-10-26T21:48:55Z<p>Nanhai: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<body><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script><br />
function picObj(src, title, detail, href){<br />
this.src = src;<br />
this.title = title;<br />
this.detail = detail;<br />
this.href = href;<br />
}<br />
//*************************自定义数据部分*************************<br />
<br />
//定义菜单及侧边栏数据<br />
var menuObj = {<br />
Home : [<br />
{<br />
title : "<strong>What's new</strong>",<br />
picArray : [new picObj("http://partsregistry.org/wiki/images/f/ff/%E5%85%A8%E6%99%AF%E5%8A%A0%E6%AD%BB%E4%BA%A11.png", "Panorama of the Whole Project Scheme", "Four novel devices, Fatty Acid Degradation, Cellulose Synthesis, Colonization and Death to ensure high efficiency orchestrate calorie absorption and bacteria survival and make you slim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/d/d9/A_picture_of_Pcar.png", "Pcar: Promoter of CRP As a Repressor", "By inserting CRP-binding site to overlap with the -10 region of a constitutive promoter, Pcar is able to be induced by glucose, while CRP serves as a repressor rather than an activator.", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#Pcar"),<br />
new picObj("https://static.igem.org/mediawiki/2012/3/37/Pfadr_picture.png", "PfadR: Synthesized promoter regulated solely by fatty acid", "With tandem FadR binding site, PfadR is able to be repressed solely by fatty acid.", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#PfadR"),<br />
new picObj("https://static.igem.org/mediawiki/2012/0/09/%E8%83%96%E5%AD%90%E7%98%A6%E5%AD%90.png", "Long term efficiency of the E.coslim", "When viewed at macroscopic way, the E.coslim may have an advantage of long term efficiency,by regulating the human gut microbiota.And we have certified this by mathematical model", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#PfadR")<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>Pathway Introduction</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/igem.org/8/82/Pathway_FattyAcid.png", "Fatty Acid Degradation", "Feel free to eat meat since the fat is all degraded by our E.coslim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=3"),<br />
new picObj("https://static.igem.org/mediawiki/igem.org/1/18/Pathway_Cellulose.png", "Cellulose Synthesis", "Transforming glucose into cellulose, the high-sugar food you eat will be turned into vegetables!", "https://2012.igem.org/Team:WHU-China/Project?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/e/ea/Device_three.png", "Colonization", "The magic molecule c-di-GMP enables E.coslim colonizing in the gut to better fulfill its magic function!", "https://2012.igem.org/Team:WHU-China/Project?catalog=5")<br />
]<br />
},<br />
<br />
{<br />
title : "<strong>Future Perspective</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/ab/%E5%8F%8C%E8%83%B6%E5%9B%8A2.jpg", "Two Capsule Design", "Capsule I, the E.coslim, makes you slim, while Capsule II, xylose, terminates the effects of the former.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/d/d2/Fpbody2.jpg", "In vitro experiment in a simulated intestine", "The gut microbiota and E.coslim will be inoculated in a simulated intestine, then the concentration measurement of each component will tell us whether E.coslim works as desired.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/8/85/%E5%B0%8F%E9%BC%A0%E5%AE%9E%E9%AA%8C02.jpg", "In vivo experiment in mice", "E.coslim will also be inoculated into mice and the culture-independent microbiome analysis will tell us the real situation in vivo.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0")<br />
]<br />
},<br />
<br />
<br />
<br />
{<br />
title : "<strong>Achievement</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/c/ca/Achievements_1.png", "Biobicks we have improved", "In our project,we have improved the function of some biobricks,such as BBa_J54222,BBa_K188011 and BBa_R0051.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/f/f5/Achievements_2.png", "Novel promoter we designed", "Because no such promoter which can meet our demand exists in the nature, we designed two novel promoter Pcar and PfadR to achieve the goal.In addition, we also have set up a standard for promoter design. ", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/3/31/Achievements_methods.png", "Methods we improved", "In our project,we improved some traditional method to measure fatty acids and cellulose, and also we developped a software named FANCY to detect the fluorescence intensity of single cell", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/b/b0/Achievements_human.png", "Human Practice", "We have helped another iGEM team to debug their project and mathematical model,also we did a survey on GMOs and publisized iGEM to the public ", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
new picObj("https://static.igem.org/mediawiki/2012/a/ac/Achievements_5.png", "Devices", "This year,our project has focused on some of the the hot-button issues,such as c-di-CMP ,gut microbiota and so on. At last, we submitted 66 new biobricks", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>About Us</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/a7/Whu-2012-1.jpg", "WHU-China 2012, I was there", "The Entrance of State Wuhan University", "https://2012.igem.org/Team:WHU-China/Team?catalog=1"),<br />
new picObj("https://static.igem.org/mediawiki/2012/2/23/Whu2012heying.jpg", "MIT, we're coming!", "Collge of Life Sciences of WHU", "https://2012.igem.org/Team:WHU-China/Team?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/4/43/Whu2012-2.jpg", "WHU-China, Hooray!", "Yuntai Mountain, Henan Province", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=5")<br />
]<br />
}<br />
],<br />
Team : [<br />
{<br />
title : '<strong>Members</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Instructors</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Team History</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About WHU</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About Our Lab</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Acknow-</br>ledgements</strong>',<br />
dir : []<br />
},<br />
<br />
],<br />
Project : [<br />
{<br />
title : '<strong>Description</strong>',<br />
dir : [<br />
<br />
]<br />
},<br />
{<br />
title : '<strong>Background</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Promoter Design</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device I: Fatty Acid Degradation</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device II: Cellulose Synthesis</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device III: Colonization</strong>',<br />
dir : []<br />
},<br />
],<br />
Modeling : [<br />
{<br />
title : '<strong>Future Perspectives</strong>',<br />
dir : []<br />
},<br />
<br />
{<br />
title : '<strong>Model I: Fatty Acid Degradation</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Model II: Microbiota Regulation</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Software Tool: FANCY</strong>',<br />
dir : []<br />
}<br />
],<br />
Notebooks : [<br />
{<br />
title : '<strong>Parts</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Safety</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Protocols</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Events</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Brain-</br>storming</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Gallery</strong>',<br />
dir : []<br />
}<br />
],<br />
HumanPractice : [<br />
{<br />
title : '<strong>Outline</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Questionaire Survey</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Publicity</strong>',<br />
dir : []<br />
}<br />
]<br />
}; <br />
//*************************自定义数据部分*************************<br />
</script><br />
<style type="text/css"><br />
/*<br />
* base css, DO NOT MODIFY!<br />
*/<br />
* {<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
font-family: "Verdana", sans-serif;<br />
color: #333;<br />
list-style: none;<br />
outline: none;<br />
resize: none;<br />
}<br />
html {<br />
overflow-y: scroll;<br />
}<br />
body {<br />
background: url("https://static.igem.org/mediawiki/2012/2/22/Body-bg.jpg") center center fixed;<br />
}<br />
a {<br />
text-decoration: none;<br />
}<br />
.clear {<br />
width: 0;<br />
height: 0;<br />
line-height: 0;<br />
display: block;<br />
clear: both;<br />
}<br />
<br />
/*<br />
* common css, include "header","footer"...<br />
*/<br />
div.center {<br />
width: 1000px;<br />
margin: 0 auto;<br />
position: relative;<br />
}<br />
div.header {<br />
width: 1000px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/1/12/Header-bg.png") no-repeat;<br />
position: relative;<br />
z-index: 50;<br />
}<br />
div.nav {<br />
position: absolute;<br />
height: 80px;<br />
top: 185px;<br />
left: 245px;<br />
}<br />
li.nav-outerLi {<br />
display: block;<br />
float: left;<br />
width: 80px;<br />
height: 80px;<br />
margin: 0 6px;<br />
cursor: pointer;<br />
}<br />
h2.nav-h21,h2.nav-h22,h2.nav-h23,h2.nav-h24,h2.nav-h25,h2.nav-h26 {<br />
display: block;<br />
background: url("https://static.igem.org/mediawiki/2012/9/91/Nav-tabs.png") no-repeat;<br />
width: 80px;<br />
height: 80px;<br />
background-position: 0 0;<br />
z-index: 150;<br />
position: relative;<br />
}<br />
h2.nav-h22 {<br />
background-position: -80px 0;<br />
}<br />
h2.nav-h23 {<br />
background-position: -160px 0;<br />
}<br />
h2.nav-h24 {<br />
background-position: -240px 0;<br />
}<br />
h2.nav-h25 {<br />
background-position: -320px 0;<br />
}<br />
h2.nav-h26 {<br />
background-position: -400px 0;<br />
}<br />
h2.nav-h21:hover {<br />
background-position: 0 -80px;<br />
}<br />
h2.nav-h22:hover {<br />
background-position: -80px -80px;<br />
}<br />
h2.nav-h23:hover {<br />
background-position: -160px -80px;<br />
}<br />
h2.nav-h24:hover {<br />
background-position: -240px -80px;<br />
}<br />
h2.nav-h25:hover {<br />
background-position: -320px -80px;<br />
}<br />
h2.nav-h26:hover {<br />
background-position: -400px -80px;<br />
}<br />
h2.nav-h21on {<br />
background-position: 0 -160px;<br />
}<br />
h2.nav-h22on {<br />
background-position: -80px -160px;<br />
}<br />
h2.nav-h23on {<br />
background-position: -160px -160px;<br />
}<br />
h2.nav-h24on {<br />
background-position: -240px -160px;<br />
}<br />
h2.nav-h25on {<br />
background-position: -320px -160px;<br />
}<br />
h2.nav-h26on {<br />
background-position: -400px -160px;<br />
}<br />
ul.nav-innerUl{<br />
position: absolute;<br />
top: 40px;<br />
padding-top: 40px;<br />
width: 76px;<br />
border-left: 2px solid #000;<br />
border-right: 2px solid #000;<br />
z-index: 140;<br />
display: none;<br />
}<br />
em.nav-libg{<br />
display: block;<br />
width: 96px;<br />
height: 11px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/48/Nav-libg.png');<br />
margin-left: -10px;<br />
}<br />
ul.nav-innerUl1{<br />
background: #fffaca;<br />
}<br />
ul.nav-innerUl2{<br />
background: #dedede;<br />
}<br />
ul.nav-innerUl3{<br />
background: #d9f0c9;<br />
}<br />
ul.nav-innerUl4{<br />
background: #f6e5ff;<br />
}<br />
ul.nav-innerUl5{<br />
background: #ebfcff;<br />
}<br />
ul.nav-innerUl6{<br />
background: #ffeee8;<br />
}<br />
li.nav-innerLi{<br />
font-size: 10px;<br />
line-height: 14px;<br />
padding: 3px 5px;<br />
}<br />
li.nav-innerLi:hover{<br />
background: #fff;<br />
}<br />
div.middle {<br />
width: 940px;<br />
background: #e6deb8;<br />
background: rgba(230,222,184,0.5);<br />
position: absolute;<br />
top: 300px;<br />
left: 30px;<br />
}<br />
div.aside {<br />
width: 160px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/b/b3/Aside-bg.png") no-repeat;<br />
margin-left: 20px;<br />
margin-top: 100px;<br />
float: left;<br />
padding: 20px;<br />
}<br />
ul.aside-outerUl {<br />
margin: 15px;<br />
}<br />
li.aside-outerLi {<br />
margin: 15px 0;<br />
background: #fff1a9;<br />
padding: 5px 10px;<br />
color: #725718;<br />
font-size: 16px;<br />
line-height: 24px;<br />
font-weight: bold;<br />
text-align: center;<br />
cursor: pointer;<br />
}<br />
li.aside-outerLi:hover {<br />
background: #fff8d3;<br />
}<br />
div.main {<br />
width: 640px;<br />
height: 400px;<br />
border: 5px solid #333;<br />
background: #fff;<br />
float: right;<br />
margin: 100px 30px 30px 0;<br />
}<br />
div.footer {<br />
}<br />
<br />
/*<br />
* picSlider Css<br />
*/<br />
#picSlider {<br />
width: 640px;<br />
height: 320px;<br />
}<br />
.momo {<br />
background: #000;<br />
}<br />
.momo .pic li {<br />
width: 100%;<br />
height: 100%;<br />
overflow: hidden;<br />
position: absolute;<br />
display: none;<br />
}<br />
.momo .txt li {<br />
position: absolute;<br />
padding: 5px 10px;<br />
z-index: 2;<br />
bottom: 0;<br />
height: 28px;<br />
background: #DBDBDB;<br />
display: none;<br />
}<br />
.momo .txt li a {<br />
display: block;<br />
position: relative;<br />
z-index: 1;<br />
color: #333;<br />
font-size: 12px;<br />
font-weight: bold;<br />
text-decoration: none;<br />
}<br />
.momo .num {<br />
position: absolute;<br />
z-index: 3;<br />
bottom: 5px;<br />
right: 5px;<br />
}<br />
.momo .num li {<br />
float: left;<br />
}<br />
.momo .num li a {<br />
color: #333;<br />
float: left;<br />
margin-left: 3px;<br />
width: 15px;<br />
height: 15px;<br />
line-height: 15px;<br />
*line-height: 14px;<br />
overflow: hidden;<br />
border: 1px solid #AEC1CC;<br />
text-align: center;<br />
cursor: pointer;<br />
background: #fff;<br />
text-decoration: none;<br />
}<br />
.momo .num li.current a, .momo .num li.hover a {<br />
color: #fff;<br />
background: #f60;<br />
-webkit-transition: all 0.4s;<br />
-moz-transition: all 0.4s;<br />
-o-transition: all 0.4s;<br />
}<br />
.momo_picSlider .txt li{<br />
width: 620px;<br />
}<br />
.momo_picSlider .txt li a{<br />
font-size: 16px;<br />
line-height: 24px;<br />
}<br />
#p-logo {<br />
display:none;<br />
}<br />
#top-section {<br />
height:0;<br />
border:none;<br />
}<br />
#search-controls {<br />
display:none;<br />
}<br />
#content {<br />
position:inherit;<br />
width:inherit;<br />
margin:0;<br />
padding:0;<br />
background:inherit;<br />
color:inherit;<br />
border:none;<br />
line-height:inherit;<br />
z-index:2;<br />
}<br />
.firstHeading {<br />
display:none;<br />
}<br />
#catlinks {<br />
display:none;<br />
}<br />
#footer-box {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#menubar ul li a {<br />
background:none;<br />
}<br />
#bodyContent h1,#bodyContent h2 {<br />
margin:0;<br />
border:0;<br />
padding: 0;<br />
}<br />
.left-menu:hover {<br />
background:none;<br />
}<br />
</style><br />
<div class="center"><br />
<div class="header"><br />
<div class="nav"><br />
<ul class="nav-outerUl"><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China"><h2 class="nav-h21 nav-h21on" title="Home"></h2></a><br />
<ul class="nav-innerUl nav-innerUl1" name="Home"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Team"><h2 class="nav-h22" title="Team"></h2></a><br />
<ul class="nav-innerUl nav-innerUl2" name="Team"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Project"><h2 class="nav-h23" title="Project"></h2></a><br />
<ul class="nav-innerUl nav-innerUl3" name="Project"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Modeling"><h2 class="nav-h24" title="Modeling"></h2></a><br />
<ul class="nav-innerUl nav-innerUl4" name="Modeling"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Notebooks"><h2 class="nav-h25" title="Notebooks"></h2></a><br />
<ul class="nav-innerUl nav-innerUl5" name="Notebooks"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/humanPractice"><h2 class="nav-h26" title="Human Practice"></h2></a><br />
<ul class="nav-innerUl nav-innerUl6" name="HumanPractice"></ul><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div class="middle"><br />
<div class="aside"><br />
<ul class="aside-outerUl"></ul><br />
</div><br />
<div class="main"></div><br />
<div class="clear"></div><br />
</div><br />
<div class="footer"></div><br />
</div><br />
<script src="http://www.yichengliu.com/code/igem/home.js"></script><br />
</body><br />
</html></div>Nanhaihttp://2012.igem.org/File:Achievements_5.pngFile:Achievements 5.png2012-10-26T21:37:58Z<p>Nanhai: </p>
<hr />
<div></div>Nanhaihttp://2012.igem.org/File:Achievements_human.pngFile:Achievements human.png2012-10-26T21:28:34Z<p>Nanhai: </p>
<hr />
<div></div>Nanhaihttp://2012.igem.org/File:Achievements_methods.pngFile:Achievements methods.png2012-10-26T21:22:51Z<p>Nanhai: </p>
<hr />
<div></div>Nanhaihttp://2012.igem.org/File:Achievements_2.pngFile:Achievements 2.png2012-10-26T21:10:50Z<p>Nanhai: </p>
<hr />
<div></div>Nanhaihttp://2012.igem.org/File:Achievements_1.pngFile:Achievements 1.png2012-10-26T21:02:30Z<p>Nanhai: </p>
<hr />
<div></div>Nanhaihttp://2012.igem.org/Team:WHU-ChinaTeam:WHU-China2012-10-26T20:51:47Z<p>Nanhai: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<body><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script><br />
function picObj(src, title, detail, href){<br />
this.src = src;<br />
this.title = title;<br />
this.detail = detail;<br />
this.href = href;<br />
}<br />
//*************************自定义数据部分*************************<br />
<br />
//定义菜单及侧边栏数据<br />
var menuObj = {<br />
Home : [<br />
{<br />
title : "<strong>What's new</strong>",<br />
picArray : [new picObj("http://partsregistry.org/wiki/images/f/ff/%E5%85%A8%E6%99%AF%E5%8A%A0%E6%AD%BB%E4%BA%A11.png", "Panorama of the Whole Project Scheme", "Four novel devices, Fatty Acid Degradation, Cellulose Synthesis, Colonization and Death to ensure high efficiency orchestrate calorie absorption and bacteria survival and make you slim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/d/d9/A_picture_of_Pcar.png", "Pcar: Promoter of CRP As a Repressor", "By inserting CRP-binding site to overlap with the -10 region of a constitutive promoter, Pcar is able to be induced by glucose, while CRP serves as a repressor rather than an activator.", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#Pcar"),<br />
new picObj("https://static.igem.org/mediawiki/2012/3/37/Pfadr_picture.png", "PfadR: Synthesized promoter regulated solely by fatty acid", "With tandem FadR binding site, PfadR is able to be repressed solely by fatty acid.", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#PfadR"),<br />
new picObj("https://static.igem.org/mediawiki/2012/0/09/%E8%83%96%E5%AD%90%E7%98%A6%E5%AD%90.png", "Long term efficiency of the E.coslim", "When viewed at macroscopic way, the E.coslim may have an advantage of long term efficiency,by regulating the human gut microbiota.And we have certified this by mathematical model", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#PfadR")<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>Pathway Introduction</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/igem.org/8/82/Pathway_FattyAcid.png", "Fatty Acid Degradation", "Feel free to eat meat since the fat is all degraded by our E.coslim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=3"),<br />
new picObj("https://static.igem.org/mediawiki/igem.org/1/18/Pathway_Cellulose.png", "Cellulose Synthesis", "Transforming glucose into cellulose, the high-sugar food you eat will be turned into vegetables!", "https://2012.igem.org/Team:WHU-China/Project?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/e/ea/Device_three.png", "Colonization", "The magic molecule c-di-GMP enables E.coslim colonizing in the gut to better fulfill its magic function!", "https://2012.igem.org/Team:WHU-China/Project?catalog=5")<br />
]<br />
},<br />
{<br />
title : "<strong>Future Perspective</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/ab/%E5%8F%8C%E8%83%B6%E5%9B%8A2.jpg", "Two Capsule Design", "Capsule I, the E.coslim, makes you slim, while Capsule II, xylose, terminates the effects of the former.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/d/d2/Fpbody2.jpg", "In vitro experiment in a simulated intestine", "The gut microbiota and E.coslim will be inoculated in a simulated intestine, then the concentration measurement of each component will tell us whether E.coslim works as desired.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/8/85/%E5%B0%8F%E9%BC%A0%E5%AE%9E%E9%AA%8C02.jpg", "In vivo experiment in mice", "E.coslim will also be inoculated into mice and the culture-independent microbiome analysis will tell us the real situation in vivo.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0")<br />
]<br />
},<br />
{<br />
title : "<strong>Achievement</strong>",<br />
picArray : [<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>About Us</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/a7/Whu-2012-1.jpg", "WHU-China 2012, I was there", "The Entrance of State Wuhan University", "https://2012.igem.org/Team:WHU-China/Team?catalog=1"),<br />
new picObj("https://static.igem.org/mediawiki/2012/2/23/Whu2012heying.jpg", "MIT, we're coming!", "Collge of Life Sciences of WHU", "https://2012.igem.org/Team:WHU-China/Team?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/4/43/Whu2012-2.jpg", "WHU-China, Hooray!", "Yuntai Mountain, Henan Province", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=5")<br />
]<br />
}<br />
],<br />
Team : [<br />
{<br />
title : '<strong>Members</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Instructors</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Team History</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About WHU</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About Our Lab</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Acknow-</br>ledgements</strong>',<br />
dir : []<br />
},<br />
<br />
],<br />
Project : [<br />
{<br />
title : '<strong>Description</strong>',<br />
dir : [<br />
<br />
]<br />
},<br />
{<br />
title : '<strong>Background</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Promoter Design</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device I: Fatty Acid Degradation</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device II: Cellulose Synthesis</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device III: Colonization</strong>',<br />
dir : []<br />
},<br />
],<br />
Modeling : [<br />
{<br />
title : '<strong>Future Perspectives</strong>',<br />
dir : []<br />
},<br />
<br />
{<br />
title : '<strong>Model I: Fatty Acid Degradation</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Model II: Microbiota Regulation</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Software Tool: FANCY</strong>',<br />
dir : []<br />
}<br />
],<br />
Notebooks : [<br />
{<br />
title : '<strong>Parts</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Safety</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Protocols</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Events</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Brain-</br>storming</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Gallery</strong>',<br />
dir : []<br />
}<br />
],<br />
HumanPractice : [<br />
{<br />
title : '<strong>Outline</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Questionaire Survey</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Publicity</strong>',<br />
dir : []<br />
}<br />
]<br />
}; <br />
//*************************自定义数据部分*************************<br />
</script><br />
<style type="text/css"><br />
/*<br />
* base css, DO NOT MODIFY!<br />
*/<br />
* {<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
font-family: "Verdana", sans-serif;<br />
color: #333;<br />
list-style: none;<br />
outline: none;<br />
resize: none;<br />
}<br />
html {<br />
overflow-y: scroll;<br />
}<br />
body {<br />
background: url("https://static.igem.org/mediawiki/2012/2/22/Body-bg.jpg") center center fixed;<br />
}<br />
a {<br />
text-decoration: none;<br />
}<br />
.clear {<br />
width: 0;<br />
height: 0;<br />
line-height: 0;<br />
display: block;<br />
clear: both;<br />
}<br />
<br />
/*<br />
* common css, include "header","footer"...<br />
*/<br />
div.center {<br />
width: 1000px;<br />
margin: 0 auto;<br />
position: relative;<br />
}<br />
div.header {<br />
width: 1000px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/1/12/Header-bg.png") no-repeat;<br />
position: relative;<br />
z-index: 50;<br />
}<br />
div.nav {<br />
position: absolute;<br />
height: 80px;<br />
top: 185px;<br />
left: 245px;<br />
}<br />
li.nav-outerLi {<br />
display: block;<br />
float: left;<br />
width: 80px;<br />
height: 80px;<br />
margin: 0 6px;<br />
cursor: pointer;<br />
}<br />
h2.nav-h21,h2.nav-h22,h2.nav-h23,h2.nav-h24,h2.nav-h25,h2.nav-h26 {<br />
display: block;<br />
background: url("https://static.igem.org/mediawiki/2012/9/91/Nav-tabs.png") no-repeat;<br />
width: 80px;<br />
height: 80px;<br />
background-position: 0 0;<br />
z-index: 150;<br />
position: relative;<br />
}<br />
h2.nav-h22 {<br />
background-position: -80px 0;<br />
}<br />
h2.nav-h23 {<br />
background-position: -160px 0;<br />
}<br />
h2.nav-h24 {<br />
background-position: -240px 0;<br />
}<br />
h2.nav-h25 {<br />
background-position: -320px 0;<br />
}<br />
h2.nav-h26 {<br />
background-position: -400px 0;<br />
}<br />
h2.nav-h21:hover {<br />
background-position: 0 -80px;<br />
}<br />
h2.nav-h22:hover {<br />
background-position: -80px -80px;<br />
}<br />
h2.nav-h23:hover {<br />
background-position: -160px -80px;<br />
}<br />
h2.nav-h24:hover {<br />
background-position: -240px -80px;<br />
}<br />
h2.nav-h25:hover {<br />
background-position: -320px -80px;<br />
}<br />
h2.nav-h26:hover {<br />
background-position: -400px -80px;<br />
}<br />
h2.nav-h21on {<br />
background-position: 0 -160px;<br />
}<br />
h2.nav-h22on {<br />
background-position: -80px -160px;<br />
}<br />
h2.nav-h23on {<br />
background-position: -160px -160px;<br />
}<br />
h2.nav-h24on {<br />
background-position: -240px -160px;<br />
}<br />
h2.nav-h25on {<br />
background-position: -320px -160px;<br />
}<br />
h2.nav-h26on {<br />
background-position: -400px -160px;<br />
}<br />
ul.nav-innerUl{<br />
position: absolute;<br />
top: 40px;<br />
padding-top: 40px;<br />
width: 76px;<br />
border-left: 2px solid #000;<br />
border-right: 2px solid #000;<br />
z-index: 140;<br />
display: none;<br />
}<br />
em.nav-libg{<br />
display: block;<br />
width: 96px;<br />
height: 11px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/48/Nav-libg.png');<br />
margin-left: -10px;<br />
}<br />
ul.nav-innerUl1{<br />
background: #fffaca;<br />
}<br />
ul.nav-innerUl2{<br />
background: #dedede;<br />
}<br />
ul.nav-innerUl3{<br />
background: #d9f0c9;<br />
}<br />
ul.nav-innerUl4{<br />
background: #f6e5ff;<br />
}<br />
ul.nav-innerUl5{<br />
background: #ebfcff;<br />
}<br />
ul.nav-innerUl6{<br />
background: #ffeee8;<br />
}<br />
li.nav-innerLi{<br />
font-size: 10px;<br />
line-height: 14px;<br />
padding: 3px 5px;<br />
}<br />
li.nav-innerLi:hover{<br />
background: #fff;<br />
}<br />
div.middle {<br />
width: 940px;<br />
background: #e6deb8;<br />
background: rgba(230,222,184,0.5);<br />
position: absolute;<br />
top: 300px;<br />
left: 30px;<br />
}<br />
div.aside {<br />
width: 160px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/b/b3/Aside-bg.png") no-repeat;<br />
margin-left: 20px;<br />
margin-top: 100px;<br />
float: left;<br />
padding: 20px;<br />
}<br />
ul.aside-outerUl {<br />
margin: 15px;<br />
}<br />
li.aside-outerLi {<br />
margin: 15px 0;<br />
background: #fff1a9;<br />
padding: 5px 10px;<br />
color: #725718;<br />
font-size: 16px;<br />
line-height: 24px;<br />
font-weight: bold;<br />
text-align: center;<br />
cursor: pointer;<br />
}<br />
li.aside-outerLi:hover {<br />
background: #fff8d3;<br />
}<br />
div.main {<br />
width: 640px;<br />
height: 400px;<br />
border: 5px solid #333;<br />
background: #fff;<br />
float: right;<br />
margin: 100px 30px 30px 0;<br />
}<br />
div.footer {<br />
}<br />
<br />
/*<br />
* picSlider Css<br />
*/<br />
#picSlider {<br />
width: 640px;<br />
height: 320px;<br />
}<br />
.momo {<br />
background: #000;<br />
}<br />
.momo .pic li {<br />
width: 100%;<br />
height: 100%;<br />
overflow: hidden;<br />
position: absolute;<br />
display: none;<br />
}<br />
.momo .txt li {<br />
position: absolute;<br />
padding: 5px 10px;<br />
z-index: 2;<br />
bottom: 0;<br />
height: 28px;<br />
background: #DBDBDB;<br />
display: none;<br />
}<br />
.momo .txt li a {<br />
display: block;<br />
position: relative;<br />
z-index: 1;<br />
color: #333;<br />
font-size: 12px;<br />
font-weight: bold;<br />
text-decoration: none;<br />
}<br />
.momo .num {<br />
position: absolute;<br />
z-index: 3;<br />
bottom: 5px;<br />
right: 5px;<br />
}<br />
.momo .num li {<br />
float: left;<br />
}<br />
.momo .num li a {<br />
color: #333;<br />
float: left;<br />
margin-left: 3px;<br />
width: 15px;<br />
height: 15px;<br />
line-height: 15px;<br />
*line-height: 14px;<br />
overflow: hidden;<br />
border: 1px solid #AEC1CC;<br />
text-align: center;<br />
cursor: pointer;<br />
background: #fff;<br />
text-decoration: none;<br />
}<br />
.momo .num li.current a, .momo .num li.hover a {<br />
color: #fff;<br />
background: #f60;<br />
-webkit-transition: all 0.4s;<br />
-moz-transition: all 0.4s;<br />
-o-transition: all 0.4s;<br />
}<br />
.momo_picSlider .txt li{<br />
width: 620px;<br />
}<br />
.momo_picSlider .txt li a{<br />
font-size: 16px;<br />
line-height: 24px;<br />
}<br />
#p-logo {<br />
display:none;<br />
}<br />
#top-section {<br />
height:0;<br />
border:none;<br />
}<br />
#search-controls {<br />
display:none;<br />
}<br />
#content {<br />
position:inherit;<br />
width:inherit;<br />
margin:0;<br />
padding:0;<br />
background:inherit;<br />
color:inherit;<br />
border:none;<br />
line-height:inherit;<br />
z-index:2;<br />
}<br />
.firstHeading {<br />
display:none;<br />
}<br />
#catlinks {<br />
display:none;<br />
}<br />
#footer-box {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#menubar ul li a {<br />
background:none;<br />
}<br />
#bodyContent h1,#bodyContent h2 {<br />
margin:0;<br />
border:0;<br />
padding: 0;<br />
}<br />
.left-menu:hover {<br />
background:none;<br />
}<br />
</style><br />
<div class="center"><br />
<div class="header"><br />
<div class="nav"><br />
<ul class="nav-outerUl"><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China"><h2 class="nav-h21 nav-h21on" title="Home"></h2></a><br />
<ul class="nav-innerUl nav-innerUl1" name="Home"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Team"><h2 class="nav-h22" title="Team"></h2></a><br />
<ul class="nav-innerUl nav-innerUl2" name="Team"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Project"><h2 class="nav-h23" title="Project"></h2></a><br />
<ul class="nav-innerUl nav-innerUl3" name="Project"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Modeling"><h2 class="nav-h24" title="Modeling"></h2></a><br />
<ul class="nav-innerUl nav-innerUl4" name="Modeling"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Notebooks"><h2 class="nav-h25" title="Notebooks"></h2></a><br />
<ul class="nav-innerUl nav-innerUl5" name="Notebooks"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/humanPractice"><h2 class="nav-h26" title="Human Practice"></h2></a><br />
<ul class="nav-innerUl nav-innerUl6" name="HumanPractice"></ul><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div class="middle"><br />
<div class="aside"><br />
<ul class="aside-outerUl"></ul><br />
</div><br />
<div class="main"></div><br />
<div class="clear"></div><br />
</div><br />
<div class="footer"></div><br />
</div><br />
<script src="http://www.yichengliu.com/code/igem/home.js"></script><br />
</body><br />
</html></div>Nanhaihttp://2012.igem.org/File:Pfadr_picture.pngFile:Pfadr picture.png2012-10-26T20:51:24Z<p>Nanhai: </p>
<hr />
<div></div>Nanhaihttp://2012.igem.org/File:A_picture_of_Pcar.pngFile:A picture of Pcar.png2012-10-26T20:50:33Z<p>Nanhai: </p>
<hr />
<div></div>Nanhaihttp://2012.igem.org/Team:WHU-ChinaTeam:WHU-China2012-10-26T20:40:22Z<p>Nanhai: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<body><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script><br />
function picObj(src, title, detail, href){<br />
this.src = src;<br />
this.title = title;<br />
this.detail = detail;<br />
this.href = href;<br />
}<br />
//*************************自定义数据部分*************************<br />
<br />
//定义菜单及侧边栏数据<br />
var menuObj = {<br />
Home : [<br />
{<br />
title : "<strong>What's new</strong>",<br />
picArray : [new picObj("http://partsregistry.org/wiki/images/f/ff/%E5%85%A8%E6%99%AF%E5%8A%A0%E6%AD%BB%E4%BA%A11.png", "Panorama of the Whole Project Scheme", "Four novel devices, Fatty Acid Degradation, Cellulose Synthesis, Colonization and Death to ensure high efficiency orchestrate calorie absorption and bacteria survival and make you slim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/8/88/Pcar1.jpg", "Pcar: Promoter of CRP As a Repressor", "By inserting CRP-binding site to overlap with the -10 region of a constitutive promoter, Pcar is able to be induced by glucose, while CRP serves as a repressor rather than an activator.", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#Pcar"),<br />
new picObj("https://static.igem.org/mediawiki/2012/4/4d/Pfadr1.jpg", "PfadR: Synthesized promoter regulated solely by fatty acid", "With tandem FadR binding site, PfadR is able to be repressed solely by fatty acid.", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#PfadR"),<br />
new picObj("https://static.igem.org/mediawiki/2012/0/09/%E8%83%96%E5%AD%90%E7%98%A6%E5%AD%90.png", "Long term efficiency of the E.coslim", "When viewed at macroscopic way, the E.coslim may have an advantage of long term efficiency,by regulating the human gut microbiota.And we have certified this by mathematical model", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#PfadR")<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>Pathway Introduction</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/igem.org/8/82/Pathway_FattyAcid.png", "Fatty Acid Degradation", "Feel free to eat meat since the fat is all degraded by our E.coslim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=3"),<br />
new picObj("https://static.igem.org/mediawiki/igem.org/1/18/Pathway_Cellulose.png", "Cellulose Synthesis", "Transforming glucose into cellulose, the high-sugar food you eat will be turned into vegetables!", "https://2012.igem.org/Team:WHU-China/Project?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/e/ea/Device_three.png", "Colonization", "The magic molecule c-di-GMP enables E.coslim colonizing in the gut to better fulfill its magic function!", "https://2012.igem.org/Team:WHU-China/Project?catalog=5")<br />
]<br />
},<br />
{<br />
title : "<strong>Future Perspective</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/ab/%E5%8F%8C%E8%83%B6%E5%9B%8A2.jpg", "Two Capsule Design", "Capsule I, the E.coslim, makes you slim, while Capsule II, xylose, terminates the effects of the former.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/d/d2/Fpbody2.jpg", "In vitro experiment in a simulated intestine", "The gut microbiota and E.coslim will be inoculated in a simulated intestine, then the concentration measurement of each component will tell us whether E.coslim works as desired.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/8/85/%E5%B0%8F%E9%BC%A0%E5%AE%9E%E9%AA%8C02.jpg", "In vivo experiment in mice", "E.coslim will also be inoculated into mice and the culture-independent microbiome analysis will tell us the real situation in vivo.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0")<br />
]<br />
},<br />
{<br />
title : "<strong>Achievement</strong>",<br />
picArray : [<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>About Us</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/a7/Whu-2012-1.jpg", "WHU-China 2012, I was there", "The Entrance of State Wuhan University", "https://2012.igem.org/Team:WHU-China/Team?catalog=1"),<br />
new picObj("https://static.igem.org/mediawiki/2012/2/23/Whu2012heying.jpg", "MIT, we're coming!", "Collge of Life Sciences of WHU", "https://2012.igem.org/Team:WHU-China/Team?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/4/43/Whu2012-2.jpg", "WHU-China, Hooray!", "Yuntai Mountain, Henan Province", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=5")<br />
]<br />
}<br />
],<br />
Team : [<br />
{<br />
title : '<strong>Members</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Instructors</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Team History</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About WHU</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About Our Lab</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Acknow-</br>ledgements</strong>',<br />
dir : []<br />
},<br />
<br />
],<br />
Project : [<br />
{<br />
title : '<strong>Description</strong>',<br />
dir : [<br />
<br />
]<br />
},<br />
{<br />
title : '<strong>Background</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Promoter Design</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device I: Fatty Acid Degradation</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device II: Cellulose Synthesis</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device III: Colonization</strong>',<br />
dir : []<br />
},<br />
],<br />
Modeling : [<br />
{<br />
title : '<strong>Future Perspectives</strong>',<br />
dir : []<br />
},<br />
<br />
{<br />
title : '<strong>Model I: Fatty Acid Degradation</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Model II: Microbiota Regulation</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Software Tool: FANCY</strong>',<br />
dir : []<br />
}<br />
],<br />
Notebooks : [<br />
{<br />
title : '<strong>Parts</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Safety</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Protocols</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Events</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Brain-</br>storming</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Gallery</strong>',<br />
dir : []<br />
}<br />
],<br />
HumanPractice : [<br />
{<br />
title : '<strong>Outline</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Questionaire Survey</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Publicity</strong>',<br />
dir : []<br />
}<br />
]<br />
}; <br />
//*************************自定义数据部分*************************<br />
</script><br />
<style type="text/css"><br />
/*<br />
* base css, DO NOT MODIFY!<br />
*/<br />
* {<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
font-family: "Verdana", sans-serif;<br />
color: #333;<br />
list-style: none;<br />
outline: none;<br />
resize: none;<br />
}<br />
html {<br />
overflow-y: scroll;<br />
}<br />
body {<br />
background: url("https://static.igem.org/mediawiki/2012/2/22/Body-bg.jpg") center center fixed;<br />
}<br />
a {<br />
text-decoration: none;<br />
}<br />
.clear {<br />
width: 0;<br />
height: 0;<br />
line-height: 0;<br />
display: block;<br />
clear: both;<br />
}<br />
<br />
/*<br />
* common css, include "header","footer"...<br />
*/<br />
div.center {<br />
width: 1000px;<br />
margin: 0 auto;<br />
position: relative;<br />
}<br />
div.header {<br />
width: 1000px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/1/12/Header-bg.png") no-repeat;<br />
position: relative;<br />
z-index: 50;<br />
}<br />
div.nav {<br />
position: absolute;<br />
height: 80px;<br />
top: 185px;<br />
left: 245px;<br />
}<br />
li.nav-outerLi {<br />
display: block;<br />
float: left;<br />
width: 80px;<br />
height: 80px;<br />
margin: 0 6px;<br />
cursor: pointer;<br />
}<br />
h2.nav-h21,h2.nav-h22,h2.nav-h23,h2.nav-h24,h2.nav-h25,h2.nav-h26 {<br />
display: block;<br />
background: url("https://static.igem.org/mediawiki/2012/9/91/Nav-tabs.png") no-repeat;<br />
width: 80px;<br />
height: 80px;<br />
background-position: 0 0;<br />
z-index: 150;<br />
position: relative;<br />
}<br />
h2.nav-h22 {<br />
background-position: -80px 0;<br />
}<br />
h2.nav-h23 {<br />
background-position: -160px 0;<br />
}<br />
h2.nav-h24 {<br />
background-position: -240px 0;<br />
}<br />
h2.nav-h25 {<br />
background-position: -320px 0;<br />
}<br />
h2.nav-h26 {<br />
background-position: -400px 0;<br />
}<br />
h2.nav-h21:hover {<br />
background-position: 0 -80px;<br />
}<br />
h2.nav-h22:hover {<br />
background-position: -80px -80px;<br />
}<br />
h2.nav-h23:hover {<br />
background-position: -160px -80px;<br />
}<br />
h2.nav-h24:hover {<br />
background-position: -240px -80px;<br />
}<br />
h2.nav-h25:hover {<br />
background-position: -320px -80px;<br />
}<br />
h2.nav-h26:hover {<br />
background-position: -400px -80px;<br />
}<br />
h2.nav-h21on {<br />
background-position: 0 -160px;<br />
}<br />
h2.nav-h22on {<br />
background-position: -80px -160px;<br />
}<br />
h2.nav-h23on {<br />
background-position: -160px -160px;<br />
}<br />
h2.nav-h24on {<br />
background-position: -240px -160px;<br />
}<br />
h2.nav-h25on {<br />
background-position: -320px -160px;<br />
}<br />
h2.nav-h26on {<br />
background-position: -400px -160px;<br />
}<br />
ul.nav-innerUl{<br />
position: absolute;<br />
top: 40px;<br />
padding-top: 40px;<br />
width: 76px;<br />
border-left: 2px solid #000;<br />
border-right: 2px solid #000;<br />
z-index: 140;<br />
display: none;<br />
}<br />
em.nav-libg{<br />
display: block;<br />
width: 96px;<br />
height: 11px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/48/Nav-libg.png');<br />
margin-left: -10px;<br />
}<br />
ul.nav-innerUl1{<br />
background: #fffaca;<br />
}<br />
ul.nav-innerUl2{<br />
background: #dedede;<br />
}<br />
ul.nav-innerUl3{<br />
background: #d9f0c9;<br />
}<br />
ul.nav-innerUl4{<br />
background: #f6e5ff;<br />
}<br />
ul.nav-innerUl5{<br />
background: #ebfcff;<br />
}<br />
ul.nav-innerUl6{<br />
background: #ffeee8;<br />
}<br />
li.nav-innerLi{<br />
font-size: 10px;<br />
line-height: 14px;<br />
padding: 3px 5px;<br />
}<br />
li.nav-innerLi:hover{<br />
background: #fff;<br />
}<br />
div.middle {<br />
width: 940px;<br />
background: #e6deb8;<br />
background: rgba(230,222,184,0.5);<br />
position: absolute;<br />
top: 300px;<br />
left: 30px;<br />
}<br />
div.aside {<br />
width: 160px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/b/b3/Aside-bg.png") no-repeat;<br />
margin-left: 20px;<br />
margin-top: 100px;<br />
float: left;<br />
padding: 20px;<br />
}<br />
ul.aside-outerUl {<br />
margin: 15px;<br />
}<br />
li.aside-outerLi {<br />
margin: 15px 0;<br />
background: #fff1a9;<br />
padding: 5px 10px;<br />
color: #725718;<br />
font-size: 16px;<br />
line-height: 24px;<br />
font-weight: bold;<br />
text-align: center;<br />
cursor: pointer;<br />
}<br />
li.aside-outerLi:hover {<br />
background: #fff8d3;<br />
}<br />
div.main {<br />
width: 640px;<br />
height: 400px;<br />
border: 5px solid #333;<br />
background: #fff;<br />
float: right;<br />
margin: 100px 30px 30px 0;<br />
}<br />
div.footer {<br />
}<br />
<br />
/*<br />
* picSlider Css<br />
*/<br />
#picSlider {<br />
width: 640px;<br />
height: 320px;<br />
}<br />
.momo {<br />
background: #000;<br />
}<br />
.momo .pic li {<br />
width: 100%;<br />
height: 100%;<br />
overflow: hidden;<br />
position: absolute;<br />
display: none;<br />
}<br />
.momo .txt li {<br />
position: absolute;<br />
padding: 5px 10px;<br />
z-index: 2;<br />
bottom: 0;<br />
height: 28px;<br />
background: #DBDBDB;<br />
display: none;<br />
}<br />
.momo .txt li a {<br />
display: block;<br />
position: relative;<br />
z-index: 1;<br />
color: #333;<br />
font-size: 12px;<br />
font-weight: bold;<br />
text-decoration: none;<br />
}<br />
.momo .num {<br />
position: absolute;<br />
z-index: 3;<br />
bottom: 5px;<br />
right: 5px;<br />
}<br />
.momo .num li {<br />
float: left;<br />
}<br />
.momo .num li a {<br />
color: #333;<br />
float: left;<br />
margin-left: 3px;<br />
width: 15px;<br />
height: 15px;<br />
line-height: 15px;<br />
*line-height: 14px;<br />
overflow: hidden;<br />
border: 1px solid #AEC1CC;<br />
text-align: center;<br />
cursor: pointer;<br />
background: #fff;<br />
text-decoration: none;<br />
}<br />
.momo .num li.current a, .momo .num li.hover a {<br />
color: #fff;<br />
background: #f60;<br />
-webkit-transition: all 0.4s;<br />
-moz-transition: all 0.4s;<br />
-o-transition: all 0.4s;<br />
}<br />
.momo_picSlider .txt li{<br />
width: 620px;<br />
}<br />
.momo_picSlider .txt li a{<br />
font-size: 16px;<br />
line-height: 24px;<br />
}<br />
#p-logo {<br />
display:none;<br />
}<br />
#top-section {<br />
height:0;<br />
border:none;<br />
}<br />
#search-controls {<br />
display:none;<br />
}<br />
#content {<br />
position:inherit;<br />
width:inherit;<br />
margin:0;<br />
padding:0;<br />
background:inherit;<br />
color:inherit;<br />
border:none;<br />
line-height:inherit;<br />
z-index:2;<br />
}<br />
.firstHeading {<br />
display:none;<br />
}<br />
#catlinks {<br />
display:none;<br />
}<br />
#footer-box {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#menubar ul li a {<br />
background:none;<br />
}<br />
#bodyContent h1,#bodyContent h2 {<br />
margin:0;<br />
border:0;<br />
padding: 0;<br />
}<br />
.left-menu:hover {<br />
background:none;<br />
}<br />
</style><br />
<div class="center"><br />
<div class="header"><br />
<div class="nav"><br />
<ul class="nav-outerUl"><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China"><h2 class="nav-h21 nav-h21on" title="Home"></h2></a><br />
<ul class="nav-innerUl nav-innerUl1" name="Home"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Team"><h2 class="nav-h22" title="Team"></h2></a><br />
<ul class="nav-innerUl nav-innerUl2" name="Team"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Project"><h2 class="nav-h23" title="Project"></h2></a><br />
<ul class="nav-innerUl nav-innerUl3" name="Project"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Modeling"><h2 class="nav-h24" title="Modeling"></h2></a><br />
<ul class="nav-innerUl nav-innerUl4" name="Modeling"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Notebooks"><h2 class="nav-h25" title="Notebooks"></h2></a><br />
<ul class="nav-innerUl nav-innerUl5" name="Notebooks"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/humanPractice"><h2 class="nav-h26" title="Human Practice"></h2></a><br />
<ul class="nav-innerUl nav-innerUl6" name="HumanPractice"></ul><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div class="middle"><br />
<div class="aside"><br />
<ul class="aside-outerUl"></ul><br />
</div><br />
<div class="main"></div><br />
<div class="clear"></div><br />
</div><br />
<div class="footer"></div><br />
</div><br />
<script src="http://www.yichengliu.com/code/igem/home.js"></script><br />
</body><br />
</html></div>Nanhaihttp://2012.igem.org/File:Device_three.pngFile:Device three.png2012-10-26T20:37:40Z<p>Nanhai: </p>
<hr />
<div></div>Nanhaihttp://2012.igem.org/File:Device.pngFile:Device.png2012-10-26T20:36:16Z<p>Nanhai: uploaded a new version of &quot;File:Device.png&quot;</p>
<hr />
<div></div>Nanhaihttp://2012.igem.org/File:Device.pngFile:Device.png2012-10-26T20:34:22Z<p>Nanhai: uploaded a new version of &quot;File:Device.png&quot;</p>
<hr />
<div></div>Nanhaihttp://2012.igem.org/File:Device.pngFile:Device.png2012-10-26T20:31:56Z<p>Nanhai: uploaded a new version of &quot;File:Device.png&quot;</p>
<hr />
<div></div>Nanhaihttp://2012.igem.org/Team:WHU-ChinaTeam:WHU-China2012-10-26T20:16:13Z<p>Nanhai: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<body><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script><br />
function picObj(src, title, detail, href){<br />
this.src = src;<br />
this.title = title;<br />
this.detail = detail;<br />
this.href = href;<br />
}<br />
//*************************自定义数据部分*************************<br />
<br />
//定义菜单及侧边栏数据<br />
var menuObj = {<br />
Home : [<br />
{<br />
title : "<strong>What's new</strong>",<br />
picArray : [new picObj("http://partsregistry.org/wiki/images/f/ff/%E5%85%A8%E6%99%AF%E5%8A%A0%E6%AD%BB%E4%BA%A11.png", "Panorama of the Whole Project Scheme", "Four novel devices, Fatty Acid Degradation, Cellulose Synthesis, Colonization and Death to ensure high efficiency orchestrate calorie absorption and bacteria survival and make you slim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/8/88/Pcar1.jpg", "Pcar: Promoter of CRP As a Repressor", "By inserting CRP-binding site to overlap with the -10 region of a constitutive promoter, Pcar is able to be induced by glucose, while CRP serves as a repressor rather than an activator.", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#Pcar"),<br />
new picObj("https://static.igem.org/mediawiki/2012/4/4d/Pfadr1.jpg", "PfadR: Synthesized promoter regulated solely by fatty acid", "With tandem FadR binding site, PfadR is able to be repressed solely by fatty acid.", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#PfadR"),<br />
new picObj("https://static.igem.org/mediawiki/2012/0/09/%E8%83%96%E5%AD%90%E7%98%A6%E5%AD%90.png", "Long term efficiency of the E.coslim", "When viewed in macroscopic way, the E.coslim may have an advantage of long term efficiency,by regulating the human gut microbiota.", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#PfadR")<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>Pathway Introduction</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/igem.org/8/82/Pathway_FattyAcid.png", "Fatty Acid Degradation", "Feel free to eat meat since the fat is all degraded by our E.coslim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=3"),<br />
new picObj("https://static.igem.org/mediawiki/igem.org/1/18/Pathway_Cellulose.png", "Cellulose Synthesis", "Transforming glucose into cellulose, the high-sugar food you eat will be turned into vegetables!", "https://2012.igem.org/Team:WHU-China/Project?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/igem.org/6/63/Pathway_Colonization.png", "Colonization", "The magic molecule c-di-GMP enables E.coslim colonizing in the gut to better fulfill its magic function!", "https://2012.igem.org/Team:WHU-China/Project?catalog=5")<br />
]<br />
},<br />
{<br />
title : "<strong>Future Perspective</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/ab/%E5%8F%8C%E8%83%B6%E5%9B%8A2.jpg", "Two Capsule Design", "Capsule I, the E.coslim, makes you slim, while Capsule II, xylose, terminates the effects of the former.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/d/d2/Fpbody2.jpg", "In vitro experiment in a simulated intestine", "The gut microbiota and E.coslim will be inoculated in a simulated intestine, then the concentration measurement of each component will tell us whether E.coslim works as desired.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),<br />
new picObj("https://static.igem.org/mediawiki/2012/8/85/%E5%B0%8F%E9%BC%A0%E5%AE%9E%E9%AA%8C02.jpg", "In vivo experiment in mice", "E.coslim will also be inoculated into mice and the culture-independent microbiome analysis will tell us the real situation in vivo.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0")<br />
]<br />
},<br />
{<br />
title : "<strong>Achievement</strong>",<br />
picArray : [<br />
<br />
]<br />
},<br />
{<br />
title : "<strong>About Us</strong>",<br />
picArray : [<br />
new picObj("https://static.igem.org/mediawiki/2012/a/a7/Whu-2012-1.jpg", "WHU-China 2012, I was there", "The Entrance of State Wuhan University", "https://2012.igem.org/Team:WHU-China/Team?catalog=1"),<br />
new picObj("https://static.igem.org/mediawiki/2012/2/23/Whu2012heying.jpg", "MIT, we're coming!", "Collge of Life Sciences of WHU", "https://2012.igem.org/Team:WHU-China/Team?catalog=4"),<br />
new picObj("https://static.igem.org/mediawiki/2012/4/43/Whu2012-2.jpg", "WHU-China, Hooray!", "Yuntai Mountain, Henan Province", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=5")<br />
]<br />
}<br />
],<br />
Team : [<br />
{<br />
title : '<strong>Members</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Instructors</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Team History</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About WHU</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>About Our Lab</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Acknow-</br>ledgements</strong>',<br />
dir : []<br />
},<br />
<br />
],<br />
Project : [<br />
{<br />
title : '<strong>Description</strong>',<br />
dir : [<br />
<br />
]<br />
},<br />
{<br />
title : '<strong>Background</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Promoter Design</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device I: Fatty Acid Degradation</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device II: Cellulose Synthesis</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device III: Colonization</strong>',<br />
dir : []<br />
},<br />
],<br />
Modeling : [<br />
{<br />
title : '<strong>Future Perspectives</strong>',<br />
dir : []<br />
},<br />
<br />
{<br />
title : '<strong>Model I: Fatty Acid Degradation</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Model II: Microbiota Regulation</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Software Tool: FANCY</strong>',<br />
dir : []<br />
}<br />
],<br />
Notebooks : [<br />
{<br />
title : '<strong>Parts</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Safety</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Protocols</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Events</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Brain-</br>storming</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Gallery</strong>',<br />
dir : []<br />
}<br />
],<br />
HumanPractice : [<br />
{<br />
title : '<strong>Outline</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Questionaire Survey</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Publicity</strong>',<br />
dir : []<br />
}<br />
]<br />
}; <br />
//*************************自定义数据部分*************************<br />
</script><br />
<style type="text/css"><br />
/*<br />
* base css, DO NOT MODIFY!<br />
*/<br />
* {<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
font-family: "Verdana", sans-serif;<br />
color: #333;<br />
list-style: none;<br />
outline: none;<br />
resize: none;<br />
}<br />
html {<br />
overflow-y: scroll;<br />
}<br />
body {<br />
background: url("https://static.igem.org/mediawiki/2012/2/22/Body-bg.jpg") center center fixed;<br />
}<br />
a {<br />
text-decoration: none;<br />
}<br />
.clear {<br />
width: 0;<br />
height: 0;<br />
line-height: 0;<br />
display: block;<br />
clear: both;<br />
}<br />
<br />
/*<br />
* common css, include "header","footer"...<br />
*/<br />
div.center {<br />
width: 1000px;<br />
margin: 0 auto;<br />
position: relative;<br />
}<br />
div.header {<br />
width: 1000px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/1/12/Header-bg.png") no-repeat;<br />
position: relative;<br />
z-index: 50;<br />
}<br />
div.nav {<br />
position: absolute;<br />
height: 80px;<br />
top: 185px;<br />
left: 245px;<br />
}<br />
li.nav-outerLi {<br />
display: block;<br />
float: left;<br />
width: 80px;<br />
height: 80px;<br />
margin: 0 6px;<br />
cursor: pointer;<br />
}<br />
h2.nav-h21,h2.nav-h22,h2.nav-h23,h2.nav-h24,h2.nav-h25,h2.nav-h26 {<br />
display: block;<br />
background: url("https://static.igem.org/mediawiki/2012/9/91/Nav-tabs.png") no-repeat;<br />
width: 80px;<br />
height: 80px;<br />
background-position: 0 0;<br />
z-index: 150;<br />
position: relative;<br />
}<br />
h2.nav-h22 {<br />
background-position: -80px 0;<br />
}<br />
h2.nav-h23 {<br />
background-position: -160px 0;<br />
}<br />
h2.nav-h24 {<br />
background-position: -240px 0;<br />
}<br />
h2.nav-h25 {<br />
background-position: -320px 0;<br />
}<br />
h2.nav-h26 {<br />
background-position: -400px 0;<br />
}<br />
h2.nav-h21:hover {<br />
background-position: 0 -80px;<br />
}<br />
h2.nav-h22:hover {<br />
background-position: -80px -80px;<br />
}<br />
h2.nav-h23:hover {<br />
background-position: -160px -80px;<br />
}<br />
h2.nav-h24:hover {<br />
background-position: -240px -80px;<br />
}<br />
h2.nav-h25:hover {<br />
background-position: -320px -80px;<br />
}<br />
h2.nav-h26:hover {<br />
background-position: -400px -80px;<br />
}<br />
h2.nav-h21on {<br />
background-position: 0 -160px;<br />
}<br />
h2.nav-h22on {<br />
background-position: -80px -160px;<br />
}<br />
h2.nav-h23on {<br />
background-position: -160px -160px;<br />
}<br />
h2.nav-h24on {<br />
background-position: -240px -160px;<br />
}<br />
h2.nav-h25on {<br />
background-position: -320px -160px;<br />
}<br />
h2.nav-h26on {<br />
background-position: -400px -160px;<br />
}<br />
ul.nav-innerUl{<br />
position: absolute;<br />
top: 40px;<br />
padding-top: 40px;<br />
width: 76px;<br />
border-left: 2px solid #000;<br />
border-right: 2px solid #000;<br />
z-index: 140;<br />
display: none;<br />
}<br />
em.nav-libg{<br />
display: block;<br />
width: 96px;<br />
height: 11px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/48/Nav-libg.png');<br />
margin-left: -10px;<br />
}<br />
ul.nav-innerUl1{<br />
background: #fffaca;<br />
}<br />
ul.nav-innerUl2{<br />
background: #dedede;<br />
}<br />
ul.nav-innerUl3{<br />
background: #d9f0c9;<br />
}<br />
ul.nav-innerUl4{<br />
background: #f6e5ff;<br />
}<br />
ul.nav-innerUl5{<br />
background: #ebfcff;<br />
}<br />
ul.nav-innerUl6{<br />
background: #ffeee8;<br />
}<br />
li.nav-innerLi{<br />
font-size: 10px;<br />
line-height: 14px;<br />
padding: 3px 5px;<br />
}<br />
li.nav-innerLi:hover{<br />
background: #fff;<br />
}<br />
div.middle {<br />
width: 940px;<br />
background: #e6deb8;<br />
background: rgba(230,222,184,0.5);<br />
position: absolute;<br />
top: 300px;<br />
left: 30px;<br />
}<br />
div.aside {<br />
width: 160px;<br />
height: 380px;<br />
background: url("https://static.igem.org/mediawiki/2012/b/b3/Aside-bg.png") no-repeat;<br />
margin-left: 20px;<br />
margin-top: 100px;<br />
float: left;<br />
padding: 20px;<br />
}<br />
ul.aside-outerUl {<br />
margin: 15px;<br />
}<br />
li.aside-outerLi {<br />
margin: 15px 0;<br />
background: #fff1a9;<br />
padding: 5px 10px;<br />
color: #725718;<br />
font-size: 16px;<br />
line-height: 24px;<br />
font-weight: bold;<br />
text-align: center;<br />
cursor: pointer;<br />
}<br />
li.aside-outerLi:hover {<br />
background: #fff8d3;<br />
}<br />
div.main {<br />
width: 640px;<br />
height: 400px;<br />
border: 5px solid #333;<br />
background: #fff;<br />
float: right;<br />
margin: 100px 30px 30px 0;<br />
}<br />
div.footer {<br />
}<br />
<br />
/*<br />
* picSlider Css<br />
*/<br />
#picSlider {<br />
width: 640px;<br />
height: 320px;<br />
}<br />
.momo {<br />
background: #000;<br />
}<br />
.momo .pic li {<br />
width: 100%;<br />
height: 100%;<br />
overflow: hidden;<br />
position: absolute;<br />
display: none;<br />
}<br />
.momo .txt li {<br />
position: absolute;<br />
padding: 5px 10px;<br />
z-index: 2;<br />
bottom: 0;<br />
height: 28px;<br />
background: #DBDBDB;<br />
display: none;<br />
}<br />
.momo .txt li a {<br />
display: block;<br />
position: relative;<br />
z-index: 1;<br />
color: #333;<br />
font-size: 12px;<br />
font-weight: bold;<br />
text-decoration: none;<br />
}<br />
.momo .num {<br />
position: absolute;<br />
z-index: 3;<br />
bottom: 5px;<br />
right: 5px;<br />
}<br />
.momo .num li {<br />
float: left;<br />
}<br />
.momo .num li a {<br />
color: #333;<br />
float: left;<br />
margin-left: 3px;<br />
width: 15px;<br />
height: 15px;<br />
line-height: 15px;<br />
*line-height: 14px;<br />
overflow: hidden;<br />
border: 1px solid #AEC1CC;<br />
text-align: center;<br />
cursor: pointer;<br />
background: #fff;<br />
text-decoration: none;<br />
}<br />
.momo .num li.current a, .momo .num li.hover a {<br />
color: #fff;<br />
background: #f60;<br />
-webkit-transition: all 0.4s;<br />
-moz-transition: all 0.4s;<br />
-o-transition: all 0.4s;<br />
}<br />
.momo_picSlider .txt li{<br />
width: 620px;<br />
}<br />
.momo_picSlider .txt li a{<br />
font-size: 16px;<br />
line-height: 24px;<br />
}<br />
#p-logo {<br />
display:none;<br />
}<br />
#top-section {<br />
height:0;<br />
border:none;<br />
}<br />
#search-controls {<br />
display:none;<br />
}<br />
#content {<br />
position:inherit;<br />
width:inherit;<br />
margin:0;<br />
padding:0;<br />
background:inherit;<br />
color:inherit;<br />
border:none;<br />
line-height:inherit;<br />
z-index:2;<br />
}<br />
.firstHeading {<br />
display:none;<br />
}<br />
#catlinks {<br />
display:none;<br />
}<br />
#footer-box {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#menubar ul li a {<br />
background:none;<br />
}<br />
#bodyContent h1,#bodyContent h2 {<br />
margin:0;<br />
border:0;<br />
padding: 0;<br />
}<br />
.left-menu:hover {<br />
background:none;<br />
}<br />
</style><br />
<div class="center"><br />
<div class="header"><br />
<div class="nav"><br />
<ul class="nav-outerUl"><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China"><h2 class="nav-h21 nav-h21on" title="Home"></h2></a><br />
<ul class="nav-innerUl nav-innerUl1" name="Home"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Team"><h2 class="nav-h22" title="Team"></h2></a><br />
<ul class="nav-innerUl nav-innerUl2" name="Team"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Project"><h2 class="nav-h23" title="Project"></h2></a><br />
<ul class="nav-innerUl nav-innerUl3" name="Project"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Modeling"><h2 class="nav-h24" title="Modeling"></h2></a><br />
<ul class="nav-innerUl nav-innerUl4" name="Modeling"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Notebooks"><h2 class="nav-h25" title="Notebooks"></h2></a><br />
<ul class="nav-innerUl nav-innerUl5" name="Notebooks"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/humanPractice"><h2 class="nav-h26" title="Human Practice"></h2></a><br />
<ul class="nav-innerUl nav-innerUl6" name="HumanPractice"></ul><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div class="middle"><br />
<div class="aside"><br />
<ul class="aside-outerUl"></ul><br />
</div><br />
<div class="main"></div><br />
<div class="clear"></div><br />
</div><br />
<div class="footer"></div><br />
</div><br />
<script src="http://www.yichengliu.com/code/igem/home.js"></script><br />
</body><br />
</html></div>Nanhaihttp://2012.igem.org/File:%E8%83%96%E5%AD%90%E7%98%A6%E5%AD%90.pngFile:胖子瘦子.png2012-10-26T20:08:38Z<p>Nanhai: </p>
<hr />
<div></div>Nanhaihttp://2012.igem.org/Team:WHU-China/NotebooksTeam:WHU-China/Notebooks2012-10-26T19:41:18Z<p>Nanhai: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<body><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script><br />
function picObj(src, title, detail, href){<br />
this.src = src;<br />
this.title = title;<br />
this.detail = detail;<br />
this.href = href;<br />
}<br />
//*************************自定义数据部分*************************<br />
<br />
//定义菜单及侧边栏数据<br />
var menuObj = {<br />
Home : [<br />
{<br />
title : "<strong>what's new</strong>",<br />
picArray : [<br />
new picObj("http://imgsrc.baidu.com/forum/pic/item/d25e8bd4b31c87011d9cdb7c277f9e2f0708ff34.jpg", "one piece", "yi zhang haizeiwang de tu", "http://tieba.baidu.com/f?kw=%BA%A3%D4%F4%CD%F5"),<br />
new picObj("http://imgsrc.baidu.com/forum/pic/item/d25e8bd4b31c87011d9cdb7c277f9e2f0708ff34.jpg", "one piece", "yi zhang haizeiwang de tu", "http://tieba.baidu.com/f?kw=%BA%A3%D4%F4%CD%F5"),<br />
new picObj("http://imgsrc.baidu.com/forum/pic/item/d25e8bd4b31c87011d9cdb7c277f9e2f0708ff34.jpg", "one piece", "yi zhang haizeiwang de tu", "http://tieba.baidu.com/f?kw=%BA%A3%D4%F4%CD%F5")<br />
]<br />
},<br />
{<br />
title : "<strong>pathway introduction</strong>",<br />
picArray : [<br />
new picObj("2.png", "title 2", "pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1production 1", "#"),<br />
new picObj("2.png", "title 2", "pathway introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2", "#"),<br />
new picObj("2.png", "title 2", "pathway introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3", "#")<br />
]<br />
},<br />
{<br />
title : "<strong>future prospective</strong>",<br />
picArray : [<br />
new picObj("3.png", "title 3", "future prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1utureive 1", "#"),<br />
new picObj("3.png", "title 3", "future prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospecpective 2", "#"),<br />
new picObj("3.png", "title 3", "future prospective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3", "#")<br />
]<br />
},<br />
{<br />
title : "<strong>about us</strong>",<br />
picArray : [<br />
new picObj("4.png", "title 4", "about us 1", "#"),<br />
new picObj("4.png", "title 4", "about us 2", "#"),<br />
new picObj("4.png", "title 4", "about us 3", "#")<br />
]<br />
}<br />
],<br />
Team : [<br />
{<br />
title : '<strong>Members</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Instructors</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Team History</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>about WHU</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>about Our Lab</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Acknol-</br>edgements</strong>',<br />
dir : []<br />
},<br />
<br />
],<br />
Project : [<br />
{<br />
title : '<strong>Outline</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Background</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Promoter Design</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device I: Fatty Acid Degradation</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device II: Cellulose Synthesis</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device III: Colonization</strong>',<br />
dir : []<br />
},<br />
],<br />
Modeling : [<br />
{<br />
title : '<strong>Future Perspectives</strong>',<br />
dir : []<br />
},<br />
<br />
{<br />
title : '<strong>Model I: Fatty Acid Degradation</strong>',<br />
dir : [<br />
{<br />
title : 'The Ordinary Differential Equations of the Model',<br />
href : '#The Ordinary Differential Equations of the Model'<br />
},<br />
{<br />
title : 'Analysis on the Steady State of the ODE',<br />
href : '#Analysis on the Steady State of the ODE'<br />
},<br />
{<br />
title : 'Parameter Screening',<br />
href : '#Parameter Screening'<br />
},<br />
{<br />
title : 'Conclusion',<br />
href : '#Conclusion'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Model II: Microbiota Regulation</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Software Tool: FANCY</strong>',<br />
dir : []<br />
}<br />
],<br />
Notebooks : [<br />
{<br />
title : '<strong>Parts</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Safety</strong>',<br />
dir : [<br />
{<br />
title : 'Brief Answers to Safety Questions',<br />
href : '#Brief Answers to Safety Questions'<br />
},<br />
{<br />
title : 'General Safety Issues',<br />
href : '#General Safety Issues'<br />
},<br />
{<br />
title : 'Safety Considerations of Our Biobrick parts and Our Project',<br />
href : '#Safety Considerations of Our Biobrick parts and Our Project'<br />
},<br />
{<br />
title : 'Safety Management and Practice',<br />
href : '#Safety Management and Practice'<br />
},<br />
{<br />
title : 'Biosafety and Publicity',<br />
href : '#Biosafety and Publicity'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Protocols</strong>',<br />
dir : [<br />
{<br />
title : 'Protocol for fluorescence measurement',<br />
href : '#Protocol for fluorescence measurement'<br />
},<br />
{<br />
title : 'Protocols of Cupric-Soap Reaction',<br />
href : '#Protocols of Cupric-Soap Reaction'<br />
},<br />
{<br />
title : 'Krebs-Ringer Phosphate(KRPD Buffer Solution)',<br />
href : '#Krebs-Ringer Phosphate(KRPD Buffer Solution)'<br />
},<br />
{<br />
title : 'Cellulose Detection',<br />
href : '#Cellulose Detection'<br />
},<br />
<br />
{<br />
title : 'In vitro Experiment',<br />
href : '#In vitro Experiment'<br />
},<br />
{<br />
title : 'Plate Assay',<br />
href : '#Plate Assay'<br />
},<br />
{<br />
title : 'Materials and Methods of SDS-PAGE',<br />
href : '#Materials and Methods of SDS-PAGE'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Events</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Brain-</br>storming</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Gallery</strong>',<br />
dir : [<br />
{<br />
title : 'team',<br />
href : '#team'<br />
},<br />
{<br />
title : 'presentation',<br />
href : '#presentation'<br />
},<br />
{<br />
title : 'human practice',<br />
href : '#human practice'<br />
},<br />
{<br />
title : 'doodle',<br />
href : '#doodle'<br />
},<br />
{<br />
title : 'funny pictures',<br />
href : '#funny pictures'<br />
}]},<br />
{<br />
title : '<strong>A Letter from Fancy</strong>',<br />
dir : []<br />
<br />
<br />
}<br />
],<br />
HumanPractice : [<br />
{<br />
title : '<strong>Outline</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Questionaire Survey</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Publicity</strong>',<br />
dir : []<br />
}<br />
]<br />
}; <br />
//*************************自定义数据部分*************************<br />
</script><br />
<style type="text/css"><br />
/*<br />
* base css, DO NOT MODIFY!<br />
*/<br />
* {<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
font-family: "Verdana", sans-serif;<br />
color: #333;<br />
list-style: none;<br />
outline: none;<br />
resize: none;<br />
}<br />
html {<br />
overflow-y: scroll;<br />
}<br />
body {<br />
background: url("https://static.igem.org/mediawiki/2012/6/69/Body-bg2.jpg") center center fixed;<br />
}<br />
a {<br />
text-decoration: none;<br />
}<br />
.clear {<br />
width: 0;<br />
height: 0;<br />
line-height: 0;<br />
display: block;<br />
clear: both;<br />
}<br />
<br />
/*<br />
* common css, include "header","footer"...<br />
*/<br />
div.center {<br />
width: 940px;<br />
margin: 0 auto;<br />
}<br />
div.header {<br />
width: 940px;<br />
height: 357px;<br />
background: url("https://static.igem.org/mediawiki/2012/8/80/Header-bg2.png") no-repeat;<br />
position: relative;<br />
z-index: 50;<br />
}<br />
div.nav {<br />
position: absolute;<br />
height: 80px;<br />
top: 206px;<br />
left: 350px;<br />
}<br />
li.nav-outerLi {<br />
display: block;<br />
float: left;<br />
width: 80px;<br />
height: 80px;<br />
margin: 0 6px;<br />
cursor: pointer;<br />
}<br />
h2.nav-h21,h2.nav-h22,h2.nav-h23,h2.nav-h24,h2.nav-h25,h2.nav-h26 {<br />
display: block;<br />
background: url("https://static.igem.org/mediawiki/2012/9/91/Nav-tabs.png") no-repeat;<br />
width: 80px;<br />
height: 80px;<br />
background-position: 0 0;<br />
z-index: 150;<br />
position: relative;<br />
}<br />
h2.nav-h22 {<br />
background-position: -80px 0;<br />
}<br />
h2.nav-h23 {<br />
background-position: -160px 0;<br />
}<br />
h2.nav-h24 {<br />
background-position: -240px 0;<br />
}<br />
h2.nav-h25 {<br />
background-position: -320px 0;<br />
}<br />
h2.nav-h26 {<br />
background-position: -400px 0;<br />
}<br />
h2.nav-h21:hover {<br />
background-position: 0 -80px;<br />
}<br />
h2.nav-h22:hover {<br />
background-position: -80px -80px;<br />
}<br />
h2.nav-h23:hover {<br />
background-position: -160px -80px;<br />
}<br />
h2.nav-h24:hover {<br />
background-position: -240px -80px;<br />
}<br />
h2.nav-h25:hover {<br />
background-position: -320px -80px;<br />
}<br />
h2.nav-h26:hover {<br />
background-position: -400px -80px;<br />
}<br />
h2.nav-h21on {<br />
background-position: 0 -160px;<br />
}<br />
h2.nav-h22on {<br />
background-position: -80px -160px;<br />
}<br />
h2.nav-h23on {<br />
background-position: -160px -160px;<br />
}<br />
h2.nav-h24on {<br />
background-position: -240px -160px;<br />
}<br />
h2.nav-h25on {<br />
background-position: -320px -160px;<br />
}<br />
h2.nav-h26on {<br />
background-position: -400px -160px;<br />
}<br />
ul.nav-innerUl{<br />
position: absolute;<br />
top: 40px;<br />
padding-top: 40px;<br />
width: 76px;<br />
border-left: 2px solid #000;<br />
border-right: 2px solid #000;<br />
z-index: 140;<br />
display: none;<br />
}<br />
em.nav-libg{<br />
display: block;<br />
width: 96px;<br />
height: 11px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/48/Nav-libg.png');<br />
margin-left: -10px;<br />
}<br />
ul.nav-innerUl1{<br />
background: #fffaca;<br />
}<br />
ul.nav-innerUl2{<br />
background: #dedede;<br />
}<br />
ul.nav-innerUl3{<br />
background: #d9f0c9;<br />
}<br />
ul.nav-innerUl4{<br />
background: #f6e5ff;<br />
}<br />
ul.nav-innerUl5{<br />
background: #ebfcff;<br />
}<br />
ul.nav-innerUl6{<br />
background: #ffeee8;<br />
}<br />
li.nav-innerLi{<br />
font-size: 10px;<br />
line-height: 14px;<br />
padding: 3px 5px;<br />
}<br />
li.nav-innerLi:hover{<br />
background: #fff;<br />
}<br />
div.middle {<br />
width: 940px;<br />
background: #e6deb8;<br />
background: rgba(230,222,184,0.5);<br />
position: absolute;<br />
top: 178px;<br />
}<br />
div.aside {<br />
width: 174px;<br />
height: 441px;<br />
background: url("https://static.igem.org/mediawiki/2012/9/96/Aside-bg2.png") no-repeat;<br />
margin-left: 10px;<br />
float: left;<br />
padding: 179px 86px 0 40px;<br />
}<br />
div.asideFixed {<br />
position: fixed;<br />
top: 0;<br />
}<br />
ul.aside-outerUl {<br />
position: relative;<br />
margin: 7px 10px;<br />
}<br />
li.aside-outerLi {<br />
margin: 10px 0;<br />
}<br />
li.aside-outerLi h2{<br />
padding: 4px 0;<br />
color: #725718;<br />
background: #fff1a9;<br />
font-size: 14px;<br />
line-height: 22px;<br />
font-weight: bold;<br />
text-align: center;<br />
cursor: pointer;<br />
}<br />
li.aside-outerLi:hover h2{<br />
background: #fff8d3;<br />
}<br />
ul.aside-innerUl {<br />
display: none;<br />
}<br />
ul.aside-innerUl li {<br />
background: #bdc9ad;<br />
margin: 3px 0;<br />
font-family: arial, sans-serif;<br />
font-size: 14px;<br />
line-height: 22px;<br />
text-align: center;<br />
cursor: pointer;<br />
}<br />
ul.aside-innerUl li:hover{<br />
background: #d4dcc9;<br />
}<br />
div.main {<br />
width: 580px;<br />
border: 1px solid #9e8366;<br />
background: #f0e2c1;<br />
float: right;<br />
margin: 149px 30px 30px 0;<br />
}<br />
div.passage {<br />
display: none;<br />
margin: 30px;<br />
}<br />
div.show{<br />
display: block;<br />
}<br />
div.passage h3 {<br />
font-size: 26px;<br />
line-height: 39px;<br />
font-weight: bold;<br />
background: #859f93;<br />
color: #f0e2c1;<br />
display: block;<br />
width: auto;<br />
padding: 0 10px;<br />
}<br />
div.passage p {<br />
margin: 14px 0;<br />
font-size: 13px;<br />
line-height: 20px;<br />
}<br />
div.passage img {<br />
display: block;<br />
float: right;<br />
padding: 0 0 20px 30px;<br />
background: #f0e2c1;<br />
}<br />
div.footer {<br />
}<br />
#p-logo {<br />
display:none;<br />
}<br />
#top-section {<br />
height:0;<br />
border:none;<br />
}<br />
#search-controls {<br />
display:none;<br />
}<br />
#content {<br />
position:inherit;<br />
width:inherit;<br />
margin:0;<br />
padding:0;<br />
background:inherit;<br />
color:inherit;<br />
border:none;<br />
line-height:inherit;<br />
z-index:2;<br />
}<br />
.firstHeading {<br />
display:none;<br />
}<br />
#catlinks {<br />
display:none;<br />
}<br />
#footer-box {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#menubar ul li a {<br />
background:none;<br />
}<br />
#bodyContent h1,#bodyContent h2 {<br />
margin:0;<br />
border:0;<br />
padding: 0;<br />
}<br />
#bodyContent h2.nav-h2-title{<br />
padding: 5px 0;<br />
}<br />
.left-menu:hover {<br />
background:none;<br />
}<br />
.nav-bg-logo{<br />
float: left;<br />
}<br />
</style><br />
</head><br />
<body><br />
<div class="center"><br />
<div class="header"><br />
<img class="nav-bg-logo" src="https://static.igem.org/mediawiki/2012/4/44/Nav-bg-logo1.png" /><br />
<div class="nav"><br />
<ul class="nav-outerUl"><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China"><h2 class="nav-h21" title="Home"></h2></a><br />
<ul class="nav-innerUl nav-innerUl1" name="Home"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Team"><h2 class="nav-h22" title="Team"></h2></a><br />
<ul class="nav-innerUl nav-innerUl2" name="Team"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Project"><h2 class="nav-h23" title="Project"></h2></a><br />
<ul class="nav-innerUl nav-innerUl3" name="Project"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Modeling"><h2 class="nav-h24" title="Modeling"></h2></a><br />
<ul class="nav-innerUl nav-innerUl4" name="Modeling"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Notebooks"><h2 class="nav-h25 nav-h25on" title="Notebooks"></h2></a><br />
<ul class="nav-innerUl nav-innerUl5" name="Notebooks"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/HumanPractice"><h2 class="nav-h26" title="Human Practice"></h2></a><br />
<ul class="nav-innerUl nav-innerUl6" name="HumanPractice"></ul><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div class="middle"><br />
<div class="aside"><br />
<ul class="aside-outerUl"></ul><br />
</div><br />
<div class="main"><br />
<div class="passage divcell0"><br />
<table class=" pgrouptable tablesorter" cellspacing="0" cellpadding="0" style="width: 100%;"><thead><br />
<tr><th class="header" style="width:8px"></th><th class="header" style="width:8px"></th><th class="header" style="width:8px"></th><th class="header" style="width: 87px;">Name</th><th class="header" style="width: 80px" colspan="">Type</th><th class="header" style="width: auto;" colspan="">Description</th><th class="header" style="width: 150px" colspan="">Designer</th><th class="header" style="width: 50px" colspan="">Length</th><br />
</tr></thead><tbody><br />
<tr><br />
<td class="status_cell heart13">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861060">BBa_K861060</a></td><td>Regulatory</td><td>PfadR, synthetic promoter with tandem FadR binding site</td><td width="100px">Kuanwei Sheng</td><td align="right">76</td><br />
</tr><br />
<tr><br />
<td class="status_cell heart13">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861171">BBa_K861171</a></td><td>Regulatory</td><td>Pcar, synthetic promoter repressed by CRP</td><td width="100px">Kuanwei Sheng</td><td align="right">36</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861001">BBa_K861001</a></td><td>Generator</td><td>FadL with a strong RBS and a double terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">1465</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_green">W</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861002">BBa_K861002</a></td><td>Generator</td><td>Constitutively expressed FadL</td><td width="100px">Kuanwei Sheng</td><td align="right">1508</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861003">BBa_K861003</a></td><td>Generator</td><td>PfadR regulated FadL</td><td width="100px">Kuanwei Sheng</td><td align="right">1549</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861010">BBa_K861010</a></td><td>Coding</td><td>FadD, an inner membrane-associated acyl-CoA synthase</td><td width="100px">Kuanwei Sheng</td><td align="right">1605</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861011">BBa_K861011</a></td><td>Generator</td><td>FadD with RBS and terminator.</td><td width="100px">Kuanwei Sheng</td><td align="right">1729</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861013">BBa_K861013</a></td><td>Generator</td><td>IPTG induced FadD</td><td width="100px">Kuanwei Sheng</td><td align="right">1792</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861014">BBa_K861014</a></td><td>Generator</td><td>Constitutively expressed FadD</td><td width="100px">Kuanwei Sheng</td><td align="right">1772</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861015">BBa_K861015</a></td><td>Generator</td><td>Constitutively expressed FadD</td><td width="100px">Kuanwei Sheng</td><td align="right">1772</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861016">BBa_K861016</a></td><td>Generator</td><td>PfadR regulated FadD</td><td width="100px">Kuanwei Sheng</td><td align="right">1813</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861020">BBa_K861020</a></td><td>Coding</td><td>FadE ,acyl-CoA dehydrogenase </td><td width="100px">Kuanwei Sheng</td><td align="right">2445</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861021">BBa_K861021</a></td><td>Coding</td><td>FadE gene for fatty acid degradation from <i>Salmonella enterica</i> LT2</td><td width="100px">Kuanwei Sheng</td><td align="right">2592</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861022">BBa_K861022</a></td><td>Generator</td><td>FadE with RBS and terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">2569</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861023">BBa_K861023</a></td><td>Generator</td><td>S-FadE with a RBS and a terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">2716</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861024">BBa_K861024</a></td><td>Generator</td><td>IPTG induced FadE</td><td width="100px">Kuanwei Sheng</td><td align="right">2632</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861025">BBa_K861025</a></td><td>Generator</td><td>Constitutively expressed FadE</td><td width="100px">Kuanwei Sheng</td><td align="right">2612</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861026">BBa_K861026</a></td><td>Generator</td><td>Constitutively expressed FadE</td><td width="100px">Kuanwei Sheng</td><td align="right">2612</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861027">BBa_K861027</a></td><td>Generator</td><td>Constitutively expressed FadE</td><td width="100px">Kuanwei Sheng</td><td align="right">2612</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861028">BBa_K861028</a></td><td>Generator</td><td>PfadR regulated FadE</td><td width="100px">Kuanwei Sheng</td><td align="right">2653</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861029">BBa_K861029</a></td><td>Regulatory</td><td>PfadR regulated S-FadE</td><td width="100px">Kuanwei Sheng</td><td align="right">2800</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861030">BBa_K861030</a></td><td>Coding</td><td>FadB, gene for fatty acid degradation from E.coli K12</td><td width="100px">Kuanwei Sheng</td><td align="right">1164</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861031">BBa_K861031</a></td><td>Coding</td><td>FadJ, gene for fatty acid degradation from <i>E.coli str. K12</i></td><td width="100px">Kuanwei Sheng</td><td align="right">2145</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861032">BBa_K861032</a></td><td>Coding</td><td> S-FadB gene for fatty acid degradation from <i>Salmonella enterica</i> LT2</td><td width="100px">Kuanwei Sheng</td><td align="right">2190</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861033">BBa_K861033</a></td><td>Generator</td><td>FadB with a RBS and a terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">1288</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861034">BBa_K861034</a></td><td>Generator</td><td> FadJ gene with a RBS and a terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">2269</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861035">BBa_K861035</a></td><td>Generator</td><td>S-FadB with a RBS and a terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">2314</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861036">BBa_K861036</a></td><td>Generator</td><td>IPTG induced FadA and FadB</td><td width="100px">Kuanwei Sheng</td><td align="right">2544</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861037">BBa_K861037</a></td><td>Generator</td><td>IPTG induced FadI and FadJ</td><td width="100px">Kuanwei Sheng</td><td align="right">3672</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861038">BBa_K861038</a></td><td>Generator</td><td>IPTG induced S-FadA and S-FadB</td><td width="100px">Kuanwei Sheng</td><td align="right">3673</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861041">BBa_K861041</a></td><td>Coding</td><td>FadI, gene for fatty acid degradation from <i>E.coli str. K12</i></td><td width="100px">Kuanwei Sheng</td><td align="right">1311</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861042">BBa_K861042</a></td><td>Coding</td><td>FadA, gene for fatty acid degradation from <i>Salmonella enterica</i> LT2</td><td width="100px">Kuanwei Sheng</td><td align="right">1164</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861043">BBa_K861043</a></td><td>Translational_Unit</td><td>FadA with a RBS</td><td width="100px">Kuanwei Sheng</td><td align="right">1185</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861044">BBa_K861044</a></td><td>Translational_Unit</td><td>FadI with a RBS</td><td width="100px">Kuanwei Sheng</td><td align="right">1332</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861045">BBa_K861045</a></td><td>Generator</td><td>S-FadA with a RBS and a terminator </td><td width="100px">Kuanwei Sheng</td><td align="right">1288</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861046">BBa_K861046</a></td><td>Generator</td><td>PfadR regulated FadA and FadB</td><td width="100px">Kuanwei Sheng</td><td align="right">2565</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861047">BBa_K861047</a></td><td>Generator</td><td>PfadR regulated FadI and FadJ</td><td width="100px">Kuanwei Sheng</td><td align="right">3693</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861048">BBa_K861048</a></td><td>Generator</td><td>PfadR regulated S-FadA and S-FadB</td><td width="100px">Kuanwei Sheng</td><td align="right">3591</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861050">BBa_K861050</a></td><td>Coding</td><td>FadR, fatty acid sensor from <i>E.coli str. K12</i></td><td width="100px">Kuanwei Sheng</td><td align="right">720</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861051">BBa_K861051</a></td><td>Generator</td><td>FadR with a RBS and a terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">844</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861052">BBa_K861052</a></td><td>Generator</td><td>Constitutive expressed FadR</td><td width="100px">Kuanwei Sheng</td><td align="right">887</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861061">BBa_K861061</a></td><td>Reporter</td><td>Efficacy testing RFP generator of BBa_K861060 (PfadR)</td><td width="100px">Kuanwei Sheng</td><td align="right">945</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861062">BBa_K861062</a></td><td>Regulatory</td><td>PfadR with FadR overexpressed</td><td width="100px">Kuanwei Sheng</td><td align="right">1840</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_green">W</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861070">BBa_K861070</a></td><td>Coding</td><td>AdrA gene from E.coli K12</td><td width="100px">Kuanwei Sheng</td><td align="right">1167</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_green">W</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861071">BBa_K861071</a></td><td>Generator</td><td>AdrA gene with a RBS and a terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">1293</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_green">W</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861072">BBa_K861072</a></td><td>Generator</td><td>Constitutively expressed AdrA</td><td width="100px">Kuanwei Sheng</td><td align="right">1336</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_green">W</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861073">BBa_K861073</a></td><td>Generator</td><td>Constitutively expressed AdrA</td><td width="100px">Kuanwei Sheng</td><td align="right">1336</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861074">BBa_K861074</a></td><td>Generator</td><td>Pcar regulated AdrA</td><td width="100px">Kuanwei Sheng</td><td align="right">1337</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861090">BBa_K861090</a></td><td>Coding</td><td>YhjH Gene From <i>E.coli str. K12</i></td><td width="100px">Kuanwei Sheng</td><td align="right">768</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861091">BBa_K861091</a></td><td>Generator</td><td>YhjH gene with a RBS and a Terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">892</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861100">BBa_K861100</a></td><td>Coding</td><td>BcsA,cellulose synthetase, catalytic subunit</td><td width="100px">Xian Xia</td><td align="right">2619</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861101">BBa_K861101</a></td><td>Generator</td><td>BcsA with RBS and terminator</td><td width="100px">Xian Xia</td><td align="right">2743</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861102">BBa_K861102</a></td><td>Generator</td><td> BcsA controlled by promoter repressed by CRP</td><td width="100px">Xian Xia</td><td align="right">2787</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861110">BBa_K861110</a></td><td>Coding</td><td>BcsB,regulator of cellulose synthetase</td><td width="100px">Xian Xia</td><td align="right">2340</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861111">BBa_K861111</a></td><td>Generator</td><td>BcsB with RBS and terminator</td><td width="100px">Xian Xia</td><td align="right">2464</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861112">BBa_K861112</a></td><td>Generator</td><td>BcsB controlled by promoter repressed by CRP</td><td width="100px">Xian Xia</td><td align="right">2508</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861120">BBa_K861120</a></td><td>Coding</td><td>BcsZ, endo-1,4-D-glucanase</td><td width="100px">Xian Xia</td><td align="right">1107</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861121">BBa_K861121</a></td><td>Generator</td><td>BcsZ with RBS and terminator</td><td width="100px">Xian Xia</td><td align="right">1231</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861122">BBa_K861122</a></td><td>Generator</td><td>BcsZ generator repressed by CRP (directly)</td><td width="100px">Xian Xia</td><td align="right">1275</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861130">BBa_K861130</a></td><td>Coding</td><td>BcsC,cellulose synthetase subunit</td><td width="100px">Xian Xia</td><td align="right">3474</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861131">BBa_K861131</a></td><td>Generator</td><td>BcsC with RBS and terminator</td><td width="100px">Xian Xia</td><td align="right">3598</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861132">BBa_K861132</a></td><td>Generator</td><td>BcsC controlled by promoter repressed by CRP</td><td width="100px">Xian Xia</td><td align="right">3642</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861140">BBa_K861140</a></td><td>Coding</td><td> GalU,glucose-1-phosphate uridylyltransferase</td><td width="100px">Chang Liu</td><td align="right">909</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861141">BBa_K861141</a></td><td>Generator</td><td>GalU with a RBS and a terminator</td><td width="100px">Xian Xia</td><td align="right">1033</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861142">BBa_K861142</a></td><td>Generator</td><td>GalU generator repressed by CRP (directly)</td><td width="100px">Xian Xia</td><td align="right">1077</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861150">BBa_K861150</a></td><td>Coding</td><td>GalF, putative regulatory subunit for GalU </td><td width="100px">Xian Xia</td><td align="right">894</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861151">BBa_K861151</a></td><td>Generator</td><td>GalF with a RBS and a terminator</td><td width="100px">Xian Xia</td><td align="right">1018</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861152">BBa_K861152</a></td><td>Generator</td><td>GalF generator repressed by CRP (directly)</td><td width="100px">Xian Xia</td><td align="right">1062</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861160">BBa_K861160</a></td><td>Coding</td><td>CRP, cAMP receptor protein</td><td width="100px">Kuanwei Sheng</td><td align="right">633</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861161">BBa_K861161</a></td><td>Generator</td><td>CRP with a RBS and a terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">757</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861162">BBa_K861162</a></td><td>Generator</td><td>Constitutively expresses Crp</td><td width="100px">Xian Xia, Kuanwei Sheng</td><td align="right">800</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861163">BBa_K861163</a></td><td>Generator</td><td>Constitutively expresses Crp</td><td width="100px">Xian Xia</td><td align="right">800</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861169">BBa_K861169</a></td><td>Regulatory</td><td>Indirect regulatory device, activated at high glucose concentration</td><td width="100px">Kuanwei Sheng</td><td align="right">1961</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861170">BBa_K861170</a></td><td>Regulatory</td><td>PI ,Glucose-activated promoter</td><td width="100px">Kuanwei Sheng</td><td align="right">36</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861172">BBa_K861172</a></td><td>Generator</td><td> lambda cI generator controlled by PcstA (glucose-repressible promoter)</td><td width="100px">Xian Xia</td><td align="right">1069</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861173">BBa_K861173</a></td><td>Reporter</td><td>mRFP generator controlled by PcstA (glucose-repressible promoter)</td><td width="100px">Kuanwei Sheng, Xian Xia</td><td align="right">1000</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861174">BBa_K861174</a></td><td>Regulatory</td><td>A control device for BBa_K861169</td><td width="100px">Xian Xia</td><td align="right">1899</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861175">BBa_K861175</a></td><td>Reporter</td><td>Efficacy testing RFP generator of BBa_K861170 (PI)</td><td width="100px">Kuanwei Shneg, Xian Xia</td><td align="right">905</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861176">BBa_K861176</a></td><td>Reporter</td><td>mRFP expressed after Pcar</td><td width="100px">Kuanwei Sheng, Xian Xia</td><td align="right">905</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861177">BBa_K861177</a></td><td>Generator</td><td>K861162+ K861175 </td><td width="100px">Kuanwei Sheng</td><td align="right">1713</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861178">BBa_K861178</a></td><td>Device</td><td>Pcar efficacy testing device with CRP overexpressed</td><td width="100px">Kuanwei Sheng, Xian Xia</td><td align="right">1713</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861179">BBa_K861179</a></td><td>Generator</td><td>K861162+J23119</td><td width="100px">Chang Liu</td><td align="right">843</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861345">BBa_K861345</a></td><td>Generator</td><td>IPTG induced S-fadE</td><td width="100px">Kuanwei Sheng</td><td align="right">2779</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861346">BBa_K861346</a></td><td>Intermediate</td><td>IPTG induced promoter with FadA, intermediate part for BBa_K861036</td><td width="100px">Kuanwei Sheng</td><td align="right">1248</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861347">BBa_K861347</a></td><td>Intermediate</td><td>IPTG induced promoter with FadI, intermediate part for BBa_K861037</td><td width="100px">Kuanwei Sheng</td><td align="right">1395</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861348">BBa_K861348</a></td><td>Intermediate</td><td>IPTG induced promoter with S-FadA, intermediate part for BBa_K861038</td><td width="100px">Kuanwei Sheng</td><td align="right">1351</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861349">BBa_K861349</a></td><td>Intermediate</td><td>PfadR with FadA, intermediate part for BBa_K861046</td><td width="100px">Kuanwei Sheng</td><td align="right">1269</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861350">BBa_K861350</a></td><td>Composite</td><td>PfadR with FadI, intermediate part for BBa_K861047</td><td width="100px">Kuanwei Sheng</td><td align="right">1416</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861351">BBa_K861351</a></td><td>Composite</td><td>PfadR with S-FadA, intermediate part for BBa_K861048</td><td width="100px">Kuanwei Sheng</td><td align="right">1372</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861400">BBa_K861400</a></td><td>Coding</td><td>Gene coding protein FadA for fatty acid degradation</td><td width="100px">Kuanwei Sheng</td><td align="right">1164</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861500">BBa_K861500</a></td><td>Coding</td><td>FadL, Long-chain fatty acids transporter from <i>E.coli str. K12</i></td><td width="100px">Kuanwei Sheng</td><td align="right">1341</td><br />
</tr><br />
</tbody><br />
</table><br />
</div><br />
<div class="passage divcell1"><br />
<a name="Brief Answers to Safety Questions"><h3>Brief Answers to Safety Questions</h3></a><br />
<p align="justify"> Welcome to our Safety Page. We will first answer the safety questions asked by iGEM headquarters briefly, and then discuss safety issues associated with our project in detail. In addition, we will provide our ideas and practice on guaranteeing and developing biosafety.<br />
</p><br />
<p align="justify"><br />
<strong>Q1. Would any of your project ideas raise safety issues in terms of: Researcher safety, public safety, or environmental safety?</strong></br><br />
No. Our design is based on the commonly used nonpathogenic <i>E. coli K.12</i> strain and genes we manipulated are original genes in <i>E. coli</i>. The protein products, at least from current understanding, will cause no harm to researchers, the public and environment. In addition, strict lab practice is executed to further ensure safety.<br />
</p><br />
<p align="justify"><br />
<strong>Q2. Do any of the new BioBrick parts (or devices) that you made this year raise any safety issues? If yes,</br> <br />
Did you document these issues in the Registry?</br><br />
How did you manage to handle the safety issue?</br><br />
How could other teams learn from your experience?</strong></br><br />
Yes, we will discuss this question in latter part of this page (Safety Considerations of Our Biobrick parts and Our Project).<br />
</p><br />
<p align="justify"><br />
<strong>Q3. Is there a local biosafety group, committee, or review board at your institution?</br> <br />
If yes, what does your local biosafety group think about your project?</br><br />
If no, which specific biosafety rules or guidelines do you have to consider in your country?</strong></br><br />
Yes. All materials obtained have received the approvals from the department's laboratory management committees. We are also obliged to observe the regulations of Teaching Centre of Experimental Biology and apply for approval for materials before we start our project.<br />
</p><br />
<p align="justify"><br />
<strong>Q4. Do you have any other ideas how to deal with safety issues that could be useful for future iGEM competitions? How could parts, devices and systems be made even safer through biosafety engineering?</strong></br><br />
Some classified measures should be taken according to the safety of the material. For example, plasmids that may harm the safety, when submitted, should receive more attention and have a stricter package. Some harmful byproducts during experiments should be eliminated properly.</br><br />
We have done our human practice aiming at understanding attitude of the public towards genetically modified baceria and publicizing biosafety ideas to the public, which we think should be popularized to other teams in future iGEM competitions.<br />
</p><br />
<a name="General Safety Issues"><h3>General Safety Issues</h3></a><br />
<p align="justify"><br />
In this part, we will illustrate organisms, reagents and equipments we use that may cause safety problems, and introduce our operation standard, management and trains protecting the team members, public and environment.<br />
<br /><br />
<img src="https://static.igem.org/mediawiki/2012/0/05/Safety_Table_1.jpg" width="500" height="500" hspace="2" vspace="1" border="2" align="top" /><br />
As above, all the organisms and DNA hosts are not of high individual or community risk. Until now, the only used organism is <i>E. coli K.12</i> (and some of its varieties, for example, DH5&alpha;, a RecA mutated strain). Our current lab of basic-biosafety level 1 is safe enough to manipulate this strain. Only the genome (a generous present from University of Dundee iGEM team), but not the living Salmonella enterica was manipulated in the lab, and the genes from it are homogeneous of <i>E. coli K.12</i>, not associated with pathogenesis. We will not implement our future experimental plan with microorganisms of risk group 2 or vertebrates in our current lab, for too low is the biosafety level and no animal facilities.<br />
<br /><br />
To manipulate microorganisms, an ultra clean cabinet is used and strict aseptic technique is followed. All experimenters have been trained on foundation microbiology technique and biosafety. All microorganism contacting vessels are sterilized before and after experiments in appropriate protocols. Also, all microorganism materials will be sterilized before discarded. In this way, we believe that no public or environmental harm will be caused by the experimental organisms. In addition, no one in our team will be hurt by the experimental organisms.<br />
<br /><br />
The genetic modifications we make will change metabolism of bacteria. However, there is no evidence both theoretically and experimentally that these modifications will improve the pathogenicity of the bacteria or cause damage to environment even taking the risk of horizontal gene transfer into consideration. The effects of expressing gene <i>adrA</i> regarding infectivity and pathogenicity on <i>E. coli</i> is not clear now, but it still can be easily controlled in the lab environment without human ingestion. Also, we will insert a death device into the bacteria cell when we construct the whole system (still far from now) to avoid the proliferation out of control. For more information about gene safety, please read the next section and documents of our relevant parts on registry.<br />
</p><br />
<p align="justify"><br />
We have considered the potential harmful chemicals and equipments, as listed below:<br />
<ul><br />
<li></p><br />
<p align="justify"> Basic molecular experiments: NaOH, HCl, SDS, acrylamide, TEMED, ethanol, IPTG, liquid nitrogen, &beta;-mercaptoethanol, xylene cyanol FF.<br />
</li><br />
<li></p><br />
<p align="justify"> Bacteria culture: ampicillin, kanamycin, chloramphenicol.<br />
</li></p><br />
<p align="justify"> Chemical analysis and measurements: acetone, cupric acetate, Sudan III, Congo red, Coomassie Brilliant Blue G-250, Coomassie Brilliant Blue R-250.<br />
<li></p><br />
<p align="justify"> Equipments: UV lamp, supercentrifuge, heating equipments (alcohol burner, PCR amplifier, water bath, dry bath), electrophoresis apparatus, -80℃ refrigerator, ultrasonic cell disruptor.<br />
</li><br />
</ul><br />
</br></p><br />
<p align="justify"> All of these are regular reagents and apparatus in a molecular biology laboratory. The risks of them come from inflammability, explosibility, irritation, corrosivity, toxicity, carcinogenicity and physical injury. But none of them raises special safety issue, with chemical hood, emergency shower, normal personal protection, safety management and safety training.</br><br />
Only trace amount of antibiotics are used. Inactivated will they be before discared.<br />
</p><br />
<p ><br />
<img src="https://static.igem.org/mediawiki/2012/0/07/Safety_Figure_3.jpg" alt="Emergency Shower" width="500" height="750" hspace="2" vspace="1" border="2" align="top" /><strong>Emergency Shower</strong></img><br />
</p><br />
<a name="Safety Considerations of Our Biobrick parts and Our Project"><h3>Safety Considerations of Our Biobrick parts and Our Project</h3></a><br />
<p><br />
In this section, we are going to answer safety question 2 in detail, taking the potential risk in the future into concern.<br />
<br /><br />
The main safety challenge we must face is that as a practical bacteria therapy our direction is, we shall demonstrate that the “<i>E. coslim</i>” will not harm its host when it is developed completely. As few experiments we can do in such limited time, we have done a series of theoretical work to solve problems in this field.<br />
Intestine-colonized pathogenic <i>E. coli</i> may cause immune responses, following by diarrhea, inflammation and fever (although the strain we use is considered non-pathogen). Thus we plan to transplant the whole synthetic system to another organism (for example, <i>Bacillus subtilis</i>, has proved safe in human intestine). We know that it is hard as the two organisms are very different on transcriptional mechanisms, but we believe the work of establishing model system (that is what we are doing) in <i>E. coli</i> will make it easier. Also, as the rapid development of synthetic biology and gut microbiology, we hope in the near future, we can modify the genome of <i>E. coli</i> to change it a safe intestine microbe.<br />
<br /><br />
Another risk is that when the engineered bacteria get higher efficiency on energy production, they could proliferate out of control. To forestall this situation, we design a “death” device (for more information, click on <a href="https://2012.igem.org/Team:WHU-China/Death">Death</a>) using D-xylose as inducer. It means if you want to stop weight losing, what you have to do is to eat some D-xylose, and the “<i>E. coslim</i>” will die, shed from the intestinal wall and be poured out. What is more, designed as a two-plasmid system, it prevents all possible horizontal gene transfers.<br />
<br /><br />
Further safety issues will be raised and discussed in future experiments, including those operates in intestinal model and animals (For more information, click on Future Perspectives).<br />
</p><br />
<a name="Safety Management and Practice"><h3>Safety Management and Practice</h3></a><br />
<p align="justify"><br />
Our project has past a review of an expert committee, of which members are professors or associate professors of microbiology, genetics and bioengineering. Safety issues are considered seriously before they approved our design. <br />
We have consulted a few experts for safety questions about both artificial intestinal bacteria and experiments. Their advices help us improve the safety of the whole planning system. For that, we thank Dr. Yulan Wang and Dr. Tiangang Liu so much.<br />
Our lab is supervised by Teaching Centre of Experimental Biology, Wuhan University (TCEB, whose leader is our instructor <a href="https://2012.igem.org/Team:WHU-China/Team#Zhixiong Xie">Dr. Zhixiong Xie</a>). An expert group of this centre formulates safety guidelines and guarantees their performance in all teaching labs. All experiments we do past its review.<br />
Our safety management system includes the followings:<br />
Management of Chemicals, Equipments and Experimenters: Chemicals and equipments are registered in TCEB before they are available for us. Equipments are checked and maintained regular. And an entrance guard system is used to ensure only the admitted could enter the lab.<br />
<ul><br />
<li><br />
Responsibility distribution: All members worked in the lab are divided to three groups. The group leaders arrange schedules of experiments after assessing safety issues in the group (for example, the safety train of the experimental executer). Every member records his/her experiments in detail in the notebook of the group. Each group takes responses for cleaning and checking risks in the lab in turns. The group leader takes responses to the team leader. The team leader reports regular on safety to engineer Miss Long Yan, who is authorized by TCEB and manages the lab.<br />
</li><br />
<li><br />
Management of Chemicals, Equipments and Experimenters: Chemicals and equipments are registered in TCEB before they are available for us. Equipments are checked and maintained regular. And an entrance guard system is used to ensure only the admitted could enter the lab.<br />
</li><br />
<li><br />
Training: Our team members have been trained after Guidance of Student Experiments formulated by TCEB. <br />
</li><br />
</ul><br />
</p><br />
<p><br />
<img src="https://static.igem.org/mediawiki/2012/f/fe/Safety_Figure_4.png" alt="Guidence of Student Experiments" height="500" width="500" hspace="2" vspace="1" border="2" align="top" /><strong>Guidence of Student Experiments</strong></img><br />
</p><br />
<a name="Biosafety and Publicity"><h3>Biosafety and Publicity</h3></a><br />
<p align="justify"><br />
We believe that biosafety is not an issue which should be only considered inside biological lab, but also around people and communities. Spreading knowledge of biosafety to the public will help eliminate misunderstanding and prejudice, from which the science and all the people will benefit. We hope that sharing this idea with all iGEM teams can be useful to take advantage on biosafety.<br />
<br /><br />
To investigate public attitude towards our project and to publicize our biosafety ideas are what we do for our human practice. As “eating bacteria” is somehow an unacceptable concept now, we would like to find whether people know the truth about biosafety issues raised by bioengineered bacteria, or they are just panicked by their imaginary “bacteria”. And then, after initiating basic knowledge of microbiology, gene engineering and synthetic biology, we shall take a look on if people’s opinion to biosafety issues will change. In this way, we will estimate the value of our scientific publicity.<br />
<br /><br />
The rational discussions of biosafety we take with the public do not limited on our project, but also hotspot issues such as transgenics and stem cell therapies. For more information, please click on <a href="https://2012.igem.org/Team:WHU-China/Human_Practice">Human Practice</a>.<br />
</p><br />
<p><br />
<img src="https://static.igem.org/mediawiki/2012/a/a4/Safety_Figure_5.jpg" alt="Introducing a Simplified Intestinal Model" width="500" height="333" hspace="2" vspace="1" border="2" align="center" /><strong>Introducing a Simplified Intestinal Model</strong></img><br />
</p><br />
</div><br />
<div class="passage divcell2"><br />
<a name="Protocol for fluorescence measurement"><h4>Protocol for fluorescence measurement</h4></a><br />
<p align="justify">Minimal Medium</p><br />
<p align="justify">M9: </p><br />
<p align="justify"> For 1L Medium add</p><br />
<p align="justify">Na<sub>2</sub>HPO<sub>4</sub>·12H<sub>2</sub>O 15g </p><br />
<p align="justify">KH<sub>2</sub>PO<sub>4</sub> 3g</p> <br />
<p align="justify">NaCl 1g </p><br />
<p align="justify">NH<sub>4</sub>Cl 0.5g</p><br />
<p align="justify">After autoclaving, add: </p><br />
<p align="justify">MgSO<sub>4</sub>(1mol/L) 2mL</p><br />
<p align="justify">Bacteria strain:CaCl<sub>2</sub> 100μL </p><br />
<p align="justify">Triton X-100 (as emulsifier) 2uL</p><br />
<p align="justify"><br> </p><br />
<p align="justify"><strong>Note</strong></p><br />
<p align="justify">1.For M9 medium using oleic acid as sole carbon source, various amount of oleic acid was first emulsified 1:1 with 10% Triton X-100. M9 medium was then slowly added with constant vortex. M9 medium with high concentration of oleic acid was diluted by M9 medium with triton to form various concentrations;</p><br />
<p align="justify">2. For M9 medium using glucose as sole carbon source, M9 medium with high concentration of glucose was diluted by M9 medium to form various concentrations.</p> <br />
<p align="justify"><strong>Step</strong></p><br />
<p align="justify">1. Seed liquor which was activated over night was inoculated into M9 medium which contains different concentration of oleic acid. And it was then incubated at 37℃ for 24 hours;</p><br />
<p align="justify">2. After 24h of incubation in 24 well plates in 37℃, bacteria culture was centrifuged at 3000rmp for 5min, washed and resuspended in PBS;</p><br />
<p align="justify">3. We detected the OD600 and fluorescence of using SpectraMax M2 plate reader (Molecular Devices) .Excitation at 584 nm and emission at 607 nm were used. All fluorescence was normalized with cell density by measuring the absorbance at 600 nm.</p><br />
<br />
<a name="Protocols of Cupric-Soap Reaction"><h3>Protocols of Cupric-Soap Reaction</h3></a><br />
<p align="justify">To test metabolism of long fatty acids, we used oleic acid as sole carbon source in mediums, and used cupric-soap reaction to determinate oleic acid concentration preliminarily. </p><br />
<p align="justify">Modified M9 minimal medium with emulsified oleic acid as sole carbon</p><br />
<p align="justify"> Minimal medium was the same with that in Materials and methods for PfadR </p><br />
<p align="justify">What's Important:</p><br />
<p align="justify">Slowly pour M9 minimal medium into mixture of oleic acid and Triton X-100 to get more homogeneous solution.</p><br />
<p align="justify">Analysis the concentration of the oleic acid in the medium by cupric-acetate method</p><br />
<p align="justify"><strong>Step</strong></p> <br />
<p align="justify">1.Collect 5 ml medium which has been used to cultivate bacteria. Then centrifuge the medium at 3000rpm for 10 min to separate bacteria and medium;</p><br />
<p align="justify"> 2.Decant 3ml supernatant liquid into a 10ml EP. Add 3ml acetone to the liquid, 1ml at a time, shaking 10-20 times before adding another 1 ml in order to avoid the effect of the ions of the liquid during the extraction progress;</p><br />
<p align="justify"> 3.Add 3 ml isooctane once ,shaking for at least 90s, stand for 2min or longer until layering completely;</p><br />
<p align="justify"p>4.Collect 3 ml clear isooctane in a 5 ml EP, Add 800?l cupric-acetate (5% m/v, adjust pH to 6.8 with pyridine), Shaking for 90 seconds, stand for 2min or longer until layering completely;</p><br />
<p align="justify">5.Detect OD of organic phase in a spectrometry at 715nm.</p><br />
<p align="justify"><strong>The Standard Curve</strong></p><br />
<p align="justify">We add 1.6ml, 3.2ml, 4.8ml, 6.4ml, 9.6ml, 11.2ml oleic acid into 3ml M9 medium to generate a gradient. The absorbency is measured as described in the protocol.</p><br />
<p align="justify"><img src="https://static.igem.org/mediawiki/igem.org/5/56/Wps_clip_image-5855.png"alt="Guidence of Student Experiments" height="500" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<p align="justify">We slightly modified the methods provided by Kwon and Rhee, 1986, adding the extraction step, for it is dispensable when bacteria are in the medium. However, the standard curve is still very close to the paper’s, which proves that plausible and accurate</p><br />
<br />
<br />
<br />
<a name="Krebs-Ringer Phosphate(KRPD Buffer Solution)"><h3>Krebs-Ringer Phosphate(KRPD Buffer Solution)</h3></a><br />
<br />
<p align="justify"><strong>Solutions</strong></p><br />
<p align="justify"> Solution A:</p><br />
<p align="justify">For 100 mL: </p><br />
<p align="justify">NaCl 7.5985g ; KCl 0.3727g ; CaCl<sub>2</sub> 0.1054g; glucose-H<sub>2</sub>O 0.9495g, </p><br />
<p align="justify"> Solution A:</p><br />
<p align="justify">For 100 mL: </p><br />
<p align="justify"> NaH<sub>2</sub>PO<sub>4</sub>·2H<sub>2</sub>O 0 .2964g ;Na<sub>2</sub>HPO<sub>4</sub>·12H<sub>2</sub>O 2.9011g,</p><br />
<p align="justify">After dissolving, add MgSO<sub>4</sub>·7H<sub>2</sub>O 0.3130g</p><br />
<p align="justify">Mix A solution and B solution, add 790ml dd H<sub>2</sub>O, then regulate pH to 7.2~7.4 using 1M NaOH/1M HCl, finally add dd H<sub>2</sub>O to a final total volume of 1L. </p><br />
<p align="justify"><strong>Procedures</strong></p><br />
<p align="justify">1. cultivate cells in 1 liter of medium to late exponential phase;</p><br />
<p align="justify">2. harvest by centrifugation at 35℃;</p><br />
<p align="justify">3. wash twice with 2 liters of warm(35℃)0.05M potassium phosphate buffer (pH 7.4) containing 1%(v/v) Triton X-100;</p><br />
<p align="justify">4. resuspend in 0.05M potassium phosphate buffer (pH 7.4) containing mercaptoethanol;</p><br />
<p align="justify">5. add sufficient volume of buffer to give a concentration of about 50mg(dry weight) of cells/ml;</p><br />
<p align="justify">6. disrupt cells with a Bransor Sonifier for 1min. The treatment was applied for 15s intervals, under 4 ℃;</p><br />
<p align="justify"> 7. centrifuge at10,000×g for 30min; </p><br />
<p align="justify">8. decant supernatant liquid for enzymatic assay, the protein concentration was determined by the biuret method;</p><br />
<p align="justify">9.analyze fatty acid oxidation in cell-free extracts</p><br />
<p align="justify">Note: little oxidation was observed when less than 1mg.</p><br />
<p align="justify"><strong>Reaction Mixture</strong></p><br />
<p align="justify">1.0ml of freshly oxygenated Krebs-Ringer phosphate(pH 7.4)</p><br />
<p align="justify">Palmitate-1-14C, 20nmole (80,000 counts/min)</p><br />
<p align="justify">CoA, 1 μ mole</p><br />
<p align="justify">NAD, 1μ mole</p><br />
<p align="justify">ATP, 1μ mole</p><br />
<p align="justify">Succinate, 10 n moles</p><br />
<p align="justify">Supernatant protein, 1~5 mg</p><br />
<p align="justify">dd H<sub>2</sub>O to a final total volume of 2.0ml </p><br />
<br />
<br />
<br />
<br />
<a name="Cellulose Detection"><h3>Cellulose Detection</h3></a><br />
<br />
<p align="justify">1. Inoculate the bacteria into liquid LB medium and then incubate it for 24 hours at 37℃;</p><br />
<p align="justify">2. After centrifugation, supernatant is preserved for use, while deposits are resuspended with PBS and adjust to OD600 1.0;</p><br />
<p align="justify">3. Exceed cellulase was used to digest cellulose in supernatant and deposits. After the cellulase is added, 1mL solution was sampled every 3 min and cellulose of the sample was inactivated immediately;</p><br />
<p align="justify">4. Ten minutes later, the reduce sugar is detected in all the samples with or without cellulose;</p><br />
<br />
<br />
<p align="justify">5. 2mL DNS solution is mixed with the sample, and incubated in boiling water for two minutes, then it is cooled rapidly;</p><br />
<p align="justify">6. After 9 mL ddH<sub>2</sub>O being added into the solution, record absorbance at 540nm;</p><br />
<p align="justify">7.The Standard Curve of glucose concentration</p><br />
<p align="justify"><img src="https://static.igem.org/mediawiki/2012/c/cb/Biao.png" height="148" width="520" hspace="2" vspace="1" border="2" align="top" /></p><br />
<p align="justify"><img src="https://static.igem.org/mediawiki/2012/9/9c/Standard_curve.png" height="680" width="520" hspace="2" vspace="1" border="2" align="top" /></p><br />
<p align="justify">Then all tubes was treated in the same way with that in step 5 and 6.</p><br />
<p align="justify">8.Calculate the amount of cellulose in cell culture.</p><br />
<br />
<a name="In vitro Experiment"><h3>In vitro Experiment</h3></a><br />
<br />
<p align="justify">1. inoculate 100μl bacteria into 100ml LB , shaking at 37C overnight .</P><br />
<p align="justify">2. inoculate 1L LB using the culture above at the next morning , on the scale of 1:20 .</p><br />
<p align="justify">3. Separate above medium into 250ml flask , shaking at 37C for 3-4h .</p><br />
<p align="justify">4. 8000 rpm , 6min to collect the bacteria .</p><br />
<p align="justify">5. Using PBS to resuspend the bacteria to 50mg / ml .</p><br />
<p align="justify">6. Ultrasonication 1min , every 15s having an interval to cool on the ice .</p><br />
<p align="justify">7. Using Coomassie blue staining to measure the concentration of the total protein .</p><br />
<p align="justify">8. In 2ml reaction system , add 5ul oleate ,40 ul Triton 10% , 1ml Krebs-Ringer phosphate buffer , 10nmol succinate , 1 umol COA , 1umol ATP , 1 umol NAD . </p><br />
<p align="justify">9. react at 37C for 6h</p><br />
<br />
<p align="justify">In this experiment , the concentration of total protein in the cell extracts of the five sample are almost the same , so we assume that adding the same volume guarantee the same amount of protein is added . </p><br />
<br />
<p align="justify">The reaction system for the control BBa_R0011+(R0011), BBa_R0011+fadE , BBa_R0011 + fadD , BBa_R0011 + Samonella A Samonella B , BBa_R0011 + fadI fadJ : 1ml Krebs-Ringer phosphate buffer , 10nmol succinate , 1 umol COA , 1umol ATP , 1 umol NAD , 1ml cell extract .</p><br />
<br />
<p align="justify">The reaction system for BBa_R0011+fadD and BBa_R0011+fadE mixture : 2ml Krebs-Ringer phosphate buffer , 20 nmol succinate , 2 umol COA , 2 umol ATP , 2 umol NAD , 1ml cell extract for each gene.</p><br />
<br />
<p align="justify">The reaction system for BBa_R0011+fadD , BBa_R0011+fadE , and BBa_R0011 + Samonella fadA Samonella fadB mixture :<br />
3ml Krebs-Ringer phosphate buffer , 30nmol succinate , 3umol COA , 3umol ATP , 3 umol NAD , 1ml cell extract for each gene.</p><br />
<br />
<p align="justify">The reaction system for BBa_R0011+fadD , BBa_R0011+fadE , BBa_R0011+Samonella A Samonella B , and BBa_R0011+fad I fad J mixture :4ml Krebs-Ringer phosphate buffer , 40nmol succinate , 4umol COA , 4umol ATP , 4 umol NAD , 1ml cell extract for each gene </p><br />
<br />
<br />
<a name="Plate Assay"><h3>Plate Assay</h3></a><br />
<p align="justify">1. J12107- AdrA and control RBS was incubate and vortex in LB medium with Ampicillin overnight</p> <p align="justify">2. OD600 was measured; LB was then added to make the two test tubes had the same OD600</p> <p align="justify">3. Bacteria were inoculated by sterilized needle piercing a pre-labeled 0.3% agar LB semisolid plate for 4-5 minutes in super clean bench.</p> <p align="justify"> 4. Carefully placed the plate horizontally in a 37 degree incubator overnight. Avoid shaking of the plate.</p> <p align="justify">5. Clones on the plate were observed. </p> <br />
<br />
<br />
<a name="Materials and Methods of SDS-PAGE"><h3>Materials and Methods of SDS-PAGE</h3></a><br />
<br />
<p align="justify"><img src="https://static.igem.org/mediawiki/2012/a/ab/BIAO_2.png"alt="Guidence of Student Experiments" height="160" width="520" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<br />
<p align="justify">Coomassie Blue Stain</p><br />
<p align="justify">-Coomassie brilliant blue G-250 50mg</p><br />
<p align="justify">-95% ethanol 25ml</p><br />
<p align="justify">-85%H<sub>3</sub>PO<sub>4</sub> 50ml</p><br />
<p align="justify">-H<sub>2</sub>O, adjust to 500ml</p><br />
<p align="justify">-filter</p><br />
<br />
<p align="justify">Destain solution </p><br />
<p align="justify">-methanol 250ml</p><br />
<p align="justify">-acetic acid 50ml</p><br />
<p align="justify">-H<sub>2</sub>O adjust to 500ml</p><br />
<br />
<p align="justify">2x SDS loading buffer</p><br />
<p align="justify">-0.5mol/l Tirs-HCl(PH6.8) 25ml</p><br />
<p align="justify">-10%SDS 8ml</p><br />
<p align="justify">-50%glycerol 20ml</p><br />
<p align="justify">-2-mercaptoethanol 2ml</p><br />
<p align="justify">-1%Bromphenol Blue 4ml</p><br />
<p align="justify">-H<sub>2</sub>O adjust to 100ml</p><br />
<br />
<p align="justify">10xSDS-PAGE running buffer </p><br />
<p align="justify">Tris base, 30.3 g </p><br />
<p align="justify">M glycine 144.1g</p><br />
<p align="justify">SDS 10 g</p><br />
<p align="justify">-H<sub>2</sub>O adjust to 1L</p><br />
<p align="justify">Steps</p><br />
<br />
<p align="justify">Protein expression</p><br />
<p align="justify">1.inoculate the liquid strains into LB medium supplement with 50μg/mL ampicillin, incubate the medium at at 37℃ until OD600 reaches 0.6;</p><br />
<p align="justify">2. Separate the culture into two test tubes. Add IPTG into one of two tubes at a final concentration of 1mM to induce the expression of </p><br />
<p align="justify">3. 1 mL of the culture is sampled every hour. After centrifugation, deposits was suspended with 300 μL PBS and 200 μL 2x SDS loading buffer, then incubated in boiling water for 15 min.</p><br />
<p align="justify">4. 10μl of samples was load in lanes, run the SDS-PAGE</p><br />
<p align="justify">5. Stained the SDS-PAGE 5 hours</p><br />
<p align="justify">6. Destain the SDS-PAGE until you can see the protein band.</p><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<div class="passage divcell3"><br />
<h3>team history</h3><br />
<p><strong>Dec. 2011</strong></p><br />
<p align="justify">WHU iGEM team was established</p><br />
<p><strong>Dec. 2011 to Feb. 2012</strong></p><br />
<p align="justify">Every one presented their own idea, then we discussed the feasibility of these ideas.</p><br />
<p><strong>Feb. 2012 </strong></p><br />
<p align="justify">The final project was determined, named E.coslim</p><br />
<p><strong>Mar. 2012</strong></p><br />
<p align="justify">We finished an outstanding presentation. Our reply was approved by the leaders of college of life sciences, Wuhan University.</p><br />
<p><strong>Apr. 2012 </strong></p><br />
<p align="justify">Our iGEM team was divided into 3 groups—group of Sheng, group of Xia and group of Mei. </p><br />
<p><strong>Apr. 2012 to prsent</strong></p><br />
<p align="justify">Experiments started….</p><br />
<p><strong>Apr. 2012</strong></p><br />
<p align="justify">Group of Sheng: FADR was connected to pSB1A2 plasmid carrier</p><br />
<p align="justify"> FADR was connected to RFP gene</p><br />
<p align="justify">Group of Xia: starting to connect genes of CI control system </p><br />
<p align="justify"> Testing the function of CI control system</p><br />
<p align="justify">Group of Mei: YhjH/ FadE/ FadD/ FadL gene was connected to pSB1A2 plasmid carrier</p><br />
<br />
<p><strong>May. 2012 </strong></p><br />
<p align="justify">Group of Sheng: FadB/ FadJ gene was connected to pSB1A2 plasmid carrier, then BBa_B0030(RBS) as well</p><br />
<p align="justify">Group of Xia: They devised two promoters p110 and p101, which were expected to be controlled by glucose. However, they failed.</p><br />
<p align="justify">Group of Mei: YhjH/ FadE/ FadD/ FadL gene was connected to BBa_B0030(RBS)</p><br />
<br />
<p><strong>June 2012 </strong></p><br />
<p align="justify">G of S: FadR was connected to low-copied plasmid carrier.</p><br />
<p align="justify"> sFadB and sFadA genes were connected to BBa_B0030 (RBS)</p><br />
<p align="justify"> sFadE gene was connected to pSB1A2 plasmid carrier</p><br />
<p align="justify"> G of X: the connection of genes, which were relative with cellulose, was finished.</p><br />
<p align="justify"> Another two promoter were devised, p1 and p2</p><br />
<p align="justify">G of M: YhjH/ FadE/ FadD/ FadL gene was connected to BBa_B0024 (terminator)</p><br />
<br />
<p><strong>July 2012 </strong></p><br />
<p align="justify">G of S: FadJ was connected to BBa_B0024 (terminator), sFadE gene was copied by PCR technology</p><br />
<p align="justify"> On the front half of this month, they conducted several pre-experiments of oleic acid test</p><br />
<p align="justify"> On the next half month, they started normal experiments of oleic acid test</p><br />
<p align="justify">G of X: started to test the function of p1 and p2</p><br />
<p align="justify">G of M: YhjH/ FadE gene was connected to BBa_J23100 (promoter)</p><br />
<p align="justify"> Finish the standard curve of oleic acid test</p><br />
<br />
<p><strong>Aug. 2012 </strong></p><br />
<p align="justify">G of S: sFadE was induced to point mutation, then it was connected to BBa_B0030 (RBS) and BBa_B0024 (terminator) respectively</p><br />
<p align="justify"> sFadB was connected to BBa_B0030 (RBS) and BBa_B0024 (terminator) respectively.</p><br />
<p align="justify">G of X: test the function of cellulose-controlled genes, having got satisfying results</p><br />
<p align="justify">G of M: copied Adra gene and finished the connection of BBa_B0030 (RBS), BBa_B0024 (terminator) and BBa_J23107 (promoter), BBa_J23114 (promoter) respectively. FadE/YhjH/FadD/fadL were connected to BBa_J23107 (promoter), BBa_J23114 (promoter). </p><br />
<br />
<p><strong>Sep 2012</strong></p><br />
<p align="justify">G of S: Transferred all the parts in pSB1A2 into pSB1C3, Tested the function of PfadR, Characterized the effect of each gene on fatty acid consumption, started to set up the platform for in vitro experiments.</p><br />
<p align="justify">G of X: Transferred all the parts in pSB1A2 into pSB1C3, tested the function of cellulose system. Repeat the test of the function of cellulose-controlled genes.</p><br />
<p align="justify">G of M: Transferred all the parts in pSB1A2 into pSB1C3, test the function of Adra/YhjH.</p></p><br />
<br />
<br />
<br />
</div><br />
<div class="passage divcell4"><br />
<h3>Brainstorming</h3><br />
<br />
<h4>About E.coslim by Kuanwei Sheng</h4><br />
<p align="justify">In order to help people lose weight, besides our three devices, we also have come up with many other creative ways. </p><br />
<br />
<br />
<p align="justify"><strong>Ⅰ.Short chain peptides synthesis</strong></p><br />
<p align="justify">Recent researches have indicated that some short chain peptides in intestine have effect on inhibiting appetites, therefore decrease the food intake. We thus formed the idea that we could synthesis a DNA chain that encodes those short peptides.</p><br />
<br />
<p align="justify"><strong>Ⅱ.Biosynthesis of L-carnitine</strong> </p><br />
<p align="justify">L-carnitine is a molecule that facilitates the progress of transporting fatty acids into mitochondria where these fatty acids will be disintegrated. We once considered use L-carnitine to help the host metabolize fatty acid better. However, the biosynthesis of L-carnitine has too many derivatives or the pathway is patented by others.</p><br />
<br />
<p align="justify"><strong>Ⅲ.Xylose isomerase</strong></p><br />
<p align="justify">Xylose is a prebiotics that can hardly be absorbed by human. We consulted many papers and find that glucose can be converted into xylose by xylose isomerase. Therefore, we thought maybe we could lower the glucose available in intestine by expressing xylose isomerase. However, this process is shown to be reversible latter. Mutated the sequence of the protein may generate high converting rate, yet it is too laborious and risky for a short time project.</p><br />
<br />
<br />
<h4>Other novel ideas</h4><br />
<br />
<p align="justify"><strong>Tackle Water bloom by Tong Wang and Kuanwei Sheng</strong></p><br />
<p align="justify">Since the detrimental effects caused by cyanobacteria to the environment such as making water carcinogenic have become a serve global problem, we therefore tried to employ E.coli as an expression system to eliminate these detrimental effects. When we first took over this project, we thought about limiting the growth of cyanobacteria. Along with the process we got to read a large amount of relevant papers about cyanobacteria, we found that not only the main detrimental effects caused by cyanobacteria is attributed to its product which is a cyclic peptide called microcystin, but also microcystin can regulate the population density. Then we came to realize the importance of microcystin and began to search information about it. Through over this process, we discovered a gene cluster which is responsible for the microcystin degradation pathway. It encodes four enzymes——MlrA、MlrB、MlrC and MlrD. Also, we found that some non-toxic cyclic peptides produced by cyanobacteria such as Anabaenopeptin B and Anabaenopeptin F can induce lysis of cyanobacteria. The latter finding can be utilized as an effective cell population density control mechanism. Thus we thought about constructing two independent systems to eliminate cyanobacteria, one about inducing lysis of cyanobacteria and the other about degrading microcystin. Finally we gave up this project because of the reasons that these gene clusters are too large to be expressed in E.coli and that E.coli cannot survive in the sea, however, we still feel proud of these fancy ideas.</p><br />
<br />
<p align="justify"><strong>Desalination of sea water by Kuanwei Sheng</strong></p><br />
<p align="justify">We came up with the thought that engineering bacteria can intake ions like Na+, cl-, Mg2+ and etc. under special stimulus. Also, under another certain stimulus, the bacteria can export those salts out of cells for reuse. Therefore, we can use these bacteria to desalinize sea water and extract the salt the same time. However, there is no such ion channel that can meet our needs.</p><br />
<br />
<p align="justify"><strong>Sense the earthquake By Min Ye</strong></p><br />
<p align="justify">We once tried to find proteins that can sense vibration and construct a pathway to report that vibration. However, we are not able to find the protein that can meet our needs.</p><br />
<br />
<p align="justify"><strong>Auto plasmid preps By Kuanwei Sheng</strong></p><br />
<p align="justify">We thought about constructing a synthetic protein that combines zinc finger protein which can recognize the specific sequence of DNA and signal peptide that can make proteins be exported out of the bacteria by secretion pathway. Therefore, it is possible that plasmid can be exported out the cells together with the zinc finger protein.</p><br />
<br />
<p align="justify"><strong>Outer Membrane Vesicle (OMV) to treat cancer By Kuanwei Sheng</strong></p><br />
<p align="justify">We thought to use Outer Membrane Vesicle (OMV) to treat cancer. Specifically, we thought about localizing antibody that can recognize certain cancer on the surface of OMVs via signal peptides. Also, we thought we may localize cell division inhibitor protein or protein that lead to cell death inside the OMVs. Therefore, we hoped that the OMV excreted by the bacteria can recognize and kill cancer cells.</p><br />
<br />
<p align="justify"><strong>Multicell Yeast By Wenxiong Zhou</strong></p><br />
<p align="justify"><img src="https://static.igem.org/mediawiki/igem.org/9/96/Wps_clip_image-23886.png " height="288" width="503" hspace="2" vspace="1" border="2" align="top"></p></br><br />
<br />
<p align="justify">Transform the yeast from a single-cell microbe to a multi-cell organism by setting bistability of gene expression among cells of yeasts adhered in amalgamation.</p><br />
<p align="justify"><strong>To kill superbacteria</strong></p><br />
<p align="justify">Now with the spread usage of the antibiotics, many bacteria adopt ability to fight against the antibiotics. And now it’s a big problem that antibiotics are no longer useful as before. So to kill these bacteria, Jing and her group thinks they can device some proteins or artificial micromachine to detect DNA that code proteins contributing to the ability to degenerate antibiotics. And then by transferring these plasmids coding artificial proteins or micromachines, they can inhibit the expression of enzymes or proteins degenerating antibiotics. </p><br />
<br />
<br />
<br />
<br />
</div><br />
<div class="passage divcell5"><br />
<a name="team"><h3><strong>team</strong></h3></a><br />
<p><img src="https://static.igem.org/mediawiki/igem.org/9/93/Finish_presentation_in_whu.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/f/f8/Photo_of_whu_china2.jpg " height="361" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/f/f8/Journey4.jpg " height="343" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/a/a1/Journey3.jpg " height="362" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/3/3b/IMG_1842.jpg " height="336" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/7/70/IMG_1837.JPG " height="392" width="518" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/a/a7/IMG_2021.jpg " height="337" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/2/2d/Photo_of_group1_%282%29.jpg " height="375" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/a/a5/Photo_of_group_2.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/0/0a/........jpg " height="351" width="518" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/a/aa/Journey2.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/7/76/IMG_1759.JPG " height="351" width="518" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/b/b6/IMG_2183.jpg " height="351" width="518" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/f/f4/Journey1.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<br />
<br />
<a name="presentation"><h3><strong>presentation</strong></h3></a><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/e/ee/Discussion11.jpg " height="375" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/d/d9/Presentation_in_whu44.jpg " height="375" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/a/aa/Discussion33.jpg " height="337" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/6/6d/Discussion66.JPG " height="374" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/a/a3/Preparation_for_presentation_in_whu33.jpg " height="353" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/7/76/Preparation_for_presentation_in_HK22.jpg " height="362" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/9/9a/Preparation_for_presentation_in_whu11.jpg " height="359" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/d/d3/Waiting_for_result_of_presentation1.jpg " height="402" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/5/56/Preparation_for_presentation_in_HK11.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<a name="human practice"><h3><strong>human practice</strong></h3></a><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/1/12/Human_practice2.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/1/1f/Human_practice3.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/a/a4/Human_practice4.jpg " height="383" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/9/97/Human_practice5.jpg " height="409" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/2/2a/Human_practice6.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/8/8b/Human_practice8.jpg " height="378" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/1/1a/Human_practice9.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/0/08/Human_practice10.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/5/56/Human_practice12.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/a/ae/Human_practice20.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/0/00/Human_practice27.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/7/7b/Human_practice28.jpg " height="381" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/2/26/Human_practice29.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/6/63/IMG_0175.JPG " height="518" width="393" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/5/5b/Poster.jpg " height="353" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/5/54/Human_practice24.jpg " height="353" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<br />
<br />
<br />
<a name="doodle"><h3><strong>doodle</strong></h3></a><br />
<p><img src="https://static.igem.org/mediawiki/2012/7/7f/Untitled.jpg " height="439" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/4/40/Funny5.jpg " height="530" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/b/be/Funny4.jpg " height="490" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/a/ad/Funny6.jpg " height="666" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/7/77/Lab1.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/9/99/Team_clothes1.jpg " height="250" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/4/4d/Team_clothes2.jpg " height="495" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/1/18/Team_clothes3.jpg " height="500" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/5/50/Team_clothes4.jpg "alt=" height="500" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/b/b4/Team_clothes5.jpg " height="250" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/d/d4/E.coslim2.JPG " height="300" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/7/7f/Funny8.jpg " height="495" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/d/d7/Funny9.jpg " height="500" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/7/71/Poster1.jpg " height="707" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/f/f9/Poster2.jpg " height="707" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/c/c2/Poster3.jpg " height="666" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/f/fc/Poster4.jpg " height="707" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/8/8c/Wiki3.jpg " height="335" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/f/f9/Wiki5.jpg" height="400" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/4/4a/Wiki6.jpg" height="435" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<br />
<br />
<br />
<br />
<a name="funny pictures"><h3><strong>funny pictures</strong></h3></a><br />
<p><img src="https://static.igem.org/mediawiki/2012/b/bc/Funny_picture1.jpg " height="356" width="400" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/1/10/Funny_picture2.jpg " height="356" width="400" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/3/3d/Funny_picture3.jpg " height="356" width="400" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/7/74/Funny_picture4.jpg " height="356" width="400" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/d/de/Funny_picture5.jpg " height="358" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/b/bd/IMG_0004.JPG " height="393" width="518" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/a/a8/IMG_0074.JPG " height="600" width="455" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/c/c1/IMG_0076.JPG " height="518" width="393" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/e/e4/IMG_0096.JPG " height="518" width="393" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/5/56/IMG_0109.JPG " height="518" width="393" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/4/4e/IMG_0117.JPG " height="600" width="450" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/6/6f/IMG_0135.JPG " height="518" width="393" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/b/be/IMG_0343.JPG " height="518" width="393" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/f/f6/IMG_0344.JPG " height="600" width="450" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/4/45/IMG_0349.JPG " height="599" width="428" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/7/75/IMG_2312.jpg " height="351" width="518" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/c/cb/Lab2.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/1/1b/Suoge%27s_birthday.jpg " height="599" width="428" hspace="2" vspace="1" border="2" align="top" /></p><br />
</div> <br />
<div class="passage divcell6"><br />
<h3><strong>A Letter from Fancy</strong></h3><br />
<p align="left">There is a very meaningful sentence in the novel The Lord of the Ring: when the respected old Billbo was going to leave the village in which he had lived for many years, he gave a lecture--”The people among you whom I recognize haven’t reached half whom I should do, besides, among those whom I love are less than the half I should do, either.</p><br />
<p align="left">None of us need to fight in a war or fight with monsters. However, all of us have indeed fought and stuck to the very end, regardless of whatever obstacles to overcome and whatever precious to sacrifice.</p><br />
<p align="left">The greatness lies in the persistence to do the ordinary things perfectly. We are all inspired by our design. However, the gap between the repetitive, seemingly endless molecular cloning and the last magic probiotic can easily wreck the passion. To the opposite, most of us have successfully endured the monotonous life. Sometimes the enzymes just don’t function well. Other times the PCR never get right for some unclear reasons. We just survived those really despair moments and made one step closer to our goal.</p><br />
<p align="left">And those heart-touching scenes are clear as if they happened yesterday. Regardless of our persuation to wait for the rain to stop, our captain determined to fetch the induction cooker in his dormitory to perform an reaction as soon as possible (We don’t have an appropriate heater in our lab). When his figure disappeared in the dark and rain, words failed me; when I got a message at 3 o’ clock in the midnight, the excited tune claiming that we no longer needed to worry about our competent cells overwhelmed me with tears; when I heard that our “artist” having caught a cold but promised that he would complete all the pictures of the web site in time, I fell into silence again; every time when Xian Xia stayed overnight in the lab, the room would be quite tidy and all the reagents would got replenished. When I saw this in the next morning, I was greatly touched.</p><br />
<p align="left">Most of us has sacrificed much time to pursue personal interest. We just decrease the time for required exams for going abroad, for working in our own labs, and for some courses we are really interested in, let alone our hobbies. No time for travelling, reading lasted paper on interested topics, shopping, chatting with friends and so on. However, after the complaints and anguish, we finally reached such a peaceful and simple spiritual state that we just want to try our best to get the best result.</p><br />
<p align="left">A man who never experienced iGEM in WHU can never really understand the complex of feelings: glory and dream, perseverance and persistence, joy and tears. You can never image how brave and respected my teammates are, how many efforts and love they have put in the team, and how strong the relationship we have built since the team has been organised.<br />
<br />
</p><br />
</div> <br />
</div><br />
<em class="clear"></em><br />
</div><br />
<div class="footer"></div><br />
</div><br />
<script src="http://www.yichengliu.com/code/igem/notebooks.js"></script><br />
</body><br />
</html></div>Nanhaihttp://2012.igem.org/Team:WHU-China/NotebooksTeam:WHU-China/Notebooks2012-10-26T19:39:16Z<p>Nanhai: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<body><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script><br />
function picObj(src, title, detail, href){<br />
this.src = src;<br />
this.title = title;<br />
this.detail = detail;<br />
this.href = href;<br />
}<br />
//*************************自定义数据部分*************************<br />
<br />
//定义菜单及侧边栏数据<br />
var menuObj = {<br />
Home : [<br />
{<br />
title : "<strong>what's new</strong>",<br />
picArray : [<br />
new picObj("http://imgsrc.baidu.com/forum/pic/item/d25e8bd4b31c87011d9cdb7c277f9e2f0708ff34.jpg", "one piece", "yi zhang haizeiwang de tu", "http://tieba.baidu.com/f?kw=%BA%A3%D4%F4%CD%F5"),<br />
new picObj("http://imgsrc.baidu.com/forum/pic/item/d25e8bd4b31c87011d9cdb7c277f9e2f0708ff34.jpg", "one piece", "yi zhang haizeiwang de tu", "http://tieba.baidu.com/f?kw=%BA%A3%D4%F4%CD%F5"),<br />
new picObj("http://imgsrc.baidu.com/forum/pic/item/d25e8bd4b31c87011d9cdb7c277f9e2f0708ff34.jpg", "one piece", "yi zhang haizeiwang de tu", "http://tieba.baidu.com/f?kw=%BA%A3%D4%F4%CD%F5")<br />
]<br />
},<br />
{<br />
title : "<strong>pathway introduction</strong>",<br />
picArray : [<br />
new picObj("2.png", "title 2", "pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1production 1", "#"),<br />
new picObj("2.png", "title 2", "pathway introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2", "#"),<br />
new picObj("2.png", "title 2", "pathway introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3", "#")<br />
]<br />
},<br />
{<br />
title : "<strong>future prospective</strong>",<br />
picArray : [<br />
new picObj("3.png", "title 3", "future prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1utureive 1", "#"),<br />
new picObj("3.png", "title 3", "future prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospecpective 2", "#"),<br />
new picObj("3.png", "title 3", "future prospective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3", "#")<br />
]<br />
},<br />
{<br />
title : "<strong>about us</strong>",<br />
picArray : [<br />
new picObj("4.png", "title 4", "about us 1", "#"),<br />
new picObj("4.png", "title 4", "about us 2", "#"),<br />
new picObj("4.png", "title 4", "about us 3", "#")<br />
]<br />
}<br />
],<br />
Team : [<br />
{<br />
title : '<strong>Members</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Instructors</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Team History</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>about WHU</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>about Our Lab</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Acknol-</br>edgements</strong>',<br />
dir : []<br />
},<br />
<br />
],<br />
Project : [<br />
{<br />
title : '<strong>Outline</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Background</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Promoter Design</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device I: Fatty Acid Degradation</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device II: Cellulose Synthesis</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device III: Colonization</strong>',<br />
dir : []<br />
},<br />
],<br />
Modeling : [<br />
{<br />
title : '<strong>Future Perspectives</strong>',<br />
dir : []<br />
},<br />
<br />
{<br />
title : '<strong>Model I: Fatty Acid Degradation</strong>',<br />
dir : [<br />
{<br />
title : 'The Ordinary Differential Equations of the Model',<br />
href : '#The Ordinary Differential Equations of the Model'<br />
},<br />
{<br />
title : 'Analysis on the Steady State of the ODE',<br />
href : '#Analysis on the Steady State of the ODE'<br />
},<br />
{<br />
title : 'Parameter Screening',<br />
href : '#Parameter Screening'<br />
},<br />
{<br />
title : 'Conclusion',<br />
href : '#Conclusion'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Model II: Microbiota Regulation</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Software Tool: FANCY</strong>',<br />
dir : []<br />
}<br />
],<br />
Notebooks : [<br />
{<br />
title : '<strong>Parts</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Safety</strong>',<br />
dir : [<br />
{<br />
title : 'Brief Answers to Safety Questions',<br />
href : '#Brief Answers to Safety Questions'<br />
},<br />
{<br />
title : 'General Safety Issues',<br />
href : '#General Safety Issues'<br />
},<br />
{<br />
title : 'Safety Considerations of Our Biobrick parts and Our Project',<br />
href : '#Safety Considerations of Our Biobrick parts and Our Project'<br />
},<br />
{<br />
title : 'Safety Management and Practice',<br />
href : '#Safety Management and Practice'<br />
},<br />
{<br />
title : 'Biosafety and Publicity',<br />
href : '#Biosafety and Publicity'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Protocols</strong>',<br />
dir : [<br />
{<br />
title : 'Protocol for fluorescence measurement',<br />
href : '#Protocol for fluorescence measurement'<br />
},<br />
{<br />
title : 'Protocols of Cupric-Soap Reaction',<br />
href : '#Protocols of Cupric-Soap Reaction'<br />
},<br />
{<br />
title : 'Krebs-Ringer Phosphate(KRPD Buffer Solution)',<br />
href : '#Krebs-Ringer Phosphate(KRPD Buffer Solution)'<br />
},<br />
{<br />
title : 'Cellulose Detection',<br />
href : '#Cellulose Detection'<br />
},<br />
{<br />
title : 'The Standard Curve',<br />
href : '#The Standard Curve'<br />
},<br />
<br />
{<br />
title : 'In vitro Experiment',<br />
href : '#In vitro Experiment'<br />
},<br />
{<br />
title : 'Plate Assay',<br />
href : '#Plate Assay'<br />
},<br />
{<br />
title : 'Materials and Methods of SDS-PAGE',<br />
href : '#Materials and Methods of SDS-PAGE'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Events</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Brain-</br>storming</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Gallery</strong>',<br />
dir : [<br />
{<br />
title : 'team',<br />
href : '#team'<br />
},<br />
{<br />
title : 'presentation',<br />
href : '#presentation'<br />
},<br />
{<br />
title : 'human practice',<br />
href : '#human practice'<br />
},<br />
{<br />
title : 'doodle',<br />
href : '#doodle'<br />
},<br />
{<br />
title : 'funny pictures',<br />
href : '#funny pictures'<br />
}]},<br />
{<br />
title : '<strong>A Letter from Fancy</strong>',<br />
dir : []<br />
<br />
<br />
}<br />
],<br />
HumanPractice : [<br />
{<br />
title : '<strong>Outline</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Questionaire Survey</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Publicity</strong>',<br />
dir : []<br />
}<br />
]<br />
}; <br />
//*************************自定义数据部分*************************<br />
</script><br />
<style type="text/css"><br />
/*<br />
* base css, DO NOT MODIFY!<br />
*/<br />
* {<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
font-family: "Verdana", sans-serif;<br />
color: #333;<br />
list-style: none;<br />
outline: none;<br />
resize: none;<br />
}<br />
html {<br />
overflow-y: scroll;<br />
}<br />
body {<br />
background: url("https://static.igem.org/mediawiki/2012/6/69/Body-bg2.jpg") center center fixed;<br />
}<br />
a {<br />
text-decoration: none;<br />
}<br />
.clear {<br />
width: 0;<br />
height: 0;<br />
line-height: 0;<br />
display: block;<br />
clear: both;<br />
}<br />
<br />
/*<br />
* common css, include "header","footer"...<br />
*/<br />
div.center {<br />
width: 940px;<br />
margin: 0 auto;<br />
}<br />
div.header {<br />
width: 940px;<br />
height: 357px;<br />
background: url("https://static.igem.org/mediawiki/2012/8/80/Header-bg2.png") no-repeat;<br />
position: relative;<br />
z-index: 50;<br />
}<br />
div.nav {<br />
position: absolute;<br />
height: 80px;<br />
top: 206px;<br />
left: 350px;<br />
}<br />
li.nav-outerLi {<br />
display: block;<br />
float: left;<br />
width: 80px;<br />
height: 80px;<br />
margin: 0 6px;<br />
cursor: pointer;<br />
}<br />
h2.nav-h21,h2.nav-h22,h2.nav-h23,h2.nav-h24,h2.nav-h25,h2.nav-h26 {<br />
display: block;<br />
background: url("https://static.igem.org/mediawiki/2012/9/91/Nav-tabs.png") no-repeat;<br />
width: 80px;<br />
height: 80px;<br />
background-position: 0 0;<br />
z-index: 150;<br />
position: relative;<br />
}<br />
h2.nav-h22 {<br />
background-position: -80px 0;<br />
}<br />
h2.nav-h23 {<br />
background-position: -160px 0;<br />
}<br />
h2.nav-h24 {<br />
background-position: -240px 0;<br />
}<br />
h2.nav-h25 {<br />
background-position: -320px 0;<br />
}<br />
h2.nav-h26 {<br />
background-position: -400px 0;<br />
}<br />
h2.nav-h21:hover {<br />
background-position: 0 -80px;<br />
}<br />
h2.nav-h22:hover {<br />
background-position: -80px -80px;<br />
}<br />
h2.nav-h23:hover {<br />
background-position: -160px -80px;<br />
}<br />
h2.nav-h24:hover {<br />
background-position: -240px -80px;<br />
}<br />
h2.nav-h25:hover {<br />
background-position: -320px -80px;<br />
}<br />
h2.nav-h26:hover {<br />
background-position: -400px -80px;<br />
}<br />
h2.nav-h21on {<br />
background-position: 0 -160px;<br />
}<br />
h2.nav-h22on {<br />
background-position: -80px -160px;<br />
}<br />
h2.nav-h23on {<br />
background-position: -160px -160px;<br />
}<br />
h2.nav-h24on {<br />
background-position: -240px -160px;<br />
}<br />
h2.nav-h25on {<br />
background-position: -320px -160px;<br />
}<br />
h2.nav-h26on {<br />
background-position: -400px -160px;<br />
}<br />
ul.nav-innerUl{<br />
position: absolute;<br />
top: 40px;<br />
padding-top: 40px;<br />
width: 76px;<br />
border-left: 2px solid #000;<br />
border-right: 2px solid #000;<br />
z-index: 140;<br />
display: none;<br />
}<br />
em.nav-libg{<br />
display: block;<br />
width: 96px;<br />
height: 11px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/48/Nav-libg.png');<br />
margin-left: -10px;<br />
}<br />
ul.nav-innerUl1{<br />
background: #fffaca;<br />
}<br />
ul.nav-innerUl2{<br />
background: #dedede;<br />
}<br />
ul.nav-innerUl3{<br />
background: #d9f0c9;<br />
}<br />
ul.nav-innerUl4{<br />
background: #f6e5ff;<br />
}<br />
ul.nav-innerUl5{<br />
background: #ebfcff;<br />
}<br />
ul.nav-innerUl6{<br />
background: #ffeee8;<br />
}<br />
li.nav-innerLi{<br />
font-size: 10px;<br />
line-height: 14px;<br />
padding: 3px 5px;<br />
}<br />
li.nav-innerLi:hover{<br />
background: #fff;<br />
}<br />
div.middle {<br />
width: 940px;<br />
background: #e6deb8;<br />
background: rgba(230,222,184,0.5);<br />
position: absolute;<br />
top: 178px;<br />
}<br />
div.aside {<br />
width: 174px;<br />
height: 441px;<br />
background: url("https://static.igem.org/mediawiki/2012/9/96/Aside-bg2.png") no-repeat;<br />
margin-left: 10px;<br />
float: left;<br />
padding: 179px 86px 0 40px;<br />
}<br />
div.asideFixed {<br />
position: fixed;<br />
top: 0;<br />
}<br />
ul.aside-outerUl {<br />
position: relative;<br />
margin: 7px 10px;<br />
}<br />
li.aside-outerLi {<br />
margin: 10px 0;<br />
}<br />
li.aside-outerLi h2{<br />
padding: 4px 0;<br />
color: #725718;<br />
background: #fff1a9;<br />
font-size: 14px;<br />
line-height: 22px;<br />
font-weight: bold;<br />
text-align: center;<br />
cursor: pointer;<br />
}<br />
li.aside-outerLi:hover h2{<br />
background: #fff8d3;<br />
}<br />
ul.aside-innerUl {<br />
display: none;<br />
}<br />
ul.aside-innerUl li {<br />
background: #bdc9ad;<br />
margin: 3px 0;<br />
font-family: arial, sans-serif;<br />
font-size: 14px;<br />
line-height: 22px;<br />
text-align: center;<br />
cursor: pointer;<br />
}<br />
ul.aside-innerUl li:hover{<br />
background: #d4dcc9;<br />
}<br />
div.main {<br />
width: 580px;<br />
border: 1px solid #9e8366;<br />
background: #f0e2c1;<br />
float: right;<br />
margin: 149px 30px 30px 0;<br />
}<br />
div.passage {<br />
display: none;<br />
margin: 30px;<br />
}<br />
div.show{<br />
display: block;<br />
}<br />
div.passage h3 {<br />
font-size: 26px;<br />
line-height: 39px;<br />
font-weight: bold;<br />
background: #859f93;<br />
color: #f0e2c1;<br />
display: block;<br />
width: auto;<br />
padding: 0 10px;<br />
}<br />
div.passage p {<br />
margin: 14px 0;<br />
font-size: 13px;<br />
line-height: 20px;<br />
}<br />
div.passage img {<br />
display: block;<br />
float: right;<br />
padding: 0 0 20px 30px;<br />
background: #f0e2c1;<br />
}<br />
div.footer {<br />
}<br />
#p-logo {<br />
display:none;<br />
}<br />
#top-section {<br />
height:0;<br />
border:none;<br />
}<br />
#search-controls {<br />
display:none;<br />
}<br />
#content {<br />
position:inherit;<br />
width:inherit;<br />
margin:0;<br />
padding:0;<br />
background:inherit;<br />
color:inherit;<br />
border:none;<br />
line-height:inherit;<br />
z-index:2;<br />
}<br />
.firstHeading {<br />
display:none;<br />
}<br />
#catlinks {<br />
display:none;<br />
}<br />
#footer-box {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#menubar ul li a {<br />
background:none;<br />
}<br />
#bodyContent h1,#bodyContent h2 {<br />
margin:0;<br />
border:0;<br />
padding: 0;<br />
}<br />
#bodyContent h2.nav-h2-title{<br />
padding: 5px 0;<br />
}<br />
.left-menu:hover {<br />
background:none;<br />
}<br />
.nav-bg-logo{<br />
float: left;<br />
}<br />
</style><br />
</head><br />
<body><br />
<div class="center"><br />
<div class="header"><br />
<img class="nav-bg-logo" src="https://static.igem.org/mediawiki/2012/4/44/Nav-bg-logo1.png" /><br />
<div class="nav"><br />
<ul class="nav-outerUl"><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China"><h2 class="nav-h21" title="Home"></h2></a><br />
<ul class="nav-innerUl nav-innerUl1" name="Home"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Team"><h2 class="nav-h22" title="Team"></h2></a><br />
<ul class="nav-innerUl nav-innerUl2" name="Team"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Project"><h2 class="nav-h23" title="Project"></h2></a><br />
<ul class="nav-innerUl nav-innerUl3" name="Project"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Modeling"><h2 class="nav-h24" title="Modeling"></h2></a><br />
<ul class="nav-innerUl nav-innerUl4" name="Modeling"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Notebooks"><h2 class="nav-h25 nav-h25on" title="Notebooks"></h2></a><br />
<ul class="nav-innerUl nav-innerUl5" name="Notebooks"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/HumanPractice"><h2 class="nav-h26" title="Human Practice"></h2></a><br />
<ul class="nav-innerUl nav-innerUl6" name="HumanPractice"></ul><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div class="middle"><br />
<div class="aside"><br />
<ul class="aside-outerUl"></ul><br />
</div><br />
<div class="main"><br />
<div class="passage divcell0"><br />
<table class=" pgrouptable tablesorter" cellspacing="0" cellpadding="0" style="width: 100%;"><thead><br />
<tr><th class="header" style="width:8px"></th><th class="header" style="width:8px"></th><th class="header" style="width:8px"></th><th class="header" style="width: 87px;">Name</th><th class="header" style="width: 80px" colspan="">Type</th><th class="header" style="width: auto;" colspan="">Description</th><th class="header" style="width: 150px" colspan="">Designer</th><th class="header" style="width: 50px" colspan="">Length</th><br />
</tr></thead><tbody><br />
<tr><br />
<td class="status_cell heart13">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861060">BBa_K861060</a></td><td>Regulatory</td><td>PfadR, synthetic promoter with tandem FadR binding site</td><td width="100px">Kuanwei Sheng</td><td align="right">76</td><br />
</tr><br />
<tr><br />
<td class="status_cell heart13">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861171">BBa_K861171</a></td><td>Regulatory</td><td>Pcar, synthetic promoter repressed by CRP</td><td width="100px">Kuanwei Sheng</td><td align="right">36</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861001">BBa_K861001</a></td><td>Generator</td><td>FadL with a strong RBS and a double terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">1465</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_green">W</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861002">BBa_K861002</a></td><td>Generator</td><td>Constitutively expressed FadL</td><td width="100px">Kuanwei Sheng</td><td align="right">1508</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861003">BBa_K861003</a></td><td>Generator</td><td>PfadR regulated FadL</td><td width="100px">Kuanwei Sheng</td><td align="right">1549</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861010">BBa_K861010</a></td><td>Coding</td><td>FadD, an inner membrane-associated acyl-CoA synthase</td><td width="100px">Kuanwei Sheng</td><td align="right">1605</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861011">BBa_K861011</a></td><td>Generator</td><td>FadD with RBS and terminator.</td><td width="100px">Kuanwei Sheng</td><td align="right">1729</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861013">BBa_K861013</a></td><td>Generator</td><td>IPTG induced FadD</td><td width="100px">Kuanwei Sheng</td><td align="right">1792</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861014">BBa_K861014</a></td><td>Generator</td><td>Constitutively expressed FadD</td><td width="100px">Kuanwei Sheng</td><td align="right">1772</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861015">BBa_K861015</a></td><td>Generator</td><td>Constitutively expressed FadD</td><td width="100px">Kuanwei Sheng</td><td align="right">1772</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861016">BBa_K861016</a></td><td>Generator</td><td>PfadR regulated FadD</td><td width="100px">Kuanwei Sheng</td><td align="right">1813</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861020">BBa_K861020</a></td><td>Coding</td><td>FadE ,acyl-CoA dehydrogenase </td><td width="100px">Kuanwei Sheng</td><td align="right">2445</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861021">BBa_K861021</a></td><td>Coding</td><td>FadE gene for fatty acid degradation from <i>Salmonella enterica</i> LT2</td><td width="100px">Kuanwei Sheng</td><td align="right">2592</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861022">BBa_K861022</a></td><td>Generator</td><td>FadE with RBS and terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">2569</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861023">BBa_K861023</a></td><td>Generator</td><td>S-FadE with a RBS and a terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">2716</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861024">BBa_K861024</a></td><td>Generator</td><td>IPTG induced FadE</td><td width="100px">Kuanwei Sheng</td><td align="right">2632</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861025">BBa_K861025</a></td><td>Generator</td><td>Constitutively expressed FadE</td><td width="100px">Kuanwei Sheng</td><td align="right">2612</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861026">BBa_K861026</a></td><td>Generator</td><td>Constitutively expressed FadE</td><td width="100px">Kuanwei Sheng</td><td align="right">2612</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861027">BBa_K861027</a></td><td>Generator</td><td>Constitutively expressed FadE</td><td width="100px">Kuanwei Sheng</td><td align="right">2612</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861028">BBa_K861028</a></td><td>Generator</td><td>PfadR regulated FadE</td><td width="100px">Kuanwei Sheng</td><td align="right">2653</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861029">BBa_K861029</a></td><td>Regulatory</td><td>PfadR regulated S-FadE</td><td width="100px">Kuanwei Sheng</td><td align="right">2800</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861030">BBa_K861030</a></td><td>Coding</td><td>FadB, gene for fatty acid degradation from E.coli K12</td><td width="100px">Kuanwei Sheng</td><td align="right">1164</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861031">BBa_K861031</a></td><td>Coding</td><td>FadJ, gene for fatty acid degradation from <i>E.coli str. K12</i></td><td width="100px">Kuanwei Sheng</td><td align="right">2145</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861032">BBa_K861032</a></td><td>Coding</td><td> S-FadB gene for fatty acid degradation from <i>Salmonella enterica</i> LT2</td><td width="100px">Kuanwei Sheng</td><td align="right">2190</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861033">BBa_K861033</a></td><td>Generator</td><td>FadB with a RBS and a terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">1288</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861034">BBa_K861034</a></td><td>Generator</td><td> FadJ gene with a RBS and a terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">2269</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861035">BBa_K861035</a></td><td>Generator</td><td>S-FadB with a RBS and a terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">2314</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861036">BBa_K861036</a></td><td>Generator</td><td>IPTG induced FadA and FadB</td><td width="100px">Kuanwei Sheng</td><td align="right">2544</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861037">BBa_K861037</a></td><td>Generator</td><td>IPTG induced FadI and FadJ</td><td width="100px">Kuanwei Sheng</td><td align="right">3672</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861038">BBa_K861038</a></td><td>Generator</td><td>IPTG induced S-FadA and S-FadB</td><td width="100px">Kuanwei Sheng</td><td align="right">3673</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861041">BBa_K861041</a></td><td>Coding</td><td>FadI, gene for fatty acid degradation from <i>E.coli str. K12</i></td><td width="100px">Kuanwei Sheng</td><td align="right">1311</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861042">BBa_K861042</a></td><td>Coding</td><td>FadA, gene for fatty acid degradation from <i>Salmonella enterica</i> LT2</td><td width="100px">Kuanwei Sheng</td><td align="right">1164</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861043">BBa_K861043</a></td><td>Translational_Unit</td><td>FadA with a RBS</td><td width="100px">Kuanwei Sheng</td><td align="right">1185</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861044">BBa_K861044</a></td><td>Translational_Unit</td><td>FadI with a RBS</td><td width="100px">Kuanwei Sheng</td><td align="right">1332</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861045">BBa_K861045</a></td><td>Generator</td><td>S-FadA with a RBS and a terminator </td><td width="100px">Kuanwei Sheng</td><td align="right">1288</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861046">BBa_K861046</a></td><td>Generator</td><td>PfadR regulated FadA and FadB</td><td width="100px">Kuanwei Sheng</td><td align="right">2565</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861047">BBa_K861047</a></td><td>Generator</td><td>PfadR regulated FadI and FadJ</td><td width="100px">Kuanwei Sheng</td><td align="right">3693</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861048">BBa_K861048</a></td><td>Generator</td><td>PfadR regulated S-FadA and S-FadB</td><td width="100px">Kuanwei Sheng</td><td align="right">3591</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861050">BBa_K861050</a></td><td>Coding</td><td>FadR, fatty acid sensor from <i>E.coli str. K12</i></td><td width="100px">Kuanwei Sheng</td><td align="right">720</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861051">BBa_K861051</a></td><td>Generator</td><td>FadR with a RBS and a terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">844</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861052">BBa_K861052</a></td><td>Generator</td><td>Constitutive expressed FadR</td><td width="100px">Kuanwei Sheng</td><td align="right">887</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861061">BBa_K861061</a></td><td>Reporter</td><td>Efficacy testing RFP generator of BBa_K861060 (PfadR)</td><td width="100px">Kuanwei Sheng</td><td align="right">945</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861062">BBa_K861062</a></td><td>Regulatory</td><td>PfadR with FadR overexpressed</td><td width="100px">Kuanwei Sheng</td><td align="right">1840</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_green">W</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861070">BBa_K861070</a></td><td>Coding</td><td>AdrA gene from E.coli K12</td><td width="100px">Kuanwei Sheng</td><td align="right">1167</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_green">W</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861071">BBa_K861071</a></td><td>Generator</td><td>AdrA gene with a RBS and a terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">1293</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_green">W</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861072">BBa_K861072</a></td><td>Generator</td><td>Constitutively expressed AdrA</td><td width="100px">Kuanwei Sheng</td><td align="right">1336</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_green">W</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861073">BBa_K861073</a></td><td>Generator</td><td>Constitutively expressed AdrA</td><td width="100px">Kuanwei Sheng</td><td align="right">1336</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861074">BBa_K861074</a></td><td>Generator</td><td>Pcar regulated AdrA</td><td width="100px">Kuanwei Sheng</td><td align="right">1337</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861090">BBa_K861090</a></td><td>Coding</td><td>YhjH Gene From <i>E.coli str. K12</i></td><td width="100px">Kuanwei Sheng</td><td align="right">768</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861091">BBa_K861091</a></td><td>Generator</td><td>YhjH gene with a RBS and a Terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">892</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861100">BBa_K861100</a></td><td>Coding</td><td>BcsA,cellulose synthetase, catalytic subunit</td><td width="100px">Xian Xia</td><td align="right">2619</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861101">BBa_K861101</a></td><td>Generator</td><td>BcsA with RBS and terminator</td><td width="100px">Xian Xia</td><td align="right">2743</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861102">BBa_K861102</a></td><td>Generator</td><td> BcsA controlled by promoter repressed by CRP</td><td width="100px">Xian Xia</td><td align="right">2787</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861110">BBa_K861110</a></td><td>Coding</td><td>BcsB,regulator of cellulose synthetase</td><td width="100px">Xian Xia</td><td align="right">2340</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861111">BBa_K861111</a></td><td>Generator</td><td>BcsB with RBS and terminator</td><td width="100px">Xian Xia</td><td align="right">2464</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861112">BBa_K861112</a></td><td>Generator</td><td>BcsB controlled by promoter repressed by CRP</td><td width="100px">Xian Xia</td><td align="right">2508</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861120">BBa_K861120</a></td><td>Coding</td><td>BcsZ, endo-1,4-D-glucanase</td><td width="100px">Xian Xia</td><td align="right">1107</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861121">BBa_K861121</a></td><td>Generator</td><td>BcsZ with RBS and terminator</td><td width="100px">Xian Xia</td><td align="right">1231</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861122">BBa_K861122</a></td><td>Generator</td><td>BcsZ generator repressed by CRP (directly)</td><td width="100px">Xian Xia</td><td align="right">1275</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861130">BBa_K861130</a></td><td>Coding</td><td>BcsC,cellulose synthetase subunit</td><td width="100px">Xian Xia</td><td align="right">3474</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861131">BBa_K861131</a></td><td>Generator</td><td>BcsC with RBS and terminator</td><td width="100px">Xian Xia</td><td align="right">3598</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861132">BBa_K861132</a></td><td>Generator</td><td>BcsC controlled by promoter repressed by CRP</td><td width="100px">Xian Xia</td><td align="right">3642</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861140">BBa_K861140</a></td><td>Coding</td><td> GalU,glucose-1-phosphate uridylyltransferase</td><td width="100px">Chang Liu</td><td align="right">909</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861141">BBa_K861141</a></td><td>Generator</td><td>GalU with a RBS and a terminator</td><td width="100px">Xian Xia</td><td align="right">1033</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861142">BBa_K861142</a></td><td>Generator</td><td>GalU generator repressed by CRP (directly)</td><td width="100px">Xian Xia</td><td align="right">1077</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861150">BBa_K861150</a></td><td>Coding</td><td>GalF, putative regulatory subunit for GalU </td><td width="100px">Xian Xia</td><td align="right">894</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861151">BBa_K861151</a></td><td>Generator</td><td>GalF with a RBS and a terminator</td><td width="100px">Xian Xia</td><td align="right">1018</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861152">BBa_K861152</a></td><td>Generator</td><td>GalF generator repressed by CRP (directly)</td><td width="100px">Xian Xia</td><td align="right">1062</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861160">BBa_K861160</a></td><td>Coding</td><td>CRP, cAMP receptor protein</td><td width="100px">Kuanwei Sheng</td><td align="right">633</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861161">BBa_K861161</a></td><td>Generator</td><td>CRP with a RBS and a terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">757</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861162">BBa_K861162</a></td><td>Generator</td><td>Constitutively expresses Crp</td><td width="100px">Xian Xia, Kuanwei Sheng</td><td align="right">800</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861163">BBa_K861163</a></td><td>Generator</td><td>Constitutively expresses Crp</td><td width="100px">Xian Xia</td><td align="right">800</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861169">BBa_K861169</a></td><td>Regulatory</td><td>Indirect regulatory device, activated at high glucose concentration</td><td width="100px">Kuanwei Sheng</td><td align="right">1961</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861170">BBa_K861170</a></td><td>Regulatory</td><td>PI ,Glucose-activated promoter</td><td width="100px">Kuanwei Sheng</td><td align="right">36</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861172">BBa_K861172</a></td><td>Generator</td><td> lambda cI generator controlled by PcstA (glucose-repressible promoter)</td><td width="100px">Xian Xia</td><td align="right">1069</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861173">BBa_K861173</a></td><td>Reporter</td><td>mRFP generator controlled by PcstA (glucose-repressible promoter)</td><td width="100px">Kuanwei Sheng, Xian Xia</td><td align="right">1000</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861174">BBa_K861174</a></td><td>Regulatory</td><td>A control device for BBa_K861169</td><td width="100px">Xian Xia</td><td align="right">1899</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861175">BBa_K861175</a></td><td>Reporter</td><td>Efficacy testing RFP generator of BBa_K861170 (PI)</td><td width="100px">Kuanwei Shneg, Xian Xia</td><td align="right">905</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861176">BBa_K861176</a></td><td>Reporter</td><td>mRFP expressed after Pcar</td><td width="100px">Kuanwei Sheng, Xian Xia</td><td align="right">905</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861177">BBa_K861177</a></td><td>Generator</td><td>K861162+ K861175 </td><td width="100px">Kuanwei Sheng</td><td align="right">1713</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861178">BBa_K861178</a></td><td>Device</td><td>Pcar efficacy testing device with CRP overexpressed</td><td width="100px">Kuanwei Sheng, Xian Xia</td><td align="right">1713</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861179">BBa_K861179</a></td><td>Generator</td><td>K861162+J23119</td><td width="100px">Chang Liu</td><td align="right">843</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861345">BBa_K861345</a></td><td>Generator</td><td>IPTG induced S-fadE</td><td width="100px">Kuanwei Sheng</td><td align="right">2779</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861346">BBa_K861346</a></td><td>Intermediate</td><td>IPTG induced promoter with FadA, intermediate part for BBa_K861036</td><td width="100px">Kuanwei Sheng</td><td align="right">1248</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861347">BBa_K861347</a></td><td>Intermediate</td><td>IPTG induced promoter with FadI, intermediate part for BBa_K861037</td><td width="100px">Kuanwei Sheng</td><td align="right">1395</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861348">BBa_K861348</a></td><td>Intermediate</td><td>IPTG induced promoter with S-FadA, intermediate part for BBa_K861038</td><td width="100px">Kuanwei Sheng</td><td align="right">1351</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861349">BBa_K861349</a></td><td>Intermediate</td><td>PfadR with FadA, intermediate part for BBa_K861046</td><td width="100px">Kuanwei Sheng</td><td align="right">1269</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861350">BBa_K861350</a></td><td>Composite</td><td>PfadR with FadI, intermediate part for BBa_K861047</td><td width="100px">Kuanwei Sheng</td><td align="right">1416</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861351">BBa_K861351</a></td><td>Composite</td><td>PfadR with S-FadA, intermediate part for BBa_K861048</td><td width="100px">Kuanwei Sheng</td><td align="right">1372</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861400">BBa_K861400</a></td><td>Coding</td><td>Gene coding protein FadA for fatty acid degradation</td><td width="100px">Kuanwei Sheng</td><td align="right">1164</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861500">BBa_K861500</a></td><td>Coding</td><td>FadL, Long-chain fatty acids transporter from <i>E.coli str. K12</i></td><td width="100px">Kuanwei Sheng</td><td align="right">1341</td><br />
</tr><br />
</tbody><br />
</table><br />
</div><br />
<div class="passage divcell1"><br />
<a name="Brief Answers to Safety Questions"><h3>Brief Answers to Safety Questions</h3></a><br />
<p align="justify"> Welcome to our Safety Page. We will first answer the safety questions asked by iGEM headquarters briefly, and then discuss safety issues associated with our project in detail. In addition, we will provide our ideas and practice on guaranteeing and developing biosafety.<br />
</p><br />
<p align="justify"><br />
<strong>Q1. Would any of your project ideas raise safety issues in terms of: Researcher safety, public safety, or environmental safety?</strong></br><br />
No. Our design is based on the commonly used nonpathogenic <i>E. coli K.12</i> strain and genes we manipulated are original genes in <i>E. coli</i>. The protein products, at least from current understanding, will cause no harm to researchers, the public and environment. In addition, strict lab practice is executed to further ensure safety.<br />
</p><br />
<p align="justify"><br />
<strong>Q2. Do any of the new BioBrick parts (or devices) that you made this year raise any safety issues? If yes,</br> <br />
Did you document these issues in the Registry?</br><br />
How did you manage to handle the safety issue?</br><br />
How could other teams learn from your experience?</strong></br><br />
Yes, we will discuss this question in latter part of this page (Safety Considerations of Our Biobrick parts and Our Project).<br />
</p><br />
<p align="justify"><br />
<strong>Q3. Is there a local biosafety group, committee, or review board at your institution?</br> <br />
If yes, what does your local biosafety group think about your project?</br><br />
If no, which specific biosafety rules or guidelines do you have to consider in your country?</strong></br><br />
Yes. All materials obtained have received the approvals from the department's laboratory management committees. We are also obliged to observe the regulations of Teaching Centre of Experimental Biology and apply for approval for materials before we start our project.<br />
</p><br />
<p align="justify"><br />
<strong>Q4. Do you have any other ideas how to deal with safety issues that could be useful for future iGEM competitions? How could parts, devices and systems be made even safer through biosafety engineering?</strong></br><br />
Some classified measures should be taken according to the safety of the material. For example, plasmids that may harm the safety, when submitted, should receive more attention and have a stricter package. Some harmful byproducts during experiments should be eliminated properly.</br><br />
We have done our human practice aiming at understanding attitude of the public towards genetically modified baceria and publicizing biosafety ideas to the public, which we think should be popularized to other teams in future iGEM competitions.<br />
</p><br />
<a name="General Safety Issues"><h3>General Safety Issues</h3></a><br />
<p align="justify"><br />
In this part, we will illustrate organisms, reagents and equipments we use that may cause safety problems, and introduce our operation standard, management and trains protecting the team members, public and environment.<br />
<br /><br />
<img src="https://static.igem.org/mediawiki/2012/0/05/Safety_Table_1.jpg" width="500" height="500" hspace="2" vspace="1" border="2" align="top" /><br />
As above, all the organisms and DNA hosts are not of high individual or community risk. Until now, the only used organism is <i>E. coli K.12</i> (and some of its varieties, for example, DH5&alpha;, a RecA mutated strain). Our current lab of basic-biosafety level 1 is safe enough to manipulate this strain. Only the genome (a generous present from University of Dundee iGEM team), but not the living Salmonella enterica was manipulated in the lab, and the genes from it are homogeneous of <i>E. coli K.12</i>, not associated with pathogenesis. We will not implement our future experimental plan with microorganisms of risk group 2 or vertebrates in our current lab, for too low is the biosafety level and no animal facilities.<br />
<br /><br />
To manipulate microorganisms, an ultra clean cabinet is used and strict aseptic technique is followed. All experimenters have been trained on foundation microbiology technique and biosafety. All microorganism contacting vessels are sterilized before and after experiments in appropriate protocols. Also, all microorganism materials will be sterilized before discarded. In this way, we believe that no public or environmental harm will be caused by the experimental organisms. In addition, no one in our team will be hurt by the experimental organisms.<br />
<br /><br />
The genetic modifications we make will change metabolism of bacteria. However, there is no evidence both theoretically and experimentally that these modifications will improve the pathogenicity of the bacteria or cause damage to environment even taking the risk of horizontal gene transfer into consideration. The effects of expressing gene <i>adrA</i> regarding infectivity and pathogenicity on <i>E. coli</i> is not clear now, but it still can be easily controlled in the lab environment without human ingestion. Also, we will insert a death device into the bacteria cell when we construct the whole system (still far from now) to avoid the proliferation out of control. For more information about gene safety, please read the next section and documents of our relevant parts on registry.<br />
</p><br />
<p align="justify"><br />
We have considered the potential harmful chemicals and equipments, as listed below:<br />
<ul><br />
<li></p><br />
<p align="justify"> Basic molecular experiments: NaOH, HCl, SDS, acrylamide, TEMED, ethanol, IPTG, liquid nitrogen, &beta;-mercaptoethanol, xylene cyanol FF.<br />
</li><br />
<li></p><br />
<p align="justify"> Bacteria culture: ampicillin, kanamycin, chloramphenicol.<br />
</li></p><br />
<p align="justify"> Chemical analysis and measurements: acetone, cupric acetate, Sudan III, Congo red, Coomassie Brilliant Blue G-250, Coomassie Brilliant Blue R-250.<br />
<li></p><br />
<p align="justify"> Equipments: UV lamp, supercentrifuge, heating equipments (alcohol burner, PCR amplifier, water bath, dry bath), electrophoresis apparatus, -80℃ refrigerator, ultrasonic cell disruptor.<br />
</li><br />
</ul><br />
</br></p><br />
<p align="justify"> All of these are regular reagents and apparatus in a molecular biology laboratory. The risks of them come from inflammability, explosibility, irritation, corrosivity, toxicity, carcinogenicity and physical injury. But none of them raises special safety issue, with chemical hood, emergency shower, normal personal protection, safety management and safety training.</br><br />
Only trace amount of antibiotics are used. Inactivated will they be before discared.<br />
</p><br />
<p ><br />
<img src="https://static.igem.org/mediawiki/2012/0/07/Safety_Figure_3.jpg" alt="Emergency Shower" width="500" height="750" hspace="2" vspace="1" border="2" align="top" /><strong>Emergency Shower</strong></img><br />
</p><br />
<a name="Safety Considerations of Our Biobrick parts and Our Project"><h3>Safety Considerations of Our Biobrick parts and Our Project</h3></a><br />
<p><br />
In this section, we are going to answer safety question 2 in detail, taking the potential risk in the future into concern.<br />
<br /><br />
The main safety challenge we must face is that as a practical bacteria therapy our direction is, we shall demonstrate that the “<i>E. coslim</i>” will not harm its host when it is developed completely. As few experiments we can do in such limited time, we have done a series of theoretical work to solve problems in this field.<br />
Intestine-colonized pathogenic <i>E. coli</i> may cause immune responses, following by diarrhea, inflammation and fever (although the strain we use is considered non-pathogen). Thus we plan to transplant the whole synthetic system to another organism (for example, <i>Bacillus subtilis</i>, has proved safe in human intestine). We know that it is hard as the two organisms are very different on transcriptional mechanisms, but we believe the work of establishing model system (that is what we are doing) in <i>E. coli</i> will make it easier. Also, as the rapid development of synthetic biology and gut microbiology, we hope in the near future, we can modify the genome of <i>E. coli</i> to change it a safe intestine microbe.<br />
<br /><br />
Another risk is that when the engineered bacteria get higher efficiency on energy production, they could proliferate out of control. To forestall this situation, we design a “death” device (for more information, click on <a href="https://2012.igem.org/Team:WHU-China/Death">Death</a>) using D-xylose as inducer. It means if you want to stop weight losing, what you have to do is to eat some D-xylose, and the “<i>E. coslim</i>” will die, shed from the intestinal wall and be poured out. What is more, designed as a two-plasmid system, it prevents all possible horizontal gene transfers.<br />
<br /><br />
Further safety issues will be raised and discussed in future experiments, including those operates in intestinal model and animals (For more information, click on Future Perspectives).<br />
</p><br />
<a name="Safety Management and Practice"><h3>Safety Management and Practice</h3></a><br />
<p align="justify"><br />
Our project has past a review of an expert committee, of which members are professors or associate professors of microbiology, genetics and bioengineering. Safety issues are considered seriously before they approved our design. <br />
We have consulted a few experts for safety questions about both artificial intestinal bacteria and experiments. Their advices help us improve the safety of the whole planning system. For that, we thank Dr. Yulan Wang and Dr. Tiangang Liu so much.<br />
Our lab is supervised by Teaching Centre of Experimental Biology, Wuhan University (TCEB, whose leader is our instructor <a href="https://2012.igem.org/Team:WHU-China/Team#Zhixiong Xie">Dr. Zhixiong Xie</a>). An expert group of this centre formulates safety guidelines and guarantees their performance in all teaching labs. All experiments we do past its review.<br />
Our safety management system includes the followings:<br />
Management of Chemicals, Equipments and Experimenters: Chemicals and equipments are registered in TCEB before they are available for us. Equipments are checked and maintained regular. And an entrance guard system is used to ensure only the admitted could enter the lab.<br />
<ul><br />
<li><br />
Responsibility distribution: All members worked in the lab are divided to three groups. The group leaders arrange schedules of experiments after assessing safety issues in the group (for example, the safety train of the experimental executer). Every member records his/her experiments in detail in the notebook of the group. Each group takes responses for cleaning and checking risks in the lab in turns. The group leader takes responses to the team leader. The team leader reports regular on safety to engineer Miss Long Yan, who is authorized by TCEB and manages the lab.<br />
</li><br />
<li><br />
Management of Chemicals, Equipments and Experimenters: Chemicals and equipments are registered in TCEB before they are available for us. Equipments are checked and maintained regular. And an entrance guard system is used to ensure only the admitted could enter the lab.<br />
</li><br />
<li><br />
Training: Our team members have been trained after Guidance of Student Experiments formulated by TCEB. <br />
</li><br />
</ul><br />
</p><br />
<p><br />
<img src="https://static.igem.org/mediawiki/2012/f/fe/Safety_Figure_4.png" alt="Guidence of Student Experiments" height="500" width="500" hspace="2" vspace="1" border="2" align="top" /><strong>Guidence of Student Experiments</strong></img><br />
</p><br />
<a name="Biosafety and Publicity"><h3>Biosafety and Publicity</h3></a><br />
<p align="justify"><br />
We believe that biosafety is not an issue which should be only considered inside biological lab, but also around people and communities. Spreading knowledge of biosafety to the public will help eliminate misunderstanding and prejudice, from which the science and all the people will benefit. We hope that sharing this idea with all iGEM teams can be useful to take advantage on biosafety.<br />
<br /><br />
To investigate public attitude towards our project and to publicize our biosafety ideas are what we do for our human practice. As “eating bacteria” is somehow an unacceptable concept now, we would like to find whether people know the truth about biosafety issues raised by bioengineered bacteria, or they are just panicked by their imaginary “bacteria”. And then, after initiating basic knowledge of microbiology, gene engineering and synthetic biology, we shall take a look on if people’s opinion to biosafety issues will change. In this way, we will estimate the value of our scientific publicity.<br />
<br /><br />
The rational discussions of biosafety we take with the public do not limited on our project, but also hotspot issues such as transgenics and stem cell therapies. For more information, please click on <a href="https://2012.igem.org/Team:WHU-China/Human_Practice">Human Practice</a>.<br />
</p><br />
<p><br />
<img src="https://static.igem.org/mediawiki/2012/a/a4/Safety_Figure_5.jpg" alt="Introducing a Simplified Intestinal Model" width="500" height="333" hspace="2" vspace="1" border="2" align="center" /><strong>Introducing a Simplified Intestinal Model</strong></img><br />
</p><br />
</div><br />
<div class="passage divcell2"><br />
<a name="Protocol for fluorescence measurement"><h4>Protocol for fluorescence measurement</h4></a><br />
<p align="justify">Minimal Medium</p><br />
<p align="justify">M9: </p><br />
<p align="justify"> For 1L Medium add</p><br />
<p align="justify">Na<sub>2</sub>HPO<sub>4</sub>·12H<sub>2</sub>O 15g </p><br />
<p align="justify">KH<sub>2</sub>PO<sub>4</sub> 3g</p> <br />
<p align="justify">NaCl 1g </p><br />
<p align="justify">NH<sub>4</sub>Cl 0.5g</p><br />
<p align="justify">After autoclaving, add: </p><br />
<p align="justify">MgSO<sub>4</sub>(1mol/L) 2mL</p><br />
<p align="justify">Bacteria strain:CaCl<sub>2</sub> 100μL </p><br />
<p align="justify">Triton X-100 (as emulsifier) 2uL</p><br />
<p align="justify"><br> </p><br />
<p align="justify"><strong>Note</strong></p><br />
<p align="justify">1.For M9 medium using oleic acid as sole carbon source, various amount of oleic acid was first emulsified 1:1 with 10% Triton X-100. M9 medium was then slowly added with constant vortex. M9 medium with high concentration of oleic acid was diluted by M9 medium with triton to form various concentrations;</p><br />
<p align="justify">2. For M9 medium using glucose as sole carbon source, M9 medium with high concentration of glucose was diluted by M9 medium to form various concentrations.</p> <br />
<p align="justify"><strong>Step</strong></p><br />
<p align="justify">1. Seed liquor which was activated over night was inoculated into M9 medium which contains different concentration of oleic acid. And it was then incubated at 37℃ for 24 hours;</p><br />
<p align="justify">2. After 24h of incubation in 24 well plates in 37℃, bacteria culture was centrifuged at 3000rmp for 5min, washed and resuspended in PBS;</p><br />
<p align="justify">3. We detected the OD600 and fluorescence of using SpectraMax M2 plate reader (Molecular Devices) .Excitation at 584 nm and emission at 607 nm were used. All fluorescence was normalized with cell density by measuring the absorbance at 600 nm.</p><br />
<br />
<a name="Protocols of Cupric-Soap Reaction"><h3>Protocols of Cupric-Soap Reaction</h3></a><br />
<p align="justify">To test metabolism of long fatty acids, we used oleic acid as sole carbon source in mediums, and used cupric-soap reaction to determinate oleic acid concentration preliminarily. </p><br />
<p align="justify">Modified M9 minimal medium with emulsified oleic acid as sole carbon</p><br />
<p align="justify"> Minimal medium was the same with that in Materials and methods for PfadR </p><br />
<p align="justify">What's Important:</p><br />
<p align="justify">Slowly pour M9 minimal medium into mixture of oleic acid and Triton X-100 to get more homogeneous solution.</p><br />
<p align="justify">Analysis the concentration of the oleic acid in the medium by cupric-acetate method</p><br />
<p align="justify"><strong>Step</strong></p> <br />
<p align="justify">1.Collect 5 ml medium which has been used to cultivate bacteria. Then centrifuge the medium at 3000rpm for 10 min to separate bacteria and medium;</p><br />
<p align="justify"> 2.Decant 3ml supernatant liquid into a 10ml EP. Add 3ml acetone to the liquid, 1ml at a time, shaking 10-20 times before adding another 1 ml in order to avoid the effect of the ions of the liquid during the extraction progress;</p><br />
<p align="justify"> 3.Add 3 ml isooctane once ,shaking for at least 90s, stand for 2min or longer until layering completely;</p><br />
<p align="justify"p>4.Collect 3 ml clear isooctane in a 5 ml EP, Add 800?l cupric-acetate (5% m/v, adjust pH to 6.8 with pyridine), Shaking for 90 seconds, stand for 2min or longer until layering completely;</p><br />
<p align="justify">5.Detect OD of organic phase in a spectrometry at 715nm.</p><br />
<p align="justify"><strong>The Standard Curve</strong></p><br />
<p align="justify">We add 1.6ml, 3.2ml, 4.8ml, 6.4ml, 9.6ml, 11.2ml oleic acid into 3ml M9 medium to generate a gradient. The absorbency is measured as described in the protocol.</p><br />
<p align="justify"><img src="https://static.igem.org/mediawiki/igem.org/5/56/Wps_clip_image-5855.png"alt="Guidence of Student Experiments" height="500" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<p align="justify">We slightly modified the methods provided by Kwon and Rhee, 1986, adding the extraction step, for it is dispensable when bacteria are in the medium. However, the standard curve is still very close to the paper’s, which proves that plausible and accurate</p><br />
<br />
<br />
<br />
<a name="Krebs-Ringer Phosphate(KRPD Buffer Solution)"><h3>Krebs-Ringer Phosphate(KRPD Buffer Solution)</h3></a><br />
<br />
<p align="justify"><strong>Solutions</strong></p><br />
<p align="justify"> Solution A:</p><br />
<p align="justify">For 100 mL: </p><br />
<p align="justify">NaCl 7.5985g ; KCl 0.3727g ; CaCl<sub>2</sub> 0.1054g; glucose-H<sub>2</sub>O 0.9495g, </p><br />
<p align="justify"> Solution A:</p><br />
<p align="justify">For 100 mL: </p><br />
<p align="justify"> NaH<sub>2</sub>PO<sub>4</sub>·2H<sub>2</sub>O 0 .2964g ;Na<sub>2</sub>HPO<sub>4</sub>·12H<sub>2</sub>O 2.9011g,</p><br />
<p align="justify">After dissolving, add MgSO<sub>4</sub>·7H<sub>2</sub>O 0.3130g</p><br />
<p align="justify">Mix A solution and B solution, add 790ml dd H<sub>2</sub>O, then regulate pH to 7.2~7.4 using 1M NaOH/1M HCl, finally add dd H<sub>2</sub>O to a final total volume of 1L. </p><br />
<p align="justify"><strong>Procedures</strong></p><br />
<p align="justify">1. cultivate cells in 1 liter of medium to late exponential phase;</p><br />
<p align="justify">2. harvest by centrifugation at 35℃;</p><br />
<p align="justify">3. wash twice with 2 liters of warm(35℃)0.05M potassium phosphate buffer (pH 7.4) containing 1%(v/v) Triton X-100;</p><br />
<p align="justify">4. resuspend in 0.05M potassium phosphate buffer (pH 7.4) containing mercaptoethanol;</p><br />
<p align="justify">5. add sufficient volume of buffer to give a concentration of about 50mg(dry weight) of cells/ml;</p><br />
<p align="justify">6. disrupt cells with a Bransor Sonifier for 1min. The treatment was applied for 15s intervals, under 4 ℃;</p><br />
<p align="justify"> 7. centrifuge at10,000×g for 30min; </p><br />
<p align="justify">8. decant supernatant liquid for enzymatic assay, the protein concentration was determined by the biuret method;</p><br />
<p align="justify">9.analyze fatty acid oxidation in cell-free extracts</p><br />
<p align="justify">Note: little oxidation was observed when less than 1mg.</p><br />
<p align="justify"><strong>Reaction Mixture</strong></p><br />
<p align="justify">1.0ml of freshly oxygenated Krebs-Ringer phosphate(pH 7.4)</p><br />
<p align="justify">Palmitate-1-14C, 20nmole (80,000 counts/min)</p><br />
<p align="justify">CoA, 1 μ mole</p><br />
<p align="justify">NAD, 1μ mole</p><br />
<p align="justify">ATP, 1μ mole</p><br />
<p align="justify">Succinate, 10 n moles</p><br />
<p align="justify">Supernatant protein, 1~5 mg</p><br />
<p align="justify">dd H<sub>2</sub>O to a final total volume of 2.0ml </p><br />
<br />
<br />
<br />
<br />
<a name="Cellulose Detection"><h3>Cellulose Detection</h3></a><br />
<br />
<p align="justify">1. Inoculate the bacteria into liquid LB medium and then incubate it for 24 hours at 37℃;</p><br />
<p align="justify">2. After centrifugation, supernatant is preserved for use, while deposits are resuspended with PBS and adjust to OD600 1.0;</p><br />
<p align="justify">3. Exceed cellulase was used to digest cellulose in supernatant and deposits. After the cellulase is added, 1mL solution was sampled every 3 min and cellulose of the sample was inactivated immediately;</p><br />
<p align="justify">4. Ten minutes later, the reduce sugar is detected in all the samples with or without cellulose;</p><br />
<br />
<br />
<p align="justify">5. 2mL DNS solution is mixed with the sample, and incubated in boiling water for two minutes, then it is cooled rapidly;</p><br />
<p align="justify">6. After 9 mL ddH<sub>2</sub>O being added into the solution, record absorbance at 540nm;</p><br />
<p align="justify">7.The Standard Curve of glucose concentration</p><br />
<p align="justify"><img src="https://static.igem.org/mediawiki/2012/c/cb/Biao.png" height="148" width="520" hspace="2" vspace="1" border="2" align="top" /></p><br />
<p align="justify"><img src="https://static.igem.org/mediawiki/2012/9/9c/Standard_curve.png" height="680" width="520" hspace="2" vspace="1" border="2" align="top" /></p><br />
<p align="justify">Then all tubes was treated in the same way with that in step 5 and 6.</p><br />
<p align="justify">8.Calculate the amount of cellulose in cell culture.</p><br />
<br />
<a name="In vitro Experiment"><h3>In vitro Experiment</h3></a><br />
<br />
<p align="justify">1. inoculate 100μl bacteria into 100ml LB , shaking at 37C overnight .</P><br />
<p align="justify">2. inoculate 1L LB using the culture above at the next morning , on the scale of 1:20 .</p><br />
<p align="justify">3. Separate above medium into 250ml flask , shaking at 37C for 3-4h .</p><br />
<p align="justify">4. 8000 rpm , 6min to collect the bacteria .</p><br />
<p align="justify">5. Using PBS to resuspend the bacteria to 50mg / ml .</p><br />
<p align="justify">6. Ultrasonication 1min , every 15s having an interval to cool on the ice .</p><br />
<p align="justify">7. Using Coomassie blue staining to measure the concentration of the total protein .</p><br />
<p align="justify">8. In 2ml reaction system , add 5ul oleate ,40 ul Triton 10% , 1ml Krebs-Ringer phosphate buffer , 10nmol succinate , 1 umol COA , 1umol ATP , 1 umol NAD . </p><br />
<p align="justify">9. react at 37C for 6h</p><br />
<br />
<p align="justify">In this experiment , the concentration of total protein in the cell extracts of the five sample are almost the same , so we assume that adding the same volume guarantee the same amount of protein is added . </p><br />
<br />
<p align="justify">The reaction system for the control BBa_R0011+(R0011), BBa_R0011+fadE , BBa_R0011 + fadD , BBa_R0011 + Samonella A Samonella B , BBa_R0011 + fadI fadJ : 1ml Krebs-Ringer phosphate buffer , 10nmol succinate , 1 umol COA , 1umol ATP , 1 umol NAD , 1ml cell extract .</p><br />
<br />
<p align="justify">The reaction system for BBa_R0011+fadD and BBa_R0011+fadE mixture : 2ml Krebs-Ringer phosphate buffer , 20 nmol succinate , 2 umol COA , 2 umol ATP , 2 umol NAD , 1ml cell extract for each gene.</p><br />
<br />
<p align="justify">The reaction system for BBa_R0011+fadD , BBa_R0011+fadE , and BBa_R0011 + Samonella fadA Samonella fadB mixture :<br />
3ml Krebs-Ringer phosphate buffer , 30nmol succinate , 3umol COA , 3umol ATP , 3 umol NAD , 1ml cell extract for each gene.</p><br />
<br />
<p align="justify">The reaction system for BBa_R0011+fadD , BBa_R0011+fadE , BBa_R0011+Samonella A Samonella B , and BBa_R0011+fad I fad J mixture :4ml Krebs-Ringer phosphate buffer , 40nmol succinate , 4umol COA , 4umol ATP , 4 umol NAD , 1ml cell extract for each gene </p><br />
<br />
<br />
<a name="Plate Assay"><h3>Plate Assay</h3></a><br />
<p align="justify">1. J12107- AdrA and control RBS was incubate and vortex in LB medium with Ampicillin overnight</p> <p align="justify">2. OD600 was measured; LB was then added to make the two test tubes had the same OD600</p> <p align="justify">3. Bacteria were inoculated by sterilized needle piercing a pre-labeled 0.3% agar LB semisolid plate for 4-5 minutes in super clean bench.</p> <p align="justify"> 4. Carefully placed the plate horizontally in a 37 degree incubator overnight. Avoid shaking of the plate.</p> <p align="justify">5. Clones on the plate were observed. </p> <br />
<br />
<br />
<a name="Materials and Methods of SDS-PAGE"><h3>Materials and Methods of SDS-PAGE</h3></a><br />
<br />
<p align="justify"><img src="https://static.igem.org/mediawiki/2012/a/ab/BIAO_2.png"alt="Guidence of Student Experiments" height="160" width="520" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<br />
<p align="justify">Coomassie Blue Stain</p><br />
<p align="justify">-Coomassie brilliant blue G-250 50mg</p><br />
<p align="justify">-95% ethanol 25ml</p><br />
<p align="justify">-85%H<sub>3</sub>PO<sub>4</sub> 50ml</p><br />
<p align="justify">-H<sub>2</sub>O, adjust to 500ml</p><br />
<p align="justify">-filter</p><br />
<br />
<p align="justify">Destain solution </p><br />
<p align="justify">-methanol 250ml</p><br />
<p align="justify">-acetic acid 50ml</p><br />
<p align="justify">-H<sub>2</sub>O adjust to 500ml</p><br />
<br />
<p align="justify">2x SDS loading buffer</p><br />
<p align="justify">-0.5mol/l Tirs-HCl(PH6.8) 25ml</p><br />
<p align="justify">-10%SDS 8ml</p><br />
<p align="justify">-50%glycerol 20ml</p><br />
<p align="justify">-2-mercaptoethanol 2ml</p><br />
<p align="justify">-1%Bromphenol Blue 4ml</p><br />
<p align="justify">-H<sub>2</sub>O adjust to 100ml</p><br />
<br />
<p align="justify">10xSDS-PAGE running buffer </p><br />
<p align="justify">Tris base, 30.3 g </p><br />
<p align="justify">M glycine 144.1g</p><br />
<p align="justify">SDS 10 g</p><br />
<p align="justify">-H<sub>2</sub>O adjust to 1L</p><br />
<p align="justify">Steps</p><br />
<br />
<p align="justify">Protein expression</p><br />
<p align="justify">1.inoculate the liquid strains into LB medium supplement with 50μg/mL ampicillin, incubate the medium at at 37℃ until OD600 reaches 0.6;</p><br />
<p align="justify">2. Separate the culture into two test tubes. Add IPTG into one of two tubes at a final concentration of 1mM to induce the expression of </p><br />
<p align="justify">3. 1 mL of the culture is sampled every hour. After centrifugation, deposits was suspended with 300 μL PBS and 200 μL 2x SDS loading buffer, then incubated in boiling water for 15 min.</p><br />
<p align="justify">4. 10μl of samples was load in lanes, run the SDS-PAGE</p><br />
<p align="justify">5. Stained the SDS-PAGE 5 hours</p><br />
<p align="justify">6. Destain the SDS-PAGE until you can see the protein band.</p><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<div class="passage divcell3"><br />
<h3>team history</h3><br />
<p><strong>Dec. 2011</strong></p><br />
<p align="justify">WHU iGEM team was established</p><br />
<p><strong>Dec. 2011 to Feb. 2012</strong></p><br />
<p align="justify">Every one presented their own idea, then we discussed the feasibility of these ideas.</p><br />
<p><strong>Feb. 2012 </strong></p><br />
<p align="justify">The final project was determined, named E.coslim</p><br />
<p><strong>Mar. 2012</strong></p><br />
<p align="justify">We finished an outstanding presentation. Our reply was approved by the leaders of college of life sciences, Wuhan University.</p><br />
<p><strong>Apr. 2012 </strong></p><br />
<p align="justify">Our iGEM team was divided into 3 groups—group of Sheng, group of Xia and group of Mei. </p><br />
<p><strong>Apr. 2012 to prsent</strong></p><br />
<p align="justify">Experiments started….</p><br />
<p><strong>Apr. 2012</strong></p><br />
<p align="justify">Group of Sheng: FADR was connected to pSB1A2 plasmid carrier</p><br />
<p align="justify"> FADR was connected to RFP gene</p><br />
<p align="justify">Group of Xia: starting to connect genes of CI control system </p><br />
<p align="justify"> Testing the function of CI control system</p><br />
<p align="justify">Group of Mei: YhjH/ FadE/ FadD/ FadL gene was connected to pSB1A2 plasmid carrier</p><br />
<br />
<p><strong>May. 2012 </strong></p><br />
<p align="justify">Group of Sheng: FadB/ FadJ gene was connected to pSB1A2 plasmid carrier, then BBa_B0030(RBS) as well</p><br />
<p align="justify">Group of Xia: They devised two promoters p110 and p101, which were expected to be controlled by glucose. However, they failed.</p><br />
<p align="justify">Group of Mei: YhjH/ FadE/ FadD/ FadL gene was connected to BBa_B0030(RBS)</p><br />
<br />
<p><strong>June 2012 </strong></p><br />
<p align="justify">G of S: FadR was connected to low-copied plasmid carrier.</p><br />
<p align="justify"> sFadB and sFadA genes were connected to BBa_B0030 (RBS)</p><br />
<p align="justify"> sFadE gene was connected to pSB1A2 plasmid carrier</p><br />
<p align="justify"> G of X: the connection of genes, which were relative with cellulose, was finished.</p><br />
<p align="justify"> Another two promoter were devised, p1 and p2</p><br />
<p align="justify">G of M: YhjH/ FadE/ FadD/ FadL gene was connected to BBa_B0024 (terminator)</p><br />
<br />
<p><strong>July 2012 </strong></p><br />
<p align="justify">G of S: FadJ was connected to BBa_B0024 (terminator), sFadE gene was copied by PCR technology</p><br />
<p align="justify"> On the front half of this month, they conducted several pre-experiments of oleic acid test</p><br />
<p align="justify"> On the next half month, they started normal experiments of oleic acid test</p><br />
<p align="justify">G of X: started to test the function of p1 and p2</p><br />
<p align="justify">G of M: YhjH/ FadE gene was connected to BBa_J23100 (promoter)</p><br />
<p align="justify"> Finish the standard curve of oleic acid test</p><br />
<br />
<p><strong>Aug. 2012 </strong></p><br />
<p align="justify">G of S: sFadE was induced to point mutation, then it was connected to BBa_B0030 (RBS) and BBa_B0024 (terminator) respectively</p><br />
<p align="justify"> sFadB was connected to BBa_B0030 (RBS) and BBa_B0024 (terminator) respectively.</p><br />
<p align="justify">G of X: test the function of cellulose-controlled genes, having got satisfying results</p><br />
<p align="justify">G of M: copied Adra gene and finished the connection of BBa_B0030 (RBS), BBa_B0024 (terminator) and BBa_J23107 (promoter), BBa_J23114 (promoter) respectively. FadE/YhjH/FadD/fadL were connected to BBa_J23107 (promoter), BBa_J23114 (promoter). </p><br />
<br />
<p><strong>Sep 2012</strong></p><br />
<p align="justify">G of S: Transferred all the parts in pSB1A2 into pSB1C3, Tested the function of PfadR, Characterized the effect of each gene on fatty acid consumption, started to set up the platform for in vitro experiments.</p><br />
<p align="justify">G of X: Transferred all the parts in pSB1A2 into pSB1C3, tested the function of cellulose system. Repeat the test of the function of cellulose-controlled genes.</p><br />
<p align="justify">G of M: Transferred all the parts in pSB1A2 into pSB1C3, test the function of Adra/YhjH.</p></p><br />
<br />
<br />
<br />
</div><br />
<div class="passage divcell4"><br />
<h3>Brainstorming</h3><br />
<br />
<h4>About E.coslim by Kuanwei Sheng</h4><br />
<p align="justify">In order to help people lose weight, besides our three devices, we also have come up with many other creative ways. </p><br />
<br />
<br />
<p align="justify"><strong>Ⅰ.Short chain peptides synthesis</strong></p><br />
<p align="justify">Recent researches have indicated that some short chain peptides in intestine have effect on inhibiting appetites, therefore decrease the food intake. We thus formed the idea that we could synthesis a DNA chain that encodes those short peptides.</p><br />
<br />
<p align="justify"><strong>Ⅱ.Biosynthesis of L-carnitine</strong> </p><br />
<p align="justify">L-carnitine is a molecule that facilitates the progress of transporting fatty acids into mitochondria where these fatty acids will be disintegrated. We once considered use L-carnitine to help the host metabolize fatty acid better. However, the biosynthesis of L-carnitine has too many derivatives or the pathway is patented by others.</p><br />
<br />
<p align="justify"><strong>Ⅲ.Xylose isomerase</strong></p><br />
<p align="justify">Xylose is a prebiotics that can hardly be absorbed by human. We consulted many papers and find that glucose can be converted into xylose by xylose isomerase. Therefore, we thought maybe we could lower the glucose available in intestine by expressing xylose isomerase. However, this process is shown to be reversible latter. Mutated the sequence of the protein may generate high converting rate, yet it is too laborious and risky for a short time project.</p><br />
<br />
<br />
<h4>Other novel ideas</h4><br />
<br />
<p align="justify"><strong>Tackle Water bloom by Tong Wang and Kuanwei Sheng</strong></p><br />
<p align="justify">Since the detrimental effects caused by cyanobacteria to the environment such as making water carcinogenic have become a serve global problem, we therefore tried to employ E.coli as an expression system to eliminate these detrimental effects. When we first took over this project, we thought about limiting the growth of cyanobacteria. Along with the process we got to read a large amount of relevant papers about cyanobacteria, we found that not only the main detrimental effects caused by cyanobacteria is attributed to its product which is a cyclic peptide called microcystin, but also microcystin can regulate the population density. Then we came to realize the importance of microcystin and began to search information about it. Through over this process, we discovered a gene cluster which is responsible for the microcystin degradation pathway. It encodes four enzymes——MlrA、MlrB、MlrC and MlrD. Also, we found that some non-toxic cyclic peptides produced by cyanobacteria such as Anabaenopeptin B and Anabaenopeptin F can induce lysis of cyanobacteria. The latter finding can be utilized as an effective cell population density control mechanism. Thus we thought about constructing two independent systems to eliminate cyanobacteria, one about inducing lysis of cyanobacteria and the other about degrading microcystin. Finally we gave up this project because of the reasons that these gene clusters are too large to be expressed in E.coli and that E.coli cannot survive in the sea, however, we still feel proud of these fancy ideas.</p><br />
<br />
<p align="justify"><strong>Desalination of sea water by Kuanwei Sheng</strong></p><br />
<p align="justify">We came up with the thought that engineering bacteria can intake ions like Na+, cl-, Mg2+ and etc. under special stimulus. Also, under another certain stimulus, the bacteria can export those salts out of cells for reuse. Therefore, we can use these bacteria to desalinize sea water and extract the salt the same time. However, there is no such ion channel that can meet our needs.</p><br />
<br />
<p align="justify"><strong>Sense the earthquake By Min Ye</strong></p><br />
<p align="justify">We once tried to find proteins that can sense vibration and construct a pathway to report that vibration. However, we are not able to find the protein that can meet our needs.</p><br />
<br />
<p align="justify"><strong>Auto plasmid preps By Kuanwei Sheng</strong></p><br />
<p align="justify">We thought about constructing a synthetic protein that combines zinc finger protein which can recognize the specific sequence of DNA and signal peptide that can make proteins be exported out of the bacteria by secretion pathway. Therefore, it is possible that plasmid can be exported out the cells together with the zinc finger protein.</p><br />
<br />
<p align="justify"><strong>Outer Membrane Vesicle (OMV) to treat cancer By Kuanwei Sheng</strong></p><br />
<p align="justify">We thought to use Outer Membrane Vesicle (OMV) to treat cancer. Specifically, we thought about localizing antibody that can recognize certain cancer on the surface of OMVs via signal peptides. Also, we thought we may localize cell division inhibitor protein or protein that lead to cell death inside the OMVs. Therefore, we hoped that the OMV excreted by the bacteria can recognize and kill cancer cells.</p><br />
<br />
<p align="justify"><strong>Multicell Yeast By Wenxiong Zhou</strong></p><br />
<p align="justify"><img src="https://static.igem.org/mediawiki/igem.org/9/96/Wps_clip_image-23886.png " height="288" width="503" hspace="2" vspace="1" border="2" align="top"></p></br><br />
<br />
<p align="justify">Transform the yeast from a single-cell microbe to a multi-cell organism by setting bistability of gene expression among cells of yeasts adhered in amalgamation.</p><br />
<p align="justify"><strong>To kill superbacteria</strong></p><br />
<p align="justify">Now with the spread usage of the antibiotics, many bacteria adopt ability to fight against the antibiotics. And now it’s a big problem that antibiotics are no longer useful as before. So to kill these bacteria, Jing and her group thinks they can device some proteins or artificial micromachine to detect DNA that code proteins contributing to the ability to degenerate antibiotics. And then by transferring these plasmids coding artificial proteins or micromachines, they can inhibit the expression of enzymes or proteins degenerating antibiotics. </p><br />
<br />
<br />
<br />
<br />
</div><br />
<div class="passage divcell5"><br />
<a name="team"><h3><strong>team</strong></h3></a><br />
<p><img src="https://static.igem.org/mediawiki/igem.org/9/93/Finish_presentation_in_whu.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/f/f8/Photo_of_whu_china2.jpg " height="361" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/f/f8/Journey4.jpg " height="343" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/a/a1/Journey3.jpg " height="362" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/3/3b/IMG_1842.jpg " height="336" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/7/70/IMG_1837.JPG " height="392" width="518" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/a/a7/IMG_2021.jpg " height="337" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/2/2d/Photo_of_group1_%282%29.jpg " height="375" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/a/a5/Photo_of_group_2.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/0/0a/........jpg " height="351" width="518" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/a/aa/Journey2.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/7/76/IMG_1759.JPG " height="351" width="518" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/b/b6/IMG_2183.jpg " height="351" width="518" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/f/f4/Journey1.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<br />
<br />
<a name="presentation"><h3><strong>presentation</strong></h3></a><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/e/ee/Discussion11.jpg " height="375" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/d/d9/Presentation_in_whu44.jpg " height="375" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/a/aa/Discussion33.jpg " height="337" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/6/6d/Discussion66.JPG " height="374" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/a/a3/Preparation_for_presentation_in_whu33.jpg " height="353" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/7/76/Preparation_for_presentation_in_HK22.jpg " height="362" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/9/9a/Preparation_for_presentation_in_whu11.jpg " height="359" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/d/d3/Waiting_for_result_of_presentation1.jpg " height="402" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/5/56/Preparation_for_presentation_in_HK11.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<a name="human practice"><h3><strong>human practice</strong></h3></a><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/1/12/Human_practice2.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/1/1f/Human_practice3.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/a/a4/Human_practice4.jpg " height="383" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/9/97/Human_practice5.jpg " height="409" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/2/2a/Human_practice6.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/8/8b/Human_practice8.jpg " height="378" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/1/1a/Human_practice9.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/0/08/Human_practice10.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/5/56/Human_practice12.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/a/ae/Human_practice20.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/0/00/Human_practice27.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/7/7b/Human_practice28.jpg " height="381" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/2/26/Human_practice29.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/6/63/IMG_0175.JPG " height="518" width="393" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/5/5b/Poster.jpg " height="353" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/5/54/Human_practice24.jpg " height="353" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<br />
<br />
<br />
<a name="doodle"><h3><strong>doodle</strong></h3></a><br />
<p><img src="https://static.igem.org/mediawiki/2012/7/7f/Untitled.jpg " height="439" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/4/40/Funny5.jpg " height="530" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/b/be/Funny4.jpg " height="490" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/a/ad/Funny6.jpg " height="666" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/7/77/Lab1.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/9/99/Team_clothes1.jpg " height="250" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/4/4d/Team_clothes2.jpg " height="495" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/1/18/Team_clothes3.jpg " height="500" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/5/50/Team_clothes4.jpg "alt=" height="500" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/b/b4/Team_clothes5.jpg " height="250" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/d/d4/E.coslim2.JPG " height="300" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/7/7f/Funny8.jpg " height="495" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/d/d7/Funny9.jpg " height="500" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/7/71/Poster1.jpg " height="707" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/f/f9/Poster2.jpg " height="707" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/c/c2/Poster3.jpg " height="666" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/f/fc/Poster4.jpg " height="707" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/8/8c/Wiki3.jpg " height="335" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/f/f9/Wiki5.jpg" height="400" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/4/4a/Wiki6.jpg" height="435" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<br />
<br />
<br />
<br />
<a name="funny pictures"><h3><strong>funny pictures</strong></h3></a><br />
<p><img src="https://static.igem.org/mediawiki/2012/b/bc/Funny_picture1.jpg " height="356" width="400" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/1/10/Funny_picture2.jpg " height="356" width="400" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/3/3d/Funny_picture3.jpg " height="356" width="400" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/7/74/Funny_picture4.jpg " height="356" width="400" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/d/de/Funny_picture5.jpg " height="358" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/b/bd/IMG_0004.JPG " height="393" width="518" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/a/a8/IMG_0074.JPG " height="600" width="455" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/c/c1/IMG_0076.JPG " height="518" width="393" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/e/e4/IMG_0096.JPG " height="518" width="393" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/5/56/IMG_0109.JPG " height="518" width="393" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/4/4e/IMG_0117.JPG " height="600" width="450" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/6/6f/IMG_0135.JPG " height="518" width="393" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/b/be/IMG_0343.JPG " height="518" width="393" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/f/f6/IMG_0344.JPG " height="600" width="450" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/4/45/IMG_0349.JPG " height="599" width="428" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/7/75/IMG_2312.jpg " height="351" width="518" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/c/cb/Lab2.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/1/1b/Suoge%27s_birthday.jpg " height="599" width="428" hspace="2" vspace="1" border="2" align="top" /></p><br />
</div> <br />
<div class="passage divcell6"><br />
<h3><strong>A Letter from Fancy</strong></h3><br />
<p align="left">There is a very meaningful sentence in the novel The Lord of the Ring: when the respected old Billbo was going to leave the village in which he had lived for many years, he gave a lecture--”The people among you whom I recognize haven’t reached half whom I should do, besides, among those whom I love are less than the half I should do, either.</p><br />
<p align="left">None of us need to fight in a war or fight with monsters. However, all of us have indeed fought and stuck to the very end, regardless of whatever obstacles to overcome and whatever precious to sacrifice.</p><br />
<p align="left">The greatness lies in the persistence to do the ordinary things perfectly. We are all inspired by our design. However, the gap between the repetitive, seemingly endless molecular cloning and the last magic probiotic can easily wreck the passion. To the opposite, most of us have successfully endured the monotonous life. Sometimes the enzymes just don’t function well. Other times the PCR never get right for some unclear reasons. We just survived those really despair moments and made one step closer to our goal.</p><br />
<p align="left">And those heart-touching scenes are clear as if they happened yesterday. Regardless of our persuation to wait for the rain to stop, our captain determined to fetch the induction cooker in his dormitory to perform an reaction as soon as possible (We don’t have an appropriate heater in our lab). When his figure disappeared in the dark and rain, words failed me; when I got a message at 3 o’ clock in the midnight, the excited tune claiming that we no longer needed to worry about our competent cells overwhelmed me with tears; when I heard that our “artist” having caught a cold but promised that he would complete all the pictures of the web site in time, I fell into silence again; every time when Xian Xia stayed overnight in the lab, the room would be quite tidy and all the reagents would got replenished. When I saw this in the next morning, I was greatly touched.</p><br />
<p align="left">Most of us has sacrificed much time to pursue personal interest. We just decrease the time for required exams for going abroad, for working in our own labs, and for some courses we are really interested in, let alone our hobbies. No time for travelling, reading lasted paper on interested topics, shopping, chatting with friends and so on. However, after the complaints and anguish, we finally reached such a peaceful and simple spiritual state that we just want to try our best to get the best result.</p><br />
<p align="left">A man who never experienced iGEM in WHU can never really understand the complex of feelings: glory and dream, perseverance and persistence, joy and tears. You can never image how brave and respected my teammates are, how many efforts and love they have put in the team, and how strong the relationship we have built since the team has been organised.<br />
<br />
</p><br />
</div> <br />
</div><br />
<em class="clear"></em><br />
</div><br />
<div class="footer"></div><br />
</div><br />
<script src="http://www.yichengliu.com/code/igem/notebooks.js"></script><br />
</body><br />
</html></div>Nanhaihttp://2012.igem.org/Team:WHU-China/NotebooksTeam:WHU-China/Notebooks2012-10-26T19:36:02Z<p>Nanhai: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<body><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script><br />
function picObj(src, title, detail, href){<br />
this.src = src;<br />
this.title = title;<br />
this.detail = detail;<br />
this.href = href;<br />
}<br />
//*************************自定义数据部分*************************<br />
<br />
//定义菜单及侧边栏数据<br />
var menuObj = {<br />
Home : [<br />
{<br />
title : "<strong>what's new</strong>",<br />
picArray : [<br />
new picObj("http://imgsrc.baidu.com/forum/pic/item/d25e8bd4b31c87011d9cdb7c277f9e2f0708ff34.jpg", "one piece", "yi zhang haizeiwang de tu", "http://tieba.baidu.com/f?kw=%BA%A3%D4%F4%CD%F5"),<br />
new picObj("http://imgsrc.baidu.com/forum/pic/item/d25e8bd4b31c87011d9cdb7c277f9e2f0708ff34.jpg", "one piece", "yi zhang haizeiwang de tu", "http://tieba.baidu.com/f?kw=%BA%A3%D4%F4%CD%F5"),<br />
new picObj("http://imgsrc.baidu.com/forum/pic/item/d25e8bd4b31c87011d9cdb7c277f9e2f0708ff34.jpg", "one piece", "yi zhang haizeiwang de tu", "http://tieba.baidu.com/f?kw=%BA%A3%D4%F4%CD%F5")<br />
]<br />
},<br />
{<br />
title : "<strong>pathway introduction</strong>",<br />
picArray : [<br />
new picObj("2.png", "title 2", "pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1production 1", "#"),<br />
new picObj("2.png", "title 2", "pathway introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2", "#"),<br />
new picObj("2.png", "title 2", "pathway introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3", "#")<br />
]<br />
},<br />
{<br />
title : "<strong>future prospective</strong>",<br />
picArray : [<br />
new picObj("3.png", "title 3", "future prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1utureive 1", "#"),<br />
new picObj("3.png", "title 3", "future prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospecpective 2", "#"),<br />
new picObj("3.png", "title 3", "future prospective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3", "#")<br />
]<br />
},<br />
{<br />
title : "<strong>about us</strong>",<br />
picArray : [<br />
new picObj("4.png", "title 4", "about us 1", "#"),<br />
new picObj("4.png", "title 4", "about us 2", "#"),<br />
new picObj("4.png", "title 4", "about us 3", "#")<br />
]<br />
}<br />
],<br />
Team : [<br />
{<br />
title : '<strong>Members</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Instructors</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Team History</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>about WHU</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>about Our Lab</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Acknol-</br>edgements</strong>',<br />
dir : []<br />
},<br />
<br />
],<br />
Project : [<br />
{<br />
title : '<strong>Outline</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Background</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Promoter Design</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device I: Fatty Acid Degradation</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device II: Cellulose Synthesis</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device III: Colonization</strong>',<br />
dir : []<br />
},<br />
],<br />
Modeling : [<br />
{<br />
title : '<strong>Future Perspectives</strong>',<br />
dir : []<br />
},<br />
<br />
{<br />
title : '<strong>Model I: Fatty Acid Degradation</strong>',<br />
dir : [<br />
{<br />
title : 'The Ordinary Differential Equations of the Model',<br />
href : '#The Ordinary Differential Equations of the Model'<br />
},<br />
{<br />
title : 'Analysis on the Steady State of the ODE',<br />
href : '#Analysis on the Steady State of the ODE'<br />
},<br />
{<br />
title : 'Parameter Screening',<br />
href : '#Parameter Screening'<br />
},<br />
{<br />
title : 'Conclusion',<br />
href : '#Conclusion'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Model II: Microbiota Regulation</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Software Tool: FANCY</strong>',<br />
dir : []<br />
}<br />
],<br />
Notebooks : [<br />
{<br />
title : '<strong>Parts</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Safety</strong>',<br />
dir : [<br />
{<br />
title : 'Brief Answers to Safety Questions',<br />
href : '#Brief Answers to Safety Questions'<br />
},<br />
{<br />
title : 'General Safety Issues',<br />
href : '#General Safety Issues'<br />
},<br />
{<br />
title : 'Safety Considerations of Our Biobrick parts and Our Project',<br />
href : '#Safety Considerations of Our Biobrick parts and Our Project'<br />
},<br />
{<br />
title : 'Safety Management and Practice',<br />
href : '#Safety Management and Practice'<br />
},<br />
{<br />
title : 'Biosafety and Publicity',<br />
href : '#Biosafety and Publicity'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Protocols</strong>',<br />
dir : [<br />
{<br />
title : 'Protocol for fluorescence measurement',<br />
href : '#Protocol for fluorescence measurement'<br />
},<br />
{<br />
title : 'Protocols of Cupric-Soap Reaction',<br />
href : '#Protocols of Cupric-Soap Reaction'<br />
},<br />
{<br />
title : 'Krebs-Ringer Phosphate(KRPD Buffer Solution)',<br />
href : '#Krebs-Ringer Phosphate(KRPD Buffer Solution)'<br />
},<br />
{<br />
title : 'Cellulose Detection',<br />
href : '#Cellulose Detection'<br />
},<br />
{<br />
title : 'The Standard Curve',<br />
href : '#The Standard Curve'<br />
},<br />
<br />
{<br />
title : 'In vitro Experiment',<br />
href : '#In vitro Experiment'<br />
},<br />
{<br />
title : 'Plate Assay',<br />
href : '#Plate Assay'<br />
},<br />
{<br />
title : 'Materials and Methods of SDS-PAGE',<br />
href : '#Materials and Methods of SDS-PAGE'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Events</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Brain-</br>storming</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Gallery</strong>',<br />
dir : [<br />
{<br />
title : 'team',<br />
href : '#team'<br />
},<br />
{<br />
title : 'presentation',<br />
href : '#presentation'<br />
},<br />
{<br />
title : 'human practice',<br />
href : '#human practice'<br />
},<br />
{<br />
title : 'doodle',<br />
href : '#doodle'<br />
},<br />
{<br />
title : 'funny pictures',<br />
href : '#funny pictures'<br />
}]},<br />
{<br />
title : '<strong>A Letter from Fancy</strong>',<br />
dir : []<br />
<br />
<br />
}<br />
],<br />
HumanPractice : [<br />
{<br />
title : '<strong>Outline</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Questionaire Survey</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Publicity</strong>',<br />
dir : []<br />
}<br />
]<br />
}; <br />
//*************************自定义数据部分*************************<br />
</script><br />
<style type="text/css"><br />
/*<br />
* base css, DO NOT MODIFY!<br />
*/<br />
* {<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
font-family: "Verdana", sans-serif;<br />
color: #333;<br />
list-style: none;<br />
outline: none;<br />
resize: none;<br />
}<br />
html {<br />
overflow-y: scroll;<br />
}<br />
body {<br />
background: url("https://static.igem.org/mediawiki/2012/6/69/Body-bg2.jpg") center center fixed;<br />
}<br />
a {<br />
text-decoration: none;<br />
}<br />
.clear {<br />
width: 0;<br />
height: 0;<br />
line-height: 0;<br />
display: block;<br />
clear: both;<br />
}<br />
<br />
/*<br />
* common css, include "header","footer"...<br />
*/<br />
div.center {<br />
width: 940px;<br />
margin: 0 auto;<br />
}<br />
div.header {<br />
width: 940px;<br />
height: 357px;<br />
background: url("https://static.igem.org/mediawiki/2012/8/80/Header-bg2.png") no-repeat;<br />
position: relative;<br />
z-index: 50;<br />
}<br />
div.nav {<br />
position: absolute;<br />
height: 80px;<br />
top: 206px;<br />
left: 350px;<br />
}<br />
li.nav-outerLi {<br />
display: block;<br />
float: left;<br />
width: 80px;<br />
height: 80px;<br />
margin: 0 6px;<br />
cursor: pointer;<br />
}<br />
h2.nav-h21,h2.nav-h22,h2.nav-h23,h2.nav-h24,h2.nav-h25,h2.nav-h26 {<br />
display: block;<br />
background: url("https://static.igem.org/mediawiki/2012/9/91/Nav-tabs.png") no-repeat;<br />
width: 80px;<br />
height: 80px;<br />
background-position: 0 0;<br />
z-index: 150;<br />
position: relative;<br />
}<br />
h2.nav-h22 {<br />
background-position: -80px 0;<br />
}<br />
h2.nav-h23 {<br />
background-position: -160px 0;<br />
}<br />
h2.nav-h24 {<br />
background-position: -240px 0;<br />
}<br />
h2.nav-h25 {<br />
background-position: -320px 0;<br />
}<br />
h2.nav-h26 {<br />
background-position: -400px 0;<br />
}<br />
h2.nav-h21:hover {<br />
background-position: 0 -80px;<br />
}<br />
h2.nav-h22:hover {<br />
background-position: -80px -80px;<br />
}<br />
h2.nav-h23:hover {<br />
background-position: -160px -80px;<br />
}<br />
h2.nav-h24:hover {<br />
background-position: -240px -80px;<br />
}<br />
h2.nav-h25:hover {<br />
background-position: -320px -80px;<br />
}<br />
h2.nav-h26:hover {<br />
background-position: -400px -80px;<br />
}<br />
h2.nav-h21on {<br />
background-position: 0 -160px;<br />
}<br />
h2.nav-h22on {<br />
background-position: -80px -160px;<br />
}<br />
h2.nav-h23on {<br />
background-position: -160px -160px;<br />
}<br />
h2.nav-h24on {<br />
background-position: -240px -160px;<br />
}<br />
h2.nav-h25on {<br />
background-position: -320px -160px;<br />
}<br />
h2.nav-h26on {<br />
background-position: -400px -160px;<br />
}<br />
ul.nav-innerUl{<br />
position: absolute;<br />
top: 40px;<br />
padding-top: 40px;<br />
width: 76px;<br />
border-left: 2px solid #000;<br />
border-right: 2px solid #000;<br />
z-index: 140;<br />
display: none;<br />
}<br />
em.nav-libg{<br />
display: block;<br />
width: 96px;<br />
height: 11px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/48/Nav-libg.png');<br />
margin-left: -10px;<br />
}<br />
ul.nav-innerUl1{<br />
background: #fffaca;<br />
}<br />
ul.nav-innerUl2{<br />
background: #dedede;<br />
}<br />
ul.nav-innerUl3{<br />
background: #d9f0c9;<br />
}<br />
ul.nav-innerUl4{<br />
background: #f6e5ff;<br />
}<br />
ul.nav-innerUl5{<br />
background: #ebfcff;<br />
}<br />
ul.nav-innerUl6{<br />
background: #ffeee8;<br />
}<br />
li.nav-innerLi{<br />
font-size: 10px;<br />
line-height: 14px;<br />
padding: 3px 5px;<br />
}<br />
li.nav-innerLi:hover{<br />
background: #fff;<br />
}<br />
div.middle {<br />
width: 940px;<br />
background: #e6deb8;<br />
background: rgba(230,222,184,0.5);<br />
position: absolute;<br />
top: 178px;<br />
}<br />
div.aside {<br />
width: 174px;<br />
height: 441px;<br />
background: url("https://static.igem.org/mediawiki/2012/9/96/Aside-bg2.png") no-repeat;<br />
margin-left: 10px;<br />
float: left;<br />
padding: 179px 86px 0 40px;<br />
}<br />
div.asideFixed {<br />
position: fixed;<br />
top: 0;<br />
}<br />
ul.aside-outerUl {<br />
position: relative;<br />
margin: 7px 10px;<br />
}<br />
li.aside-outerLi {<br />
margin: 10px 0;<br />
}<br />
li.aside-outerLi h2{<br />
padding: 4px 0;<br />
color: #725718;<br />
background: #fff1a9;<br />
font-size: 14px;<br />
line-height: 22px;<br />
font-weight: bold;<br />
text-align: center;<br />
cursor: pointer;<br />
}<br />
li.aside-outerLi:hover h2{<br />
background: #fff8d3;<br />
}<br />
ul.aside-innerUl {<br />
display: none;<br />
}<br />
ul.aside-innerUl li {<br />
background: #bdc9ad;<br />
margin: 3px 0;<br />
font-family: arial, sans-serif;<br />
font-size: 14px;<br />
line-height: 22px;<br />
text-align: center;<br />
cursor: pointer;<br />
}<br />
ul.aside-innerUl li:hover{<br />
background: #d4dcc9;<br />
}<br />
div.main {<br />
width: 580px;<br />
border: 1px solid #9e8366;<br />
background: #f0e2c1;<br />
float: right;<br />
margin: 149px 30px 30px 0;<br />
}<br />
div.passage {<br />
display: none;<br />
margin: 30px;<br />
}<br />
div.show{<br />
display: block;<br />
}<br />
div.passage h3 {<br />
font-size: 26px;<br />
line-height: 39px;<br />
font-weight: bold;<br />
background: #859f93;<br />
color: #f0e2c1;<br />
display: block;<br />
width: auto;<br />
padding: 0 10px;<br />
}<br />
div.passage p {<br />
margin: 14px 0;<br />
font-size: 13px;<br />
line-height: 20px;<br />
}<br />
div.passage img {<br />
display: block;<br />
float: right;<br />
padding: 0 0 20px 30px;<br />
background: #f0e2c1;<br />
}<br />
div.footer {<br />
}<br />
#p-logo {<br />
display:none;<br />
}<br />
#top-section {<br />
height:0;<br />
border:none;<br />
}<br />
#search-controls {<br />
display:none;<br />
}<br />
#content {<br />
position:inherit;<br />
width:inherit;<br />
margin:0;<br />
padding:0;<br />
background:inherit;<br />
color:inherit;<br />
border:none;<br />
line-height:inherit;<br />
z-index:2;<br />
}<br />
.firstHeading {<br />
display:none;<br />
}<br />
#catlinks {<br />
display:none;<br />
}<br />
#footer-box {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#menubar ul li a {<br />
background:none;<br />
}<br />
#bodyContent h1,#bodyContent h2 {<br />
margin:0;<br />
border:0;<br />
padding: 0;<br />
}<br />
#bodyContent h2.nav-h2-title{<br />
padding: 5px 0;<br />
}<br />
.left-menu:hover {<br />
background:none;<br />
}<br />
.nav-bg-logo{<br />
float: left;<br />
}<br />
</style><br />
</head><br />
<body><br />
<div class="center"><br />
<div class="header"><br />
<img class="nav-bg-logo" src="https://static.igem.org/mediawiki/2012/4/44/Nav-bg-logo1.png" /><br />
<div class="nav"><br />
<ul class="nav-outerUl"><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China"><h2 class="nav-h21" title="Home"></h2></a><br />
<ul class="nav-innerUl nav-innerUl1" name="Home"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Team"><h2 class="nav-h22" title="Team"></h2></a><br />
<ul class="nav-innerUl nav-innerUl2" name="Team"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Project"><h2 class="nav-h23" title="Project"></h2></a><br />
<ul class="nav-innerUl nav-innerUl3" name="Project"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Modeling"><h2 class="nav-h24" title="Modeling"></h2></a><br />
<ul class="nav-innerUl nav-innerUl4" name="Modeling"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Notebooks"><h2 class="nav-h25 nav-h25on" title="Notebooks"></h2></a><br />
<ul class="nav-innerUl nav-innerUl5" name="Notebooks"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/HumanPractice"><h2 class="nav-h26" title="Human Practice"></h2></a><br />
<ul class="nav-innerUl nav-innerUl6" name="HumanPractice"></ul><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div class="middle"><br />
<div class="aside"><br />
<ul class="aside-outerUl"></ul><br />
</div><br />
<div class="main"><br />
<div class="passage divcell0"><br />
<table class=" pgrouptable tablesorter" cellspacing="0" cellpadding="0" style="width: 100%;"><thead><br />
<tr><th class="header" style="width:8px"></th><th class="header" style="width:8px"></th><th class="header" style="width:8px"></th><th class="header" style="width: 87px;">Name</th><th class="header" style="width: 80px" colspan="">Type</th><th class="header" style="width: auto;" colspan="">Description</th><th class="header" style="width: 150px" colspan="">Designer</th><th class="header" style="width: 50px" colspan="">Length</th><br />
</tr></thead><tbody><br />
<tr><br />
<td class="status_cell heart13">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861060">BBa_K861060</a></td><td>Regulatory</td><td>PfadR, synthetic promoter with tandem FadR binding site</td><td width="100px">Kuanwei Sheng</td><td align="right">76</td><br />
</tr><br />
<tr><br />
<td class="status_cell heart13">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861171">BBa_K861171</a></td><td>Regulatory</td><td>Pcar, synthetic promoter repressed by CRP</td><td width="100px">Kuanwei Sheng</td><td align="right">36</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861001">BBa_K861001</a></td><td>Generator</td><td>FadL with a strong RBS and a double terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">1465</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_green">W</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861002">BBa_K861002</a></td><td>Generator</td><td>Constitutively expressed FadL</td><td width="100px">Kuanwei Sheng</td><td align="right">1508</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861003">BBa_K861003</a></td><td>Generator</td><td>PfadR regulated FadL</td><td width="100px">Kuanwei Sheng</td><td align="right">1549</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861010">BBa_K861010</a></td><td>Coding</td><td>FadD, an inner membrane-associated acyl-CoA synthase</td><td width="100px">Kuanwei Sheng</td><td align="right">1605</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861011">BBa_K861011</a></td><td>Generator</td><td>FadD with RBS and terminator.</td><td width="100px">Kuanwei Sheng</td><td align="right">1729</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861013">BBa_K861013</a></td><td>Generator</td><td>IPTG induced FadD</td><td width="100px">Kuanwei Sheng</td><td align="right">1792</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861014">BBa_K861014</a></td><td>Generator</td><td>Constitutively expressed FadD</td><td width="100px">Kuanwei Sheng</td><td align="right">1772</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861015">BBa_K861015</a></td><td>Generator</td><td>Constitutively expressed FadD</td><td width="100px">Kuanwei Sheng</td><td align="right">1772</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861016">BBa_K861016</a></td><td>Generator</td><td>PfadR regulated FadD</td><td width="100px">Kuanwei Sheng</td><td align="right">1813</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861020">BBa_K861020</a></td><td>Coding</td><td>FadE ,acyl-CoA dehydrogenase </td><td width="100px">Kuanwei Sheng</td><td align="right">2445</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861021">BBa_K861021</a></td><td>Coding</td><td>FadE gene for fatty acid degradation from <i>Salmonella enterica</i> LT2</td><td width="100px">Kuanwei Sheng</td><td align="right">2592</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861022">BBa_K861022</a></td><td>Generator</td><td>FadE with RBS and terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">2569</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861023">BBa_K861023</a></td><td>Generator</td><td>S-FadE with a RBS and a terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">2716</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861024">BBa_K861024</a></td><td>Generator</td><td>IPTG induced FadE</td><td width="100px">Kuanwei Sheng</td><td align="right">2632</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861025">BBa_K861025</a></td><td>Generator</td><td>Constitutively expressed FadE</td><td width="100px">Kuanwei Sheng</td><td align="right">2612</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861026">BBa_K861026</a></td><td>Generator</td><td>Constitutively expressed FadE</td><td width="100px">Kuanwei Sheng</td><td align="right">2612</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861027">BBa_K861027</a></td><td>Generator</td><td>Constitutively expressed FadE</td><td width="100px">Kuanwei Sheng</td><td align="right">2612</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861028">BBa_K861028</a></td><td>Generator</td><td>PfadR regulated FadE</td><td width="100px">Kuanwei Sheng</td><td align="right">2653</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861029">BBa_K861029</a></td><td>Regulatory</td><td>PfadR regulated S-FadE</td><td width="100px">Kuanwei Sheng</td><td align="right">2800</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861030">BBa_K861030</a></td><td>Coding</td><td>FadB, gene for fatty acid degradation from E.coli K12</td><td width="100px">Kuanwei Sheng</td><td align="right">1164</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861031">BBa_K861031</a></td><td>Coding</td><td>FadJ, gene for fatty acid degradation from <i>E.coli str. K12</i></td><td width="100px">Kuanwei Sheng</td><td align="right">2145</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861032">BBa_K861032</a></td><td>Coding</td><td> S-FadB gene for fatty acid degradation from <i>Salmonella enterica</i> LT2</td><td width="100px">Kuanwei Sheng</td><td align="right">2190</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861033">BBa_K861033</a></td><td>Generator</td><td>FadB with a RBS and a terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">1288</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861034">BBa_K861034</a></td><td>Generator</td><td> FadJ gene with a RBS and a terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">2269</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861035">BBa_K861035</a></td><td>Generator</td><td>S-FadB with a RBS and a terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">2314</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861036">BBa_K861036</a></td><td>Generator</td><td>IPTG induced FadA and FadB</td><td width="100px">Kuanwei Sheng</td><td align="right">2544</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861037">BBa_K861037</a></td><td>Generator</td><td>IPTG induced FadI and FadJ</td><td width="100px">Kuanwei Sheng</td><td align="right">3672</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861038">BBa_K861038</a></td><td>Generator</td><td>IPTG induced S-FadA and S-FadB</td><td width="100px">Kuanwei Sheng</td><td align="right">3673</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861041">BBa_K861041</a></td><td>Coding</td><td>FadI, gene for fatty acid degradation from <i>E.coli str. K12</i></td><td width="100px">Kuanwei Sheng</td><td align="right">1311</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861042">BBa_K861042</a></td><td>Coding</td><td>FadA, gene for fatty acid degradation from <i>Salmonella enterica</i> LT2</td><td width="100px">Kuanwei Sheng</td><td align="right">1164</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861043">BBa_K861043</a></td><td>Translational_Unit</td><td>FadA with a RBS</td><td width="100px">Kuanwei Sheng</td><td align="right">1185</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861044">BBa_K861044</a></td><td>Translational_Unit</td><td>FadI with a RBS</td><td width="100px">Kuanwei Sheng</td><td align="right">1332</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861045">BBa_K861045</a></td><td>Generator</td><td>S-FadA with a RBS and a terminator </td><td width="100px">Kuanwei Sheng</td><td align="right">1288</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861046">BBa_K861046</a></td><td>Generator</td><td>PfadR regulated FadA and FadB</td><td width="100px">Kuanwei Sheng</td><td align="right">2565</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861047">BBa_K861047</a></td><td>Generator</td><td>PfadR regulated FadI and FadJ</td><td width="100px">Kuanwei Sheng</td><td align="right">3693</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861048">BBa_K861048</a></td><td>Generator</td><td>PfadR regulated S-FadA and S-FadB</td><td width="100px">Kuanwei Sheng</td><td align="right">3591</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861050">BBa_K861050</a></td><td>Coding</td><td>FadR, fatty acid sensor from <i>E.coli str. K12</i></td><td width="100px">Kuanwei Sheng</td><td align="right">720</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861051">BBa_K861051</a></td><td>Generator</td><td>FadR with a RBS and a terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">844</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861052">BBa_K861052</a></td><td>Generator</td><td>Constitutive expressed FadR</td><td width="100px">Kuanwei Sheng</td><td align="right">887</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861061">BBa_K861061</a></td><td>Reporter</td><td>Efficacy testing RFP generator of BBa_K861060 (PfadR)</td><td width="100px">Kuanwei Sheng</td><td align="right">945</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861062">BBa_K861062</a></td><td>Regulatory</td><td>PfadR with FadR overexpressed</td><td width="100px">Kuanwei Sheng</td><td align="right">1840</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_green">W</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861070">BBa_K861070</a></td><td>Coding</td><td>AdrA gene from E.coli K12</td><td width="100px">Kuanwei Sheng</td><td align="right">1167</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_green">W</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861071">BBa_K861071</a></td><td>Generator</td><td>AdrA gene with a RBS and a terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">1293</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_green">W</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861072">BBa_K861072</a></td><td>Generator</td><td>Constitutively expressed AdrA</td><td width="100px">Kuanwei Sheng</td><td align="right">1336</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_green">W</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861073">BBa_K861073</a></td><td>Generator</td><td>Constitutively expressed AdrA</td><td width="100px">Kuanwei Sheng</td><td align="right">1336</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861074">BBa_K861074</a></td><td>Generator</td><td>Pcar regulated AdrA</td><td width="100px">Kuanwei Sheng</td><td align="right">1337</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861090">BBa_K861090</a></td><td>Coding</td><td>YhjH Gene From <i>E.coli str. K12</i></td><td width="100px">Kuanwei Sheng</td><td align="right">768</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861091">BBa_K861091</a></td><td>Generator</td><td>YhjH gene with a RBS and a Terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">892</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861100">BBa_K861100</a></td><td>Coding</td><td>BcsA,cellulose synthetase, catalytic subunit</td><td width="100px">Xian Xia</td><td align="right">2619</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861101">BBa_K861101</a></td><td>Generator</td><td>BcsA with RBS and terminator</td><td width="100px">Xian Xia</td><td align="right">2743</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861102">BBa_K861102</a></td><td>Generator</td><td> BcsA controlled by promoter repressed by CRP</td><td width="100px">Xian Xia</td><td align="right">2787</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861110">BBa_K861110</a></td><td>Coding</td><td>BcsB,regulator of cellulose synthetase</td><td width="100px">Xian Xia</td><td align="right">2340</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861111">BBa_K861111</a></td><td>Generator</td><td>BcsB with RBS and terminator</td><td width="100px">Xian Xia</td><td align="right">2464</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861112">BBa_K861112</a></td><td>Generator</td><td>BcsB controlled by promoter repressed by CRP</td><td width="100px">Xian Xia</td><td align="right">2508</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861120">BBa_K861120</a></td><td>Coding</td><td>BcsZ, endo-1,4-D-glucanase</td><td width="100px">Xian Xia</td><td align="right">1107</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861121">BBa_K861121</a></td><td>Generator</td><td>BcsZ with RBS and terminator</td><td width="100px">Xian Xia</td><td align="right">1231</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861122">BBa_K861122</a></td><td>Generator</td><td>BcsZ generator repressed by CRP (directly)</td><td width="100px">Xian Xia</td><td align="right">1275</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861130">BBa_K861130</a></td><td>Coding</td><td>BcsC,cellulose synthetase subunit</td><td width="100px">Xian Xia</td><td align="right">3474</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861131">BBa_K861131</a></td><td>Generator</td><td>BcsC with RBS and terminator</td><td width="100px">Xian Xia</td><td align="right">3598</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861132">BBa_K861132</a></td><td>Generator</td><td>BcsC controlled by promoter repressed by CRP</td><td width="100px">Xian Xia</td><td align="right">3642</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861140">BBa_K861140</a></td><td>Coding</td><td> GalU,glucose-1-phosphate uridylyltransferase</td><td width="100px">Chang Liu</td><td align="right">909</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861141">BBa_K861141</a></td><td>Generator</td><td>GalU with a RBS and a terminator</td><td width="100px">Xian Xia</td><td align="right">1033</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861142">BBa_K861142</a></td><td>Generator</td><td>GalU generator repressed by CRP (directly)</td><td width="100px">Xian Xia</td><td align="right">1077</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861150">BBa_K861150</a></td><td>Coding</td><td>GalF, putative regulatory subunit for GalU </td><td width="100px">Xian Xia</td><td align="right">894</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861151">BBa_K861151</a></td><td>Generator</td><td>GalF with a RBS and a terminator</td><td width="100px">Xian Xia</td><td align="right">1018</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861152">BBa_K861152</a></td><td>Generator</td><td>GalF generator repressed by CRP (directly)</td><td width="100px">Xian Xia</td><td align="right">1062</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861160">BBa_K861160</a></td><td>Coding</td><td>CRP, cAMP receptor protein</td><td width="100px">Kuanwei Sheng</td><td align="right">633</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861161">BBa_K861161</a></td><td>Generator</td><td>CRP with a RBS and a terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">757</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861162">BBa_K861162</a></td><td>Generator</td><td>Constitutively expresses Crp</td><td width="100px">Xian Xia, Kuanwei Sheng</td><td align="right">800</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861163">BBa_K861163</a></td><td>Generator</td><td>Constitutively expresses Crp</td><td width="100px">Xian Xia</td><td align="right">800</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861169">BBa_K861169</a></td><td>Regulatory</td><td>Indirect regulatory device, activated at high glucose concentration</td><td width="100px">Kuanwei Sheng</td><td align="right">1961</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861170">BBa_K861170</a></td><td>Regulatory</td><td>PI ,Glucose-activated promoter</td><td width="100px">Kuanwei Sheng</td><td align="right">36</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861172">BBa_K861172</a></td><td>Generator</td><td> lambda cI generator controlled by PcstA (glucose-repressible promoter)</td><td width="100px">Xian Xia</td><td align="right">1069</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861173">BBa_K861173</a></td><td>Reporter</td><td>mRFP generator controlled by PcstA (glucose-repressible promoter)</td><td width="100px">Kuanwei Sheng, Xian Xia</td><td align="right">1000</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861174">BBa_K861174</a></td><td>Regulatory</td><td>A control device for BBa_K861169</td><td width="100px">Xian Xia</td><td align="right">1899</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861175">BBa_K861175</a></td><td>Reporter</td><td>Efficacy testing RFP generator of BBa_K861170 (PI)</td><td width="100px">Kuanwei Shneg, Xian Xia</td><td align="right">905</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861176">BBa_K861176</a></td><td>Reporter</td><td>mRFP expressed after Pcar</td><td width="100px">Kuanwei Sheng, Xian Xia</td><td align="right">905</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861177">BBa_K861177</a></td><td>Generator</td><td>K861162+ K861175 </td><td width="100px">Kuanwei Sheng</td><td align="right">1713</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861178">BBa_K861178</a></td><td>Device</td><td>Pcar efficacy testing device with CRP overexpressed</td><td width="100px">Kuanwei Sheng, Xian Xia</td><td align="right">1713</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861179">BBa_K861179</a></td><td>Generator</td><td>K861162+J23119</td><td width="100px">Chang Liu</td><td align="right">843</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861345">BBa_K861345</a></td><td>Generator</td><td>IPTG induced S-fadE</td><td width="100px">Kuanwei Sheng</td><td align="right">2779</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861346">BBa_K861346</a></td><td>Intermediate</td><td>IPTG induced promoter with FadA, intermediate part for BBa_K861036</td><td width="100px">Kuanwei Sheng</td><td align="right">1248</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861347">BBa_K861347</a></td><td>Intermediate</td><td>IPTG induced promoter with FadI, intermediate part for BBa_K861037</td><td width="100px">Kuanwei Sheng</td><td align="right">1395</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861348">BBa_K861348</a></td><td>Intermediate</td><td>IPTG induced promoter with S-FadA, intermediate part for BBa_K861038</td><td width="100px">Kuanwei Sheng</td><td align="right">1351</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861349">BBa_K861349</a></td><td>Intermediate</td><td>PfadR with FadA, intermediate part for BBa_K861046</td><td width="100px">Kuanwei Sheng</td><td align="right">1269</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861350">BBa_K861350</a></td><td>Composite</td><td>PfadR with FadI, intermediate part for BBa_K861047</td><td width="100px">Kuanwei Sheng</td><td align="right">1416</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861351">BBa_K861351</a></td><td>Composite</td><td>PfadR with S-FadA, intermediate part for BBa_K861048</td><td width="100px">Kuanwei Sheng</td><td align="right">1372</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861400">BBa_K861400</a></td><td>Coding</td><td>Gene coding protein FadA for fatty acid degradation</td><td width="100px">Kuanwei Sheng</td><td align="right">1164</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861500">BBa_K861500</a></td><td>Coding</td><td>FadL, Long-chain fatty acids transporter from <i>E.coli str. K12</i></td><td width="100px">Kuanwei Sheng</td><td align="right">1341</td><br />
</tr><br />
</tbody><br />
</table><br />
</div><br />
<div class="passage divcell1"><br />
<a name="Brief Answers to Safety Questions"><h3>Brief Answers to Safety Questions</h3></a><br />
<p align="justify"> Welcome to our Safety Page. We will first answer the safety questions asked by iGEM headquarters briefly, and then discuss safety issues associated with our project in detail. In addition, we will provide our ideas and practice on guaranteeing and developing biosafety.<br />
</p><br />
<p align="justify"><br />
<strong>Q1. Would any of your project ideas raise safety issues in terms of: Researcher safety, public safety, or environmental safety?</strong></br><br />
No. Our design is based on the commonly used nonpathogenic <i>E. coli K.12</i> strain and genes we manipulated are original genes in <i>E. coli</i>. The protein products, at least from current understanding, will cause no harm to researchers, the public and environment. In addition, strict lab practice is executed to further ensure safety.<br />
</p><br />
<p align="justify"><br />
<strong>Q2. Do any of the new BioBrick parts (or devices) that you made this year raise any safety issues? If yes,</br> <br />
Did you document these issues in the Registry?</br><br />
How did you manage to handle the safety issue?</br><br />
How could other teams learn from your experience?</strong></br><br />
Yes, we will discuss this question in latter part of this page (Safety Considerations of Our Biobrick parts and Our Project).<br />
</p><br />
<p align="justify"><br />
<strong>Q3. Is there a local biosafety group, committee, or review board at your institution?</br> <br />
If yes, what does your local biosafety group think about your project?</br><br />
If no, which specific biosafety rules or guidelines do you have to consider in your country?</strong></br><br />
Yes. All materials obtained have received the approvals from the department's laboratory management committees. We are also obliged to observe the regulations of Teaching Centre of Experimental Biology and apply for approval for materials before we start our project.<br />
</p><br />
<p align="justify"><br />
<strong>Q4. Do you have any other ideas how to deal with safety issues that could be useful for future iGEM competitions? How could parts, devices and systems be made even safer through biosafety engineering?</strong></br><br />
Some classified measures should be taken according to the safety of the material. For example, plasmids that may harm the safety, when submitted, should receive more attention and have a stricter package. Some harmful byproducts during experiments should be eliminated properly.</br><br />
We have done our human practice aiming at understanding attitude of the public towards genetically modified baceria and publicizing biosafety ideas to the public, which we think should be popularized to other teams in future iGEM competitions.<br />
</p><br />
<a name="General Safety Issues"><h3>General Safety Issues</h3></a><br />
<p align="justify"><br />
In this part, we will illustrate organisms, reagents and equipments we use that may cause safety problems, and introduce our operation standard, management and trains protecting the team members, public and environment.<br />
<br /><br />
<img src="https://static.igem.org/mediawiki/2012/0/05/Safety_Table_1.jpg" width="500" height="500" hspace="2" vspace="1" border="2" align="top" /><br />
As above, all the organisms and DNA hosts are not of high individual or community risk. Until now, the only used organism is <i>E. coli K.12</i> (and some of its varieties, for example, DH5&alpha;, a RecA mutated strain). Our current lab of basic-biosafety level 1 is safe enough to manipulate this strain. Only the genome (a generous present from University of Dundee iGEM team), but not the living Salmonella enterica was manipulated in the lab, and the genes from it are homogeneous of <i>E. coli K.12</i>, not associated with pathogenesis. We will not implement our future experimental plan with microorganisms of risk group 2 or vertebrates in our current lab, for too low is the biosafety level and no animal facilities.<br />
<br /><br />
To manipulate microorganisms, an ultra clean cabinet is used and strict aseptic technique is followed. All experimenters have been trained on foundation microbiology technique and biosafety. All microorganism contacting vessels are sterilized before and after experiments in appropriate protocols. Also, all microorganism materials will be sterilized before discarded. In this way, we believe that no public or environmental harm will be caused by the experimental organisms. In addition, no one in our team will be hurt by the experimental organisms.<br />
<br /><br />
The genetic modifications we make will change metabolism of bacteria. However, there is no evidence both theoretically and experimentally that these modifications will improve the pathogenicity of the bacteria or cause damage to environment even taking the risk of horizontal gene transfer into consideration. The effects of expressing gene <i>adrA</i> regarding infectivity and pathogenicity on <i>E. coli</i> is not clear now, but it still can be easily controlled in the lab environment without human ingestion. Also, we will insert a death device into the bacteria cell when we construct the whole system (still far from now) to avoid the proliferation out of control. For more information about gene safety, please read the next section and documents of our relevant parts on registry.<br />
</p><br />
<p align="justify"><br />
We have considered the potential harmful chemicals and equipments, as listed below:<br />
<ul><br />
<li></p><br />
<p align="justify"> Basic molecular experiments: NaOH, HCl, SDS, acrylamide, TEMED, ethanol, IPTG, liquid nitrogen, &beta;-mercaptoethanol, xylene cyanol FF.<br />
</li><br />
<li></p><br />
<p align="justify"> Bacteria culture: ampicillin, kanamycin, chloramphenicol.<br />
</li></p><br />
<p align="justify"> Chemical analysis and measurements: acetone, cupric acetate, Sudan III, Congo red, Coomassie Brilliant Blue G-250, Coomassie Brilliant Blue R-250.<br />
<li></p><br />
<p align="justify"> Equipments: UV lamp, supercentrifuge, heating equipments (alcohol burner, PCR amplifier, water bath, dry bath), electrophoresis apparatus, -80℃ refrigerator, ultrasonic cell disruptor.<br />
</li><br />
</ul><br />
</br></p><br />
<p align="justify"> All of these are regular reagents and apparatus in a molecular biology laboratory. The risks of them come from inflammability, explosibility, irritation, corrosivity, toxicity, carcinogenicity and physical injury. But none of them raises special safety issue, with chemical hood, emergency shower, normal personal protection, safety management and safety training.</br><br />
Only trace amount of antibiotics are used. Inactivated will they be before discared.<br />
</p><br />
<p ><br />
<img src="https://static.igem.org/mediawiki/2012/0/07/Safety_Figure_3.jpg" alt="Emergency Shower" width="500" height="750" hspace="2" vspace="1" border="2" align="top" /><strong>Emergency Shower</strong></img><br />
</p><br />
<a name="Safety Considerations of Our Biobrick parts and Our Project"><h3>Safety Considerations of Our Biobrick parts and Our Project</h3></a><br />
<p><br />
In this section, we are going to answer safety question 2 in detail, taking the potential risk in the future into concern.<br />
<br /><br />
The main safety challenge we must face is that as a practical bacteria therapy our direction is, we shall demonstrate that the “<i>E. coslim</i>” will not harm its host when it is developed completely. As few experiments we can do in such limited time, we have done a series of theoretical work to solve problems in this field.<br />
Intestine-colonized pathogenic <i>E. coli</i> may cause immune responses, following by diarrhea, inflammation and fever (although the strain we use is considered non-pathogen). Thus we plan to transplant the whole synthetic system to another organism (for example, <i>Bacillus subtilis</i>, has proved safe in human intestine). We know that it is hard as the two organisms are very different on transcriptional mechanisms, but we believe the work of establishing model system (that is what we are doing) in <i>E. coli</i> will make it easier. Also, as the rapid development of synthetic biology and gut microbiology, we hope in the near future, we can modify the genome of <i>E. coli</i> to change it a safe intestine microbe.<br />
<br /><br />
Another risk is that when the engineered bacteria get higher efficiency on energy production, they could proliferate out of control. To forestall this situation, we design a “death” device (for more information, click on <a href="https://2012.igem.org/Team:WHU-China/Death">Death</a>) using D-xylose as inducer. It means if you want to stop weight losing, what you have to do is to eat some D-xylose, and the “<i>E. coslim</i>” will die, shed from the intestinal wall and be poured out. What is more, designed as a two-plasmid system, it prevents all possible horizontal gene transfers.<br />
<br /><br />
Further safety issues will be raised and discussed in future experiments, including those operates in intestinal model and animals (For more information, click on Future Perspectives).<br />
</p><br />
<a name="Safety Management and Practice"><h3>Safety Management and Practice</h3></a><br />
<p align="justify"><br />
Our project has past a review of an expert committee, of which members are professors or associate professors of microbiology, genetics and bioengineering. Safety issues are considered seriously before they approved our design. <br />
We have consulted a few experts for safety questions about both artificial intestinal bacteria and experiments. Their advices help us improve the safety of the whole planning system. For that, we thank Dr. Yulan Wang and Dr. Tiangang Liu so much.<br />
Our lab is supervised by Teaching Centre of Experimental Biology, Wuhan University (TCEB, whose leader is our instructor <a href="https://2012.igem.org/Team:WHU-China/Team#Zhixiong Xie">Dr. Zhixiong Xie</a>). An expert group of this centre formulates safety guidelines and guarantees their performance in all teaching labs. All experiments we do past its review.<br />
Our safety management system includes the followings:<br />
Management of Chemicals, Equipments and Experimenters: Chemicals and equipments are registered in TCEB before they are available for us. Equipments are checked and maintained regular. And an entrance guard system is used to ensure only the admitted could enter the lab.<br />
<ul><br />
<li><br />
Responsibility distribution: All members worked in the lab are divided to three groups. The group leaders arrange schedules of experiments after assessing safety issues in the group (for example, the safety train of the experimental executer). Every member records his/her experiments in detail in the notebook of the group. Each group takes responses for cleaning and checking risks in the lab in turns. The group leader takes responses to the team leader. The team leader reports regular on safety to engineer Miss Long Yan, who is authorized by TCEB and manages the lab.<br />
</li><br />
<li><br />
Management of Chemicals, Equipments and Experimenters: Chemicals and equipments are registered in TCEB before they are available for us. Equipments are checked and maintained regular. And an entrance guard system is used to ensure only the admitted could enter the lab.<br />
</li><br />
<li><br />
Training: Our team members have been trained after Guidance of Student Experiments formulated by TCEB. <br />
</li><br />
</ul><br />
</p><br />
<p><br />
<img src="https://static.igem.org/mediawiki/2012/f/fe/Safety_Figure_4.png" alt="Guidence of Student Experiments" height="500" width="500" hspace="2" vspace="1" border="2" align="top" /><strong>Guidence of Student Experiments</strong></img><br />
</p><br />
<a name="Biosafety and Publicity"><h3>Biosafety and Publicity</h3></a><br />
<p align="justify"><br />
We believe that biosafety is not an issue which should be only considered inside biological lab, but also around people and communities. Spreading knowledge of biosafety to the public will help eliminate misunderstanding and prejudice, from which the science and all the people will benefit. We hope that sharing this idea with all iGEM teams can be useful to take advantage on biosafety.<br />
<br /><br />
To investigate public attitude towards our project and to publicize our biosafety ideas are what we do for our human practice. As “eating bacteria” is somehow an unacceptable concept now, we would like to find whether people know the truth about biosafety issues raised by bioengineered bacteria, or they are just panicked by their imaginary “bacteria”. And then, after initiating basic knowledge of microbiology, gene engineering and synthetic biology, we shall take a look on if people’s opinion to biosafety issues will change. In this way, we will estimate the value of our scientific publicity.<br />
<br /><br />
The rational discussions of biosafety we take with the public do not limited on our project, but also hotspot issues such as transgenics and stem cell therapies. For more information, please click on <a href="https://2012.igem.org/Team:WHU-China/Human_Practice">Human Practice</a>.<br />
</p><br />
<p><br />
<img src="https://static.igem.org/mediawiki/2012/a/a4/Safety_Figure_5.jpg" alt="Introducing a Simplified Intestinal Model" width="500" height="333" hspace="2" vspace="1" border="2" align="center" /><strong>Introducing a Simplified Intestinal Model</strong></img><br />
</p><br />
</div><br />
<div class="passage divcell2"><br />
<a name="Protocol for fluorescence measurement"><h4>Protocol for fluorescence measurement</h4></a><br />
<p align="justify">Minimal Medium</p><br />
<p align="justify">M9: </p><br />
<p align="justify"> For 1L Medium add</p><br />
<p align="justify">Na<sub>2</sub>HPO<sub>4</sub>·12H<sub>2</sub>O 15g </p><br />
<p align="justify">KH<sub>2</sub>PO<sub>4</sub> 3g</p> <br />
<p align="justify">NaCl 1g </p><br />
<p align="justify">NH<sub>4</sub>Cl 0.5g</p><br />
<p align="justify">After autoclaving, add: </p><br />
<p align="justify">MgSO<sub>4</sub>(1mol/L) 2mL</p><br />
<p align="justify">Bacteria strain:CaCl<sub>2</sub> 100μL </p><br />
<p align="justify">Triton X-100 (as emulsifier) 2uL</p><br />
<p align="justify"><br> </p><br />
<p align="justify"><strong>Note</strong></p><br />
<p align="justify">1.For M9 medium using oleic acid as sole carbon source, various amount of oleic acid was first emulsified 1:1 with 10% Triton X-100. M9 medium was then slowly added with constant vortex. M9 medium with high concentration of oleic acid was diluted by M9 medium with triton to form various concentrations;</p><br />
<p align="justify">2. For M9 medium using glucose as sole carbon source, M9 medium with high concentration of glucose was diluted by M9 medium to form various concentrations.</p> <br />
<p align="justify"><strong>Step</strong></p><br />
<p align="justify">1. Seed liquor which was activated over night was inoculated into M9 medium which contains different concentration of oleic acid. And it was then incubated at 37℃ for 24 hours;</p><br />
<p align="justify">2. After 24h of incubation in 24 well plates in 37℃, bacteria culture was centrifuged at 3000rmp for 5min, washed and resuspended in PBS;</p><br />
<p align="justify">3. We detected the OD600 and fluorescence of using SpectraMax M2 plate reader (Molecular Devices) .Excitation at 584 nm and emission at 607 nm were used. All fluorescence was normalized with cell density by measuring the absorbance at 600 nm.</p><br />
<br />
<a name="Protocols of Cupric-Soap Reaction"><h3>Protocols of Cupric-Soap Reaction</h3></a><br />
<p align="justify">To test metabolism of long fatty acids, we used oleic acid as sole carbon source in mediums, and used cupric-soap reaction to determinate oleic acid concentration preliminarily. </p><br />
<p align="justify">Modified M9 minimal medium with emulsified oleic acid as sole carbon</p><br />
<p align="justify"> Minimal medium was the same with that in Materials and methods for PfadR </p><br />
<p align="justify">What's Important:</p><br />
<p align="justify">Slowly pour M9 minimal medium into mixture of oleic acid and Triton X-100 to get more homogeneous solution.</p><br />
<p align="justify">Analysis the concentration of the oleic acid in the medium by cupric-acetate method</p><br />
<p align="justify"><strong>Step</strong></p> <br />
<p align="justify">1.Collect 5 ml medium which has been used to cultivate bacteria. Then centrifuge the medium at 3000rpm for 10 min to separate bacteria and medium;</p><br />
<p align="justify"> 2.Decant 3ml supernatant liquid into a 10ml EP. Add 3ml acetone to the liquid, 1ml at a time, shaking 10-20 times before adding another 1 ml in order to avoid the effect of the ions of the liquid during the extraction progress;</p><br />
<p align="justify"> 3.Add 3 ml isooctane once ,shaking for at least 90s, stand for 2min or longer until layering completely;</p><br />
<p align="justify"p>4.Collect 3 ml clear isooctane in a 5 ml EP, Add 800?l cupric-acetate (5% m/v, adjust pH to 6.8 with pyridine), Shaking for 90 seconds, stand for 2min or longer until layering completely;</p><br />
<p align="justify">5.Detect OD of organic phase in a spectrometry at 715nm.</p><br />
<p align="justify"><strong>The Standard Curve</strong></p><br />
<p align="justify">We add 1.6ml, 3.2ml, 4.8ml, 6.4ml, 9.6ml, 11.2ml oleic acid into 3ml M9 medium to generate a gradient. The absorbency is measured as described in the protocol.</p><br />
<p align="justify"><img src="https://static.igem.org/mediawiki/igem.org/5/56/Wps_clip_image-5855.png"alt="Guidence of Student Experiments" height="500" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<p align="justify">We slightly modified the methods provided by Kwon and Rhee, 1986, adding the extraction step, for it is dispensable when bacteria are in the medium. However, the standard curve is still very close to the paper’s, which proves that plausible and accurate</p><br />
<br />
<br />
<br />
<a name="Krebs-Ringer Phosphate(KRPD Buffer Solution)"><h3>Krebs-Ringer Phosphate(KRPD Buffer Solution)</h3></a><br />
<br />
<p align="justify"><strong>Solutions</strong></p><br />
<p align="justify"> Solution A:</p><br />
<p align="justify">For 100 mL: </p><br />
<p align="justify">NaCl 7.5985g ; KCl 0.3727g ; CaCl<sub>2</sub> 0.1054g; glucose-H<sub>2</sub>O 0.9495g, </p><br />
<p align="justify"> Solution A:</p><br />
<p align="justify">For 100 mL: </p><br />
<p align="justify"> NaH<sub>2</sub>PO<sub>4</sub>·2H<sub>2</sub>O 0 .2964g ;Na<sub>2</sub>HPO<sub>4</sub>·12H<sub>2</sub>O 2.9011g,</p><br />
<p align="justify">After dissolving, add MgSO<sub>4</sub>·7H<sub>2</sub>O 0.3130g</p><br />
<p align="justify">Mix A solution and B solution, add 790ml dd H<sub>2</sub>O, then regulate pH to 7.2~7.4 using 1M NaOH/1M HCl, finally add dd H<sub>2</sub>O to a final total volume of 1L. </p><br />
<h4">Procedures </h4><br />
<p align="justify">1. cultivate cells in 1 liter of medium to late exponential phase;</p><br />
<p align="justify">2. harvest by centrifugation at 35℃;</p><br />
<p align="justify">3. wash twice with 2 liters of warm(35℃)0.05M potassium phosphate buffer (pH 7.4) containing 1%(v/v) Triton X-100;</p><br />
<p align="justify">4. resuspend in 0.05M potassium phosphate buffer (pH 7.4) containing mercaptoethanol;</p><br />
<p align="justify">5. add sufficient volume of buffer to give a concentration of about 50mg(dry weight) of cells/ml;</p><br />
<p align="justify">6. disrupt cells with a Bransor Sonifier for 1min. The treatment was applied for 15s intervals, under 4 ℃;</p><br />
<p align="justify"> 7. centrifuge at10,000×g for 30min; </p><br />
<p align="justify">8. decant supernatant liquid for enzymatic assay, the protein concentration was determined by the biuret method;</p><br />
<p align="justify">9.analyze fatty acid oxidation in cell-free extracts</p><br />
<p align="justify">Note: little oxidation was observed when less than 1mg.</p><br />
<h4>Reaction Mixture</h4></a><br />
<p align="justify">1.0ml of freshly oxygenated Krebs-Ringer phosphate(pH 7.4)</p><br />
<p align="justify">Palmitate-1-14C, 20nmole (80,000 counts/min)</p><br />
<p align="justify">CoA, 1 μ mole</p><br />
<p align="justify">NAD, 1μ mole</p><br />
<p align="justify">ATP, 1μ mole</p><br />
<p align="justify">Succinate, 10 n moles</p><br />
<p align="justify">Supernatant protein, 1~5 mg</p><br />
<p align="justify">dd H<sub>2</sub>O to a final total volume of 2.0ml </p><br />
<br />
<br />
<br />
<br />
<a name="Cellulose Detection"><h3>Cellulose Detection</h3></a><br />
<br />
<p align="justify">1. Inoculate the bacteria into liquid LB medium and then incubate it for 24 hours at 37℃;</p><br />
<p align="justify">2. After centrifugation, supernatant is preserved for use, while deposits are resuspended with PBS and adjust to OD600 1.0;</p><br />
<p align="justify">3. Exceed cellulase was used to digest cellulose in supernatant and deposits. After the cellulase is added, 1mL solution was sampled every 3 min and cellulose of the sample was inactivated immediately;</p><br />
<p align="justify">4. Ten minutes later, the reduce sugar is detected in all the samples with or without cellulose;</p><br />
<br />
<br />
<p align="justify">5. 2mL DNS solution is mixed with the sample, and incubated in boiling water for two minutes, then it is cooled rapidly;</p><br />
<p align="justify">6. After 9 mL ddH<sub>2</sub>O being added into the solution, record absorbance at 540nm;</p><br />
<p align="justify">7.The Standard Curve of glucose concentration</p><br />
<p align="justify"><img src="https://static.igem.org/mediawiki/2012/c/cb/Biao.png" height="148" width="520" hspace="2" vspace="1" border="2" align="top" /></p><br />
<p align="justify"><img src="https://static.igem.org/mediawiki/2012/9/9c/Standard_curve.png" height="680" width="520" hspace="2" vspace="1" border="2" align="top" /></p><br />
<p align="justify">Then all tubes was treated in the same way with that in step 5 and 6.</p><br />
<p align="justify">8.Calculate the amount of cellulose in cell culture.</p><br />
<br />
<a name="In vitro Experiment"><h3>In vitro Experiment</h3></a><br />
<br />
<p align="justify">1. inoculate 100μl bacteria into 100ml LB , shaking at 37C overnight .</P><br />
<p align="justify">2. inoculate 1L LB using the culture above at the next morning , on the scale of 1:20 .</p><br />
<p align="justify">3. Separate above medium into 250ml flask , shaking at 37C for 3-4h .</p><br />
<p align="justify">4. 8000 rpm , 6min to collect the bacteria .</p><br />
<p align="justify">5. Using PBS to resuspend the bacteria to 50mg / ml .</p><br />
<p align="justify">6. Ultrasonication 1min , every 15s having an interval to cool on the ice .</p><br />
<p align="justify">7. Using Coomassie blue staining to measure the concentration of the total protein .</p><br />
<p align="justify">8. In 2ml reaction system , add 5ul oleate ,40 ul Triton 10% , 1ml Krebs-Ringer phosphate buffer , 10nmol succinate , 1 umol COA , 1umol ATP , 1 umol NAD . </p><br />
<p align="justify">9. react at 37C for 6h</p><br />
<br />
<p align="justify">In this experiment , the concentration of total protein in the cell extracts of the five sample are almost the same , so we assume that adding the same volume guarantee the same amount of protein is added . </p><br />
<br />
<p align="justify">The reaction system for the control BBa_R0011+(R0011), BBa_R0011+fadE , BBa_R0011 + fadD , BBa_R0011 + Samonella A Samonella B , BBa_R0011 + fadI fadJ : 1ml Krebs-Ringer phosphate buffer , 10nmol succinate , 1 umol COA , 1umol ATP , 1 umol NAD , 1ml cell extract .</p><br />
<br />
<p align="justify">The reaction system for BBa_R0011+fadD and BBa_R0011+fadE mixture : 2ml Krebs-Ringer phosphate buffer , 20 nmol succinate , 2 umol COA , 2 umol ATP , 2 umol NAD , 1ml cell extract for each gene.</p><br />
<br />
<p align="justify">The reaction system for BBa_R0011+fadD , BBa_R0011+fadE , and BBa_R0011 + Samonella fadA Samonella fadB mixture :<br />
3ml Krebs-Ringer phosphate buffer , 30nmol succinate , 3umol COA , 3umol ATP , 3 umol NAD , 1ml cell extract for each gene.</p><br />
<br />
<p align="justify">The reaction system for BBa_R0011+fadD , BBa_R0011+fadE , BBa_R0011+Samonella A Samonella B , and BBa_R0011+fad I fad J mixture :4ml Krebs-Ringer phosphate buffer , 40nmol succinate , 4umol COA , 4umol ATP , 4 umol NAD , 1ml cell extract for each gene </p><br />
<br />
<br />
<a name="Plate Assay"><h3>Plate Assay</h3></a><br />
<p align="justify">1. J12107- AdrA and control RBS was incubate and vortex in LB medium with Ampicillin overnight</p> <p align="justify">2. OD600 was measured; LB was then added to make the two test tubes had the same OD600</p> <p align="justify">3. Bacteria were inoculated by sterilized needle piercing a pre-labeled 0.3% agar LB semisolid plate for 4-5 minutes in super clean bench.</p> <p align="justify"> 4. Carefully placed the plate horizontally in a 37 degree incubator overnight. Avoid shaking of the plate.</p> <p align="justify">5. Clones on the plate were observed. </p> <br />
<br />
<br />
<a name="Materials and Methods of SDS-PAGE"><h3>Materials and Methods of SDS-PAGE</h3></a><br />
<br />
<p align="justify"><img src="https://static.igem.org/mediawiki/2012/a/ab/BIAO_2.png"alt="Guidence of Student Experiments" height="160" width="520" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<br />
<p align="justify">Coomassie Blue Stain</p><br />
<p align="justify">-Coomassie brilliant blue G-250 50mg</p><br />
<p align="justify">-95% ethanol 25ml</p><br />
<p align="justify">-85%H<sub>3</sub>PO<sub>4</sub> 50ml</p><br />
<p align="justify">-H<sub>2</sub>O, adjust to 500ml</p><br />
<p align="justify">-filter</p><br />
<br />
<p align="justify">Destain solution </p><br />
<p align="justify">-methanol 250ml</p><br />
<p align="justify">-acetic acid 50ml</p><br />
<p align="justify">-H<sub>2</sub>O adjust to 500ml</p><br />
<br />
<p align="justify">2x SDS loading buffer</p><br />
<p align="justify">-0.5mol/l Tirs-HCl(PH6.8) 25ml</p><br />
<p align="justify">-10%SDS 8ml</p><br />
<p align="justify">-50%glycerol 20ml</p><br />
<p align="justify">-2-mercaptoethanol 2ml</p><br />
<p align="justify">-1%Bromphenol Blue 4ml</p><br />
<p align="justify">-H<sub>2</sub>O adjust to 100ml</p><br />
<br />
<p align="justify">10xSDS-PAGE running buffer </p><br />
<p align="justify">Tris base, 30.3 g </p><br />
<p align="justify">M glycine 144.1g</p><br />
<p align="justify">SDS 10 g</p><br />
<p align="justify">-H<sub>2</sub>O adjust to 1L</p><br />
<p align="justify">Steps</p><br />
<br />
<p align="justify">Protein expression</p><br />
<p align="justify">1.inoculate the liquid strains into LB medium supplement with 50μg/mL ampicillin, incubate the medium at at 37℃ until OD600 reaches 0.6;</p><br />
<p align="justify">2. Separate the culture into two test tubes. Add IPTG into one of two tubes at a final concentration of 1mM to induce the expression of </p><br />
<p align="justify">3. 1 mL of the culture is sampled every hour. After centrifugation, deposits was suspended with 300 μL PBS and 200 μL 2x SDS loading buffer, then incubated in boiling water for 15 min.</p><br />
<p align="justify">4. 10μl of samples was load in lanes, run the SDS-PAGE</p><br />
<p align="justify">5. Stained the SDS-PAGE 5 hours</p><br />
<p align="justify">6. Destain the SDS-PAGE until you can see the protein band.</p><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<div class="passage divcell3"><br />
<h3>team history</h3><br />
<p><strong>Dec. 2011</strong></p><br />
<p align="justify">WHU iGEM team was established</p><br />
<p><strong>Dec. 2011 to Feb. 2012</strong></p><br />
<p align="justify">Every one presented their own idea, then we discussed the feasibility of these ideas.</p><br />
<p><strong>Feb. 2012 </strong></p><br />
<p align="justify">The final project was determined, named E.coslim</p><br />
<p><strong>Mar. 2012</strong></p><br />
<p align="justify">We finished an outstanding presentation. Our reply was approved by the leaders of college of life sciences, Wuhan University.</p><br />
<p><strong>Apr. 2012 </strong></p><br />
<p align="justify">Our iGEM team was divided into 3 groups—group of Sheng, group of Xia and group of Mei. </p><br />
<p><strong>Apr. 2012 to prsent</strong></p><br />
<p align="justify">Experiments started….</p><br />
<p><strong>Apr. 2012</strong></p><br />
<p align="justify">Group of Sheng: FADR was connected to pSB1A2 plasmid carrier</p><br />
<p align="justify"> FADR was connected to RFP gene</p><br />
<p align="justify">Group of Xia: starting to connect genes of CI control system </p><br />
<p align="justify"> Testing the function of CI control system</p><br />
<p align="justify">Group of Mei: YhjH/ FadE/ FadD/ FadL gene was connected to pSB1A2 plasmid carrier</p><br />
<br />
<p><strong>May. 2012 </strong></p><br />
<p align="justify">Group of Sheng: FadB/ FadJ gene was connected to pSB1A2 plasmid carrier, then BBa_B0030(RBS) as well</p><br />
<p align="justify">Group of Xia: They devised two promoters p110 and p101, which were expected to be controlled by glucose. However, they failed.</p><br />
<p align="justify">Group of Mei: YhjH/ FadE/ FadD/ FadL gene was connected to BBa_B0030(RBS)</p><br />
<br />
<p><strong>June 2012 </strong></p><br />
<p align="justify">G of S: FadR was connected to low-copied plasmid carrier.</p><br />
<p align="justify"> sFadB and sFadA genes were connected to BBa_B0030 (RBS)</p><br />
<p align="justify"> sFadE gene was connected to pSB1A2 plasmid carrier</p><br />
<p align="justify"> G of X: the connection of genes, which were relative with cellulose, was finished.</p><br />
<p align="justify"> Another two promoter were devised, p1 and p2</p><br />
<p align="justify">G of M: YhjH/ FadE/ FadD/ FadL gene was connected to BBa_B0024 (terminator)</p><br />
<br />
<p><strong>July 2012 </strong></p><br />
<p align="justify">G of S: FadJ was connected to BBa_B0024 (terminator), sFadE gene was copied by PCR technology</p><br />
<p align="justify"> On the front half of this month, they conducted several pre-experiments of oleic acid test</p><br />
<p align="justify"> On the next half month, they started normal experiments of oleic acid test</p><br />
<p align="justify">G of X: started to test the function of p1 and p2</p><br />
<p align="justify">G of M: YhjH/ FadE gene was connected to BBa_J23100 (promoter)</p><br />
<p align="justify"> Finish the standard curve of oleic acid test</p><br />
<br />
<p><strong>Aug. 2012 </strong></p><br />
<p align="justify">G of S: sFadE was induced to point mutation, then it was connected to BBa_B0030 (RBS) and BBa_B0024 (terminator) respectively</p><br />
<p align="justify"> sFadB was connected to BBa_B0030 (RBS) and BBa_B0024 (terminator) respectively.</p><br />
<p align="justify">G of X: test the function of cellulose-controlled genes, having got satisfying results</p><br />
<p align="justify">G of M: copied Adra gene and finished the connection of BBa_B0030 (RBS), BBa_B0024 (terminator) and BBa_J23107 (promoter), BBa_J23114 (promoter) respectively. FadE/YhjH/FadD/fadL were connected to BBa_J23107 (promoter), BBa_J23114 (promoter). </p><br />
<br />
<p><strong>Sep 2012</strong></p><br />
<p align="justify">G of S: Transferred all the parts in pSB1A2 into pSB1C3, Tested the function of PfadR, Characterized the effect of each gene on fatty acid consumption, started to set up the platform for in vitro experiments.</p><br />
<p align="justify">G of X: Transferred all the parts in pSB1A2 into pSB1C3, tested the function of cellulose system. Repeat the test of the function of cellulose-controlled genes.</p><br />
<p align="justify">G of M: Transferred all the parts in pSB1A2 into pSB1C3, test the function of Adra/YhjH.</p></p><br />
<br />
<br />
<br />
</div><br />
<div class="passage divcell4"><br />
<h3>Brainstorming</h3><br />
<br />
<h4>About E.coslim by Kuanwei Sheng</h4><br />
<p align="justify">In order to help people lose weight, besides our three devices, we also have come up with many other creative ways. </p><br />
<br />
<br />
<p align="justify"><strong>Ⅰ.Short chain peptides synthesis</strong></p><br />
<p align="justify">Recent researches have indicated that some short chain peptides in intestine have effect on inhibiting appetites, therefore decrease the food intake. We thus formed the idea that we could synthesis a DNA chain that encodes those short peptides.</p><br />
<br />
<p align="justify"><strong>Ⅱ.Biosynthesis of L-carnitine</strong> </p><br />
<p align="justify">L-carnitine is a molecule that facilitates the progress of transporting fatty acids into mitochondria where these fatty acids will be disintegrated. We once considered use L-carnitine to help the host metabolize fatty acid better. However, the biosynthesis of L-carnitine has too many derivatives or the pathway is patented by others.</p><br />
<br />
<p align="justify"><strong>Ⅲ.Xylose isomerase</strong></p><br />
<p align="justify">Xylose is a prebiotics that can hardly be absorbed by human. We consulted many papers and find that glucose can be converted into xylose by xylose isomerase. Therefore, we thought maybe we could lower the glucose available in intestine by expressing xylose isomerase. However, this process is shown to be reversible latter. Mutated the sequence of the protein may generate high converting rate, yet it is too laborious and risky for a short time project.</p><br />
<br />
<br />
<h4>Other novel ideas</h4><br />
<br />
<p align="justify"><strong>Tackle Water bloom by Tong Wang and Kuanwei Sheng</strong></p><br />
<p align="justify">Since the detrimental effects caused by cyanobacteria to the environment such as making water carcinogenic have become a serve global problem, we therefore tried to employ E.coli as an expression system to eliminate these detrimental effects. When we first took over this project, we thought about limiting the growth of cyanobacteria. Along with the process we got to read a large amount of relevant papers about cyanobacteria, we found that not only the main detrimental effects caused by cyanobacteria is attributed to its product which is a cyclic peptide called microcystin, but also microcystin can regulate the population density. Then we came to realize the importance of microcystin and began to search information about it. Through over this process, we discovered a gene cluster which is responsible for the microcystin degradation pathway. It encodes four enzymes——MlrA、MlrB、MlrC and MlrD. Also, we found that some non-toxic cyclic peptides produced by cyanobacteria such as Anabaenopeptin B and Anabaenopeptin F can induce lysis of cyanobacteria. The latter finding can be utilized as an effective cell population density control mechanism. Thus we thought about constructing two independent systems to eliminate cyanobacteria, one about inducing lysis of cyanobacteria and the other about degrading microcystin. Finally we gave up this project because of the reasons that these gene clusters are too large to be expressed in E.coli and that E.coli cannot survive in the sea, however, we still feel proud of these fancy ideas.</p><br />
<br />
<p align="justify"><strong>Desalination of sea water by Kuanwei Sheng</strong></p><br />
<p align="justify">We came up with the thought that engineering bacteria can intake ions like Na+, cl-, Mg2+ and etc. under special stimulus. Also, under another certain stimulus, the bacteria can export those salts out of cells for reuse. Therefore, we can use these bacteria to desalinize sea water and extract the salt the same time. However, there is no such ion channel that can meet our needs.</p><br />
<br />
<p align="justify"><strong>Sense the earthquake By Min Ye</strong></p><br />
<p align="justify">We once tried to find proteins that can sense vibration and construct a pathway to report that vibration. However, we are not able to find the protein that can meet our needs.</p><br />
<br />
<p align="justify"><strong>Auto plasmid preps By Kuanwei Sheng</strong></p><br />
<p align="justify">We thought about constructing a synthetic protein that combines zinc finger protein which can recognize the specific sequence of DNA and signal peptide that can make proteins be exported out of the bacteria by secretion pathway. Therefore, it is possible that plasmid can be exported out the cells together with the zinc finger protein.</p><br />
<br />
<p align="justify"><strong>Outer Membrane Vesicle (OMV) to treat cancer By Kuanwei Sheng</strong></p><br />
<p align="justify">We thought to use Outer Membrane Vesicle (OMV) to treat cancer. Specifically, we thought about localizing antibody that can recognize certain cancer on the surface of OMVs via signal peptides. Also, we thought we may localize cell division inhibitor protein or protein that lead to cell death inside the OMVs. Therefore, we hoped that the OMV excreted by the bacteria can recognize and kill cancer cells.</p><br />
<br />
<p align="justify"><strong>Multicell Yeast By Wenxiong Zhou</strong></p><br />
<p align="justify"><img src="https://static.igem.org/mediawiki/igem.org/9/96/Wps_clip_image-23886.png " height="288" width="503" hspace="2" vspace="1" border="2" align="top"></p></br><br />
<br />
<p align="justify">Transform the yeast from a single-cell microbe to a multi-cell organism by setting bistability of gene expression among cells of yeasts adhered in amalgamation.</p><br />
<p align="justify"><strong>To kill superbacteria</strong></p><br />
<p align="justify">Now with the spread usage of the antibiotics, many bacteria adopt ability to fight against the antibiotics. And now it’s a big problem that antibiotics are no longer useful as before. So to kill these bacteria, Jing and her group thinks they can device some proteins or artificial micromachine to detect DNA that code proteins contributing to the ability to degenerate antibiotics. And then by transferring these plasmids coding artificial proteins or micromachines, they can inhibit the expression of enzymes or proteins degenerating antibiotics. </p><br />
<br />
<br />
<br />
<br />
</div><br />
<div class="passage divcell5"><br />
<a name="team"><h3><strong>team</strong></h3></a><br />
<p><img src="https://static.igem.org/mediawiki/igem.org/9/93/Finish_presentation_in_whu.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/f/f8/Photo_of_whu_china2.jpg " height="361" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/f/f8/Journey4.jpg " height="343" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/a/a1/Journey3.jpg " height="362" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/3/3b/IMG_1842.jpg " height="336" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/7/70/IMG_1837.JPG " height="392" width="518" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/a/a7/IMG_2021.jpg " height="337" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/2/2d/Photo_of_group1_%282%29.jpg " height="375" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/a/a5/Photo_of_group_2.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/0/0a/........jpg " height="351" width="518" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/a/aa/Journey2.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/7/76/IMG_1759.JPG " height="351" width="518" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/b/b6/IMG_2183.jpg " height="351" width="518" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/f/f4/Journey1.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<br />
<br />
<a name="presentation"><h3><strong>presentation</strong></h3></a><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/e/ee/Discussion11.jpg " height="375" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/d/d9/Presentation_in_whu44.jpg " height="375" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/a/aa/Discussion33.jpg " height="337" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/6/6d/Discussion66.JPG " height="374" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/a/a3/Preparation_for_presentation_in_whu33.jpg " height="353" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/7/76/Preparation_for_presentation_in_HK22.jpg " height="362" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/9/9a/Preparation_for_presentation_in_whu11.jpg " height="359" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/d/d3/Waiting_for_result_of_presentation1.jpg " height="402" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/5/56/Preparation_for_presentation_in_HK11.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<a name="human practice"><h3><strong>human practice</strong></h3></a><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/1/12/Human_practice2.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/1/1f/Human_practice3.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/a/a4/Human_practice4.jpg " height="383" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/9/97/Human_practice5.jpg " height="409" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/2/2a/Human_practice6.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/8/8b/Human_practice8.jpg " height="378" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/1/1a/Human_practice9.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/0/08/Human_practice10.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/5/56/Human_practice12.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/a/ae/Human_practice20.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/0/00/Human_practice27.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/7/7b/Human_practice28.jpg " height="381" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/2/26/Human_practice29.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/6/63/IMG_0175.JPG " height="518" width="393" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/5/5b/Poster.jpg " height="353" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/5/54/Human_practice24.jpg " height="353" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<br />
<br />
<br />
<a name="doodle"><h3><strong>doodle</strong></h3></a><br />
<p><img src="https://static.igem.org/mediawiki/2012/7/7f/Untitled.jpg " height="439" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/4/40/Funny5.jpg " height="530" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/b/be/Funny4.jpg " height="490" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/a/ad/Funny6.jpg " height="666" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/7/77/Lab1.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/9/99/Team_clothes1.jpg " height="250" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/4/4d/Team_clothes2.jpg " height="495" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/1/18/Team_clothes3.jpg " height="500" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/5/50/Team_clothes4.jpg "alt=" height="500" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/b/b4/Team_clothes5.jpg " height="250" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/d/d4/E.coslim2.JPG " height="300" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/7/7f/Funny8.jpg " height="495" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/d/d7/Funny9.jpg " height="500" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/7/71/Poster1.jpg " height="707" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/f/f9/Poster2.jpg " height="707" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/c/c2/Poster3.jpg " height="666" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/f/fc/Poster4.jpg " height="707" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/8/8c/Wiki3.jpg " height="335" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/f/f9/Wiki5.jpg" height="400" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/4/4a/Wiki6.jpg" height="435" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<br />
<br />
<br />
<br />
<a name="funny pictures"><h3><strong>funny pictures</strong></h3></a><br />
<p><img src="https://static.igem.org/mediawiki/2012/b/bc/Funny_picture1.jpg " height="356" width="400" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/1/10/Funny_picture2.jpg " height="356" width="400" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/3/3d/Funny_picture3.jpg " height="356" width="400" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/7/74/Funny_picture4.jpg " height="356" width="400" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/d/de/Funny_picture5.jpg " height="358" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/b/bd/IMG_0004.JPG " height="393" width="518" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/a/a8/IMG_0074.JPG " height="600" width="455" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/c/c1/IMG_0076.JPG " height="518" width="393" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/e/e4/IMG_0096.JPG " height="518" width="393" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/5/56/IMG_0109.JPG " height="518" width="393" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/4/4e/IMG_0117.JPG " height="600" width="450" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/6/6f/IMG_0135.JPG " height="518" width="393" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/b/be/IMG_0343.JPG " height="518" width="393" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/f/f6/IMG_0344.JPG " height="600" width="450" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/4/45/IMG_0349.JPG " height="599" width="428" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/7/75/IMG_2312.jpg " height="351" width="518" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/c/cb/Lab2.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/1/1b/Suoge%27s_birthday.jpg " height="599" width="428" hspace="2" vspace="1" border="2" align="top" /></p><br />
</div> <br />
<div class="passage divcell6"><br />
<h3><strong>A Letter from Fancy</strong></h3><br />
<p align="left">There is a very meaningful sentence in the novel The Lord of the Ring: when the respected old Billbo was going to leave the village in which he had lived for many years, he gave a lecture--”The people among you whom I recognize haven’t reached half whom I should do, besides, among those whom I love are less than the half I should do, either.</p><br />
<p align="left">None of us need to fight in a war or fight with monsters. However, all of us have indeed fought and stuck to the very end, regardless of whatever obstacles to overcome and whatever precious to sacrifice.</p><br />
<p align="left">The greatness lies in the persistence to do the ordinary things perfectly. We are all inspired by our design. However, the gap between the repetitive, seemingly endless molecular cloning and the last magic probiotic can easily wreck the passion. To the opposite, most of us have successfully endured the monotonous life. Sometimes the enzymes just don’t function well. Other times the PCR never get right for some unclear reasons. We just survived those really despair moments and made one step closer to our goal.</p><br />
<p align="left">And those heart-touching scenes are clear as if they happened yesterday. Regardless of our persuation to wait for the rain to stop, our captain determined to fetch the induction cooker in his dormitory to perform an reaction as soon as possible (We don’t have an appropriate heater in our lab). When his figure disappeared in the dark and rain, words failed me; when I got a message at 3 o’ clock in the midnight, the excited tune claiming that we no longer needed to worry about our competent cells overwhelmed me with tears; when I heard that our “artist” having caught a cold but promised that he would complete all the pictures of the web site in time, I fell into silence again; every time when Xian Xia stayed overnight in the lab, the room would be quite tidy and all the reagents would got replenished. When I saw this in the next morning, I was greatly touched.</p><br />
<p align="left">Most of us has sacrificed much time to pursue personal interest. We just decrease the time for required exams for going abroad, for working in our own labs, and for some courses we are really interested in, let alone our hobbies. No time for travelling, reading lasted paper on interested topics, shopping, chatting with friends and so on. However, after the complaints and anguish, we finally reached such a peaceful and simple spiritual state that we just want to try our best to get the best result.</p><br />
<p align="left">A man who never experienced iGEM in WHU can never really understand the complex of feelings: glory and dream, perseverance and persistence, joy and tears. You can never image how brave and respected my teammates are, how many efforts and love they have put in the team, and how strong the relationship we have built since the team has been organised.<br />
<br />
</p><br />
</div> <br />
</div><br />
<em class="clear"></em><br />
</div><br />
<div class="footer"></div><br />
</div><br />
<script src="http://www.yichengliu.com/code/igem/notebooks.js"></script><br />
</body><br />
</html></div>Nanhaihttp://2012.igem.org/Team:WHU-China/NotebooksTeam:WHU-China/Notebooks2012-10-26T19:26:03Z<p>Nanhai: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<body><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script><br />
<script><br />
function picObj(src, title, detail, href){<br />
this.src = src;<br />
this.title = title;<br />
this.detail = detail;<br />
this.href = href;<br />
}<br />
//*************************自定义数据部分*************************<br />
<br />
//定义菜单及侧边栏数据<br />
var menuObj = {<br />
Home : [<br />
{<br />
title : "<strong>what's new</strong>",<br />
picArray : [<br />
new picObj("http://imgsrc.baidu.com/forum/pic/item/d25e8bd4b31c87011d9cdb7c277f9e2f0708ff34.jpg", "one piece", "yi zhang haizeiwang de tu", "http://tieba.baidu.com/f?kw=%BA%A3%D4%F4%CD%F5"),<br />
new picObj("http://imgsrc.baidu.com/forum/pic/item/d25e8bd4b31c87011d9cdb7c277f9e2f0708ff34.jpg", "one piece", "yi zhang haizeiwang de tu", "http://tieba.baidu.com/f?kw=%BA%A3%D4%F4%CD%F5"),<br />
new picObj("http://imgsrc.baidu.com/forum/pic/item/d25e8bd4b31c87011d9cdb7c277f9e2f0708ff34.jpg", "one piece", "yi zhang haizeiwang de tu", "http://tieba.baidu.com/f?kw=%BA%A3%D4%F4%CD%F5")<br />
]<br />
},<br />
{<br />
title : "<strong>pathway introduction</strong>",<br />
picArray : [<br />
new picObj("2.png", "title 2", "pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1production 1", "#"),<br />
new picObj("2.png", "title 2", "pathway introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2", "#"),<br />
new picObj("2.png", "title 2", "pathway introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3", "#")<br />
]<br />
},<br />
{<br />
title : "<strong>future prospective</strong>",<br />
picArray : [<br />
new picObj("3.png", "title 3", "future prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1utureive 1", "#"),<br />
new picObj("3.png", "title 3", "future prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospecpective 2", "#"),<br />
new picObj("3.png", "title 3", "future prospective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3", "#")<br />
]<br />
},<br />
{<br />
title : "<strong>about us</strong>",<br />
picArray : [<br />
new picObj("4.png", "title 4", "about us 1", "#"),<br />
new picObj("4.png", "title 4", "about us 2", "#"),<br />
new picObj("4.png", "title 4", "about us 3", "#")<br />
]<br />
}<br />
],<br />
Team : [<br />
{<br />
title : '<strong>Members</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Instructors</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Team History</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>about WHU</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>about Our Lab</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Acknol-</br>edgements</strong>',<br />
dir : []<br />
},<br />
<br />
],<br />
Project : [<br />
{<br />
title : '<strong>Outline</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Background</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Promoter Design</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device I: Fatty Acid Degradation</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device II: Cellulose Synthesis</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Device III: Colonization</strong>',<br />
dir : []<br />
},<br />
],<br />
Modeling : [<br />
{<br />
title : '<strong>Future Perspectives</strong>',<br />
dir : []<br />
},<br />
<br />
{<br />
title : '<strong>Model I: Fatty Acid Degradation</strong>',<br />
dir : [<br />
{<br />
title : 'The Ordinary Differential Equations of the Model',<br />
href : '#The Ordinary Differential Equations of the Model'<br />
},<br />
{<br />
title : 'Analysis on the Steady State of the ODE',<br />
href : '#Analysis on the Steady State of the ODE'<br />
},<br />
{<br />
title : 'Parameter Screening',<br />
href : '#Parameter Screening'<br />
},<br />
{<br />
title : 'Conclusion',<br />
href : '#Conclusion'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Model II: Microbiota Regulation</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Software Tool: FANCY</strong>',<br />
dir : []<br />
}<br />
],<br />
Notebooks : [<br />
{<br />
title : '<strong>Parts</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Safety</strong>',<br />
dir : [<br />
{<br />
title : 'Brief Answers to Safety Questions',<br />
href : '#Brief Answers to Safety Questions'<br />
},<br />
{<br />
title : 'General Safety Issues',<br />
href : '#General Safety Issues'<br />
},<br />
{<br />
title : 'Safety Considerations of Our Biobrick parts and Our Project',<br />
href : '#Safety Considerations of Our Biobrick parts and Our Project'<br />
},<br />
{<br />
title : 'Safety Management and Practice',<br />
href : '#Safety Management and Practice'<br />
},<br />
{<br />
title : 'Biosafety and Publicity',<br />
href : '#Biosafety and Publicity'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Protocols</strong>',<br />
dir : [<br />
{<br />
title : 'Protocol for fluorescence measurement',<br />
href : '#Protocol for fluorescence measurement'<br />
},<br />
{<br />
title : 'Protocols of Cupric-Soap Reaction',<br />
href : '#Protocols of Cupric-Soap Reaction'<br />
},<br />
{<br />
title : 'Krebs-Ringer Phosphate(KRPD Buffer Solution)',<br />
href : '#Krebs-Ringer Phosphate(KRPD Buffer Solution)'<br />
},<br />
{<br />
title : 'Cellulose Detection',<br />
href : '#Cellulose Detection'<br />
},<br />
{<br />
title : 'The Standard Curve',<br />
href : '#The Standard Curve'<br />
},<br />
<br />
{<br />
title : 'In vitro Experiment',<br />
href : '#In vitro Experiment'<br />
},<br />
{<br />
title : 'Plate Assay',<br />
href : '#Plate Assay'<br />
},<br />
{<br />
title : 'Materials and Methods of SDS-PAGE',<br />
href : '#Materials and Methods of SDS-PAGE'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Events</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Brain-</br>storming</strong>',<br />
dir : []<br />
},<br />
{<br />
title : '<strong>Gallery</strong>',<br />
dir : [<br />
{<br />
title : 'team',<br />
href : '#team'<br />
},<br />
{<br />
title : 'presentation',<br />
href : '#presentation'<br />
},<br />
{<br />
title : 'human practice',<br />
href : '#human practice'<br />
},<br />
{<br />
title : 'doodle',<br />
href : '#doodle'<br />
},<br />
{<br />
title : 'funny pictures',<br />
href : '#funny pictures'<br />
}]},<br />
{<br />
title : '<strong>A Letter from Fancy</strong>',<br />
dir : []<br />
<br />
<br />
}<br />
],<br />
HumanPractice : [<br />
{<br />
title : '<strong>Outline</strong>',<br />
dir : [<br />
{<br />
title : 'aaaa',<br />
href : '#aaaa'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Questionaire Survey</strong>',<br />
dir : [<br />
{<br />
title : 'bbbb',<br />
href : '#bbbb'<br />
}<br />
]<br />
},<br />
{<br />
title : '<strong>Publicity</strong>',<br />
dir : []<br />
}<br />
]<br />
}; <br />
//*************************自定义数据部分*************************<br />
</script><br />
<style type="text/css"><br />
/*<br />
* base css, DO NOT MODIFY!<br />
*/<br />
* {<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
font-family: "Verdana", sans-serif;<br />
color: #333;<br />
list-style: none;<br />
outline: none;<br />
resize: none;<br />
}<br />
html {<br />
overflow-y: scroll;<br />
}<br />
body {<br />
background: url("https://static.igem.org/mediawiki/2012/6/69/Body-bg2.jpg") center center fixed;<br />
}<br />
a {<br />
text-decoration: none;<br />
}<br />
.clear {<br />
width: 0;<br />
height: 0;<br />
line-height: 0;<br />
display: block;<br />
clear: both;<br />
}<br />
<br />
/*<br />
* common css, include "header","footer"...<br />
*/<br />
div.center {<br />
width: 940px;<br />
margin: 0 auto;<br />
}<br />
div.header {<br />
width: 940px;<br />
height: 357px;<br />
background: url("https://static.igem.org/mediawiki/2012/8/80/Header-bg2.png") no-repeat;<br />
position: relative;<br />
z-index: 50;<br />
}<br />
div.nav {<br />
position: absolute;<br />
height: 80px;<br />
top: 206px;<br />
left: 350px;<br />
}<br />
li.nav-outerLi {<br />
display: block;<br />
float: left;<br />
width: 80px;<br />
height: 80px;<br />
margin: 0 6px;<br />
cursor: pointer;<br />
}<br />
h2.nav-h21,h2.nav-h22,h2.nav-h23,h2.nav-h24,h2.nav-h25,h2.nav-h26 {<br />
display: block;<br />
background: url("https://static.igem.org/mediawiki/2012/9/91/Nav-tabs.png") no-repeat;<br />
width: 80px;<br />
height: 80px;<br />
background-position: 0 0;<br />
z-index: 150;<br />
position: relative;<br />
}<br />
h2.nav-h22 {<br />
background-position: -80px 0;<br />
}<br />
h2.nav-h23 {<br />
background-position: -160px 0;<br />
}<br />
h2.nav-h24 {<br />
background-position: -240px 0;<br />
}<br />
h2.nav-h25 {<br />
background-position: -320px 0;<br />
}<br />
h2.nav-h26 {<br />
background-position: -400px 0;<br />
}<br />
h2.nav-h21:hover {<br />
background-position: 0 -80px;<br />
}<br />
h2.nav-h22:hover {<br />
background-position: -80px -80px;<br />
}<br />
h2.nav-h23:hover {<br />
background-position: -160px -80px;<br />
}<br />
h2.nav-h24:hover {<br />
background-position: -240px -80px;<br />
}<br />
h2.nav-h25:hover {<br />
background-position: -320px -80px;<br />
}<br />
h2.nav-h26:hover {<br />
background-position: -400px -80px;<br />
}<br />
h2.nav-h21on {<br />
background-position: 0 -160px;<br />
}<br />
h2.nav-h22on {<br />
background-position: -80px -160px;<br />
}<br />
h2.nav-h23on {<br />
background-position: -160px -160px;<br />
}<br />
h2.nav-h24on {<br />
background-position: -240px -160px;<br />
}<br />
h2.nav-h25on {<br />
background-position: -320px -160px;<br />
}<br />
h2.nav-h26on {<br />
background-position: -400px -160px;<br />
}<br />
ul.nav-innerUl{<br />
position: absolute;<br />
top: 40px;<br />
padding-top: 40px;<br />
width: 76px;<br />
border-left: 2px solid #000;<br />
border-right: 2px solid #000;<br />
z-index: 140;<br />
display: none;<br />
}<br />
em.nav-libg{<br />
display: block;<br />
width: 96px;<br />
height: 11px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/48/Nav-libg.png');<br />
margin-left: -10px;<br />
}<br />
ul.nav-innerUl1{<br />
background: #fffaca;<br />
}<br />
ul.nav-innerUl2{<br />
background: #dedede;<br />
}<br />
ul.nav-innerUl3{<br />
background: #d9f0c9;<br />
}<br />
ul.nav-innerUl4{<br />
background: #f6e5ff;<br />
}<br />
ul.nav-innerUl5{<br />
background: #ebfcff;<br />
}<br />
ul.nav-innerUl6{<br />
background: #ffeee8;<br />
}<br />
li.nav-innerLi{<br />
font-size: 10px;<br />
line-height: 14px;<br />
padding: 3px 5px;<br />
}<br />
li.nav-innerLi:hover{<br />
background: #fff;<br />
}<br />
div.middle {<br />
width: 940px;<br />
background: #e6deb8;<br />
background: rgba(230,222,184,0.5);<br />
position: absolute;<br />
top: 178px;<br />
}<br />
div.aside {<br />
width: 174px;<br />
height: 441px;<br />
background: url("https://static.igem.org/mediawiki/2012/9/96/Aside-bg2.png") no-repeat;<br />
margin-left: 10px;<br />
float: left;<br />
padding: 179px 86px 0 40px;<br />
}<br />
div.asideFixed {<br />
position: fixed;<br />
top: 0;<br />
}<br />
ul.aside-outerUl {<br />
position: relative;<br />
margin: 7px 10px;<br />
}<br />
li.aside-outerLi {<br />
margin: 10px 0;<br />
}<br />
li.aside-outerLi h2{<br />
padding: 4px 0;<br />
color: #725718;<br />
background: #fff1a9;<br />
font-size: 14px;<br />
line-height: 22px;<br />
font-weight: bold;<br />
text-align: center;<br />
cursor: pointer;<br />
}<br />
li.aside-outerLi:hover h2{<br />
background: #fff8d3;<br />
}<br />
ul.aside-innerUl {<br />
display: none;<br />
}<br />
ul.aside-innerUl li {<br />
background: #bdc9ad;<br />
margin: 3px 0;<br />
font-family: arial, sans-serif;<br />
font-size: 14px;<br />
line-height: 22px;<br />
text-align: center;<br />
cursor: pointer;<br />
}<br />
ul.aside-innerUl li:hover{<br />
background: #d4dcc9;<br />
}<br />
div.main {<br />
width: 580px;<br />
border: 1px solid #9e8366;<br />
background: #f0e2c1;<br />
float: right;<br />
margin: 149px 30px 30px 0;<br />
}<br />
div.passage {<br />
display: none;<br />
margin: 30px;<br />
}<br />
div.show{<br />
display: block;<br />
}<br />
div.passage h3 {<br />
font-size: 26px;<br />
line-height: 39px;<br />
font-weight: bold;<br />
background: #859f93;<br />
color: #f0e2c1;<br />
display: block;<br />
width: auto;<br />
padding: 0 10px;<br />
}<br />
div.passage p {<br />
margin: 14px 0;<br />
font-size: 13px;<br />
line-height: 20px;<br />
}<br />
div.passage img {<br />
display: block;<br />
float: right;<br />
padding: 0 0 20px 30px;<br />
background: #f0e2c1;<br />
}<br />
div.footer {<br />
}<br />
#p-logo {<br />
display:none;<br />
}<br />
#top-section {<br />
height:0;<br />
border:none;<br />
}<br />
#search-controls {<br />
display:none;<br />
}<br />
#content {<br />
position:inherit;<br />
width:inherit;<br />
margin:0;<br />
padding:0;<br />
background:inherit;<br />
color:inherit;<br />
border:none;<br />
line-height:inherit;<br />
z-index:2;<br />
}<br />
.firstHeading {<br />
display:none;<br />
}<br />
#catlinks {<br />
display:none;<br />
}<br />
#footer-box {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#menubar ul li a {<br />
background:none;<br />
}<br />
#bodyContent h1,#bodyContent h2 {<br />
margin:0;<br />
border:0;<br />
padding: 0;<br />
}<br />
#bodyContent h2.nav-h2-title{<br />
padding: 5px 0;<br />
}<br />
.left-menu:hover {<br />
background:none;<br />
}<br />
.nav-bg-logo{<br />
float: left;<br />
}<br />
</style><br />
</head><br />
<body><br />
<div class="center"><br />
<div class="header"><br />
<img class="nav-bg-logo" src="https://static.igem.org/mediawiki/2012/4/44/Nav-bg-logo1.png" /><br />
<div class="nav"><br />
<ul class="nav-outerUl"><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China"><h2 class="nav-h21" title="Home"></h2></a><br />
<ul class="nav-innerUl nav-innerUl1" name="Home"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Team"><h2 class="nav-h22" title="Team"></h2></a><br />
<ul class="nav-innerUl nav-innerUl2" name="Team"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Project"><h2 class="nav-h23" title="Project"></h2></a><br />
<ul class="nav-innerUl nav-innerUl3" name="Project"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Modeling"><h2 class="nav-h24" title="Modeling"></h2></a><br />
<ul class="nav-innerUl nav-innerUl4" name="Modeling"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Notebooks"><h2 class="nav-h25 nav-h25on" title="Notebooks"></h2></a><br />
<ul class="nav-innerUl nav-innerUl5" name="Notebooks"></ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/HumanPractice"><h2 class="nav-h26" title="Human Practice"></h2></a><br />
<ul class="nav-innerUl nav-innerUl6" name="HumanPractice"></ul><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div class="middle"><br />
<div class="aside"><br />
<ul class="aside-outerUl"></ul><br />
</div><br />
<div class="main"><br />
<div class="passage divcell0"><br />
<table class=" pgrouptable tablesorter" cellspacing="0" cellpadding="0" style="width: 100%;"><thead><br />
<tr><th class="header" style="width:8px"></th><th class="header" style="width:8px"></th><th class="header" style="width:8px"></th><th class="header" style="width: 87px;">Name</th><th class="header" style="width: 80px" colspan="">Type</th><th class="header" style="width: auto;" colspan="">Description</th><th class="header" style="width: 150px" colspan="">Designer</th><th class="header" style="width: 50px" colspan="">Length</th><br />
</tr></thead><tbody><br />
<tr><br />
<td class="status_cell heart13">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861060">BBa_K861060</a></td><td>Regulatory</td><td>PfadR, synthetic promoter with tandem FadR binding site</td><td width="100px">Kuanwei Sheng</td><td align="right">76</td><br />
</tr><br />
<tr><br />
<td class="status_cell heart13">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861171">BBa_K861171</a></td><td>Regulatory</td><td>Pcar, synthetic promoter repressed by CRP</td><td width="100px">Kuanwei Sheng</td><td align="right">36</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861001">BBa_K861001</a></td><td>Generator</td><td>FadL with a strong RBS and a double terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">1465</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_green">W</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861002">BBa_K861002</a></td><td>Generator</td><td>Constitutively expressed FadL</td><td width="100px">Kuanwei Sheng</td><td align="right">1508</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861003">BBa_K861003</a></td><td>Generator</td><td>PfadR regulated FadL</td><td width="100px">Kuanwei Sheng</td><td align="right">1549</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861010">BBa_K861010</a></td><td>Coding</td><td>FadD, an inner membrane-associated acyl-CoA synthase</td><td width="100px">Kuanwei Sheng</td><td align="right">1605</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861011">BBa_K861011</a></td><td>Generator</td><td>FadD with RBS and terminator.</td><td width="100px">Kuanwei Sheng</td><td align="right">1729</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861013">BBa_K861013</a></td><td>Generator</td><td>IPTG induced FadD</td><td width="100px">Kuanwei Sheng</td><td align="right">1792</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861014">BBa_K861014</a></td><td>Generator</td><td>Constitutively expressed FadD</td><td width="100px">Kuanwei Sheng</td><td align="right">1772</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861015">BBa_K861015</a></td><td>Generator</td><td>Constitutively expressed FadD</td><td width="100px">Kuanwei Sheng</td><td align="right">1772</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861016">BBa_K861016</a></td><td>Generator</td><td>PfadR regulated FadD</td><td width="100px">Kuanwei Sheng</td><td align="right">1813</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861020">BBa_K861020</a></td><td>Coding</td><td>FadE ,acyl-CoA dehydrogenase </td><td width="100px">Kuanwei Sheng</td><td align="right">2445</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861021">BBa_K861021</a></td><td>Coding</td><td>FadE gene for fatty acid degradation from <i>Salmonella enterica</i> LT2</td><td width="100px">Kuanwei Sheng</td><td align="right">2592</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861022">BBa_K861022</a></td><td>Generator</td><td>FadE with RBS and terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">2569</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861023">BBa_K861023</a></td><td>Generator</td><td>S-FadE with a RBS and a terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">2716</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861024">BBa_K861024</a></td><td>Generator</td><td>IPTG induced FadE</td><td width="100px">Kuanwei Sheng</td><td align="right">2632</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861025">BBa_K861025</a></td><td>Generator</td><td>Constitutively expressed FadE</td><td width="100px">Kuanwei Sheng</td><td align="right">2612</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861026">BBa_K861026</a></td><td>Generator</td><td>Constitutively expressed FadE</td><td width="100px">Kuanwei Sheng</td><td align="right">2612</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861027">BBa_K861027</a></td><td>Generator</td><td>Constitutively expressed FadE</td><td width="100px">Kuanwei Sheng</td><td align="right">2612</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861028">BBa_K861028</a></td><td>Generator</td><td>PfadR regulated FadE</td><td width="100px">Kuanwei Sheng</td><td align="right">2653</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861029">BBa_K861029</a></td><td>Regulatory</td><td>PfadR regulated S-FadE</td><td width="100px">Kuanwei Sheng</td><td align="right">2800</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861030">BBa_K861030</a></td><td>Coding</td><td>FadB, gene for fatty acid degradation from E.coli K12</td><td width="100px">Kuanwei Sheng</td><td align="right">1164</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861031">BBa_K861031</a></td><td>Coding</td><td>FadJ, gene for fatty acid degradation from <i>E.coli str. K12</i></td><td width="100px">Kuanwei Sheng</td><td align="right">2145</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861032">BBa_K861032</a></td><td>Coding</td><td> S-FadB gene for fatty acid degradation from <i>Salmonella enterica</i> LT2</td><td width="100px">Kuanwei Sheng</td><td align="right">2190</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861033">BBa_K861033</a></td><td>Generator</td><td>FadB with a RBS and a terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">1288</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861034">BBa_K861034</a></td><td>Generator</td><td> FadJ gene with a RBS and a terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">2269</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861035">BBa_K861035</a></td><td>Generator</td><td>S-FadB with a RBS and a terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">2314</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861036">BBa_K861036</a></td><td>Generator</td><td>IPTG induced FadA and FadB</td><td width="100px">Kuanwei Sheng</td><td align="right">2544</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861037">BBa_K861037</a></td><td>Generator</td><td>IPTG induced FadI and FadJ</td><td width="100px">Kuanwei Sheng</td><td align="right">3672</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861038">BBa_K861038</a></td><td>Generator</td><td>IPTG induced S-FadA and S-FadB</td><td width="100px">Kuanwei Sheng</td><td align="right">3673</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861041">BBa_K861041</a></td><td>Coding</td><td>FadI, gene for fatty acid degradation from <i>E.coli str. K12</i></td><td width="100px">Kuanwei Sheng</td><td align="right">1311</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861042">BBa_K861042</a></td><td>Coding</td><td>FadA, gene for fatty acid degradation from <i>Salmonella enterica</i> LT2</td><td width="100px">Kuanwei Sheng</td><td align="right">1164</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861043">BBa_K861043</a></td><td>Translational_Unit</td><td>FadA with a RBS</td><td width="100px">Kuanwei Sheng</td><td align="right">1185</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861044">BBa_K861044</a></td><td>Translational_Unit</td><td>FadI with a RBS</td><td width="100px">Kuanwei Sheng</td><td align="right">1332</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861045">BBa_K861045</a></td><td>Generator</td><td>S-FadA with a RBS and a terminator </td><td width="100px">Kuanwei Sheng</td><td align="right">1288</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861046">BBa_K861046</a></td><td>Generator</td><td>PfadR regulated FadA and FadB</td><td width="100px">Kuanwei Sheng</td><td align="right">2565</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861047">BBa_K861047</a></td><td>Generator</td><td>PfadR regulated FadI and FadJ</td><td width="100px">Kuanwei Sheng</td><td align="right">3693</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861048">BBa_K861048</a></td><td>Generator</td><td>PfadR regulated S-FadA and S-FadB</td><td width="100px">Kuanwei Sheng</td><td align="right">3591</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861050">BBa_K861050</a></td><td>Coding</td><td>FadR, fatty acid sensor from <i>E.coli str. K12</i></td><td width="100px">Kuanwei Sheng</td><td align="right">720</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861051">BBa_K861051</a></td><td>Generator</td><td>FadR with a RBS and a terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">844</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861052">BBa_K861052</a></td><td>Generator</td><td>Constitutive expressed FadR</td><td width="100px">Kuanwei Sheng</td><td align="right">887</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861061">BBa_K861061</a></td><td>Reporter</td><td>Efficacy testing RFP generator of BBa_K861060 (PfadR)</td><td width="100px">Kuanwei Sheng</td><td align="right">945</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861062">BBa_K861062</a></td><td>Regulatory</td><td>PfadR with FadR overexpressed</td><td width="100px">Kuanwei Sheng</td><td align="right">1840</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_green">W</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861070">BBa_K861070</a></td><td>Coding</td><td>AdrA gene from E.coli K12</td><td width="100px">Kuanwei Sheng</td><td align="right">1167</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_green">W</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861071">BBa_K861071</a></td><td>Generator</td><td>AdrA gene with a RBS and a terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">1293</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_green">W</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861072">BBa_K861072</a></td><td>Generator</td><td>Constitutively expressed AdrA</td><td width="100px">Kuanwei Sheng</td><td align="right">1336</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_green">W</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861073">BBa_K861073</a></td><td>Generator</td><td>Constitutively expressed AdrA</td><td width="100px">Kuanwei Sheng</td><td align="right">1336</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861074">BBa_K861074</a></td><td>Generator</td><td>Pcar regulated AdrA</td><td width="100px">Kuanwei Sheng</td><td align="right">1337</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861090">BBa_K861090</a></td><td>Coding</td><td>YhjH Gene From <i>E.coli str. K12</i></td><td width="100px">Kuanwei Sheng</td><td align="right">768</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861091">BBa_K861091</a></td><td>Generator</td><td>YhjH gene with a RBS and a Terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">892</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861100">BBa_K861100</a></td><td>Coding</td><td>BcsA,cellulose synthetase, catalytic subunit</td><td width="100px">Xian Xia</td><td align="right">2619</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861101">BBa_K861101</a></td><td>Generator</td><td>BcsA with RBS and terminator</td><td width="100px">Xian Xia</td><td align="right">2743</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861102">BBa_K861102</a></td><td>Generator</td><td> BcsA controlled by promoter repressed by CRP</td><td width="100px">Xian Xia</td><td align="right">2787</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861110">BBa_K861110</a></td><td>Coding</td><td>BcsB,regulator of cellulose synthetase</td><td width="100px">Xian Xia</td><td align="right">2340</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861111">BBa_K861111</a></td><td>Generator</td><td>BcsB with RBS and terminator</td><td width="100px">Xian Xia</td><td align="right">2464</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861112">BBa_K861112</a></td><td>Generator</td><td>BcsB controlled by promoter repressed by CRP</td><td width="100px">Xian Xia</td><td align="right">2508</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861120">BBa_K861120</a></td><td>Coding</td><td>BcsZ, endo-1,4-D-glucanase</td><td width="100px">Xian Xia</td><td align="right">1107</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861121">BBa_K861121</a></td><td>Generator</td><td>BcsZ with RBS and terminator</td><td width="100px">Xian Xia</td><td align="right">1231</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861122">BBa_K861122</a></td><td>Generator</td><td>BcsZ generator repressed by CRP (directly)</td><td width="100px">Xian Xia</td><td align="right">1275</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861130">BBa_K861130</a></td><td>Coding</td><td>BcsC,cellulose synthetase subunit</td><td width="100px">Xian Xia</td><td align="right">3474</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861131">BBa_K861131</a></td><td>Generator</td><td>BcsC with RBS and terminator</td><td width="100px">Xian Xia</td><td align="right">3598</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861132">BBa_K861132</a></td><td>Generator</td><td>BcsC controlled by promoter repressed by CRP</td><td width="100px">Xian Xia</td><td align="right">3642</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861140">BBa_K861140</a></td><td>Coding</td><td> GalU,glucose-1-phosphate uridylyltransferase</td><td width="100px">Chang Liu</td><td align="right">909</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861141">BBa_K861141</a></td><td>Generator</td><td>GalU with a RBS and a terminator</td><td width="100px">Xian Xia</td><td align="right">1033</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861142">BBa_K861142</a></td><td>Generator</td><td>GalU generator repressed by CRP (directly)</td><td width="100px">Xian Xia</td><td align="right">1077</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861150">BBa_K861150</a></td><td>Coding</td><td>GalF, putative regulatory subunit for GalU </td><td width="100px">Xian Xia</td><td align="right">894</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861151">BBa_K861151</a></td><td>Generator</td><td>GalF with a RBS and a terminator</td><td width="100px">Xian Xia</td><td align="right">1018</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861152">BBa_K861152</a></td><td>Generator</td><td>GalF generator repressed by CRP (directly)</td><td width="100px">Xian Xia</td><td align="right">1062</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861160">BBa_K861160</a></td><td>Coding</td><td>CRP, cAMP receptor protein</td><td width="100px">Kuanwei Sheng</td><td align="right">633</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861161">BBa_K861161</a></td><td>Generator</td><td>CRP with a RBS and a terminator</td><td width="100px">Kuanwei Sheng</td><td align="right">757</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861162">BBa_K861162</a></td><td>Generator</td><td>Constitutively expresses Crp</td><td width="100px">Xian Xia, Kuanwei Sheng</td><td align="right">800</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861163">BBa_K861163</a></td><td>Generator</td><td>Constitutively expresses Crp</td><td width="100px">Xian Xia</td><td align="right">800</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861169">BBa_K861169</a></td><td>Regulatory</td><td>Indirect regulatory device, activated at high glucose concentration</td><td width="100px">Kuanwei Sheng</td><td align="right">1961</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861170">BBa_K861170</a></td><td>Regulatory</td><td>PI ,Glucose-activated promoter</td><td width="100px">Kuanwei Sheng</td><td align="right">36</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861172">BBa_K861172</a></td><td>Generator</td><td> lambda cI generator controlled by PcstA (glucose-repressible promoter)</td><td width="100px">Xian Xia</td><td align="right">1069</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861173">BBa_K861173</a></td><td>Reporter</td><td>mRFP generator controlled by PcstA (glucose-repressible promoter)</td><td width="100px">Kuanwei Sheng, Xian Xia</td><td align="right">1000</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861174">BBa_K861174</a></td><td>Regulatory</td><td>A control device for BBa_K861169</td><td width="100px">Xian Xia</td><td align="right">1899</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861175">BBa_K861175</a></td><td>Reporter</td><td>Efficacy testing RFP generator of BBa_K861170 (PI)</td><td width="100px">Kuanwei Shneg, Xian Xia</td><td align="right">905</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861176">BBa_K861176</a></td><td>Reporter</td><td>mRFP expressed after Pcar</td><td width="100px">Kuanwei Sheng, Xian Xia</td><td align="right">905</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861177">BBa_K861177</a></td><td>Generator</td><td>K861162+ K861175 </td><td width="100px">Kuanwei Sheng</td><td align="right">1713</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861178">BBa_K861178</a></td><td>Device</td><td>Pcar efficacy testing device with CRP overexpressed</td><td width="100px">Kuanwei Sheng, Xian Xia</td><td align="right">1713</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861179">BBa_K861179</a></td><td>Generator</td><td>K861162+J23119</td><td width="100px">Chang Liu</td><td align="right">843</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861345">BBa_K861345</a></td><td>Generator</td><td>IPTG induced S-fadE</td><td width="100px">Kuanwei Sheng</td><td align="right">2779</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861346">BBa_K861346</a></td><td>Intermediate</td><td>IPTG induced promoter with FadA, intermediate part for BBa_K861036</td><td width="100px">Kuanwei Sheng</td><td align="right">1248</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861347">BBa_K861347</a></td><td>Intermediate</td><td>IPTG induced promoter with FadI, intermediate part for BBa_K861037</td><td width="100px">Kuanwei Sheng</td><td align="right">1395</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861348">BBa_K861348</a></td><td>Intermediate</td><td>IPTG induced promoter with S-FadA, intermediate part for BBa_K861038</td><td width="100px">Kuanwei Sheng</td><td align="right">1351</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861349">BBa_K861349</a></td><td>Intermediate</td><td>PfadR with FadA, intermediate part for BBa_K861046</td><td width="100px">Kuanwei Sheng</td><td align="right">1269</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861350">BBa_K861350</a></td><td>Composite</td><td>PfadR with FadI, intermediate part for BBa_K861047</td><td width="100px">Kuanwei Sheng</td><td align="right">1416</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861351">BBa_K861351</a></td><td>Composite</td><td>PfadR with S-FadA, intermediate part for BBa_K861048</td><td width="100px">Kuanwei Sheng</td><td align="right">1372</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861400">BBa_K861400</a></td><td>Coding</td><td>Gene coding protein FadA for fatty acid degradation</td><td width="100px">Kuanwei Sheng</td><td align="right">1164</td><br />
</tr><br />
<tr><br />
<td class="status_cell "></td><td class="status_cell cell_white">&nbsp;</td><td class="status_cell cell_white">&nbsp;&nbsp;</td><td><a class="noul_link" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861500">BBa_K861500</a></td><td>Coding</td><td>FadL, Long-chain fatty acids transporter from <i>E.coli str. K12</i></td><td width="100px">Kuanwei Sheng</td><td align="right">1341</td><br />
</tr><br />
</tbody><br />
</table><br />
</div><br />
<div class="passage divcell1"><br />
<a name="Brief Answers to Safety Questions"><h3>Brief Answers to Safety Questions</h3></a><br />
<p align="justify"> Welcome to our Safety Page. We will first answer the safety questions asked by iGEM headquarters briefly, and then discuss safety issues associated with our project in detail. In addition, we will provide our ideas and practice on guaranteeing and developing biosafety.<br />
</p><br />
<p align="justify"><br />
<strong>Q1. Would any of your project ideas raise safety issues in terms of: Researcher safety, public safety, or environmental safety?</strong></br><br />
No. Our design is based on the commonly used nonpathogenic <i>E. coli K.12</i> strain and genes we manipulated are original genes in <i>E. coli</i>. The protein products, at least from current understanding, will cause no harm to researchers, the public and environment. In addition, strict lab practice is executed to further ensure safety.<br />
</p><br />
<p align="justify"><br />
<strong>Q2. Do any of the new BioBrick parts (or devices) that you made this year raise any safety issues? If yes,</br> <br />
Did you document these issues in the Registry?</br><br />
How did you manage to handle the safety issue?</br><br />
How could other teams learn from your experience?</strong></br><br />
Yes, we will discuss this question in latter part of this page (Safety Considerations of Our Biobrick parts and Our Project).<br />
</p><br />
<p align="justify"><br />
<strong>Q3. Is there a local biosafety group, committee, or review board at your institution?</br> <br />
If yes, what does your local biosafety group think about your project?</br><br />
If no, which specific biosafety rules or guidelines do you have to consider in your country?</strong></br><br />
Yes. All materials obtained have received the approvals from the department's laboratory management committees. We are also obliged to observe the regulations of Teaching Centre of Experimental Biology and apply for approval for materials before we start our project.<br />
</p><br />
<p align="justify"><br />
<strong>Q4. Do you have any other ideas how to deal with safety issues that could be useful for future iGEM competitions? How could parts, devices and systems be made even safer through biosafety engineering?</strong></br><br />
Some classified measures should be taken according to the safety of the material. For example, plasmids that may harm the safety, when submitted, should receive more attention and have a stricter package. Some harmful byproducts during experiments should be eliminated properly.</br><br />
We have done our human practice aiming at understanding attitude of the public towards genetically modified baceria and publicizing biosafety ideas to the public, which we think should be popularized to other teams in future iGEM competitions.<br />
</p><br />
<a name="General Safety Issues"><h3>General Safety Issues</h3></a><br />
<p align="justify"><br />
In this part, we will illustrate organisms, reagents and equipments we use that may cause safety problems, and introduce our operation standard, management and trains protecting the team members, public and environment.<br />
<br /><br />
<img src="https://static.igem.org/mediawiki/2012/0/05/Safety_Table_1.jpg" width="500" height="500" hspace="2" vspace="1" border="2" align="top" /><br />
As above, all the organisms and DNA hosts are not of high individual or community risk. Until now, the only used organism is <i>E. coli K.12</i> (and some of its varieties, for example, DH5&alpha;, a RecA mutated strain). Our current lab of basic-biosafety level 1 is safe enough to manipulate this strain. Only the genome (a generous present from University of Dundee iGEM team), but not the living Salmonella enterica was manipulated in the lab, and the genes from it are homogeneous of <i>E. coli K.12</i>, not associated with pathogenesis. We will not implement our future experimental plan with microorganisms of risk group 2 or vertebrates in our current lab, for too low is the biosafety level and no animal facilities.<br />
<br /><br />
To manipulate microorganisms, an ultra clean cabinet is used and strict aseptic technique is followed. All experimenters have been trained on foundation microbiology technique and biosafety. All microorganism contacting vessels are sterilized before and after experiments in appropriate protocols. Also, all microorganism materials will be sterilized before discarded. In this way, we believe that no public or environmental harm will be caused by the experimental organisms. In addition, no one in our team will be hurt by the experimental organisms.<br />
<br /><br />
The genetic modifications we make will change metabolism of bacteria. However, there is no evidence both theoretically and experimentally that these modifications will improve the pathogenicity of the bacteria or cause damage to environment even taking the risk of horizontal gene transfer into consideration. The effects of expressing gene <i>adrA</i> regarding infectivity and pathogenicity on <i>E. coli</i> is not clear now, but it still can be easily controlled in the lab environment without human ingestion. Also, we will insert a death device into the bacteria cell when we construct the whole system (still far from now) to avoid the proliferation out of control. For more information about gene safety, please read the next section and documents of our relevant parts on registry.<br />
</p><br />
<p align="justify"><br />
We have considered the potential harmful chemicals and equipments, as listed below:<br />
<ul><br />
<li></p><br />
<p align="justify"> Basic molecular experiments: NaOH, HCl, SDS, acrylamide, TEMED, ethanol, IPTG, liquid nitrogen, &beta;-mercaptoethanol, xylene cyanol FF.<br />
</li><br />
<li></p><br />
<p align="justify"> Bacteria culture: ampicillin, kanamycin, chloramphenicol.<br />
</li></p><br />
<p align="justify"> Chemical analysis and measurements: acetone, cupric acetate, Sudan III, Congo red, Coomassie Brilliant Blue G-250, Coomassie Brilliant Blue R-250.<br />
<li></p><br />
<p align="justify"> Equipments: UV lamp, supercentrifuge, heating equipments (alcohol burner, PCR amplifier, water bath, dry bath), electrophoresis apparatus, -80℃ refrigerator, ultrasonic cell disruptor.<br />
</li><br />
</ul><br />
</br></p><br />
<p align="justify"> All of these are regular reagents and apparatus in a molecular biology laboratory. The risks of them come from inflammability, explosibility, irritation, corrosivity, toxicity, carcinogenicity and physical injury. But none of them raises special safety issue, with chemical hood, emergency shower, normal personal protection, safety management and safety training.</br><br />
Only trace amount of antibiotics are used. Inactivated will they be before discared.<br />
</p><br />
<p ><br />
<img src="https://static.igem.org/mediawiki/2012/0/07/Safety_Figure_3.jpg" alt="Emergency Shower" width="500" height="750" hspace="2" vspace="1" border="2" align="top" /><strong>Emergency Shower</strong></img><br />
</p><br />
<a name="Safety Considerations of Our Biobrick parts and Our Project"><h3>Safety Considerations of Our Biobrick parts and Our Project</h3></a><br />
<p><br />
In this section, we are going to answer safety question 2 in detail, taking the potential risk in the future into concern.<br />
<br /><br />
The main safety challenge we must face is that as a practical bacteria therapy our direction is, we shall demonstrate that the “<i>E. coslim</i>” will not harm its host when it is developed completely. As few experiments we can do in such limited time, we have done a series of theoretical work to solve problems in this field.<br />
Intestine-colonized pathogenic <i>E. coli</i> may cause immune responses, following by diarrhea, inflammation and fever (although the strain we use is considered non-pathogen). Thus we plan to transplant the whole synthetic system to another organism (for example, <i>Bacillus subtilis</i>, has proved safe in human intestine). We know that it is hard as the two organisms are very different on transcriptional mechanisms, but we believe the work of establishing model system (that is what we are doing) in <i>E. coli</i> will make it easier. Also, as the rapid development of synthetic biology and gut microbiology, we hope in the near future, we can modify the genome of <i>E. coli</i> to change it a safe intestine microbe.<br />
<br /><br />
Another risk is that when the engineered bacteria get higher efficiency on energy production, they could proliferate out of control. To forestall this situation, we design a “death” device (for more information, click on <a href="https://2012.igem.org/Team:WHU-China/Death">Death</a>) using D-xylose as inducer. It means if you want to stop weight losing, what you have to do is to eat some D-xylose, and the “<i>E. coslim</i>” will die, shed from the intestinal wall and be poured out. What is more, designed as a two-plasmid system, it prevents all possible horizontal gene transfers.<br />
<br /><br />
Further safety issues will be raised and discussed in future experiments, including those operates in intestinal model and animals (For more information, click on Future Perspectives).<br />
</p><br />
<a name="Safety Management and Practice"><h3>Safety Management and Practice</h3></a><br />
<p align="justify"><br />
Our project has past a review of an expert committee, of which members are professors or associate professors of microbiology, genetics and bioengineering. Safety issues are considered seriously before they approved our design. <br />
We have consulted a few experts for safety questions about both artificial intestinal bacteria and experiments. Their advices help us improve the safety of the whole planning system. For that, we thank Dr. Yulan Wang and Dr. Tiangang Liu so much.<br />
Our lab is supervised by Teaching Centre of Experimental Biology, Wuhan University (TCEB, whose leader is our instructor <a href="https://2012.igem.org/Team:WHU-China/Team#Zhixiong Xie">Dr. Zhixiong Xie</a>). An expert group of this centre formulates safety guidelines and guarantees their performance in all teaching labs. All experiments we do past its review.<br />
Our safety management system includes the followings:<br />
Management of Chemicals, Equipments and Experimenters: Chemicals and equipments are registered in TCEB before they are available for us. Equipments are checked and maintained regular. And an entrance guard system is used to ensure only the admitted could enter the lab.<br />
<ul><br />
<li><br />
Responsibility distribution: All members worked in the lab are divided to three groups. The group leaders arrange schedules of experiments after assessing safety issues in the group (for example, the safety train of the experimental executer). Every member records his/her experiments in detail in the notebook of the group. Each group takes responses for cleaning and checking risks in the lab in turns. The group leader takes responses to the team leader. The team leader reports regular on safety to engineer Miss Long Yan, who is authorized by TCEB and manages the lab.<br />
</li><br />
<li><br />
Management of Chemicals, Equipments and Experimenters: Chemicals and equipments are registered in TCEB before they are available for us. Equipments are checked and maintained regular. And an entrance guard system is used to ensure only the admitted could enter the lab.<br />
</li><br />
<li><br />
Training: Our team members have been trained after Guidance of Student Experiments formulated by TCEB. <br />
</li><br />
</ul><br />
</p><br />
<p><br />
<img src="https://static.igem.org/mediawiki/2012/f/fe/Safety_Figure_4.png" alt="Guidence of Student Experiments" height="500" width="500" hspace="2" vspace="1" border="2" align="top" /><strong>Guidence of Student Experiments</strong></img><br />
</p><br />
<a name="Biosafety and Publicity"><h3>Biosafety and Publicity</h3></a><br />
<p align="justify"><br />
We believe that biosafety is not an issue which should be only considered inside biological lab, but also around people and communities. Spreading knowledge of biosafety to the public will help eliminate misunderstanding and prejudice, from which the science and all the people will benefit. We hope that sharing this idea with all iGEM teams can be useful to take advantage on biosafety.<br />
<br /><br />
To investigate public attitude towards our project and to publicize our biosafety ideas are what we do for our human practice. As “eating bacteria” is somehow an unacceptable concept now, we would like to find whether people know the truth about biosafety issues raised by bioengineered bacteria, or they are just panicked by their imaginary “bacteria”. And then, after initiating basic knowledge of microbiology, gene engineering and synthetic biology, we shall take a look on if people’s opinion to biosafety issues will change. In this way, we will estimate the value of our scientific publicity.<br />
<br /><br />
The rational discussions of biosafety we take with the public do not limited on our project, but also hotspot issues such as transgenics and stem cell therapies. For more information, please click on <a href="https://2012.igem.org/Team:WHU-China/Human_Practice">Human Practice</a>.<br />
</p><br />
<p><br />
<img src="https://static.igem.org/mediawiki/2012/a/a4/Safety_Figure_5.jpg" alt="Introducing a Simplified Intestinal Model" width="500" height="333" hspace="2" vspace="1" border="2" align="center" /><strong>Introducing a Simplified Intestinal Model</strong></img><br />
</p><br />
</div><br />
<div class="passage divcell2"><br />
<a name="Protocol for fluorescence measurement"><h4>Protocol for fluorescence measurement</h4></a><br />
<h4>Minimal Medium</h4></a><br />
<p align="justify">M9: </p><br />
<p align="justify"> For 1L Medium add</p><br />
<p align="justify">Na<sub>2</sub>HPO<sub>4</sub>·12H<sub>2</sub>O 15g </p><br />
<p align="justify">KH<sub>2</sub>PO<sub>4</sub> 3g</p> <br />
<p align="justify">NaCl 1g </p><br />
<p align="justify">NH<sub>4</sub>Cl 0.5g</p><br />
<p align="justify">After autoclaving, add: </p><br />
<p align="justify">MgSO<sub>4</sub>(1mol/L) 2mL</p><br />
<p align="justify">Bacteria strain:CaCl<sub>2</sub> 100μL </p><br />
<p align="justify">Triton X-100 (as emulsifier) 2uL</p><br />
<p align="justify"><br> </p><br />
<h4>Note</h4></a><br />
<p align="justify">1.For M9 medium using oleic acid as sole carbon source, various amount of oleic acid was first emulsified 1:1 with 10% Triton X-100. M9 medium was then slowly added with constant vortex. M9 medium with high concentration of oleic acid was diluted by M9 medium with triton to form various concentrations;</p><br />
<p align="justify">2. For M9 medium using glucose as sole carbon source, M9 medium with high concentration of glucose was diluted by M9 medium to form various concentrations.</p> <br />
<h4>Step</h4></a><br />
<p align="justify">1. Seed liquor which was activated over night was inoculated into M9 medium which contains different concentration of oleic acid. And it was then incubated at 37℃ for 24 hours;</p><br />
<p align="justify">2. After 24h of incubation in 24 well plates in 37℃, bacteria culture was centrifuged at 3000rmp for 5min, washed and resuspended in PBS;</p><br />
<p align="justify">3. We detected the OD600 and fluorescence of using SpectraMax M2 plate reader (Molecular Devices) .Excitation at 584 nm and emission at 607 nm were used. All fluorescence was normalized with cell density by measuring the absorbance at 600 nm.</p><br />
<br />
<a name="Protocols of Cupric-Soap Reaction"><h3>Protocols of Cupric-Soap Reaction</h3></a><br />
<p align="justify">To test metabolism of long fatty acids, we used oleic acid as sole carbon source in mediums, and used cupric-soap reaction to determinate oleic acid concentration preliminarily. </p><br />
<p align="justify">Modified M9 minimal medium with emulsified oleic acid as sole carbon</p><br />
<p align="justify"> Minimal medium was the same with that in Materials and methods for PfadR </p><br />
<p align="justify">What's Important:</p><br />
<p align="justify">Slowly pour M9 minimal medium into mixture of oleic acid and Triton X-100 to get more homogeneous solution.</p><br />
<p align="justify">Analysis the concentration of the oleic acid in the medium by cupric-acetate method</p><br />
<h4>Step</h4></a><br />
<p align="justify">1.Collect 5 ml medium which has been used to cultivate bacteria. Then centrifuge the medium at 3000rpm for 10 min to separate bacteria and medium;</p><br />
<p align="justify"> 2.Decant 3ml supernatant liquid into a 10ml EP. Add 3ml acetone to the liquid, 1ml at a time, shaking 10-20 times before adding another 1 ml in order to avoid the effect of the ions of the liquid during the extraction progress;</p><br />
<p align="justify"> 3.Add 3 ml isooctane once ,shaking for at least 90s, stand for 2min or longer until layering completely;</p><br />
<p align="justify"p>4.Collect 3 ml clear isooctane in a 5 ml EP, Add 800?l cupric-acetate (5% m/v, adjust pH to 6.8 with pyridine), Shaking for 90 seconds, stand for 2min or longer until layering completely;</p><br />
<p align="justify">5.Detect OD of organic phase in a spectrometry at 715nm.</p><br />
<h4>The Standard Curve</h></a><br />
<p align="justify">We add 1.6ml, 3.2ml, 4.8ml, 6.4ml, 9.6ml, 11.2ml oleic acid into 3ml M9 medium to generate a gradient. The absorbency is measured as described in the protocol.</p><br />
<p align="justify"><img src="https://static.igem.org/mediawiki/igem.org/5/56/Wps_clip_image-5855.png"alt="Guidence of Student Experiments" height="500" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<p align="justify">We slightly modified the methods provided by Kwon and Rhee, 1986, adding the extraction step, for it is dispensable when bacteria are in the medium. However, the standard curve is still very close to the paper’s, which proves that plausible and accurate</p><br />
<br />
<br />
<br />
<a name="Krebs-Ringer Phosphate(KRPD Buffer Solution)"><h3>Krebs-Ringer Phosphate(KRPD Buffer Solution)</h3></a><br />
<br />
<h4>Solutions</h4><br />
<p align="justify"> Solution A:</p><br />
<p align="justify">For 100 mL: </p><br />
<p align="justify">NaCl 7.5985g ; KCl 0.3727g ; CaCl<sub>2</sub> 0.1054g; glucose-H<sub>2</sub>O 0.9495g, </p><br />
<p align="justify"> Solution A:</p><br />
<p align="justify">For 100 mL: </p><br />
<p align="justify"> NaH<sub>2</sub>PO<sub>4</sub>·2H<sub>2</sub>O 0 .2964g ;Na<sub>2</sub>HPO<sub>4</sub>·12H<sub>2</sub>O 2.9011g,</p><br />
<p align="justify">After dissolving, add MgSO<sub>4</sub>·7H<sub>2</sub>O 0.3130g</p><br />
<p align="justify">Mix A solution and B solution, add 790ml dd H<sub>2</sub>O, then regulate pH to 7.2~7.4 using 1M NaOH/1M HCl, finally add dd H<sub>2</sub>O to a final total volume of 1L. </p><br />
<h4">Procedures </h4><br />
<p align="justify">1. cultivate cells in 1 liter of medium to late exponential phase;</p><br />
<p align="justify">2. harvest by centrifugation at 35℃;</p><br />
<p align="justify">3. wash twice with 2 liters of warm(35℃)0.05M potassium phosphate buffer (pH 7.4) containing 1%(v/v) Triton X-100;</p><br />
<p align="justify">4. resuspend in 0.05M potassium phosphate buffer (pH 7.4) containing mercaptoethanol;</p><br />
<p align="justify">5. add sufficient volume of buffer to give a concentration of about 50mg(dry weight) of cells/ml;</p><br />
<p align="justify">6. disrupt cells with a Bransor Sonifier for 1min. The treatment was applied for 15s intervals, under 4 ℃;</p><br />
<p align="justify"> 7. centrifuge at10,000×g for 30min; </p><br />
<p align="justify">8. decant supernatant liquid for enzymatic assay, the protein concentration was determined by the biuret method;</p><br />
<p align="justify">9.analyze fatty acid oxidation in cell-free extracts</p><br />
<p align="justify">Note: little oxidation was observed when less than 1mg.</p><br />
<h4>Reaction Mixture</h4></a><br />
<p align="justify">1.0ml of freshly oxygenated Krebs-Ringer phosphate(pH 7.4)</p><br />
<p align="justify">Palmitate-1-14C, 20nmole (80,000 counts/min)</p><br />
<p align="justify">CoA, 1 μ mole</p><br />
<p align="justify">NAD, 1μ mole</p><br />
<p align="justify">ATP, 1μ mole</p><br />
<p align="justify">Succinate, 10 n moles</p><br />
<p align="justify">Supernatant protein, 1~5 mg</p><br />
<p align="justify">dd H<sub>2</sub>O to a final total volume of 2.0ml </p><br />
<br />
<br />
<br />
<br />
<a name="Cellulose Detection"><h3>Cellulose Detection</h3></a><br />
<br />
<p align="justify">1. Inoculate the bacteria into liquid LB medium and then incubate it for 24 hours at 37℃;</p><br />
<p align="justify">2. After centrifugation, supernatant is preserved for use, while deposits are resuspended with PBS and adjust to OD600 1.0;</p><br />
<p align="justify">3. Exceed cellulase was used to digest cellulose in supernatant and deposits. After the cellulase is added, 1mL solution was sampled every 3 min and cellulose of the sample was inactivated immediately;</p><br />
<p align="justify">4. Ten minutes later, the reduce sugar is detected in all the samples with or without cellulose;</p><br />
<br />
<br />
<p align="justify">5. 2mL DNS solution is mixed with the sample, and incubated in boiling water for two minutes, then it is cooled rapidly;</p><br />
<p align="justify">6. After 9 mL ddH<sub>2</sub>O being added into the solution, record absorbance at 540nm;</p><br />
<p align="justify">7.The Standard Curve of glucose concentration</p><br />
<p align="justify"><img src="https://static.igem.org/mediawiki/2012/c/cb/Biao.png" height="148" width="520" hspace="2" vspace="1" border="2" align="top" /></p><br />
<p align="justify"><img src="https://static.igem.org/mediawiki/2012/9/9c/Standard_curve.png" height="680" width="520" hspace="2" vspace="1" border="2" align="top" /></p><br />
<p align="justify">Then all tubes was treated in the same way with that in step 5 and 6.</p><br />
<p align="justify">8.Calculate the amount of cellulose in cell culture.</p><br />
<br />
<a name="In vitro Experiment"><h3>In vitro Experiment</h3></a><br />
<br />
<p align="justify">1. inoculate 100μl bacteria into 100ml LB , shaking at 37C overnight .</P><br />
<p align="justify">2. inoculate 1L LB using the culture above at the next morning , on the scale of 1:20 .</p><br />
<p align="justify">3. Separate above medium into 250ml flask , shaking at 37C for 3-4h .</p><br />
<p align="justify">4. 8000 rpm , 6min to collect the bacteria .</p><br />
<p align="justify">5. Using PBS to resuspend the bacteria to 50mg / ml .</p><br />
<p align="justify">6. Ultrasonication 1min , every 15s having an interval to cool on the ice .</p><br />
<p align="justify">7. Using Coomassie blue staining to measure the concentration of the total protein .</p><br />
<p align="justify">8. In 2ml reaction system , add 5ul oleate ,40 ul Triton 10% , 1ml Krebs-Ringer phosphate buffer , 10nmol succinate , 1 umol COA , 1umol ATP , 1 umol NAD . </p><br />
<p align="justify">9. react at 37C for 6h</p><br />
<br />
<p align="justify">In this experiment , the concentration of total protein in the cell extracts of the five sample are almost the same , so we assume that adding the same volume guarantee the same amount of protein is added . </p><br />
<br />
<p align="justify">The reaction system for the control BBa_R0011+(R0011), BBa_R0011+fadE , BBa_R0011 + fadD , BBa_R0011 + Samonella A Samonella B , BBa_R0011 + fadI fadJ : 1ml Krebs-Ringer phosphate buffer , 10nmol succinate , 1 umol COA , 1umol ATP , 1 umol NAD , 1ml cell extract .</p><br />
<br />
<p align="justify">The reaction system for BBa_R0011+fadD and BBa_R0011+fadE mixture : 2ml Krebs-Ringer phosphate buffer , 20 nmol succinate , 2 umol COA , 2 umol ATP , 2 umol NAD , 1ml cell extract for each gene.</p><br />
<br />
<p align="justify">The reaction system for BBa_R0011+fadD , BBa_R0011+fadE , and BBa_R0011 + Samonella fadA Samonella fadB mixture :<br />
3ml Krebs-Ringer phosphate buffer , 30nmol succinate , 3umol COA , 3umol ATP , 3 umol NAD , 1ml cell extract for each gene.</p><br />
<br />
<p align="justify">The reaction system for BBa_R0011+fadD , BBa_R0011+fadE , BBa_R0011+Samonella A Samonella B , and BBa_R0011+fad I fad J mixture :4ml Krebs-Ringer phosphate buffer , 40nmol succinate , 4umol COA , 4umol ATP , 4 umol NAD , 1ml cell extract for each gene </p><br />
<br />
<br />
<a name="Plate Assay"><h3>Plate Assay</h3></a><br />
<p align="justify">1. J12107- AdrA and control RBS was incubate and vortex in LB medium with Ampicillin overnight</p> <p align="justify">2. OD600 was measured; LB was then added to make the two test tubes had the same OD600</p> <p align="justify">3. Bacteria were inoculated by sterilized needle piercing a pre-labeled 0.3% agar LB semisolid plate for 4-5 minutes in super clean bench.</p> <p align="justify"> 4. Carefully placed the plate horizontally in a 37 degree incubator overnight. Avoid shaking of the plate.</p> <p align="justify">5. Clones on the plate were observed. </p> <br />
<br />
<br />
<a name="Materials and Methods of SDS-PAGE"><h3>Materials and Methods of SDS-PAGE</h3></a><br />
<br />
<p align="justify"><img src="https://static.igem.org/mediawiki/2012/a/ab/BIAO_2.png"alt="Guidence of Student Experiments" height="160" width="520" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<br />
<p align="justify">Coomassie Blue Stain</p><br />
<p align="justify">-Coomassie brilliant blue G-250 50mg</p><br />
<p align="justify">-95% ethanol 25ml</p><br />
<p align="justify">-85%H<sub>3</sub>PO<sub>4</sub> 50ml</p><br />
<p align="justify">-H<sub>2</sub>O, adjust to 500ml</p><br />
<p align="justify">-filter</p><br />
<br />
<p align="justify">Destain solution </p><br />
<p align="justify">-methanol 250ml</p><br />
<p align="justify">-acetic acid 50ml</p><br />
<p align="justify">-H<sub>2</sub>O adjust to 500ml</p><br />
<br />
<p align="justify">2x SDS loading buffer</p><br />
<p align="justify">-0.5mol/l Tirs-HCl(PH6.8) 25ml</p><br />
<p align="justify">-10%SDS 8ml</p><br />
<p align="justify">-50%glycerol 20ml</p><br />
<p align="justify">-2-mercaptoethanol 2ml</p><br />
<p align="justify">-1%Bromphenol Blue 4ml</p><br />
<p align="justify">-H<sub>2</sub>O adjust to 100ml</p><br />
<br />
<p align="justify">10xSDS-PAGE running buffer </p><br />
<p align="justify">Tris base, 30.3 g </p><br />
<p align="justify">M glycine 144.1g</p><br />
<p align="justify">SDS 10 g</p><br />
<p align="justify">-H<sub>2</sub>O adjust to 1L</p><br />
<p align="justify">Steps</p><br />
<br />
<p align="justify">Protein expression</p><br />
<p align="justify">1.inoculate the liquid strains into LB medium supplement with 50μg/mL ampicillin, incubate the medium at at 37℃ until OD600 reaches 0.6;</p><br />
<p align="justify">2. Separate the culture into two test tubes. Add IPTG into one of two tubes at a final concentration of 1mM to induce the expression of </p><br />
<p align="justify">3. 1 mL of the culture is sampled every hour. After centrifugation, deposits was suspended with 300 μL PBS and 200 μL 2x SDS loading buffer, then incubated in boiling water for 15 min.</p><br />
<p align="justify">4. 10μl of samples was load in lanes, run the SDS-PAGE</p><br />
<p align="justify">5. Stained the SDS-PAGE 5 hours</p><br />
<p align="justify">6. Destain the SDS-PAGE until you can see the protein band.</p><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<div class="passage divcell3"><br />
<h3>team history</h3><br />
<p><strong>Dec. 2011</strong></p><br />
<p align="justify">WHU iGEM team was established</p><br />
<p><strong>Dec. 2011 to Feb. 2012</strong></p><br />
<p align="justify">Every one presented their own idea, then we discussed the feasibility of these ideas.</p><br />
<p><strong>Feb. 2012 </strong></p><br />
<p align="justify">The final project was determined, named E.coslim</p><br />
<p><strong>Mar. 2012</strong></p><br />
<p align="justify">We finished an outstanding presentation. Our reply was approved by the leaders of college of life sciences, Wuhan University.</p><br />
<p><strong>Apr. 2012 </strong></p><br />
<p align="justify">Our iGEM team was divided into 3 groups—group of Sheng, group of Xia and group of Mei. </p><br />
<p><strong>Apr. 2012 to prsent</strong></p><br />
<p align="justify">Experiments started….</p><br />
<p><strong>Apr. 2012</strong></p><br />
<p align="justify">Group of Sheng: FADR was connected to pSB1A2 plasmid carrier</p><br />
<p align="justify"> FADR was connected to RFP gene</p><br />
<p align="justify">Group of Xia: starting to connect genes of CI control system </p><br />
<p align="justify"> Testing the function of CI control system</p><br />
<p align="justify">Group of Mei: YhjH/ FadE/ FadD/ FadL gene was connected to pSB1A2 plasmid carrier</p><br />
<br />
<p><strong>May. 2012 </strong></p><br />
<p align="justify">Group of Sheng: FadB/ FadJ gene was connected to pSB1A2 plasmid carrier, then BBa_B0030(RBS) as well</p><br />
<p align="justify">Group of Xia: They devised two promoters p110 and p101, which were expected to be controlled by glucose. However, they failed.</p><br />
<p align="justify">Group of Mei: YhjH/ FadE/ FadD/ FadL gene was connected to BBa_B0030(RBS)</p><br />
<br />
<p><strong>June 2012 </strong></p><br />
<p align="justify">G of S: FadR was connected to low-copied plasmid carrier.</p><br />
<p align="justify"> sFadB and sFadA genes were connected to BBa_B0030 (RBS)</p><br />
<p align="justify"> sFadE gene was connected to pSB1A2 plasmid carrier</p><br />
<p align="justify"> G of X: the connection of genes, which were relative with cellulose, was finished.</p><br />
<p align="justify"> Another two promoter were devised, p1 and p2</p><br />
<p align="justify">G of M: YhjH/ FadE/ FadD/ FadL gene was connected to BBa_B0024 (terminator)</p><br />
<br />
<p><strong>July 2012 </strong></p><br />
<p align="justify">G of S: FadJ was connected to BBa_B0024 (terminator), sFadE gene was copied by PCR technology</p><br />
<p align="justify"> On the front half of this month, they conducted several pre-experiments of oleic acid test</p><br />
<p align="justify"> On the next half month, they started normal experiments of oleic acid test</p><br />
<p align="justify">G of X: started to test the function of p1 and p2</p><br />
<p align="justify">G of M: YhjH/ FadE gene was connected to BBa_J23100 (promoter)</p><br />
<p align="justify"> Finish the standard curve of oleic acid test</p><br />
<br />
<p><strong>Aug. 2012 </strong></p><br />
<p align="justify">G of S: sFadE was induced to point mutation, then it was connected to BBa_B0030 (RBS) and BBa_B0024 (terminator) respectively</p><br />
<p align="justify"> sFadB was connected to BBa_B0030 (RBS) and BBa_B0024 (terminator) respectively.</p><br />
<p align="justify">G of X: test the function of cellulose-controlled genes, having got satisfying results</p><br />
<p align="justify">G of M: copied Adra gene and finished the connection of BBa_B0030 (RBS), BBa_B0024 (terminator) and BBa_J23107 (promoter), BBa_J23114 (promoter) respectively. FadE/YhjH/FadD/fadL were connected to BBa_J23107 (promoter), BBa_J23114 (promoter). </p><br />
<br />
<p><strong>Sep 2012</strong></p><br />
<p align="justify">G of S: Transferred all the parts in pSB1A2 into pSB1C3, Tested the function of PfadR, Characterized the effect of each gene on fatty acid consumption, started to set up the platform for in vitro experiments.</p><br />
<p align="justify">G of X: Transferred all the parts in pSB1A2 into pSB1C3, tested the function of cellulose system. Repeat the test of the function of cellulose-controlled genes.</p><br />
<p align="justify">G of M: Transferred all the parts in pSB1A2 into pSB1C3, test the function of Adra/YhjH.</p></p><br />
<br />
<br />
<br />
</div><br />
<div class="passage divcell4"><br />
<h3>Brainstorming</h3><br />
<br />
<h4>About E.coslim by Kuanwei Sheng</h4><br />
<p align="justify">In order to help people lose weight, besides our three devices, we also have come up with many other creative ways. </p><br />
<br />
<br />
<p align="justify"><strong>Ⅰ.Short chain peptides synthesis</strong></p><br />
<p align="justify">Recent researches have indicated that some short chain peptides in intestine have effect on inhibiting appetites, therefore decrease the food intake. We thus formed the idea that we could synthesis a DNA chain that encodes those short peptides.</p><br />
<br />
<p align="justify"><strong>Ⅱ.Biosynthesis of L-carnitine</strong> </p><br />
<p align="justify">L-carnitine is a molecule that facilitates the progress of transporting fatty acids into mitochondria where these fatty acids will be disintegrated. We once considered use L-carnitine to help the host metabolize fatty acid better. However, the biosynthesis of L-carnitine has too many derivatives or the pathway is patented by others.</p><br />
<br />
<p align="justify"><strong>Ⅲ.Xylose isomerase</strong></p><br />
<p align="justify">Xylose is a prebiotics that can hardly be absorbed by human. We consulted many papers and find that glucose can be converted into xylose by xylose isomerase. Therefore, we thought maybe we could lower the glucose available in intestine by expressing xylose isomerase. However, this process is shown to be reversible latter. Mutated the sequence of the protein may generate high converting rate, yet it is too laborious and risky for a short time project.</p><br />
<br />
<br />
<h4>Other novel ideas</h4><br />
<br />
<p align="justify"><strong>Tackle Water bloom by Tong Wang and Kuanwei Sheng</strong></p><br />
<p align="justify">Since the detrimental effects caused by cyanobacteria to the environment such as making water carcinogenic have become a serve global problem, we therefore tried to employ E.coli as an expression system to eliminate these detrimental effects. When we first took over this project, we thought about limiting the growth of cyanobacteria. Along with the process we got to read a large amount of relevant papers about cyanobacteria, we found that not only the main detrimental effects caused by cyanobacteria is attributed to its product which is a cyclic peptide called microcystin, but also microcystin can regulate the population density. Then we came to realize the importance of microcystin and began to search information about it. Through over this process, we discovered a gene cluster which is responsible for the microcystin degradation pathway. It encodes four enzymes——MlrA、MlrB、MlrC and MlrD. Also, we found that some non-toxic cyclic peptides produced by cyanobacteria such as Anabaenopeptin B and Anabaenopeptin F can induce lysis of cyanobacteria. The latter finding can be utilized as an effective cell population density control mechanism. Thus we thought about constructing two independent systems to eliminate cyanobacteria, one about inducing lysis of cyanobacteria and the other about degrading microcystin. Finally we gave up this project because of the reasons that these gene clusters are too large to be expressed in E.coli and that E.coli cannot survive in the sea, however, we still feel proud of these fancy ideas.</p><br />
<br />
<p align="justify"><strong>Desalination of sea water by Kuanwei Sheng</strong></p><br />
<p align="justify">We came up with the thought that engineering bacteria can intake ions like Na+, cl-, Mg2+ and etc. under special stimulus. Also, under another certain stimulus, the bacteria can export those salts out of cells for reuse. Therefore, we can use these bacteria to desalinize sea water and extract the salt the same time. However, there is no such ion channel that can meet our needs.</p><br />
<br />
<p align="justify"><strong>Sense the earthquake By Min Ye</strong></p><br />
<p align="justify">We once tried to find proteins that can sense vibration and construct a pathway to report that vibration. However, we are not able to find the protein that can meet our needs.</p><br />
<br />
<p align="justify"><strong>Auto plasmid preps By Kuanwei Sheng</strong></p><br />
<p align="justify">We thought about constructing a synthetic protein that combines zinc finger protein which can recognize the specific sequence of DNA and signal peptide that can make proteins be exported out of the bacteria by secretion pathway. Therefore, it is possible that plasmid can be exported out the cells together with the zinc finger protein.</p><br />
<br />
<p align="justify"><strong>Outer Membrane Vesicle (OMV) to treat cancer By Kuanwei Sheng</strong></p><br />
<p align="justify">We thought to use Outer Membrane Vesicle (OMV) to treat cancer. Specifically, we thought about localizing antibody that can recognize certain cancer on the surface of OMVs via signal peptides. Also, we thought we may localize cell division inhibitor protein or protein that lead to cell death inside the OMVs. Therefore, we hoped that the OMV excreted by the bacteria can recognize and kill cancer cells.</p><br />
<br />
<p align="justify"><strong>Multicell Yeast By Wenxiong Zhou</strong></p><br />
<p align="justify"><img src="https://static.igem.org/mediawiki/igem.org/9/96/Wps_clip_image-23886.png " height="288" width="503" hspace="2" vspace="1" border="2" align="top"></p></br><br />
<br />
<p align="justify">Transform the yeast from a single-cell microbe to a multi-cell organism by setting bistability of gene expression among cells of yeasts adhered in amalgamation.</p><br />
<p align="justify"><strong>To kill superbacteria</strong></p><br />
<p align="justify">Now with the spread usage of the antibiotics, many bacteria adopt ability to fight against the antibiotics. And now it’s a big problem that antibiotics are no longer useful as before. So to kill these bacteria, Jing and her group thinks they can device some proteins or artificial micromachine to detect DNA that code proteins contributing to the ability to degenerate antibiotics. And then by transferring these plasmids coding artificial proteins or micromachines, they can inhibit the expression of enzymes or proteins degenerating antibiotics. </p><br />
<br />
<br />
<br />
<br />
</div><br />
<div class="passage divcell5"><br />
<a name="team"><h3><strong>team</strong></h3></a><br />
<p><img src="https://static.igem.org/mediawiki/igem.org/9/93/Finish_presentation_in_whu.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/f/f8/Photo_of_whu_china2.jpg " height="361" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/f/f8/Journey4.jpg " height="343" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/a/a1/Journey3.jpg " height="362" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/3/3b/IMG_1842.jpg " height="336" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/7/70/IMG_1837.JPG " height="392" width="518" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/a/a7/IMG_2021.jpg " height="337" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/2/2d/Photo_of_group1_%282%29.jpg " height="375" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/a/a5/Photo_of_group_2.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/0/0a/........jpg " height="351" width="518" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/a/aa/Journey2.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/7/76/IMG_1759.JPG " height="351" width="518" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/b/b6/IMG_2183.jpg " height="351" width="518" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/f/f4/Journey1.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<br />
<br />
<a name="presentation"><h3><strong>presentation</strong></h3></a><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/e/ee/Discussion11.jpg " height="375" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/d/d9/Presentation_in_whu44.jpg " height="375" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/a/aa/Discussion33.jpg " height="337" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/6/6d/Discussion66.JPG " height="374" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/a/a3/Preparation_for_presentation_in_whu33.jpg " height="353" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/7/76/Preparation_for_presentation_in_HK22.jpg " height="362" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/9/9a/Preparation_for_presentation_in_whu11.jpg " height="359" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/d/d3/Waiting_for_result_of_presentation1.jpg " height="402" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/5/56/Preparation_for_presentation_in_HK11.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<a name="human practice"><h3><strong>human practice</strong></h3></a><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/1/12/Human_practice2.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/1/1f/Human_practice3.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/a/a4/Human_practice4.jpg " height="383" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/9/97/Human_practice5.jpg " height="409" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/2/2a/Human_practice6.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/8/8b/Human_practice8.jpg " height="378" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/1/1a/Human_practice9.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/0/08/Human_practice10.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/5/56/Human_practice12.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/a/ae/Human_practice20.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/0/00/Human_practice27.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/7/7b/Human_practice28.jpg " height="381" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/2/26/Human_practice29.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/6/63/IMG_0175.JPG " height="518" width="393" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/5/5b/Poster.jpg " height="353" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/5/54/Human_practice24.jpg " height="353" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<br />
<br />
<br />
<a name="doodle"><h3><strong>doodle</strong></h3></a><br />
<p><img src="https://static.igem.org/mediawiki/2012/7/7f/Untitled.jpg " height="439" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/4/40/Funny5.jpg " height="530" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/b/be/Funny4.jpg " height="490" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/a/ad/Funny6.jpg " height="666" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/7/77/Lab1.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/9/99/Team_clothes1.jpg " height="250" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/4/4d/Team_clothes2.jpg " height="495" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/1/18/Team_clothes3.jpg " height="500" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/5/50/Team_clothes4.jpg "alt=" height="500" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/b/b4/Team_clothes5.jpg " height="250" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/d/d4/E.coslim2.JPG " height="300" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/7/7f/Funny8.jpg " height="495" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/d/d7/Funny9.jpg " height="500" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/7/71/Poster1.jpg " height="707" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/f/f9/Poster2.jpg " height="707" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/c/c2/Poster3.jpg " height="666" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/f/fc/Poster4.jpg " height="707" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src=" https://static.igem.org/mediawiki/igem.org/8/8c/Wiki3.jpg " height="335" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/f/f9/Wiki5.jpg" height="400" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/igem.org/4/4a/Wiki6.jpg" height="435" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<br />
<br />
<br />
<br />
<a name="funny pictures"><h3><strong>funny pictures</strong></h3></a><br />
<p><img src="https://static.igem.org/mediawiki/2012/b/bc/Funny_picture1.jpg " height="356" width="400" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/1/10/Funny_picture2.jpg " height="356" width="400" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/3/3d/Funny_picture3.jpg " height="356" width="400" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/7/74/Funny_picture4.jpg " height="356" width="400" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/d/de/Funny_picture5.jpg " height="358" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/b/bd/IMG_0004.JPG " height="393" width="518" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/a/a8/IMG_0074.JPG " height="600" width="455" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/c/c1/IMG_0076.JPG " height="518" width="393" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/e/e4/IMG_0096.JPG " height="518" width="393" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/5/56/IMG_0109.JPG " height="518" width="393" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/4/4e/IMG_0117.JPG " height="600" width="450" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/6/6f/IMG_0135.JPG " height="518" width="393" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/b/be/IMG_0343.JPG " height="518" width="393" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/f/f6/IMG_0344.JPG " height="600" width="450" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/4/45/IMG_0349.JPG " height="599" width="428" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/7/75/IMG_2312.jpg " height="351" width="518" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/c/cb/Lab2.jpg " height="333" width="500" hspace="2" vspace="1" border="2" align="top" /></p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/1/1b/Suoge%27s_birthday.jpg " height="599" width="428" hspace="2" vspace="1" border="2" align="top" /></p><br />
</div> <br />
<div class="passage divcell6"><br />
<h3><strong>A Letter from Fancy</strong></h3><br />
<p align="left">There is a very meaningful sentence in the novel The Lord of the Ring: when the respected old Billbo was going to leave the village in which he had lived for many years, he gave a lecture--”The people among you whom I recognize haven’t reached half whom I should do, besides, among those whom I love are less than the half I should do, either.</p><br />
<p align="left">None of us need to fight in a war or fight with monsters. However, all of us have indeed fought and stuck to the very end, regardless of whatever obstacles to overcome and whatever precious to sacrifice.</p><br />
<p align="left">The greatness lies in the persistence to do the ordinary things perfectly. We are all inspired by our design. However, the gap between the repetitive, seemingly endless molecular cloning and the last magic probiotic can easily wreck the passion. To the opposite, most of us have successfully endured the monotonous life. Sometimes the enzymes just don’t function well. Other times the PCR never get right for some unclear reasons. We just survived those really despair moments and made one step closer to our goal.</p><br />
<p align="left">And those heart-touching scenes are clear as if they happened yesterday. Regardless of our persuation to wait for the rain to stop, our captain determined to fetch the induction cooker in his dormitory to perform an reaction as soon as possible (We don’t have an appropriate heater in our lab). When his figure disappeared in the dark and rain, words failed me; when I got a message at 3 o’ clock in the midnight, the excited tune claiming that we no longer needed to worry about our competent cells overwhelmed me with tears; when I heard that our “artist” having caught a cold but promised that he would complete all the pictures of the web site in time, I fell into silence again; every time when Xian Xia stayed overnight in the lab, the room would be quite tidy and all the reagents would got replenished. When I saw this in the next morning, I was greatly touched.</p><br />
<p align="left">Most of us has sacrificed much time to pursue personal interest. We just decrease the time for required exams for going abroad, for working in our own labs, and for some courses we are really interested in, let alone our hobbies. No time for travelling, reading lasted paper on interested topics, shopping, chatting with friends and so on. However, after the complaints and anguish, we finally reached such a peaceful and simple spiritual state that we just want to try our best to get the best result.</p><br />
<p align="left">A man who never experienced iGEM in WHU can never really understand the complex of feelings: glory and dream, perseverance and persistence, joy and tears. You can never image how brave and respected my teammates are, how many efforts and love they have put in the team, and how strong the relationship we have built since the team has been organised.<br />
<br />
</p><br />
</div> <br />
</div><br />
<em class="clear"></em><br />
</div><br />
<div class="footer"></div><br />
</div><br />
<script src="http://www.yichengliu.com/code/igem/notebooks.js"></script><br />
</body><br />
</html></div>Nanhaihttp://2012.igem.org/File:BIAO_2.pngFile:BIAO 2.png2012-10-26T19:17:58Z<p>Nanhai: </p>
<hr />
<div></div>Nanhaihttp://2012.igem.org/File:Standard_curve.pngFile:Standard curve.png2012-10-26T18:45:22Z<p>Nanhai: </p>
<hr />
<div></div>Nanhaihttp://2012.igem.org/File:Biao.pngFile:Biao.png2012-10-26T18:44:08Z<p>Nanhai: </p>
<hr />
<div></div>Nanhaihttp://2012.igem.org/Team:WHU-China/ProjectTeam:WHU-China/Project2012-10-26T08:20:15Z<p>Nanhai: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<body><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"><br />
</script><br />
<script><br />
function picObj(src, title, detail, href) {<br />
this.src = src;<br />
this.title = title;<br />
this.detail = detail;<br />
this.href = href;<br />
}<br />
//*************************自定义数据部分*************************<br />
//定义菜单及侧边栏数据<br />
var menuObj = {<br />
Home: [{<br />
title: "<strong>What's New</strong>",<br />
picArray: [new picObj("http://imgsrc.baidu.com/forum/pic/item/d25e8bd4b31c87011d9cdb7c277f9e2f0708ff34.jpg", "one piece", "yi zhang haizeiwang de tu", "http://tieba.baidu.com/f?kw=%BA%A3%D4%F4%CD%F5"), new picObj("http://imgsrc.baidu.com/forum/pic/item/d25e8bd4b31c87011d9cdb7c277f9e2f0708ff34.jpg", "one piece", "yi zhang haizeiwang de tu", "http://tieba.baidu.com/f?kw=%BA%A3%D4%F4%CD%F5"), new picObj("http://imgsrc.baidu.com/forum/pic/item/d25e8bd4b31c87011d9cdb7c277f9e2f0708ff34.jpg", "one piece", "yi zhang haizeiwang de tu", "http://tieba.baidu.com/f?kw=%BA%A3%D4%F4%CD%F5")]<br />
},<br />
{<br />
title: "<strong>Pathway Introduction</strong>",<br />
picArray: [new picObj("2.png", "title 2", "pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1production 1", "#"), new picObj("2.png", "title 2", "pathway introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2", "#"), new picObj("2.png", "title 2", "pathway introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3", "#")]<br />
},<br />
{<br />
title: "<strong>Future Perspective</strong>",<br />
picArray: [new picObj("3.png", "title 3", "future prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1utureive 1", "#"), new picObj("3.png", "title 3", "future prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospecpective 2", "#"), new picObj("3.png", "title 3", "future prospective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3", "#")]<br />
},<br />
{<br />
title: "<strong>About Us</strong>",<br />
picArray: [new picObj("4.png", "title 4", "about us 1", "#"), new picObj("4.png", "title 4", "about us 2", "#"), new picObj("4.png", "title 4", "about us 3", "#")]<br />
}],<br />
Team: [{<br />
title: '<strong>Members</strong>',<br />
dir: [{<br />
title: 'aaaa',<br />
href: '#aaaa'<br />
}]<br />
},<br />
{<br />
title: '<strong>Instructors</strong>',<br />
dir: [{<br />
title: 'bbbb',<br />
href: '#bbbb'<br />
}]<br />
},<br />
{<br />
title: '<strong>Team History</strong>',<br />
dir: []<br />
},<br />
{<br />
title: '<strong>About WHU</strong>',<br />
dir: []<br />
},<br />
{<br />
title: '<strong>About Our Lab</strong>',<br />
dir: []<br />
},<br />
{<br />
title: '<strong>Acknol-</br>edgements</strong>',<br />
dir: []<br />
},<br />
<br />
],<br />
Project: [{<br />
title: '<strong>Description</strong>',<br />
dir: []<br />
},<br />
{<br />
title: '<strong>Background</strong>',<br />
dir: [<br />
<br />
]<br />
},<br />
{<br />
title: '<strong>Promoter Design</strong>',<br />
dir: [{<br />
title: 'Introduction',<br />
href: '#Introduction'<br />
},{<br />
title: 'Indirect Pathway Design',<br />
href: '#Indirect Pathway Design'<br />
},<br />
{<br />
title: 'Direct Regulatory Promoter Design',<br />
href: '#Direct Regulatory Promoter Design'<br />
},<br />
{<br />
title: 'Pcar',<br />
href: '#Pcar'<br />
},<br />
{<br />
title: 'PfadR',<br />
href: '#PfadR'<br />
},<br />
{<br />
title: 'Standard',<br />
href: '#Standard'<br />
}]<br />
},<br />
{<br />
title: '<strong>Device I: Fatty Acid Degradation</strong>',<br />
dir: [<br />
{<br />
title: 'Purpose',<br />
href: '#Purpose'<br />
},<br />
{<br />
title: 'Outline',<br />
href: '#Outline'<br />
},<br />
{<br />
title: 'Progress',<br />
href: '#Progress'<br />
},<br />
{<br />
title: 'Experimental Procedure',<br />
href: '#Experimental Procedure'<br />
},<br />
{<br />
title: 'Results',<br />
href: '#Results'<br />
}<br />
]<br />
},<br />
{<br />
title: '<strong>Device II: Cellulose Synthesis</strong>',<br />
dir: []<br />
},<br />
{<br />
title: '<strong>Device III: Colonization</strong>',<br />
dir: [<br />
{<br />
title: 'Purpose',<br />
href: '#Purpose2'<br />
},<br />
{<br />
title: 'Outline',<br />
href: '#Outline2'<br />
},<br />
{<br />
title: 'Experimental Procedure',<br />
href: '#Experimental Procedure2'<br />
},<br />
{<br />
title: 'Results',<br />
href: '#Results2'<br />
}<br />
]<br />
},<br />
{<br />
title: '<strong>Device IV: Death</strong>',<br />
dir: [{<br />
title: 'Outline',<br />
href: '#Outline'<br />
},<br />
{<br />
title: 'Description',<br />
href: '#Description'<br />
},<br />
<br />
{<br />
title: 'Prevention of HGT',<br />
href: '#Prevention of HGT'<br />
}]<br />
},<br />
<br />
],<br />
Modeling: [{<br />
title: '<strong>Future Perspectives</strong>',<br />
dir: []<br />
},<br />
<br />
{<br />
title: '<strong>Model I: Fatty Acid Degradation</strong>',<br />
dir: [{<br />
title: 'aaaa',<br />
href: '#aaaa'<br />
}]<br />
},<br />
{<br />
title: '<strong>Model II: Microbiota Regulation</strong>',<br />
dir: [{<br />
title: 'bbbb',<br />
href: '#bbbb'<br />
}]<br />
},<br />
{<br />
title: '<strong>Software Tool: FANCY</strong>',<br />
dir: []<br />
}],<br />
Notebooks: [<br />
{<br />
title : '<strong>Parts</strong>',<br />
dir : []<br />
},<br />
{<br />
title: '<strong>Safety</strong>',<br />
dir: [{<br />
title: 'aaaa',<br />
href: '#aaaa'<br />
}]<br />
},<br />
{<br />
title: '<strong>Protocols</strong>',<br />
dir: [{<br />
title: 'bbbb',<br />
href: '#bbbb'<br />
}]<br />
},<br />
{<br />
title: '<strong>Events</strong>',<br />
dir: []<br />
},<br />
{<br />
title: '<strong>Brain-</br>storming</strong>',<br />
dir: []<br />
},<br />
{<br />
title: '<strong>Gallery</strong>',<br />
dir: []<br />
}],<br />
HumanPractice: [{<br />
title: '<strong>Outline</strong>',<br />
dir: [{<br />
title: 'aaaa',<br />
href: '#aaaa'<br />
}]<br />
},<br />
{<br />
title: '<strong>Questionaire Survey</strong>',<br />
dir: [{<br />
title: 'bbbb',<br />
href: '#bbbb'<br />
}]<br />
},<br />
{<br />
title: '<strong>Publicity</strong>',<br />
dir: []<br />
}]<br />
};<br />
//*************************自定义数据部分*************************<br />
<br />
</script><br />
<style type="text/css"><br />
/* * base css, DO NOT MODIFY! */ * { margin: 0; padding: 0; border: 0;<br />
font-family: "Verdana", sans-serif; color: #333; list-style: none; outline:<br />
none; resize: none; } html { overflow-y: scroll; } body { background: url("https://static.igem.org/mediawiki/2012/6/69/Body-bg2.jpg")<br />
center center fixed; } a { text-decoration: none; } .clear { width: 0;<br />
height: 0; line-height: 0; display: block; clear: both; } /* * common css,<br />
include "header","footer"... */ div.center { width: 940px; margin: 0 auto;<br />
} div.header { width: 940px; height: 357px; background: url("https://static.igem.org/mediawiki/2012/8/80/Header-bg2.png")<br />
no-repeat; position: relative; z-index: 50; } div.nav { position: absolute;<br />
height: 80px; top: 206px; left: 350px; } li.nav-outerLi { display: block;<br />
float: left; width: 80px; height: 80px; margin: 0 6px; cursor: pointer;<br />
} h2.nav-h21,h2.nav-h22,h2.nav-h23,h2.nav-h24,h2.nav-h25,h2.nav-h26 { display:<br />
block; background: url("https://static.igem.org/mediawiki/2012/9/91/Nav-tabs.png")<br />
no-repeat; width: 80px; height: 80px; background-position: 0 0; z-index:<br />
150; position: relative; } h2.nav-h22 { background-position: -80px 0; }<br />
h2.nav-h23 { background-position: -160px 0; } h2.nav-h24 { background-position:<br />
-240px 0; } h2.nav-h25 { background-position: -320px 0; } h2.nav-h26 {<br />
background-position: -400px 0; } h2.nav-h21:hover { background-position:<br />
0 -80px; } h2.nav-h22:hover { background-position: -80px -80px; } h2.nav-h23:hover<br />
{ background-position: -160px -80px; } h2.nav-h24:hover { background-position:<br />
-240px -80px; } h2.nav-h25:hover { background-position: -320px -80px; }<br />
h2.nav-h26:hover { background-position: -400px -80px; } h2.nav-h21on {<br />
background-position: 0 -160px; } h2.nav-h22on { background-position: -80px<br />
-160px; } h2.nav-h23on { background-position: -160px -160px; } h2.nav-h24on<br />
{ background-position: -240px -160px; } h2.nav-h25on { background-position:<br />
-320px -160px; } h2.nav-h26on { background-position: -400px -160px; } ul.nav-innerUl{<br />
position: absolute; top: 40px; padding-top: 40px; width: 76px; border-left:<br />
2px solid #000; border-right: 2px solid #000; z-index: 140; display: none;<br />
} em.nav-libg{ display: block; width: 96px; height: 11px; background: url('https://static.igem.org/mediawiki/2012/4/48/Nav-libg.png');<br />
margin-left: -10px; } ul.nav-innerUl1{ background: #fffaca; } ul.nav-innerUl2{<br />
background: #dedede; } ul.nav-innerUl3{ background: #d9f0c9; } ul.nav-innerUl4{<br />
background: #f6e5ff; } ul.nav-innerUl5{ background: #ebfcff; } ul.nav-innerUl6{<br />
background: #ffeee8; } li.nav-innerLi{ font-size: 10px; line-height: 14px;<br />
padding: 3px 5px; } li.nav-innerLi:hover{ background: #fff; } div.middle<br />
{ width: 940px; background: #e6deb8; background: rgba(230,222,184,0.5);<br />
position: absolute; top: 178px; } div.aside { width: 174px; height: 441px;<br />
background: url("https://static.igem.org/mediawiki/2012/9/96/Aside-bg2.png")<br />
no-repeat; margin-left: 10px; float: left; padding: 179px 86px 0 40px;<br />
} div.asideFixed { position: fixed; top: 0; } ul.aside-outerUl { position:<br />
relative; margin: 7px 10px; } li.aside-outerLi { margin: 10px 0; } li.aside-outerLi<br />
h2{ padding: 4px 0; color: #725718; background: #fff1a9; font-size: 14px;<br />
line-height: 22px; font-weight: bold; text-align: center; cursor: pointer;<br />
} li.aside-outerLi:hover h2{ background: #fff8d3; } ul.aside-innerUl {<br />
display: none; } ul.aside-innerUl li { background: #bdc9ad; margin: 3px<br />
0; font-family: arial, sans-serif; font-size: 14px; line-height: 22px;<br />
text-align: center; cursor: pointer; } ul.aside-innerUl li:hover{ background:<br />
#d4dcc9; } div.main { width: 580px; border: 1px solid #9e8366; background:<br />
#f0e2c1; float: right; margin: 149px 30px 30px 0; } div.passage { display:<br />
none; margin: 30px; } div.show{ display: block; } div.passage h3 { font-size:<br />
26px; line-height: 39px; font-weight: bold; background: #859f93; color:<br />
#f0e2c1; display: block; width: auto; padding: 0 10px; } div.passage p<br />
{ margin: 14px 0; font-size: 13px; line-height: 20px; } div.passage img<br />
{ display: block; float: right; padding: 0 0 20px 30px; background: #f0e2c1;<br />
} div.footer { } #p-logo { display:none; } #top-section { height:0; border:none;<br />
} #search-controls { display:none; } #content { position:inherit; width:inherit;<br />
margin:0; padding:0; background:inherit; color:inherit; border:none; line-height:inherit;<br />
z-index:2; } .firstHeading { display:none; } #catlinks { display:none;<br />
} #footer-box { display:none; } #contentSub { display:none; } #menubar<br />
ul li a { background:none; } #bodyContent h1,#bodyContent h2 { margin:0;<br />
border:0; padding: 0; } #bodyContent h2.nav-h2-title{ padding: 5px 0; }<br />
.left-menu:hover { background:none; } .nav-bg-logo{ float: left; }<br />
</style><br />
</head><br />
<body><br />
<div class="center"><br />
<div class="header"><br />
<a href="https://2012.igem.org/Main_Page"><br />
<img class="nav-bg-logo" src="https://static.igem.org/mediawiki/2012/4/44/Nav-bg-logo1.png"<br />
/><br />
</a><br />
<div class="nav"><br />
<ul class="nav-outerUl"><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China"><br />
<h2 class="nav-h21" title="Home"><br />
</h2><br />
</a><br />
<ul class="nav-innerUl nav-innerUl1" name="Home"><br />
</ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Team"><br />
<h2 class="nav-h22" title="Team"><br />
</h2><br />
</a><br />
<ul class="nav-innerUl nav-innerUl2" name="Team"><br />
</ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Project"><br />
<h2 class="nav-h23 nav-h23on" title="Project"><br />
</h2><br />
</a><br />
<ul class="nav-innerUl nav-innerUl3" name="Project"><br />
</ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Modeling"><br />
<h2 class="nav-h24" title="Modeling"><br />
</h2><br />
</a><br />
<ul class="nav-innerUl nav-innerUl4" name="Modeling"><br />
</ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Notebooks"><br />
<h2 class="nav-h25" title="Notebooks"><br />
</h2><br />
</a><br />
<ul class="nav-innerUl nav-innerUl5" name="Notebooks"><br />
</ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/HumanPractice"><br />
<h2 class="nav-h26" title="Human Practice"><br />
</h2><br />
</a><br />
<ul class="nav-innerUl nav-innerUl6" name="HumanPractice"><br />
</ul><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div class="middle"><br />
<div class="aside"><br />
<ul class="aside-outerUl"><br />
</ul><br />
</div><br />
<div class="main"><br />
<div class="passage divcell0"><br />
<h3><br />
Project Description<br />
</h3><br />
<img src="https://static.igem.org/mediawiki/2012/d/d3/The_Whole_Pathway.png" width="500"<br />
height="360" hspace="2" vspace="1" border="2" align="left" /><br />
<p><i> The above figure is the overview of our design</i></p><br />
<p align="justify"><br />
Utilizing human microbiota to tackle diseases has long been the keen desire of scientists. This year, we WHU-China team engineered a kind of probiotics "<i>E. coslim</i>" from <i>Escherichia coli</i>, hoping to provide a new approach for treating obesity. Specifically, three genetic devices were designed. The first two devices were assembled to sense and response to fatty acids and glucose. To achieve these goals, promoters repressed by FadR and CRP were devised and synthesized respectively. When functional genes are placed downstream of these promoters appropriately, the first two devices are supposed to degrade fatty acids and convert glucose into cellulose respectively, thus preventing excessive calorie intake as well as producing prebiotics. Meanwhile, the third device was designed to control the density of "<i>E. coslim</i>". Also, xylose inducing death device was planned to terminate the effects of "<i>E.coslim</i>" at will to prevent horizontal gene transfer in future applications. As a whole, by modeling, we are developing "<i>E. coslim</i>" to regulate the microbiome composition in intestine to reduce risks of obesity.<br />
</p><br />
</div><br />
<div class="passage divcell1"><br />
<p><br />
<h4><br />
Obesity: a severe global problem<br />
</h4><br />
<p align="justify"><br />
Obesity refers to a health condition that body fat is accumulated to some<br />
extent. According to WHO, body mass index (BMI) is an index of weight-for-height<br />
that is commonly used to classify obesity in adults. It is a risk factor<br />
for various diseases, such as cardiovascular diseases (mainly heart disease<br />
and stroke), type 2 diabetes, musculoskeletal disorders (especially osteoarthritis),<br />
some cancers (endometrial, breast, and colon).<br />
</p><br />
<br /><br />
<img src="https://static.igem.org/mediawiki/2012/9/9f/Background-1.jpg" width="500"<br />
height="300" hspace="2" vspace="1" border="2" align="left" /><br />
<br /><br />
<p align="justify"><br />
As it is shown in figure 1 and 2, a large amount of people from all over<br />
the world are overweight in both developed and developing countries<br />
and it is and will become more and more severe.<br />
</p><br />
<br /><br />
<img src="https://static.igem.org/mediawiki/igem.org/8/88/The_lancet.png" width="500"<br />
height="300" hspace="2" vspace="1" border="2" align="left" /><br />
<br /><br />
<i><br />
Figure 1(from reference [4]): Past and projected prevalence of overweight<br />
(BMI ≥25 kg/m2)<br />
<br /><br />
<img src="https://static.igem.org/mediawiki/2012/0/0b/Background-2.jpg" width="500"<br />
height="400" hspace="2" vspace="1" border="2" align="right" /><br />
<br /><br />
<i><br />
Figure 2: Prevalence of obesity in different countries.<br />
<br /><br />
(Picture from The Wellington Grey blog)<br />
</i><br />
<br /><br />
</i><br />
</p><br />
<p align="justify"><br />
<h4><br />
The Cause of Obesity<br />
</h4><br />
<p align="justify"><br />
Obesity is most commonly caused by a combination of excessive food energy<br />
intake, lack of physical activity, and genetic susceptibility, although<br />
a few cases are caused primarily by genes, endocrine disorders, medications<br />
or psychiatric illness.<br />
</p><br />
<p align="justify"><br />
However, the problem of obesity emerged globally only several decades<br />
ago. Since the change of genome of a species requires a long time, the<br />
outbreak of obesity is unlikely to be caused by changes in human genome.<br />
For most individuals, controlling food intake and doing physical activity<br />
in a proper way are effective strategies to lose weight. But for some people<br />
whose health condition or current life pace keep them away from systemic<br />
and regular exercise and dieting, modulating the composition of microorganisms<br />
in intestine might act as an alternative. </p><br />
<p align="justify"><br />
Reports by Gordon have shown that, apart from human genome, the collective<br />
genome of microorganisms (microbiome) in human intestine is associated<br />
with our obesity [1]. Furthermore, microbiome is able to be changed through<br />
control of food intake [1].<br />
</p><br />
<p align="justify"><br />
Two groups of beneficial bacteria are dominant in the human gut, the Bacteroidetes<br />
and the Firmicutes. The relative proportion of Firmicutes increases<br />
in obese people by comparison with lean people [2]. </p><br />
<img src="https://static.igem.org/mediawiki/2012/f/fe/Background-3.jpg" width="500"<br />
height="120" hspace="2" vspace="1" border="2" align="top" /><br />
<i><br />
Figure 3: How excess of energy contributes to obesity<br />
</i><br />
</p><br />
<p align="justify"><br />
Pertinent study by Gordon attested their initial hypothesis that changes<br />
in microbial component have a causal relationship with obesity, thus might<br />
have potential therapeutic implications [2] [3]. Colonization of germ-free<br />
mice with an ‘obese microbiota’ results in a significantly greater increase<br />
in total body fat than colonization with a ‘lean microbiota’ [3].<br />
</br><br />
<img src="https://static.igem.org/mediawiki/2012/c/cc/Background-4.jpg" width="500"<br />
height="650" hspace="2" vspace="1" border="2" align="top" /><br />
<i><br />
Figure from reference [3]<br />
</i><br />
</p><br />
<p align="justify"><br />
<br /><br />
<h4><br />
Present strategies to lose weight<br />
</h4><br />
<p align="justify"><br />
Dieting, Exercise, Drugs and Surgery are major ways to lose weight. However,<br />
they all have many drawbacks. Dieting may cause nutritional imbalance and<br />
can be a heavy mental burden since the people may not be able to enjoy<br />
the food they want. Exercise requires regular time and is ineffective in<br />
many cases. Drugs and surgery may have many side effects and are many times<br />
more costly.<br />
</p><br />
<h4><br />
Our idea<br />
</h4><br />
<p align="justify"><br />
Previous situations and insights construct our theoretical fundament.<br />
We try to utilize synthetic biology to provide a cheap, convenient, effective<br />
and safe approach for treating obesity. Instead of passive alternation<br />
of microbiota, we are trying to construct an engineered E.coli----- E.coslim<br />
to positively change microbiota in intestine. As Figure 3 shown, we place<br />
E.coslim in the role of sensing and consuming excessive energy, which thus leads<br />
to the double effects: lowering the proportion of Firmicutes and increasing<br />
that of Bacteroidetes, and decreasing the energy available in one’s intestine.<br />
<br /><br />
</p><br />
<p align="justify"><br />
To achieve these two goals, we designed four devices, fatty acids consumption,<br />
cellulose synthesis, colonization and death device of E.coslim.<br />
</p><br />
<p><br />
<h4><br />
References<br />
</h4><br />
<br /><br />
[1] Ruth E. Ley1, Peter J. Turnbaugh1, Samuel Klein1 & Jeffrey I. Gordon1<br />
Microbial ecology: Human gut microbes associated with obesity. Nature 444,<br />
1022-1023 (21 December 2006)<br />
<br /><br />
[2] Peter J. Turnbaugh1, Ruth E. Ley1, Michael A. Mahowald1, Vincent Magrini2,<br />
Elaine R. Mardis1,2 & Jeffrey I. Gordon1 An obesity-associated gut microbiome<br />
with increased capacity for energy harvest. Vol 444|21/28 December 2006|<br />
doi: 10.1038/nature05414<br />
<br /><br />
[3] Ley RE. Obesity and the human microbiome. Curr Opin Gastroenterol.<br />
2010 Jan; 26(1):5-11.<br />
<br /><br />
[4] Y Claire Wang et.al. Health and economic burden of the projected obesity<br />
trends in the USA and the UK. Lancet. 2011<br />
</br><br />
</p><br />
</div><br />
<div class="passage divcell2"><br />
<a name="Introduction"><br />
<h3><br />
Introduction<br />
</h3><br />
</a><br />
<p align="justify"> Fatty acids and sugar should be the primary targets for genetically engineered probiotics that can help people lose weight. <br />
For probiotics to degrade fatty acids and to convert glucose into cellulose, they must be able to sense and be regulated by emergence of those substrates.<br />
Otherwise, the system may not only be inefficient but also may cause serious problems. However, there is no promoter available in nature<br />
that can solely regulated by glucose or fatty acids.<br />
Therefore, to achieve our goals, we designed an indirect pathway and a direct synthetic promoter<br />
to sense and be regulated by glucose concentration. Also another synthetic promoter was designed to sense and be regulated by fatty acids.<br />
</p><br />
<br />
<a name="Indirect Pathway Design"><br />
<h3><br />
Indirect Pathway Design<br />
</h3><br />
</a><br />
<p align="justify">In a cell, the total amount of ATP, ADP and AMP molecules remains constant. Low glucose concentration results in high activity of adenylate cyclase converting ATP into cAMP, who binds and converts cAMP receptor protein (abbreviated as CRP) to DNA-binding configuration. Conversely, when glucose concentration gets high, more ATP and less cAMP will be produced, resulting in low DNA-binding activity of CRP.</p><br />
<p align="justify">We embeded gene cI of lambda phage(<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_P0451">BBa_P0451</a>) downstream promoter PcstA (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K118011">BBa_K118011</a>), which can be activated by the binding of CRP, and genes of red fluorescence protein(RFP, <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_I13507">BBa_I13507</a>) respectively downstream the promoter BBa_R0051 repressed by protein cI. In this way we construct an indirect regulation pathway with sensus glucose, transcription activator CRP and transcription repressor cI. If the device works as design, output of RFP will be increased following the elevation of glucose concentration, and vice versa.</p><br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/d/d5/Indirect_regulation.png" width="500"<br />
height="250" hspace="2" vspace="1" align="middle" /></p><br />
<p align="center"> The indirect regulatory pathway</p><br />
<p align="justify"><strong>Method</strong></p><br />
<p align="justify"><strong>Construction of plasmid for indirect regulation pathway</strong></p><br />
<p align="justify">In this experiment, RFP reported the function of the indirect regulation pathway.</p><br />
<p align="justify"><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861173">BBa_K861173</a>: <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_I13507">BBa_I13507</a>, an mRFP generator with RBS and terminator, was embedded after CRP activated promoter <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K118011">BBa_K118011</a>.</p><br />
<p align="justify"><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861172">BBa_K861172</a>: <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_P0451">BBa_P0451</a>, a cI generator with RBS and terminator, was embedded after promoter <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K118011">BBa_K118011</a> activated by CRP.</p><br />
<p align="justify"><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861169">BBa_K861169</a>: <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861172">BBa_K861172</a> and <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_I763007">BBa_I763007</a>, a cI repressed RFP generator, were assembled .</p><br />
<p align="justify"><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861174">BBa_K861174</a>: <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K137115">BBa_K137115</a>, constitutively expressing cI generator with promoter, RBS and terminator, was assembled to <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_I763007">BBa_I763007</a> <br />
<p align="justify">All new composite parts mentioned above were transformed to competent cells of Escherichia coli str. DH5a. All positive clones are validated using PCR, restriction enzyme digestion and DNA sequencing.</p><br />
<p align="justify"><strong>Cell culture fluorescence measurement</strong></p><br />
<p align="justify">Minimal medium with different concentration of glucose(1mM, 4mM, 10 mM , 20 mM , 50 mM ,100 mM) was transferred into a 96-well plate, 200 μL for each well. Then each well was inoculated with 2 μL of seed liquor which was activated overnight in M9 minimal medium with 50mM glucose at 37℃. The wells without inoculation were regarded as blank controls to revise the results. Under each condition, three parallel samples were set. The plate was incubated at 37℃, 150rpm. Cell culture fluorescence was recorded on a SpectraMax M2 plate reader (Molecular Devices). Excitation at 584 nm and emission at 607 nm were used. All fluorescence was normalized with cell density by measuring the absorbance at 600 nm.</p><br />
<br />
<p align="justify"><strong>Capturing fluorescent image </strong></p><br />
<p align="justify">Cell morphology was observed through fluorescence microscope, and the images of bacteria with different glucose concentration were captured.</p><br />
<br />
<p align="justify"><strong>Fluorescent analysis of cyto-imaging</strong></p><br />
<p align="justify">A program named FANCY was designed to recognize single cell and calculate the fluorescence strength according to the images. For more information, please click <a href="https://2012.igem.org/Team:WHU-China/Modeling?catalog=3">Here</a>.</p><br />
<p align="justify"><strong>Results</strong></p><br />
<p align="justify">Purified plasmids constructed before were digested with XbaI and PstI for confirmation. The agarose gel electrophoresis showed that the lengths were correct. At last, the plasmids were sent for sequencing. Results showed no mutation.</p><br />
<p align="justify"><img name="" src="https://static.igem.org/mediawiki/2012/d/d5/Fluorescence_1n.png" width="520" height="409" alt=""></p><br />
<p align="center">The result for fluorescence measurement of indirect device</p> <br />
<br />
<p align="justify">In the cell culture fluorescence measurement experiment, fluorescence of BBa_K861173 decreased coordinating with glucose concentration, while BBa_K861169 was reversed.The fluorescence of BBa_K861174 was too low to record, so we do not show it here. All of the results coincided with expected results indicating that we have successfully constructed the promoter which was activated by high concentration of glucose.</p><br />
<p align="justify"><img name="" src="https://static.igem.org/mediawiki/igem.org/d/dc/Indirect_Fig_2.png" width="500" height="220" alt=""></p><br />
<p align="center">The fluorescent image of indirect device in different concentration of glucose</p><br />
<p align="justify">Fluorescent images indicate that all cells were growing normally, because the size and morphology are both the same as that of the cells in LB medium. The fluorescence of the cells in the images shows the same discipline as results from the fluorescence measurement experiments. <br><br />
The results of FANCY are showed as bellow,fluorescent intensity of PcstA+cI+RFP increased with the glucose concentration,while that of the PcstA+RFP decreased with glucose concentration.It conforms well the results that showed above.</p><br />
<p align="justify"><img name="" src="https://static.igem.org/mediawiki/igem.org/2/21/Indirect_Fig_3.png" width="506" height="189" alt=""></p> <br />
<p align="justify"><img name="" src="https://static.igem.org/mediawiki/igem.org/c/c3/Indirect_Fig_4.png" width="500" height="226" alt=""></p> <br />
<p align="center">The fluorescent intensity of indirect device from program FANCY</p> <br />
<br />
<p align="justify">&nbsp;</p><br />
<p align="justify"><strong>Discussion </strong><br><br />
All results of the three experiments indicate the device works as expected. Next, RFP will be replaced with genes of cellulose synthesis. So the excess glucose can be transformed into cellulose. <br><br />
Although the indirect regulation pathway was tested effective,it works through an intermediate product, protein cI. This determines that the device will be less sensitive to glucose than a direct regulation pathway without intermediate.</p><br />
<p align="left">&nbsp;</p><br />
<a name="Direct Regulatory Promoter Design"><br />
<h3><br />
Direct Regulatory Promoter Design </h3><br />
</a><br />
<p><strong> </strong></p><br />
<p align="justify"><strong>1. Glucose sensor</strong></p><br />
<p align="justify">To turn CRP into a repressor, we firstly consulted papers about CRP binding site and find out that 22-bp palindromic consensus site of the sequence AAATGTGATCT*AGATCACATTT. Unfortunately, this consensus sequence contain XbaI restriction site. We then designed the binding site by changing the most frequent bases in the binding site into second most frequent bases. Specifically, two binding sites were designed: AAATGTGATTTAAATCACATTT, AAATGTGATTATAATCACATTT.</p><br />
<p align="justify">Firstly, to construct promoter that can be directly repressed by CRP, we put modified CRP binding site between -35 and -10 region of promoter BBa_ J23110 (TTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGC). However, it did not work out as we suppose to. In our reporter assay, this promoter failed to express higher level of RFP when bacteria grow in M9 medium with higher glucose concentration.</p><br />
<p align="justify">Then, we tried a different strategy. we designed another promoter overlapped with CRP binding site to satisfy the sequence of -10 region of the promoter (TTGACAGCTAGCTCAAATGTGATTTAAATCACATTT). The promoter also failed to show the desired function, the expression of RFP showed that the promoter is unstable.</p><br />
<p align="justify">Finally, we designed promoter with modified CRP binding site overlapped with the -10 region of the promoter. To satisfy better CRP binding, we firstly changed the sequence in -10 region to meet the CRP consensus sequence (TTGACAGCTAGCTCAAATGTGATTATAATCACATTT). We named it <i>Pcar</i>, which was short for <i>Promoter of CRP As a Repressor</i> . This time, Pcar showed exciting property as we expected.</p><br />
<p align="justify"><strong>2. Fatty acid sensor</strong></p><br />
<p align="justify">In fact, fatty acid sensor had already been tried by iGEM2006_Tokyo_Alliance (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J54220">BBa_J54220</a>).Yet their design failed to give desirable function.<br><br />
To design promoter that is under the sole regulation of fatty acid concentration, double FadR binding sites in promoter of FadL are placed and overlapped downstream of constitutive promoter J23110 (TTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGCTGGTCCGACCTATACTCTCGCC ACTGGTCTGATTTCTAAGA). Also, FadR was overexpressed to prevent leaky expression of the promoter.</p><br />
<a name="Pcar"><br />
<h3>Pcar</h3><br />
</a><br />
<p align="justify">Although the indirect regulation pathway was tested effective, we went on attempting a more compact and widely useful direct regulation design. Hence we altered a constitutive promoter (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J23119">BBa_J23119</a>) to CRP repressible ones. We have established a new technical standard for our strategy of repressible promoter design (for more information, click on <a href="https://2012.igem.org/Team:WHU-China/Project?catalog=2#Standard">Standard</a>), but we shall focus on the design itself now.</p><br />
<p align="justify">We designed promoter Pcar based on promoter BBa_J23119, inserting CRP-binding site to overlap on six base pairs with promoter -10 region. Since steric hindrance of CRP dimer blocks the function of -10 region, gene downstream will be repressed when glucose concentration is low. That is, most CRP appears in DNA-binding configuration. The repressive effect is undermined when glucose concentration increases. Accordingly, we changed CRP from an activator to a repressor, simplifying the device with potential advantages of higher sensibility and efficiency. As experimental results show, promoter Pcar works as we expect. </p><br />
<p align="justify">&nbsp;</p><br />
<center><br />
<p><img src="https://static.igem.org/mediawiki/2012/1/1a/Direct_regulation.png" width="500" height="260" hspace="2" vspace="1" border="2" align="top" /></p><br />
</center><br />
<p align="center">The direct regulatory pathway</p><br />
<p align="justify"><strong>Methods</strong></p><br />
<p align="justify"><strong>Design of the promoter Pcar which is activated by glucose </strong></p><br />
<p align="justify">Promoter Pcar, glucose biosensor plasmid, is derived from constitutive promoter (BBa_J23119) by adding a CRP binding site upstream the promoter which has several base pairs overlapping with polymerase binding site. The sequence was synthesized with restriction enzyme cutting site for EcoRI and XbaI at the 5' terminal and SpeI at 3' terminal. The sequence of promoter Pcar has cohesive terminus at both ends, so it is very convenient for us to construct the plasmid for functional detection.The sequence of Pcar is as followed:</p><br />
<p align="justify"><img src="https://static.igem.org/mediawiki/2012/b/b5/Pcar_sequence.png" width="500" height="94" alt=""></p><br />
<p align="justify"><img src="https://static.igem.org/mediawiki/2012/4/4f/Crp_regulation.jpg" width="500" height="210" alt=""></p><br />
<p align="center">The design concept of promoter <i>Pcar</i></p><br />
<p align="justify"><strong>Construction of plasmid for direct regulation pathway</strong></p><br />
<p align="justify">In this experiment, RFP reported the function of the indirect regulation pathway.</p><br />
<p align="justify"><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861179">BBa_K861179</a>: <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_I13507">BBa_I13507</a>, an mRFP generator with RBS and terminator was embedded downstream the constitutive promoter BBa_J23119</p><br />
<p align="justify"><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861176">BBa_K861176</a>: BBa_I13507 was embedded downstream the artificial promoter Pcar.</p><br />
<p align="justify"><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861178">BBa_K861178</a>: a constitutive expressed CRP(<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J23116">BBa_J23116</a>+<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861161">BBa_K861161</a>) was assembled with K861176.</p><br />
<br />
<p align="justify">All new composite parts mentioned above were transformed to competent cells of <i>Escherichia coli</i> str. DH5a. All positive clones are validated using PCR, restriction enzyme digestion and DNA sequencing.</p><br />
<p align="justify"><strong>Functional detection</strong></p><br />
<p align="justify">The same methods with that of the indirect regulation pathway were used to confirm that the promoter worked as expected. For details, please click <a href="https://2012.igem.org/Team:WHU-China/Project?catalog=2#Indirect Pathway Design">Here</a>.</p><br />
<p align="justify"><strong>Results</strong></p><br />
<p align="justify"><strong>Construction of the plasmid for functional detection</strong></p><br />
<p align="justify">The sizes of the Promoters Pcar and J23119 are less than 100 bp and are proved to be correct by agarose gel electrophoresis. Restriction Digestion of the plasmid BBa_I13507 only have one lad on the agarose gel, it told that the plasmid was digested well. After transformation, competent cells were cultured on agar plate with 50 μg/L of ampicillin. Both red and white bacterial colonies emerged on one plate. The red ones were the correct clones revealing promoter embedded successfully, while the white ones were negative. The red clones were picked out and cultured in LB medium for plasmid extraction. Purified plasmids were digested with XbaI and PstI for confirmation. The bands of 2000bp and 1000bp showed that the promoter had been embedded successfully. At last, the plasmids we acquired were sent for sequencing, and the result shows no mutation exist. </p><br />
<p align="justify"><img name="" src="https://static.igem.org/mediawiki/2012/6/6d/Pii_%E8%83%B6%E5%9B%BE.jpg" width="520" height="584" alt=""></p><br />
<p align="center">The agarose gel for digestion comfirmation</p><br />
<br />
<p align="justify"><strong>Cell culture fluorescence measurement. </strong></p><br />
<p align="justify">The correct clones were cultured in 96-well plate at 37℃ for 24 hours, then the fluorescence and absorbance at 600 nm were recorded on a SpectraMax M2 plate reader. All fluorescence was normalized with absorbance at 600 nm. The results represented the fluorescence of every well.<br><br />
The fluorescence of K861179 was about 10000 Relative Light Units. It did not vary with concentrations of glucose. However we found a positive correlation between the fluorescence of K861176 and concentration of glucose. At a glucose concentration lower than 4mM, the fluorescence was very low, but at high concentration of glucose like 100mM, the fluorescence was much less than that of K861179. </p><br />
<p align="justify"><img name="" src="https://static.igem.org/mediawiki/2012/0/00/Fluorescence_PCAR.png" width="520" height="413" alt=""></p><br />
<p align="center">The result of promoter Pcar from fluorescence measurement</p><br />
<p align="justify"><strong>Capturing of the fluorescent image </strong></p><br />
<p align="justify">Fluorescent images indicated that all the cells were growing normally, because the size and morphology were both the same with cells in LB medium. The fluorescence of the cells in the images show the same discipline with results from the fluorescence measurement experiments. Fluorescence of K861179 was very strong but it didn't change with the glucose concentration. On the contrary, fluorescence of K861176 was relatively weak but increased with concentration of glucose.</p><br />
<p align="justify"><img name="" src="https://static.igem.org/mediawiki/2012/d/d2/PII_%E8%8D%A7%E5%85%89%E7%85%A7%E7%89%87.png" width="510" height="210" alt=""></p><br />
<p align="center">Fluorescent images of Pcar and J23119 in different glucose concentration</p><br />
<p align="justify"><strong>Fluorescent analysis of cyto-imaging</strong></p><br />
<p align="justify">The result of FANCY is showed as bellow, single cell was recognized from fluorescence images and fluorescence intensity was calculated.In the table, datas show that RFP expression was activated in high glucose concentration, which conforms well with results above.For more information about FANCY,click <a href="https://2012.igem.org/Team:WHU-China/Modeling?catalog=3">Here</a>.</p><br />
<p align="justify"><img name="" src="https://static.igem.org/mediawiki/2012/d/d4/%E8%A1%A81.png" width="500" height="140" alt=""></p><br />
<p align="center">Fluorescent intensity of Pcar from program FANCY</p><br />
<p align="justify"><strong>&nbsp;</strong></p><br />
<p align="justify"><strong>Discussion</strong></p><br />
<p align="justify">The promoter Pcar is a promoter designed for the <em>Escherichia coli</em> and it is derived from a constitutive promoter BBa_J23119. Pcar includes the CRP-binding site and the RNA polymerase-binding site which overlap each other several base pairs. Therefore, because of the steric hindrance between CRP and RNA polymerase, gene downstream of the promoter will be repressed at high concentration of CRP. In the cells, low glucose concentration results in increasing activity by adenylate cyclase. cAMP binds to the cAMP receptor protein, which, in its bound form, is able to bind tightly to the specific DNA site in the promoter and to repress the gene downstream. On the contrary, high glucose concentration will result in the expression of the promoter.</p><br />
<p align="justify">&nbsp;</p><br />
<a name="PfadR"><br />
<h3><br />
PfadR<br />
</h3><br />
</a><br />
<h4>Outline</h4><br />
<p align="justify"> The design of <br />
<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861071"> Pcar</a> had sparkled the design of <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861060">PfadR</a>. In nature, beta oxidation needs these five genes, and is regulated by many factors besides fatty acids concentration. Therefore, there is no promoter that can meet our demand to be solely regulated by fatty acids. Therefore, we tried to develop a synthetic promoter that will be regulated by fatty acids. We found that the last 3 base pairs of constitutive promoter BBa_J23110 are the same to the first three base pairs of FadR binding site of FadL. Therefore, we thought that maybe by preventing the initiation of transcription, we can achieve our goal. </p><br />
<h4>Design of the Promoter PfadR Repressed by Fatty Acids</h4><br />
<p align="justify"> Promoter PfadR, is derived from BBa_J23110. Specifically, FadR binding site of FadL gene was placed overlapping with the last 3 base pairs of BBa_J23110. The sequence was synthesized with restriction sites for EcoRI and XbaI at the 5' terminal and SpeI at 3' terminal. We use overlapping PCR to get the double strand DNA. The sequence design of PfadR is as followed: </p><br />
<p align="justify"> Forward: GGAATTCTCTAGATTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGCTGGTCCGACCT</p><br />
<p align="justify"> Reverse: GACTAGTTCTTAGAAATCAGACCAGTGGCGAGAGTATAGGTCGGACCAGCTAGCATTGT</p></br><br />
<br />
<h4>Procedures</h4><br />
<br />
<p align="justify"> For M9 medium using oleic acid as sole carbon source, oleic acid was first emulsified 10% Triton X-100. M9 medium was then slowly added with constant vortex. M9 medium with high concentration of oleic acid was diluted by M9 medium with triton to form various concentrations. </p><br />
<p align="justify">For M9 medium using glucose as sole carbon source, M9 medium with high concentration of glucose was diluted by M9 medium to form various concentrations. </p><br />
<p align="justify"> After 24h of incubation in 24 well plates in 37°C, bacteria culture was centrifuged at 3000rmp for 5min, washed and resuspended in PBS. We detected the OD600 and fluorescence of using SpectraMax M2 plate reader (Molecular Devices) .Excitation at 584 nm and emission at 607 nm were used. All fluorescence was normalized with cell density by measuring the absorbance at 600 nm. </p><br />
<br />
<h4>Result</h4><br />
<p align="justify"> Normalized using Fluorescence/0D600</p><br />
<p align="justify"> Blue: Constitutive promoter J23110</p><br />
<p align="justify"> Red: PfadR</p><br />
<p align="justify"> Glucose Concentration gradient: 0.5, 1, 5, 10 mM</p><br />
<p align="justify"> Fatty acid Concentration gradient: 0.025, 0.05, 0.1, 0.25, 0.5, 1, 1.5 mM</p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/a/ae/PFADR.png" width="500" height="400" hspace="2" vspace="1" border="2" align="top" /></p><br />
<p><i> PfadR and BBa_J23110 promoter strength at different glucose and fatty acids concentration</i></p><br />
<p align="justify"> As shown from the results, the promoter shows about 3 times induction from glucose to 1.5umol/L fatty acids medium and the fluorescence of PfadR is about one sixth of <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J23110">BBa_J23110</a>. This may be because the tandem FadR binding site has made it more difficult for Polymerase to start gene transcription. Also, in medium that use glucose as sole carbon source, PfadR seems to be leaky. However, since our bacteria is wild type <i>E.coli</i>, Fab genes was not mutated, meaning that bacteria can synthesis fatty acids. Therefore, there may be a basal level fatty acids concentration inside the cell, making the transcription not being totally repressed. </p><br />
<p align="justify"> It should also be noticed that, from fatty acids concentration 0.025umol/L to 1.5umol/L, the induction is not very obvious. F0.25, 0.5 and 1 seemed to have similar fluorescence strength. The promoter is not sensitive enough. To further improve the function of PfadR, we are planning to modify the sequence of FadR binding sites to make FadR overlap more will promoter region. Also, we will try to overexpressed FadR protein to see its effects on PfadR.</p><br />
<p align="justify">&nbsp;</p><br />
<a name="Standard"><h3 align="justify">Standard</h3></a><br />
<p align="justify">To address the problem of sensing substrates in our metabolic devices, we have developed a few promoters following the strategy of modifying unconserved regions to protein binding sites. As steric hindrance can stop RNA polymerase as well as other transcription factors from correctly binding and functioning, the binding protein become the repressor of our synthetic promoters.</p><br />
<p align="justify">To different promoters, the details of modification comes in different ways. For instance, the PfadR (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J861060">BBa_J861060</a>) is modified downstream -10 region, while Pcar (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J861171">BBa_J861171</a>) is modified between -35 and -10 region. Indeed we have tried some other modifications (for more information, click on design of promoters) but without desirable functions and we still do not know why. However, all modifications aimed at the same goal, to introduce overlapping sequences between binding site of the designed repressor and the promoter.</p><br />
<p align="justify">To test the function of these promoters, we used fluorescence measurements. First, both the modified promoter and the unmodified one (as control) were assembled with mRFP genes as reporter. Hence, after culturing and testing fluorescence intensities using different methods (see <a href="https://2012.igem.org/Team:WHU-China/Project?catalog=2#Indirect Pathway Design">indirect regulation</a> and <a href="https://2012.igem.org/Team:WHU-China/Modeling?catalog=3">FANCY</a>), we can learn if the synthetic promoter is regulated as expected.</p><br />
<p align="justify">After a few successes, we are endeavoring setting up a new technical standard on design, construction and functional test of promoters. </p><br />
<p align="justify">&nbsp;</p><br />
</div><br />
<div class="passage divcell3"><br />
<h3>Fatty Acid Degradation Device</h3></a><br />
<p><br />
<iframe width="420" height="315" src="http://www.youtube.com/embed/bauWVfxu_nA" frameborder="0" allowfullscreen></iframe><br />
</p><br />
<p>The above is the video introduction of fatty acid degradation device. For Chinese mainland visitor, please visit <a href="http://v.youku.com/v_show/id_XNDY2MTM3Mjc2.html">here</a> for the video</p><br />
<a name="Purpose"><h3>Purpose</h3></a><br />
</p><br />
<p align="justify"><br />
To help people lose weight without the need of food restriction, we designed a genetically modified <br />
<br />
<i>E.coli</i> that can sense and degrade excessive fatty acid intake by the host. We hope that, together with other two <br />
<br />
devices we designed, we can introduce our <i>E.coslim</i> as resident in intestine to consume the excessive calories intake <br />
<br />
by the host and regulate intestinal microbiota.<br />
</p><br />
<a name="Outline"><h3>Outline</h3></a><br />
<P align="justify"><br />
<img src="https://static.igem.org/mediawiki/2012/7/76/Fatty_Acid_M.png" width="300" height="400" hspace="2" vspace="1" border="2" <br />
<br />
style="float:left" /><br />
<br />
Genes that are responsible for degradation and transportation of fatty acids (FAs) from <i>E.coli K12</i> and from <br />
<br />
<i>Salmonella enterica LT2</i> were cloned. Also, a promoter named PfadR that can be regulated solely by fatty acids was also <br />
<br />
designed. By placing those fatty acid degradation genes downstream of the artificially designed promoter PfadR (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861060">BBa_K861060</a>), we hope to create a device that degrades FAs only when the concentration of FAs is high.<br />
</p><br />
<p align="justify"><br />
Long chain fatty acids are firstly imported by the transmembrane protein <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861500">FadL</a>. After FAs get into cells, a CoA will <br />
<br />
be added by inner membrane-associated <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861010">FadD</a> (acyl-CoA synthase). β-oxidation is initiated by <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861020">FadE</a>(acyl-CoA dehydrogenase), <br />
<br />
which will convert acyl-CoA into enoyl-CoA. The following cycles of hydration, oxidation, and thiolytic cleavage are carried <br />
<br />
out by tetrameric complex consisting of two <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861400">FadA</a> and two <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861030">FadB</a> proteins or two <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861041">FadI</a> and two <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861031">FadJ</a> in anaerobic condition. <br />
<br />
<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861050">FadR</a> is a transcriptional regulator that, when not binds to acyl-CoA, can either serve as an activator for fatty acid <br />
<br />
synthesis gene like FabA, FabB and etc., or a repressor for fatty acid degradation gene like FadA, FadB, FadD FadE, FadL, <br />
<br />
FadI, FadJ and etc. After long chain fatty acids are converted to fatty acyl- CoA by FadD, it can bind to FadR. The binding <br />
<br />
will alter the conformation of FadR, making FadR unable to bind to the DNA sequence it recognizes to fulfill its function. <br />
<br />
Therefore, FadR can no longer activate or repress the transcription of genes downstream FadR binding sites. However, to our <br />
<br />
knowledge, there is no promoter available in nature that can respond solely to FadR since those promoters are often regulated <br />
<br />
by glucose concentration or oxidative stress and many other factors.</br><br />
In our design, FadL, FadD, FadE, FadA, FadB, FadI and FadJ from <i>Escherichia coli K12</i>, and <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861042">FadA</a>, <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861032">FadB</a> and <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861021">FadE</a> <br />
<br />
from <i>Salmonella enterica LT2</i> are placed downstream a synthetic promoter PfadR to make them solely regulated by fatty acid concentration.</br><br />
</br><br />
<br />
</p><br />
<br />
<br />
<a name="Progress"><h3>Progress</h3></a><br />
<h4><br />
Cloning of the gene<br />
</h4><br />
<p align="justify"><br />
First, the genome of <i>Escherichia coli K12 str. DH5ɑ</i> and <i>Salmonella enterica LT2</i> (symbolized as S-) were extracted <br />
<br />
and amplified by PCR using primers for each gene. The sequences of the primers used are as bellow (5’---3’).</br><br />
<br />
FadR Forward: GGAATTCTCTAGAATGGTCATTAAGGCGCAAAG</br><br />
Reverse: GACTAGTCTTATCGCCCCTGAATGGCTAAATC</br><br />
<br />
FadA Forward: GGAATTCTCTAGAATGGAACAGGTTGTCATTGTCG</br><br />
Reverse: GACTAGTTTAAACCCGCTCAAACACCGT</br><br />
<br />
FadB Forward: GGAATTCTCTAGAATGCTTTACAAAGGCGACACC</br><br />
Reverse: GACTAGTTTAAGCCGTTTTCAGGTCGCC</br><br />
<br />
FadD Forward: GGAATTC TCTAGATTGAAGAAGGTTTGGCTTAACCG</br><br />
Reverse: GACTAGTTCAGGCTTTATTGTCCACTTTGC</br><br />
<br />
FadE Forward: GGAATTC TCTAGAATGATGATTTTGAGTATTCTCG</br><br />
Reverse: GACTAGTTTACGCGGCTTCAACTTTCCG</br><br />
<br />
FadL Forward: GGAATTC TCTAGAATGAGCCAGAAAACCCTG</br><br />
Reverse: GACTAGTTAGAACGCGTAGTTAAAGTTAG</br><br />
<br />
FadI Forward: GGAATTC TCTAGA ATGGGTCAGGTTTTACC</br><br />
Reverse: GACTAGTTTATTCCGCCTCCAGAACCA</br><br />
<br />
FadJ Forward: GGAATTCTCTAGAATGGAAATGACATCAGC</br><br />
Reverse: GACTAGTTTATTGCAGGTCAGTTGCAGTTG</br><br />
<br />
S-FadA Forward: GGAATTCTCTAGAATGGTCATTAAGGCGCAAAG</br><br />
Reverse: GACTAGTCTTATCGCCCCTGAATGGCTAAATC</br><br />
<br />
S-FadB Forward: GGAATTCTCTAGAATGCTTTATAAAGGCGACACC</br><br />
Reverse: GACTAGTTAAGCCGTTTTCAGAGAACC</br><br />
<br />
S-FadE Forward: GGAATTCTCTAGAATGATGATTTTGAGTATTATCG</br><br />
Reverse: GACTAGTTATGCGGCTTCGACTTTACGC</br><br />
<br />
</p><br />
<h4><br />
Design of the Promoter PfadR Repressed by Fatty Acids <br />
</h4><br />
<p align="justify"><br />
Promoter PfadR, is derived from <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J23110">BBa_J23110</a>. Specifically, FadR binding site of FadL gene is placed overlapping with the last <br />
<br />
3 base pairs of BBa_J23110. The sequence was synthesized with restriction sites for EcoRI and XbaI at the 5' terminal and SpeI at <br />
<br />
3' terminal. We used overlapping PCR to get the double strand DNA. The primer design of PfadR is as followed:</br><br />
Forward:<br />
GGAATTCTCTAGATTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGCTGGTCCGACCT</br><br />
Reverse:<br />
GACTAGTTCTTAGAAATCAGACCAGTGGCGAGAGTATAGGTCGGACCAGCTAGCATTGT<br />
<br />
</p><br />
<br />
<h4><br />
Construction of Biobricks<br />
</h4><br />
<p align="justify"><br />
Fatty acid degradation project is divided into two parts: promoter, and gene function.</br><br />
<br />
To discover the optimal combination of those fatty acid genes, we:</br><br />
<br />
(1) use PCR to clone those genes in <i>E.coli K12</i> and <i>Salmonella enterica LT2</i></br>,<br />
(2) restriction digest and ligate those gene into pSB1C3,</br><br />
(3) restriction digest and ligate those gene with RBS(<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_B0030">B0030</a>),</br><br />
(4) RBS-FadA, RBS-FadI, and RBS-S-FadA is ligated with both <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_R0011">BBa_R0011</a> promoter and our PfadR</br><br />
RBS-FadR, RBS-FadB, RBS-FadJ, RBS-FadE, RBS-FadD, RBS-FadL, RBS-S-FadB, and RBS-S-FadE are ligated with <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_B0034">B0034</a>,</br><br />
(5) Promoter-RBS-FadA is ligated with RBS-FadB-Terminator, PROMOTER-RBS-FadI is ligated with RBS-FadJ-Terminator and <br />
<br />
Promoter-RBS-S-FadA is ligated with RBS-S-FadB-Terminator. RBS-FadE-Terminator, RBS-FadD-Terminator, RBS-FadL-Terminator, <br />
<br />
and RBS-S-FadE-Terminator, are ligated with BBa_R0011 promoter, PfadR and various constitutive promoters.<br />
<br />
<br />
For Promoter PfadR</br><br />
(1) promoter PfadR was synthesized using overlapping PCR</br><br />
(2) RFP reporter was ligated downstream the promoter and ligted into pSB6A1</br><br />
(3) J23116+ RBS+ FadR+ Terminator was ligated to PfadR+ RFP in pSB6A1</br><br />
</p><br />
<br />
<br />
<a name="Experimental Procedure"><h3>Experimental Procedure</h3></a><br />
<br />
<p align="justify"><br />
<img src="http://partsregistry.org/wiki/images/2/28/Cupric_acetate.png" width="500" height="250" hspace="2" vspace="1" border="2" <br />
<br />
align="left" /><br />
<p align="center"><i>Cupric acetate-pyridine reaction</i></p><br />
<p><br />
We used cupric acetate-pyridine as a color developing reagent to determine fatty acid consumption of genetically modified bacteria. We had modified existing methods to extract free fatty acid in M9 medium. Also, we used IPTG induced promoter BBa_R0011 to see the expression of those proteins and extract proteins from cells. For more details, please see protocol: <a href="https://2012.igem.org/Team:WHU-China/Notebooks?catalog=2#Protocols of Cupric-Soap Reaction">Cupric-Soap Reaction</a> for more details.<br />
</p><br />
<p align="justify">We also conducted <em>in vitro</em> experienments in which we characterized fatty acid degradation capabilities of combination of enzymes using a cell free system. Please see protocol: <a href="https://2012.igem.org/Team:WHU-China/Notebooks?catalog=2#In vitro experiment"><i>In vitro</i> Experiment</a> for more details.<br />
<a name="Results"><h3>Results</h3></a><br />
<h4><br />
Characterization of each gene<br />
</h4><br />
<p align="justify"><br />
In this experiment, we wanted to test whether the ability of degrading fatty acids of our genetically modified bacteria was enhanced as expected by transforming plasmids constitutively expressing related genes in the β-oxidation pathway. The effects of the genes we tested is listed in the following chart I. The ability was reflected by the change of the concentration of the fatty acids in the medium. It was measured by cupric-acetate soap reaction as described in Protocols section. Each time we inoculated 50mg bacteria into 30ml M9 medium using fatty acid as sole carbon source, collecting the sample at the time as shown in the picture. Then the analysis of the free fatty acids was performed.<br />
</p><br />
<p align="justify"><br />
The following figures shows the effects on degrading fatty acids by expressing different genes in β-oxidation pathway in <em>E.coli</em>. They are under the regulation of promoters with different kinds of strength. J23107 and J23114 are constitutive promoters provided by the committee. PfadR is the promoter designed by ourselves. It consists of the sequence of a constitutive promoter and the binding sequence of the transcription factor, FadR, which is the sensor of the fatty acids. FadE is the acyl-CoA dehydrogenase, which have been proved as performing the rate limiting reaction in the pathway. S-FadE is the counterpart of FadE in the bacteria Samonella. FadD is the acyl-CoA synthase. FadL, a transmembrane protein, is responsible for transporting fatty acids into the bacteria. The control we used is the E.coli expressing galU, a gene responsible for synthesize cellulose.</p><br />
<img src="https://static.igem.org/mediawiki/2012/8/82/6h.png" width="500" height="400" hspace="2" vspace="1" border="2" <br />
<br />
align="left" /><p><i>Fatty acid degradation at 6h</i></p><br />
<img src="https://static.igem.org/mediawiki/2012/a/a1/12h.png" width="500" height="400" hspace="2" vspace="1" border="2" <br />
<br />
align="left" /><p><i>Fatty acid degradation at 12h</i></p><br />
<img src="https://static.igem.org/mediawiki/2012/2/28/18H.png" width="500" height="400" hspace="2" vspace="1" border="2" <br />
<br />
align="left" /><p><i>Fatty acid degradation at 18h</i></p><br />
<img src="https://static.igem.org/mediawiki/2012/8/8c/24h.png" width="500" height="400" hspace="2" vspace="1" border="2" <br />
<br />
align="left" /><p><i>Fatty acid degradation at 24h</i></p><br />
<img src="http://partsregistry.org/wiki/images/b/bb/Degradation_according_to_time.jpg" width="500" height="450" hspace="2" vspace="1" border="2" align="left" /><p><i>Fatty acid degradation of bacteria overexpressing each gene in 24h</i></p><br />
<br />
<p align="justify">Based on the measurements of the consumption at given time, we conclude that overexpressing FadL increases the metabolizing ability no matter under the regulation of J23114 (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861002">BBa_K861002</a>) or our designed promoter, PfadR(<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861003">BBa_K861003</a>). The advantage is more obvious when the time expands (consumption at 18h and 24h). It's plausible because more fadL may transport more fatty acids into the bacteria. The increased inner fatty acids concentration is quite favorable. We also notice that the later one's consumption is lower. It may attribute to the fact that our promoter is weaker than the J23114. If the copy number of FadL is less, its metabolizing rate will be slower. And the fact that the PfadR needs to be induced may also make the time needed to synthesize protein longer, which may make it less competitive. These data opposes to our assumption that overexpressing the rate limiting enzyme FadE ((<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861025">BBa_K861025</a> and (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861026">BBa_K861026</a>) doesn't have obvious effect. It may be because the original level of FadE is enough, thus overexpression is not needed. The strength of the promoter doesn't affects the rate much, which partially suggests the reason above.</p><br />
<p align="justify">We found that the slope between 12h and 18h and between 18 and 24h are less than the others. It may be because the bacteria have entered static status, the amount of bacteria becomes consistent. Also, after the first death phase, they entered logarithmic phase again. Since our inoculation is relatively large and the oleate is excessive, the situation that the bacteria has experience two life cycle is possible. A growth curve in the future can test the theory.<br />
<h4><br />
<em>In vitro</em> Experiment</h4><br />
<p align="justify">The <em>in vitro</em> experiment was designed to make up for the limitation of time to test the combination of expressing different genes together (We are short of time assembling the genes together). So we used the cell extracts to do the enzyme assay. The advantage is that we can easily mix the enzyme we want together. Since the purpose of this experiment is to test whether overexpressing multiple genes are superior to a single gene, we set the amount of every gene the same in the combination for simplicity. In the future, we can test more combinations to find the best ratio.</p><br />
<br />
<img src="http://partsregistry.org/wiki/images/8/83/In_vitro.png" width="500" height="400" hspace="2" vspace="1" border="2" <br />
<br />
align="left" /> <p><i>Fatty acids remaining after 6 hours of reaction</i></p> <br />
<br />
<p align="justify">The result was that the cell extract of bacteria overexpressing FadE (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861024">BBa_K861024</a>), FadD (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861013">BBa_K861013</a>), S- FadA S- FadB(<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861038">BBa_K861038</a>) (a regulon), FadI FadJ(<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861037">BBa_K861037</a>) (a regulon) separately all degraded oleate obviously faster than the control. This may be somewhat contrasting to the result of our <em>in vivo</em> assay, in which overexpressing the FadD and FadE did not have obvious results. However, it can be explained. The promoter is not that strong in the <em>in vivo</em> assay, otherwise the growth of the bacteria would be inhibited. However, in the <em>in vitro</em> assay, this consideration was not necessary. Also, the concentration in the final reaction system was quite high by collecting 1L medium, which may improve the metabolizing rate. </p><br />
<p align="justify">It also showed that simultaneously increasing the concentration of FadE, FadD, S- FadA and S- FadB significantly improved the degrading ability. Increasing the doze of the FadI and FadJ on the basis of above did not make any difference, while increasing FadA and FadB may be indispensible because only expressing FadD and FadE is worse than expressing the gene alone. </p><br />
<br />
</div><br />
<div class="passage divcell4"><br />
<h3>Device II: Cellulose Synthesis</h3><br />
<p><br />
<iframe width="420" height="315" src="http://www.youtube.com/embed/Sm5NzacV7hA" frameborder="0" allowfullscreen></iframe><br />
</p><br />
<p>The above is the video introduction of cellulose synthesis degradation device. For Chinese mainland visitor, please visit <a href="http://v.youku.com/v_show/id_XNDY2MTQwNTI0.html">here</a> for the video.</p><br />
<h4 align="justify">Outline</h4><br />
<p align="justify"><br />
Cellulose is an essential material for keeping intestine peristalsis without producing energy, as prebiotics, feeding vegetarian bacteria flora (including Bacteroides, whose appropriate amount has proved important to prevent obesity) of intestine as well. Thus, cellulose helps people keep slim and healthy.</p><br />
<br />
<p align="justify"><br />
The developing device aims at transforming glucose into cellulose, thus producing cellulose as well as reducing energy intake. To achieve this goal, we cloned genes of enzymes responding to cellulose synthesis from the <i>Escherichia coli</i> str. DH5&alpha;, constructing functional expressional elements with these genes respectively downstream of promoter activated by glucose. In this way, cellulose synthetase complex is built artificially under regulation of glucose, repressed under low concentration of glucose and activated under high concentration of glucose.</p><br />
<br />
<br />
<p align="justify"><br />
In the future, this device can be integrated to the assembled <em>E. coslim</em>, activated when excess glucose is sensed in intestine, converting it to cellulose.</p><br />
<br />
<p align="justify"><br />
The same as device I (fatty acid degradation), on one hand, we divide our work into two parallel sections.<em> Function</em> section includes a series of molecular biological manipulation on four genes of the cellulose synthetase complex and another two genes responding to produce substrates for cellulose synthesis. On the other hand, the design, construction and function tests of glucose-activated promoter belong to <em>regulation</em> section.</p><br />
<br />
<br />
<h4 align="justify"><br />
Description</h4><br />
<br />
<h5 align="justify">Genes to be Cloned</h5><br />
<br />
<p align="justify"><br />
4 genes, <em>bcsA</em>, <em>bcsB</em>, <em>bcsZ</em> and <em>bcsC</em>, from the rdar morphotype bacterium, are involved in cellulose biosynthesis.<br />
<p align="justify"> BcsA is considered to be the catalytic subunit.<br />
<p align="justify">BcsB can be activated the soon it binds to c-di-GMP.<br />
<p align="justify">BcsZ encodes endo-1,4-D-glucanase which belongs to glycosyl hydrolase family Ⅷ. Activation of BcsZ is required for optimal synthesis and membrane translocation of cellulose.<br />
<p align="justify">Although <em>BcsC</em> is transcribed constitutively, cellulose synthesis occurs only in the circumstances of AdrA.<br />
<p align="justify">AdrA ,a diguanylate cyclase (DGC), cyclizestwo GTPs into c-di-GMP. In turn, the activity of cellulose synthase can be increased when binds to c-di-GMP.<br />
<p align="justify">GalU catalyzes the addition of UTP to α-D-glucose 1-phosphate to yield UDP-D-glucose, which is the substrate for cellulose synthase complex<br />
<p align="justify">GalF is a predicted subunit of a GalU/GalF protein complex involved in colanic acid building blocks biosynthesis<br />
</p><br />
<br />
<h5 align="justify">Plasmid construct concept</h5><br />
<p align="justify"><br />
After the indirect regulatory pathway and promoter Pcar being tested to be effective,we can embed the genes which are involved in cellulose synthesis downstream any one of them.So cellulase can only be expressed when glucose concentration is high, and also the expression will increase with glucose concentration. In this way, our E.coslim will have the ability to convert excess glucose into cellulose.<br />
</p><br />
<br />
<h4 align="justify">Progress</h4><br />
<h5 align="justify">Clone of genes</h5><br />
<br />
<p align="justify"><br />
As for the genes that we cloned, there is no difference between <i>E. Coli</i> str. K12 MG1655 and more available DH5&alpha;. we purified and amplified these genes from genome of <i>Escherichia coli</i> str. DH5&alpha; using PCR. The primers contain standard restriction enzyme cutting sites. The sequences of the primers used are as below.<br />
<p align="justify"> <em>bcsA</em> Antisense CCTGCAGTACTAGTATCATTGTTGAGCCAAAGCCTG <br/><br />
Sense CGAATTCTTCTAGAGATGAGTATCCTGACCCGGTGG<br />
<p align="justify"> <em>bcsB</em> Antisense CCTGCAGTACTAGTATTACTCGTTATCCGGGTTAAGAC <br/><br />
Sense CGAATTCTTCTAGAGATGAAAAGAAAACTATTCTGGATTTG<br />
<p align="justify"> <em>bcsZ</em> Antisense CCTGCAGTACTAGTATTAGTGTGAATTTGCGCATTCCTGG <br/><br />
Sense CGAATTCTTCTAGAGATGAATGTGTTGCGTAGTGGAATCG<br />
<p align="justify"> <em>bcsC</em> Antisense CCTGCAGTACTAGTATTACCAGTCGGCGTAAGGTATCA <br/><br />
Sense CGAATTCTTCTAGAGATGCGCAAATTCACACTAAACATATTC<br />
<p align="justify"> <em>galF</em> Antisense CCTGCAGTACTAGTATTATTCGCTTAACAGCTTCTCG <br/><br />
Sense CGAATTCTTCTAGAGATGACGAATTTAAAAGCAGTTATACC<br />
<p align="justify"> <em>galU</em> Antisense CCTGCAGTACTAGTATTACTTCTTAATGCCCATCTCTTCT <br/><br />
Sense CGAATTCTTCTAGAGATGGCTGCCATTAATACGAAAG<br />
<br />
<p>&nbsp;</p><br />
<p align="justify">Then the genes were digested with restriction enzymes and assembled to RBS (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_B0030">BBa_B0030</a>) and terminator (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_B0024">BBa_B0024</a>).<br />
</p><br />
<br />
<br />
<br />
</p><br />
<h5 align="justify">Construction of the plasmid expressing cellulose synthetase controlled by promoter we designed</h5><br />
<br />
<p align="justify"><br />
All coding sequences were assembled to RBS and terminator, afterwards, they were embedded downstream the promoter Pcar, which can be activated at high glucose concentration.<br />
<br>The biobricks constructed were showed as bellow:<br />
<br><br />
<p align="justify"> <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861102">BBa_K861102</a>: Pcar+RBS+<i>bcsA</i>+terminator<br />
<p align="justify"> <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861112">BBa_K861112</a>: Pcar+RBS+<i>bcsB</i>+terminator<br />
<p align="justify"> <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861122">BBa_K861122</a>: Pcar+RBS+<i>bcsZ</i>+terminator<br />
<p align="justify"> <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861132">BBa_K861132</a>: Pcar+RBS+<i>bcsC</i>+terminator<br />
<p align="justify"> <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861142">BBa_K861142</a>: Pcar+RBS+<i>galU</i>+terminator<br />
<p align="justify"> <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861152">BBa_K861152</a>: Pcar+RBS+<i>galF</i>+terminator<br />
<p align="justify"> <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861074">BBa_K861074</a>: Pcar+RBS+<i>adrA</i>+terminator<br />
</p><br />
<br />
<p align="justify"><br />
All new composite parts mentioned above were transformed to competent cells of <i>Escherichia coli</i> str. DH5&alpha;. All positive clones are validated using PCR, restriction enzyme digestion and DNA sequencing.</p><br />
<br />
<h5 align="justify">Detection of Cellulose Synthesis</h5><br />
<p align="justify"><br />
To detect the cellulose synthesis, we used cellulase to degrade cellulose in the cell culture. Then total reducing sugar in the culture was measured. So the difference of total reducing sugar between culture before and after treated with cellulase represents the total cellulose synthetised by the cell. For detailed information, please click <a href="https://2012.igem.org/Team:WHU-China/Notebooks?catalog=2">Here</a>.</p><br />
<br />
<h4 align="justify">Results</h4><br />
<br />
<h5 align="justify"><br />
Clone of genes</h5><br />
<p align="justify"><br />
The gene <i>bcsA</i> is 2619bp, <i>bcsB</i> is 2340bp, <i>bcsZ</i> is 1107 bp, <i>bcsC</i> is 3474bp, <i>galU</i> is 909bp and <i>galF</i> is 894 bp. After PCR amplification, DNA fragments were examined by agarose gel electrophoresis. All genes proved correct. Then the genes were digested with restriction enzymes and embedded into plasmid backbone pSB1A2. To confirm the accuracy of sequences, positive clones were sent for sequencing after transformation. And the results showed that no mutation existed in genes.</p><br />
<br />
<P align="center"><br />
<img src="https://static.igem.org/mediawiki/2012/3/30/BcsA_B_Z_C_U_F.tif" width="500" height="416" hspace="2" vspace="1" border="2" align="middle" /></P><br />
<br />
<h5 align="justify">Detection of Cellulose Synthesis</h5><br />
<br />
<p align="justify">After treating with cellulase, total reducing sugar in supernatant and deposits was measured by methods described in our protocol. Colors in the tubes <br /><br />
becoming darker meant that reducing sugar increased with time. Amount of reducing sugar was calculated according to standard curve of glucose.</p><br />
<p align="justify">The formula of standard curve is as bellow:</p><br />
<p align="justify"><i>y</i>=1.3795<i>x</i>+0.0373</p><br />
<br />
<p align="justify">In our experiment, cells that expressed protein which was nothing to do with cellulose synthesis was used as a control.We transformed the seven genes involved in cellulose synthesis into <em>E.coli</em> and meaaured cellulose production with method mentioned above. In the step of measuring total cellulose production, exceed cellulase was appended and incubated at 50 ℃ for 1 hour, and results show that some of the seven genes help increase the ability of cellulose synthesis.</p><br />
<p align="center"><img src="https://static.igem.org/mediawiki/2012/a/a7/CELLULOSE_PRODUCTION.tif" alt="" name="CelluloseFig1" width="520" height="412" align="middle" id="CelluloseFig1" /></p><br />
<br />
<p align="justify">In addition,AdrA is responsible for the production of a small molecule,c-di-GMP, which is known as an activator of cellulase. So we co-overexpress adrA with bcsA. Cellulose output in both supernatant and deposit were show in the following figure. The cellulose production in <em>adrA</em>+<em>bcsA</em> is more than 0.6 mg/mL, which is almost two times higher than that of control.</p><br />
<br />
<p align="center"><img src="https://static.igem.org/mediawiki/igem.org/f/ff/Cellulose_Fig_1.jpg" alt="" name="CelluloseFig1" width="520" height="1247" align="middle" id="CelluloseFig1" /></p><br />
<br />
<p align="justify">&nbsp;</p><br />
<br />
<br />
<h4 align="justify"><strong>Disscusion</strong></h4><br />
<p align="justify">In our experiment, results show that cellulose yield in <em>adrA</em>+<em>bcsA</em> is higher than that of the single gene. So it indicated that the co-expression of some genes would increase cellulose production. In the next stage, we will try more combination of these genes and find the most efficient one</p><br />
<p align="justify">Actually, BcsB can be activated by c-di-GMP. But till the deadline, we have not successfully assembled Pcar and <em>bcsB</em>. In the following work, we are going to assemble a plasmid including all of the seven genes. Maybe in this way, cellulose production will increase greatly.</p><br />
<p align="justify">Other than application in the project of <em>E.coslim</em>, the cellulose device can also be used in many other fields, such as papermaking industry, biomedical materials, audio equipment and so on.</p><br />
<br />
</div><br />
<div class="passage divcell5"><br />
<h3>Colonization</h3></a><br />
<p><br />
<iframe width="420" height="315" src="http://www.youtube.com/embed/5GHyA3mUgaM" frameborder="0" allowfullscreen></iframe><br />
</p><br />
<p>The above is the video introduction of colonization device. For Chinese mainland visitor, please visit <a href="http://v.youku.com/v_show/id_XNDY2MTQwNDc2.html">here</a> for the video</p><br />
<br />
<br />
<a name="Purpose2"><h3>Purpose</h3></a><br />
<p align="justify"><br />
One big challenge of probiotics is their survival in intestine. We respond to this challenge by expressing gene <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861070">adrA</a> responsible for manufacturing the second messager c-di-GMP, a magic molecule that leads to inhibition of motility and increase of adhesion and division of <i>E.coli</i>. </p><br />
<br />
<a name="Outline2"><h3><br />
Outline<br />
</h3></a><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/8d/Biobrick04.png" width="350" height="350" hspace="2" vspace="1" border="2" style="float:left" /><br />
AdrA protein can convert GTP into c-di-GMP, a magic second massager that, besides promoting the production of cellulose(for more details, see our celluose synthesis device), can reduce the expression of flagella and acute virulence gene simultaneously. In the same time, c-di-GMP can facilitate the synthesis of various adhesins and exopolysaccharides and can promote the proteolysis of replication inhibitors. As a result, AdrA makes cells become adhesive and promote the formation of biofilm, making the bacteria gain advantages to survive in the hostile environment of intestine.<br />
</p><br />
<br />
<a name="Experimental Procedure2"><h3><br />
Experimental Procedure<br />
</h3></a><br />
<p align="justify"><br />
We tested the function of AdrA gene by plate assay. Formore details, please visit our protocol page.<br />
</p><br />
<a name="Results2"><h3><br />
Results<br />
</h3></a><br />
<p><img src="http://partsregistry.org/wiki/images/e/e7/AdrA.jpg" width="500" height="620" hspace="2" vspace="1" border="2" align="top" /></p></br><br />
<p align="justify">As can be seen from the plate. Clone with AdrA constitutively expressed using <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J23107">BBa_J23107</a> is much more smaller compared to the control that only contain <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_B0030">the plasmids of RBS</a>, though the amount of bacteria is similar. This result showed that the AdrA was successfully expressed, elevating c-di-GMP level, leading to the increase expression of adhesins and inhibition of motility.</p><br />
</div><br />
<div class="passage divcell6"><br />
<br />
<h3>Death Device</h3><br />
<p><br />
<iframe width="420" height="315" src="http://youtu.be/BpK0gitnaFU" frameborder="0" allowfullscreen></iframe><br />
</p><br />
<p>The above is the video introduction of death device. For Chinese mainland visitor, please visit <a href="http://v.youku.com/v_show/id_XNDY2MTQwNDIw.html">here</a> for the video</p><br />
<a name="Outline"><h4> Outline </h4></a><br />
<p align="justify"><br />
We plan to place endonuclease and YhjH gene downstream the xylR repressed promoter<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861200"> (BBa_K861200)</a> to make bacteria die and lose their adhesion when exposed to xylose.<br />
</p><br />
<br />
<a name="Description"><h4> Description </h4></a><br />
<p align="justify"><br />
<img src="https://static.igem.org/mediawiki/2012/c/c3/Death.png" width="500" height="300" hspace="2" vspace="1" border="2" <br />
<br />
style="float:left" /></p><br />
<br />
<br />
<p align="justify"><br />
In order to terminate the overreaction of fatty acid metabolism and cellulose synthesis, we design an elaborate device. Firstly, we determined to use endonuclease YhjH<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861090"> (BBa_K861090)</a> responsible for c-di-GMP degradation to counteract the impact of AdrA and BglII(<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K112106"> (BBa_K112106)</a>), a protein that can kill the microbe without inducing cell lysis. Since AdrA but not YhjH contains this restriction site, our E.coslim will lose their adhesion more easily. To control the expression of endonuclease and YhjH, a regulator is <br />
<br />
necessary. We selected xylose as the inducer because this monomer hardly exists in nature, so the GMOs will not be killed under natural condition. Also, it is healthy and hard to be absorbed by human beings so the concentration of xylose in the gut can keep high for a long time. We are planning to device another synthetic promoter repressed by XylR from <i>B.subtilis</i>. We hope that eating xylose will <br />
<br />
subsequently derepress the expression of endonuclease and YhjH, ending up with the loss of adhesion and the death of our E.coslim, therefore efficiently terminate the process of lossing weight. For more information and for a brief introduction of our two-capsule design, please visit our <a href="https://2012.igem.org/Team:WHU-China/Modeling?catalog=0">Future Perspective </a>.<br />
<br />
</p><br />
</br></br><br />
<br />
<a name="Prevention of HGT"><h4> Prevention of HGT </h4></a><br />
<p align="justify"><br />
In human gut, there are billions of microbes. Horizontal gene transfer of those high efficient metabolic genes between GMOs <br />
<br />
and normal intestine residents may get out of control and cause disastrous effects. Therefore, a mechanism to prevent HGT <br />
<br />
is highly necessary.<br />
To prevent horizontal gene transfer, we designed a two-plasmids system. In one plasmid, xlyR repressor encoding gene<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K143036"> (BBa_K143036)</a> from <br />
<br />
<i>Bacillus subtilis</i> will be assembled with constitutively expressed promoter. On the other plasmid, metabolic gene will be coupled with xylR repressed death system. In <br />
<br />
our GMOs, since death system is suppressed by xylR in low xylose concentration, the bacteria will not die. However, when <br />
<br />
the HGT of those high efficient metabolic genes happens, the death system will not be suppressed, and the recipient will <br />
<br />
be killed.<br />
</p><br />
<br />
</div><br />
<br />
</div><br />
<em class="clear"><br />
</em><br />
</div><br />
<div class="footer"><br />
</div><br />
</div><br />
<script src="http://www.yichengliu.com/code/igem/project.js"><br />
</script><br />
</body><br />
</html></div>Nanhaihttp://2012.igem.org/File:CELLULOSE_PRODUCTION.tifFile:CELLULOSE PRODUCTION.tif2012-10-26T07:49:04Z<p>Nanhai: uploaded a new version of &quot;File:CELLULOSE PRODUCTION.tif&quot;</p>
<hr />
<div></div>Nanhaihttp://2012.igem.org/File:CELLULOSE_PRODUCTION.tifFile:CELLULOSE PRODUCTION.tif2012-10-26T07:48:13Z<p>Nanhai: </p>
<hr />
<div></div>Nanhaihttp://2012.igem.org/Team:WHU-China/ProjectTeam:WHU-China/Project2012-10-26T07:17:46Z<p>Nanhai: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml"><br />
<body><br />
<script src="http://code.jquery.com/jquery-1.7.2.min.js"><br />
</script><br />
<script><br />
function picObj(src, title, detail, href) {<br />
this.src = src;<br />
this.title = title;<br />
this.detail = detail;<br />
this.href = href;<br />
}<br />
//*************************自定义数据部分*************************<br />
//定义菜单及侧边栏数据<br />
var menuObj = {<br />
Home: [{<br />
title: "<strong>What's New</strong>",<br />
picArray: [new picObj("http://imgsrc.baidu.com/forum/pic/item/d25e8bd4b31c87011d9cdb7c277f9e2f0708ff34.jpg", "one piece", "yi zhang haizeiwang de tu", "http://tieba.baidu.com/f?kw=%BA%A3%D4%F4%CD%F5"), new picObj("http://imgsrc.baidu.com/forum/pic/item/d25e8bd4b31c87011d9cdb7c277f9e2f0708ff34.jpg", "one piece", "yi zhang haizeiwang de tu", "http://tieba.baidu.com/f?kw=%BA%A3%D4%F4%CD%F5"), new picObj("http://imgsrc.baidu.com/forum/pic/item/d25e8bd4b31c87011d9cdb7c277f9e2f0708ff34.jpg", "one piece", "yi zhang haizeiwang de tu", "http://tieba.baidu.com/f?kw=%BA%A3%D4%F4%CD%F5")]<br />
},<br />
{<br />
title: "<strong>Pathway Introduction</strong>",<br />
picArray: [new picObj("2.png", "title 2", "pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1production 1", "#"), new picObj("2.png", "title 2", "pathway introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2", "#"), new picObj("2.png", "title 2", "pathway introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3", "#")]<br />
},<br />
{<br />
title: "<strong>Future Perspective</strong>",<br />
picArray: [new picObj("3.png", "title 3", "future prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1utureive 1", "#"), new picObj("3.png", "title 3", "future prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospecpective 2", "#"), new picObj("3.png", "title 3", "future prospective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3", "#")]<br />
},<br />
{<br />
title: "<strong>About Us</strong>",<br />
picArray: [new picObj("4.png", "title 4", "about us 1", "#"), new picObj("4.png", "title 4", "about us 2", "#"), new picObj("4.png", "title 4", "about us 3", "#")]<br />
}],<br />
Team: [{<br />
title: '<strong>Members</strong>',<br />
dir: [{<br />
title: 'aaaa',<br />
href: '#aaaa'<br />
}]<br />
},<br />
{<br />
title: '<strong>Instructors</strong>',<br />
dir: [{<br />
title: 'bbbb',<br />
href: '#bbbb'<br />
}]<br />
},<br />
{<br />
title: '<strong>Team History</strong>',<br />
dir: []<br />
},<br />
{<br />
title: '<strong>About WHU</strong>',<br />
dir: []<br />
},<br />
{<br />
title: '<strong>About Our Lab</strong>',<br />
dir: []<br />
},<br />
{<br />
title: '<strong>Acknol-</br>edgements</strong>',<br />
dir: []<br />
},<br />
<br />
],<br />
Project: [{<br />
title: '<strong>Description</strong>',<br />
dir: []<br />
},<br />
{<br />
title: '<strong>Background</strong>',<br />
dir: [<br />
<br />
]<br />
},<br />
{<br />
title: '<strong>Promoter Design</strong>',<br />
dir: [{<br />
title: 'Introduction',<br />
href: '#Introduction'<br />
},{<br />
title: 'Indirect Pathway Design',<br />
href: '#Indirect Pathway Design'<br />
},<br />
{<br />
title: 'Direct Regulatory Promoter Design',<br />
href: '#Direct Regulatory Promoter Design'<br />
},<br />
{<br />
title: 'Pcar',<br />
href: '#Pcar'<br />
},<br />
{<br />
title: 'PfadR',<br />
href: '#PfadR'<br />
},<br />
{<br />
title: 'Standard',<br />
href: '#Standard'<br />
}]<br />
},<br />
{<br />
title: '<strong>Device I: Fatty Acid Degradation</strong>',<br />
dir: [<br />
{<br />
title: 'Purpose',<br />
href: '#Purpose'<br />
},<br />
{<br />
title: 'Outline',<br />
href: '#Outline'<br />
},<br />
{<br />
title: 'Progress',<br />
href: '#Progress'<br />
},<br />
{<br />
title: 'Experimental Procedure',<br />
href: '#Experimental Procedure'<br />
},<br />
{<br />
title: 'Results',<br />
href: '#Results'<br />
}<br />
]<br />
},<br />
{<br />
title: '<strong>Device II: Cellulose Synthesis</strong>',<br />
dir: []<br />
},<br />
{<br />
title: '<strong>Device III: Colonization</strong>',<br />
dir: [<br />
{<br />
title: 'Purpose',<br />
href: '#Purpose2'<br />
},<br />
{<br />
title: 'Outline',<br />
href: '#Outline2'<br />
},<br />
{<br />
title: 'Experimental Procedure',<br />
href: '#Experimental Procedure2'<br />
},<br />
{<br />
title: 'Results',<br />
href: '#Results2'<br />
}<br />
]<br />
},<br />
{<br />
title: '<strong>Device IV: Death</strong>',<br />
dir: [{<br />
title: 'Outline',<br />
href: '#Outline'<br />
},<br />
{<br />
title: 'Description',<br />
href: '#Description'<br />
},<br />
<br />
{<br />
title: 'Prevention of HGT',<br />
href: '#Prevention of HGT'<br />
}]<br />
},<br />
<br />
],<br />
Modeling: [{<br />
title: '<strong>Future Perspectives</strong>',<br />
dir: []<br />
},<br />
<br />
{<br />
title: '<strong>Model I: Fatty Acid Degradation</strong>',<br />
dir: [{<br />
title: 'aaaa',<br />
href: '#aaaa'<br />
}]<br />
},<br />
{<br />
title: '<strong>Model II: Microbiota Regulation</strong>',<br />
dir: [{<br />
title: 'bbbb',<br />
href: '#bbbb'<br />
}]<br />
},<br />
{<br />
title: '<strong>Software Tool: FANCY</strong>',<br />
dir: []<br />
}],<br />
Notebooks: [<br />
{<br />
title : '<strong>Parts</strong>',<br />
dir : []<br />
},<br />
{<br />
title: '<strong>Safety</strong>',<br />
dir: [{<br />
title: 'aaaa',<br />
href: '#aaaa'<br />
}]<br />
},<br />
{<br />
title: '<strong>Protocols</strong>',<br />
dir: [{<br />
title: 'bbbb',<br />
href: '#bbbb'<br />
}]<br />
},<br />
{<br />
title: '<strong>Events</strong>',<br />
dir: []<br />
},<br />
{<br />
title: '<strong>Brain-</br>storming</strong>',<br />
dir: []<br />
},<br />
{<br />
title: '<strong>Gallery</strong>',<br />
dir: []<br />
}],<br />
HumanPractice: [{<br />
title: '<strong>Outline</strong>',<br />
dir: [{<br />
title: 'aaaa',<br />
href: '#aaaa'<br />
}]<br />
},<br />
{<br />
title: '<strong>Questionaire Survey</strong>',<br />
dir: [{<br />
title: 'bbbb',<br />
href: '#bbbb'<br />
}]<br />
},<br />
{<br />
title: '<strong>Publicity</strong>',<br />
dir: []<br />
}]<br />
};<br />
//*************************自定义数据部分*************************<br />
<br />
</script><br />
<style type="text/css"><br />
/* * base css, DO NOT MODIFY! */ * { margin: 0; padding: 0; border: 0;<br />
font-family: "Verdana", sans-serif; color: #333; list-style: none; outline:<br />
none; resize: none; } html { overflow-y: scroll; } body { background: url("https://static.igem.org/mediawiki/2012/6/69/Body-bg2.jpg")<br />
center center fixed; } a { text-decoration: none; } .clear { width: 0;<br />
height: 0; line-height: 0; display: block; clear: both; } /* * common css,<br />
include "header","footer"... */ div.center { width: 940px; margin: 0 auto;<br />
} div.header { width: 940px; height: 357px; background: url("https://static.igem.org/mediawiki/2012/8/80/Header-bg2.png")<br />
no-repeat; position: relative; z-index: 50; } div.nav { position: absolute;<br />
height: 80px; top: 206px; left: 350px; } li.nav-outerLi { display: block;<br />
float: left; width: 80px; height: 80px; margin: 0 6px; cursor: pointer;<br />
} h2.nav-h21,h2.nav-h22,h2.nav-h23,h2.nav-h24,h2.nav-h25,h2.nav-h26 { display:<br />
block; background: url("https://static.igem.org/mediawiki/2012/9/91/Nav-tabs.png")<br />
no-repeat; width: 80px; height: 80px; background-position: 0 0; z-index:<br />
150; position: relative; } h2.nav-h22 { background-position: -80px 0; }<br />
h2.nav-h23 { background-position: -160px 0; } h2.nav-h24 { background-position:<br />
-240px 0; } h2.nav-h25 { background-position: -320px 0; } h2.nav-h26 {<br />
background-position: -400px 0; } h2.nav-h21:hover { background-position:<br />
0 -80px; } h2.nav-h22:hover { background-position: -80px -80px; } h2.nav-h23:hover<br />
{ background-position: -160px -80px; } h2.nav-h24:hover { background-position:<br />
-240px -80px; } h2.nav-h25:hover { background-position: -320px -80px; }<br />
h2.nav-h26:hover { background-position: -400px -80px; } h2.nav-h21on {<br />
background-position: 0 -160px; } h2.nav-h22on { background-position: -80px<br />
-160px; } h2.nav-h23on { background-position: -160px -160px; } h2.nav-h24on<br />
{ background-position: -240px -160px; } h2.nav-h25on { background-position:<br />
-320px -160px; } h2.nav-h26on { background-position: -400px -160px; } ul.nav-innerUl{<br />
position: absolute; top: 40px; padding-top: 40px; width: 76px; border-left:<br />
2px solid #000; border-right: 2px solid #000; z-index: 140; display: none;<br />
} em.nav-libg{ display: block; width: 96px; height: 11px; background: url('https://static.igem.org/mediawiki/2012/4/48/Nav-libg.png');<br />
margin-left: -10px; } ul.nav-innerUl1{ background: #fffaca; } ul.nav-innerUl2{<br />
background: #dedede; } ul.nav-innerUl3{ background: #d9f0c9; } ul.nav-innerUl4{<br />
background: #f6e5ff; } ul.nav-innerUl5{ background: #ebfcff; } ul.nav-innerUl6{<br />
background: #ffeee8; } li.nav-innerLi{ font-size: 10px; line-height: 14px;<br />
padding: 3px 5px; } li.nav-innerLi:hover{ background: #fff; } div.middle<br />
{ width: 940px; background: #e6deb8; background: rgba(230,222,184,0.5);<br />
position: absolute; top: 178px; } div.aside { width: 174px; height: 441px;<br />
background: url("https://static.igem.org/mediawiki/2012/9/96/Aside-bg2.png")<br />
no-repeat; margin-left: 10px; float: left; padding: 179px 86px 0 40px;<br />
} div.asideFixed { position: fixed; top: 0; } ul.aside-outerUl { position:<br />
relative; margin: 7px 10px; } li.aside-outerLi { margin: 10px 0; } li.aside-outerLi<br />
h2{ padding: 4px 0; color: #725718; background: #fff1a9; font-size: 14px;<br />
line-height: 22px; font-weight: bold; text-align: center; cursor: pointer;<br />
} li.aside-outerLi:hover h2{ background: #fff8d3; } ul.aside-innerUl {<br />
display: none; } ul.aside-innerUl li { background: #bdc9ad; margin: 3px<br />
0; font-family: arial, sans-serif; font-size: 14px; line-height: 22px;<br />
text-align: center; cursor: pointer; } ul.aside-innerUl li:hover{ background:<br />
#d4dcc9; } div.main { width: 580px; border: 1px solid #9e8366; background:<br />
#f0e2c1; float: right; margin: 149px 30px 30px 0; } div.passage { display:<br />
none; margin: 30px; } div.show{ display: block; } div.passage h3 { font-size:<br />
26px; line-height: 39px; font-weight: bold; background: #859f93; color:<br />
#f0e2c1; display: block; width: auto; padding: 0 10px; } div.passage p<br />
{ margin: 14px 0; font-size: 13px; line-height: 20px; } div.passage img<br />
{ display: block; float: right; padding: 0 0 20px 30px; background: #f0e2c1;<br />
} div.footer { } #p-logo { display:none; } #top-section { height:0; border:none;<br />
} #search-controls { display:none; } #content { position:inherit; width:inherit;<br />
margin:0; padding:0; background:inherit; color:inherit; border:none; line-height:inherit;<br />
z-index:2; } .firstHeading { display:none; } #catlinks { display:none;<br />
} #footer-box { display:none; } #contentSub { display:none; } #menubar<br />
ul li a { background:none; } #bodyContent h1,#bodyContent h2 { margin:0;<br />
border:0; padding: 0; } #bodyContent h2.nav-h2-title{ padding: 5px 0; }<br />
.left-menu:hover { background:none; } .nav-bg-logo{ float: left; }<br />
</style><br />
</head><br />
<body><br />
<div class="center"><br />
<div class="header"><br />
<a href="https://2012.igem.org/Main_Page"><br />
<img class="nav-bg-logo" src="https://static.igem.org/mediawiki/2012/4/44/Nav-bg-logo1.png"<br />
/><br />
</a><br />
<div class="nav"><br />
<ul class="nav-outerUl"><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China"><br />
<h2 class="nav-h21" title="Home"><br />
</h2><br />
</a><br />
<ul class="nav-innerUl nav-innerUl1" name="Home"><br />
</ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Team"><br />
<h2 class="nav-h22" title="Team"><br />
</h2><br />
</a><br />
<ul class="nav-innerUl nav-innerUl2" name="Team"><br />
</ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Project"><br />
<h2 class="nav-h23 nav-h23on" title="Project"><br />
</h2><br />
</a><br />
<ul class="nav-innerUl nav-innerUl3" name="Project"><br />
</ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Modeling"><br />
<h2 class="nav-h24" title="Modeling"><br />
</h2><br />
</a><br />
<ul class="nav-innerUl nav-innerUl4" name="Modeling"><br />
</ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/Notebooks"><br />
<h2 class="nav-h25" title="Notebooks"><br />
</h2><br />
</a><br />
<ul class="nav-innerUl nav-innerUl5" name="Notebooks"><br />
</ul><br />
</li><br />
<li class="nav-outerLi"><br />
<a href="https://2012.igem.org/Team:WHU-China/HumanPractice"><br />
<h2 class="nav-h26" title="Human Practice"><br />
</h2><br />
</a><br />
<ul class="nav-innerUl nav-innerUl6" name="HumanPractice"><br />
</ul><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div class="middle"><br />
<div class="aside"><br />
<ul class="aside-outerUl"><br />
</ul><br />
</div><br />
<div class="main"><br />
<div class="passage divcell0"><br />
<h3><br />
Project Description<br />
</h3><br />
<img src="https://static.igem.org/mediawiki/2012/d/d3/The_Whole_Pathway.png" width="500"<br />
height="360" hspace="2" vspace="1" border="2" align="left" /><br />
<p><i> The above figure is the overview of our design</i></p><br />
<p align="justify"><br />
Utilizing human microbiota to tackle diseases has long been the keen desire of scientists. This year, we WHU-China team engineered a kind of probiotics "<i>E. coslim</i>" from <i>Escherichia coli</i>, hoping to provide a new approach for treating obesity. Specifically, three genetic devices were designed. The first two devices were assembled to sense and response to fatty acids and glucose. To achieve these goals, promoters repressed by FadR and CRP were devised and synthesized respectively. When functional genes are placed downstream of these promoters appropriately, the first two devices are supposed to degrade fatty acids and convert glucose into cellulose respectively, thus preventing excessive calorie intake as well as producing prebiotics. Meanwhile, the third device was designed to control the density of "<i>E. coslim</i>". Also, xylose inducing death device was planned to terminate the effects of "<i>E.coslim</i>" at will to prevent horizontal gene transfer in future applications. As a whole, by modeling, we are developing "<i>E. coslim</i>" to regulate the microbiome composition in intestine to reduce risks of obesity.<br />
</p><br />
</div><br />
<div class="passage divcell1"><br />
<p><br />
<h4><br />
Obesity: a severe global problem<br />
</h4><br />
<p align="justify"><br />
Obesity refers to a health condition that body fat is accumulated to some<br />
extent. According to WHO, body mass index (BMI) is an index of weight-for-height<br />
that is commonly used to classify obesity in adults. It is a risk factor<br />
for various diseases, such as cardiovascular diseases (mainly heart disease<br />
and stroke), type 2 diabetes, musculoskeletal disorders (especially osteoarthritis),<br />
some cancers (endometrial, breast, and colon).<br />
</p><br />
<br /><br />
<img src="https://static.igem.org/mediawiki/2012/9/9f/Background-1.jpg" width="500"<br />
height="300" hspace="2" vspace="1" border="2" align="left" /><br />
<br /><br />
<p align="justify"><br />
As it is shown in figure 1 and 2, a large amount of people from all over<br />
the world are overweight in both developed and developing countries<br />
and it is and will become more and more severe.<br />
</p><br />
<br /><br />
<img src="https://static.igem.org/mediawiki/igem.org/8/88/The_lancet.png" width="500"<br />
height="300" hspace="2" vspace="1" border="2" align="left" /><br />
<br /><br />
<i><br />
Figure 1(from reference [4]): Past and projected prevalence of overweight<br />
(BMI ≥25 kg/m2)<br />
<br /><br />
<img src="https://static.igem.org/mediawiki/2012/0/0b/Background-2.jpg" width="500"<br />
height="400" hspace="2" vspace="1" border="2" align="right" /><br />
<br /><br />
<i><br />
Figure 2: Prevalence of obesity in different countries.<br />
<br /><br />
(Picture from The Wellington Grey blog)<br />
</i><br />
<br /><br />
</i><br />
</p><br />
<p align="justify"><br />
<h4><br />
The Cause of Obesity<br />
</h4><br />
<p align="justify"><br />
Obesity is most commonly caused by a combination of excessive food energy<br />
intake, lack of physical activity, and genetic susceptibility, although<br />
a few cases are caused primarily by genes, endocrine disorders, medications<br />
or psychiatric illness.<br />
</p><br />
<p align="justify"><br />
However, the problem of obesity emerged globally only several decades<br />
ago. Since the change of genome of a species requires a long time, the<br />
outbreak of obesity is unlikely to be caused by changes in human genome.<br />
For most individuals, controlling food intake and doing physical activity<br />
in a proper way are effective strategies to lose weight. But for some people<br />
whose health condition or current life pace keep them away from systemic<br />
and regular exercise and dieting, modulating the composition of microorganisms<br />
in intestine might act as an alternative. </p><br />
<p align="justify"><br />
Reports by Gordon have shown that, apart from human genome, the collective<br />
genome of microorganisms (microbiome) in human intestine is associated<br />
with our obesity [1]. Furthermore, microbiome is able to be changed through<br />
control of food intake [1].<br />
</p><br />
<p align="justify"><br />
Two groups of beneficial bacteria are dominant in the human gut, the Bacteroidetes<br />
and the Firmicutes. The relative proportion of Firmicutes increases<br />
in obese people by comparison with lean people [2]. </p><br />
<img src="https://static.igem.org/mediawiki/2012/f/fe/Background-3.jpg" width="500"<br />
height="120" hspace="2" vspace="1" border="2" align="top" /><br />
<i><br />
Figure 3: How excess of energy contributes to obesity<br />
</i><br />
</p><br />
<p align="justify"><br />
Pertinent study by Gordon attested their initial hypothesis that changes<br />
in microbial component have a causal relationship with obesity, thus might<br />
have potential therapeutic implications [2] [3]. Colonization of germ-free<br />
mice with an ‘obese microbiota’ results in a significantly greater increase<br />
in total body fat than colonization with a ‘lean microbiota’ [3].<br />
</br><br />
<img src="https://static.igem.org/mediawiki/2012/c/cc/Background-4.jpg" width="500"<br />
height="650" hspace="2" vspace="1" border="2" align="top" /><br />
<i><br />
Figure from reference [3]<br />
</i><br />
</p><br />
<p align="justify"><br />
<br /><br />
<h4><br />
Present strategies to lose weight<br />
</h4><br />
<p align="justify"><br />
Dieting, Exercise, Drugs and Surgery are major ways to lose weight. However,<br />
they all have many drawbacks. Dieting may cause nutritional imbalance and<br />
can be a heavy mental burden since the people may not be able to enjoy<br />
the food they want. Exercise requires regular time and is ineffective in<br />
many cases. Drugs and surgery may have many side effects and are many times<br />
more costly.<br />
</p><br />
<h4><br />
Our idea<br />
</h4><br />
<p align="justify"><br />
Previous situations and insights construct our theoretical fundament.<br />
We try to utilize synthetic biology to provide a cheap, convenient, effective<br />
and safe approach for treating obesity. Instead of passive alternation<br />
of microbiota, we are trying to construct an engineered E.coli----- E.coslim<br />
to positively change microbiota in intestine. As Figure 3 shown, we place<br />
E.coslim in the role of sensing and consuming excessive energy, which thus leads<br />
to the double effects: lowering the proportion of Firmicutes and increasing<br />
that of Bacteroidetes, and decreasing the energy available in one’s intestine.<br />
<br /><br />
</p><br />
<p align="justify"><br />
To achieve these two goals, we designed four devices, fatty acids consumption,<br />
cellulose synthesis, colonization and death device of E.coslim.<br />
</p><br />
<p><br />
<h4><br />
References<br />
</h4><br />
<br /><br />
[1] Ruth E. Ley1, Peter J. Turnbaugh1, Samuel Klein1 & Jeffrey I. Gordon1<br />
Microbial ecology: Human gut microbes associated with obesity. Nature 444,<br />
1022-1023 (21 December 2006)<br />
<br /><br />
[2] Peter J. Turnbaugh1, Ruth E. Ley1, Michael A. Mahowald1, Vincent Magrini2,<br />
Elaine R. Mardis1,2 & Jeffrey I. Gordon1 An obesity-associated gut microbiome<br />
with increased capacity for energy harvest. Vol 444|21/28 December 2006|<br />
doi: 10.1038/nature05414<br />
<br /><br />
[3] Ley RE. Obesity and the human microbiome. Curr Opin Gastroenterol.<br />
2010 Jan; 26(1):5-11.<br />
<br /><br />
[4] Y Claire Wang et.al. Health and economic burden of the projected obesity<br />
trends in the USA and the UK. Lancet. 2011<br />
</br><br />
</p><br />
</div><br />
<div class="passage divcell2"><br />
<a name="Introduction"><br />
<h3><br />
Introduction<br />
</h3><br />
</a><br />
<p align="justify"> Fatty acids and sugar should be the primary targets for genetically engineered probiotics that can help people lose weight. <br />
For probiotics to degrade fatty acids and to convert glucose into cellulose, they must be able to sense and be regulated by emergence of those substrates.<br />
Otherwise, the system may not only be inefficient but also may cause serious problems. However, there is no promoter available in nature<br />
that can solely regulated by glucose or fatty acids.<br />
Therefore, to achieve our goals, we designed an indirect pathway and a direct synthetic promoter<br />
to sense and be regulated by glucose concentration. Also another synthetic promoter was designed to sense and be regulated by fatty acids.<br />
</p><br />
<br />
<a name="Indirect Pathway Design"><br />
<h3><br />
Indirect Pathway Design<br />
</h3><br />
</a><br />
<p align="justify">In a cell, the total amount of ATP, ADP and AMP molecules remains constant. Low glucose concentration results in high activity of adenylate cyclase converting ATP into cAMP, who binds and converts cAMP receptor protein (abbreviated as CRP) to DNA-binding configuration. Conversely, when glucose concentration gets high, more ATP and less cAMP will be produced, resulting in low DNA-binding activity of CRP.</p><br />
<p align="justify">We embeded gene cI of lambda phage(<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_P0451">BBa_P0451</a>) downstream promoter PcstA (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K118011">BBa_K118011</a>), which can be activated by the binding of CRP, and genes of red fluorescence protein(RFP, <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_I13507">BBa_I13507</a>) respectively downstream the promoter BBa_R0051 repressed by protein cI. In this way we construct an indirect regulation pathway with sensus glucose, transcription activator CRP and transcription repressor cI. If the device works as design, output of RFP will be increased following the elevation of glucose concentration, and vice versa.</p><br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/d/d5/Indirect_regulation.png" width="500"<br />
height="250" hspace="2" vspace="1" align="middle" /></p><br />
<p align="center"> The indirect regulatory pathway</p><br />
<p align="justify"><strong>Method</strong></p><br />
<p align="justify"><strong>Construction of plasmid for indirect regulation pathway</strong></p><br />
<p align="justify">In this experiment, RFP reported the function of the indirect regulation pathway.</p><br />
<p align="justify"><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861173">BBa_K861173</a>: <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_I13507">BBa_I13507</a>, an mRFP generator with RBS and terminator, was embedded after CRP activated promoter <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K118011">BBa_K118011</a>.</p><br />
<p align="justify"><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861172">BBa_K861172</a>: <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_P0451">BBa_P0451</a>, a cI generator with RBS and terminator, was embedded after promoter <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K118011">BBa_K118011</a> activated by CRP.</p><br />
<p align="justify"><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861169">BBa_K861169</a>: <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861172">BBa_K861172</a> and <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_I763007">BBa_I763007</a>, a cI repressed RFP generator, were assembled .</p><br />
<p align="justify"><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861174">BBa_K861174</a>: <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K137115">BBa_K137115</a>, constitutively expressing cI generator with promoter, RBS and terminator, was assembled to <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_I763007">BBa_I763007</a> <br />
<p align="justify">All new composite parts mentioned above were transformed to competent cells of Escherichia coli str. DH5a. All positive clones are validated using PCR, restriction enzyme digestion and DNA sequencing.</p><br />
<p align="justify"><strong>Cell culture fluorescence measurement</strong></p><br />
<p align="justify">Minimal medium with different concentration of glucose(1mM, 4mM, 10 mM , 20 mM , 50 mM ,100 mM) was transferred into a 96-well plate, 200 μL for each well. Then each well was inoculated with 2 μL of seed liquor which was activated overnight in M9 minimal medium with 50mM glucose at 37℃. The wells without inoculation were regarded as blank controls to revise the results. Under each condition, three parallel samples were set. The plate was incubated at 37℃, 150rpm. Cell culture fluorescence was recorded on a SpectraMax M2 plate reader (Molecular Devices). Excitation at 584 nm and emission at 607 nm were used. All fluorescence was normalized with cell density by measuring the absorbance at 600 nm.</p><br />
<br />
<p align="justify"><strong>Capturing fluorescent image </strong></p><br />
<p align="justify">Cell morphology was observed through fluorescence microscope, and the images of bacteria with different glucose concentration were captured.</p><br />
<br />
<p align="justify"><strong>Fluorescent analysis of cyto-imaging</strong></p><br />
<p align="justify">A program named FANCY was designed to recognize single cell and calculate the fluorescence strength according to the images. For more information, please click <a href="https://2012.igem.org/Team:WHU-China/Modeling?catalog=3">Here</a>.</p><br />
<p align="justify"><strong>Results</strong></p><br />
<p align="justify">Purified plasmids constructed before were digested with XbaI and PstI for confirmation. The agarose gel electrophoresis showed that the lengths were correct. At last, the plasmids were sent for sequencing. Results showed no mutation.</p><br />
<p align="justify"><img name="" src="https://static.igem.org/mediawiki/2012/d/d5/Fluorescence_1n.png" width="520" height="409" alt=""></p><br />
<p align="center">The result for fluorescence measurement of indirect device</p> <br />
<br />
<p align="justify">In the cell culture fluorescence measurement experiment, fluorescence of BBa_K861173 decreased coordinating with glucose concentration, while BBa_K861169 was reversed.The fluorescence of BBa_K861174 was too low to record, so we do not show it here. All of the results coincided with expected results indicating that we have successfully constructed the promoter which was activated by high concentration of glucose.</p><br />
<p align="justify"><img name="" src="https://static.igem.org/mediawiki/igem.org/d/dc/Indirect_Fig_2.png" width="500" height="220" alt=""></p><br />
<p align="center">The fluorescent image of indirect device in different concentration of glucose</p><br />
<p align="justify">Fluorescent images indicate that all cells were growing normally, because the size and morphology are both the same as that of the cells in LB medium. The fluorescence of the cells in the images shows the same discipline as results from the fluorescence measurement experiments. <br><br />
The results of FANCY are showed as bellow,fluorescent intensity of PcstA+cI+RFP increased with the glucose concentration,while that of the PcstA+RFP decreased with glucose concentration.It conforms well the results that showed above.</p><br />
<p align="justify"><img name="" src="https://static.igem.org/mediawiki/igem.org/2/21/Indirect_Fig_3.png" width="506" height="189" alt=""></p> <br />
<p align="justify"><img name="" src="https://static.igem.org/mediawiki/igem.org/c/c3/Indirect_Fig_4.png" width="500" height="226" alt=""></p> <br />
<p align="center">The fluorescent intensity of indirect device from program FANCY</p> <br />
<br />
<p align="justify">&nbsp;</p><br />
<p align="justify"><strong>Discussion </strong><br><br />
All results of the three experiments indicate the device works as expected. Next, RFP will be replaced with genes of cellulose synthesis. So the excess glucose can be transformed into cellulose. <br><br />
Although the indirect regulation pathway was tested effective,it works through an intermediate product, protein cI. This determines that the device will be less sensitive to glucose than a direct regulation pathway without intermediate.</p><br />
<p align="left">&nbsp;</p><br />
<a name="Direct Regulatory Promoter Design"><br />
<h3><br />
Direct Regulatory Promoter Design </h3><br />
</a><br />
<p><strong> </strong></p><br />
<p align="justify"><strong>1. Glucose sensor</strong></p><br />
<p align="justify">To turn CRP into a repressor, we firstly consulted papers about CRP binding site and find out that 22-bp palindromic consensus site of the sequence AAATGTGATCT*AGATCACATTT. Unfortunately, this consensus sequence contain XbaI restriction site. We then designed the binding site by changing the most frequent bases in the binding site into second most frequent bases. Specifically, two binding sites were designed: AAATGTGATTTAAATCACATTT, AAATGTGATTATAATCACATTT.</p><br />
<p align="justify">Firstly, to construct promoter that can be directly repressed by CRP, we put modified CRP binding site between -35 and -10 region of promoter BBa_ J23110 (TTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGC). However, it did not work out as we suppose to. In our reporter assay, this promoter failed to express higher level of RFP when bacteria grow in M9 medium with higher glucose concentration.</p><br />
<p align="justify">Then, we tried a different strategy. we designed another promoter overlapped with CRP binding site to satisfy the sequence of -10 region of the promoter (TTGACAGCTAGCTCAAATGTGATTTAAATCACATTT). The promoter also failed to show the desired function, the expression of RFP showed that the promoter is unstable.</p><br />
<p align="justify">Finally, we designed promoter with modified CRP binding site overlapped with the -10 region of the promoter. To satisfy better CRP binding, we firstly changed the sequence in -10 region to meet the CRP consensus sequence (TTGACAGCTAGCTCAAATGTGATTATAATCACATTT). We named it <i>Pcar</i>, which was short for <i>Promoter of CRP As a Repressor</i> . This time, Pcar showed exciting property as we expected.</p><br />
<p align="justify"><strong>2. Fatty acid sensor</strong></p><br />
<p align="justify">In fact, fatty acid sensor had already been tried by iGEM2006_Tokyo_Alliance (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J54220">BBa_J54220</a>).Yet their design failed to give desirable function.<br><br />
To design promoter that is under the sole regulation of fatty acid concentration, double FadR binding sites in promoter of FadL are placed and overlapped downstream of constitutive promoter J23110 (TTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGCTGGTCCGACCTATACTCTCGCC ACTGGTCTGATTTCTAAGA). Also, FadR was overexpressed to prevent leaky expression of the promoter.</p><br />
<a name="Pcar"><br />
<h3>Pcar</h3><br />
</a><br />
<p align="justify">Although the indirect regulation pathway was tested effective, we went on attempting a more compact and widely useful direct regulation design. Hence we altered a constitutive promoter (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J23119">BBa_J23119</a>) to CRP repressible ones. We have established a new technical standard for our strategy of repressible promoter design (for more information, click on <a href="https://2012.igem.org/Team:WHU-China/Project?catalog=2#Standard">Standard</a>), but we shall focus on the design itself now.</p><br />
<p align="justify">We designed promoter Pcar based on promoter BBa_J23119, inserting CRP-binding site to overlap on six base pairs with promoter -10 region. Since steric hindrance of CRP dimer blocks the function of -10 region, gene downstream will be repressed when glucose concentration is low. That is, most CRP appears in DNA-binding configuration. The repressive effect is undermined when glucose concentration increases. Accordingly, we changed CRP from an activator to a repressor, simplifying the device with potential advantages of higher sensibility and efficiency. As experimental results show, promoter Pcar works as we expect. </p><br />
<p align="justify">&nbsp;</p><br />
<center><br />
<p><img src="https://static.igem.org/mediawiki/2012/1/1a/Direct_regulation.png" width="500" height="260" hspace="2" vspace="1" border="2" align="top" /></p><br />
</center><br />
<p align="center">The direct regulatory pathway</p><br />
<p align="justify"><strong>Methods</strong></p><br />
<p align="justify"><strong>Design of the promoter Pcar which is activated by glucose </strong></p><br />
<p align="justify">Promoter Pcar, glucose biosensor plasmid, is derived from constitutive promoter (BBa_J23119) by adding a CRP binding site upstream the promoter which has several base pairs overlapping with polymerase binding site. The sequence was synthesized with restriction enzyme cutting site for EcoRI and XbaI at the 5' terminal and SpeI at 3' terminal. The sequence of promoter Pcar has cohesive terminus at both ends, so it is very convenient for us to construct the plasmid for functional detection.The sequence of Pcar is as followed:</p><br />
<p align="justify"><img src="https://static.igem.org/mediawiki/2012/b/b5/Pcar_sequence.png" width="500" height="94" alt=""></p><br />
<p align="justify"><img src="https://static.igem.org/mediawiki/2012/4/4f/Crp_regulation.jpg" width="500" height="210" alt=""></p><br />
<p align="center">The design concept of promoter <i>Pcar</i></p><br />
<p align="justify"><strong>Construction of plasmid for direct regulation pathway</strong></p><br />
<p align="justify">In this experiment, RFP reported the function of the indirect regulation pathway.</p><br />
<p align="justify"><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861179">BBa_K861179</a>: <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_I13507">BBa_I13507</a>, an mRFP generator with RBS and terminator was embedded downstream the constitutive promoter BBa_J23119</p><br />
<p align="justify"><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861176">BBa_K861176</a>: BBa_I13507 was embedded downstream the artificial promoter Pcar.</p><br />
<p align="justify"><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861178">BBa_K861178</a>: a constitutive expressed CRP(<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J23116">BBa_J23116</a>+<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861161">BBa_K861161</a>) was assembled with K861176.</p><br />
<br />
<p align="justify">All new composite parts mentioned above were transformed to competent cells of <i>Escherichia coli</i> str. DH5a. All positive clones are validated using PCR, restriction enzyme digestion and DNA sequencing.</p><br />
<p align="justify"><strong>Functional detection</strong></p><br />
<p align="justify">The same methods with that of the indirect regulation pathway were used to confirm that the promoter worked as expected. For details, please click <a href="https://2012.igem.org/Team:WHU-China/Project?catalog=2#Indirect Pathway Design">Here</a>.</p><br />
<p align="justify"><strong>Results</strong></p><br />
<p align="justify"><strong>Construction of the plasmid for functional detection</strong></p><br />
<p align="justify">The sizes of the Promoters Pcar and J23119 are less than 100 bp and are proved to be correct by agarose gel electrophoresis. Restriction Digestion of the plasmid BBa_I13507 only have one lad on the agarose gel, it told that the plasmid was digested well. After transformation, competent cells were cultured on agar plate with 50 μg/L of ampicillin. Both red and white bacterial colonies emerged on one plate. The red ones were the correct clones revealing promoter embedded successfully, while the white ones were negative. The red clones were picked out and cultured in LB medium for plasmid extraction. Purified plasmids were digested with XbaI and PstI for confirmation. The bands of 2000bp and 1000bp showed that the promoter had been embedded successfully. At last, the plasmids we acquired were sent for sequencing, and the result shows no mutation exist. </p><br />
<p align="justify"><img name="" src="https://static.igem.org/mediawiki/2012/6/6d/Pii_%E8%83%B6%E5%9B%BE.jpg" width="520" height="584" alt=""></p><br />
<p align="center">The agarose gel for digestion comfirmation</p><br />
<br />
<p align="justify"><strong>Cell culture fluorescence measurement. </strong></p><br />
<p align="justify">The correct clones were cultured in 96-well plate at 37℃ for 24 hours, then the fluorescence and absorbance at 600 nm were recorded on a SpectraMax M2 plate reader. All fluorescence was normalized with absorbance at 600 nm. The results represented the fluorescence of every well.<br><br />
The fluorescence of K861179 was about 10000 Relative Light Units. It did not vary with concentrations of glucose. However we found a positive correlation between the fluorescence of K861176 and concentration of glucose. At a glucose concentration lower than 4mM, the fluorescence was very low, but at high concentration of glucose like 100mM, the fluorescence was much less than that of K861179. </p><br />
<p align="justify"><img name="" src="https://static.igem.org/mediawiki/2012/0/00/Fluorescence_PCAR.png" width="520" height="413" alt=""></p><br />
<p align="center">The result of promoter Pcar from fluorescence measurement</p><br />
<p align="justify"><strong>Capturing of the fluorescent image </strong></p><br />
<p align="justify">Fluorescent images indicated that all the cells were growing normally, because the size and morphology were both the same with cells in LB medium. The fluorescence of the cells in the images show the same discipline with results from the fluorescence measurement experiments. Fluorescence of K861179 was very strong but it didn't change with the glucose concentration. On the contrary, fluorescence of K861176 was relatively weak but increased with concentration of glucose.</p><br />
<p align="justify"><img name="" src="https://static.igem.org/mediawiki/2012/d/d2/PII_%E8%8D%A7%E5%85%89%E7%85%A7%E7%89%87.png" width="510" height="210" alt=""></p><br />
<p align="center">Fluorescent images of Pcar and J23119 in different glucose concentration</p><br />
<p align="justify"><strong>Fluorescent analysis of cyto-imaging</strong></p><br />
<p align="justify">The result of FANCY is showed as bellow, single cell was recognized from fluorescence images and fluorescence intensity was calculated.In the table, datas show that RFP expression was activated in high glucose concentration, which conforms well with results above.For more information about FANCY,click <a href="https://2012.igem.org/Team:WHU-China/Modeling?catalog=3">Here</a>.</p><br />
<p align="justify"><img name="" src="https://static.igem.org/mediawiki/2012/d/d4/%E8%A1%A81.png" width="500" height="140" alt=""></p><br />
<p align="center">Fluorescent intensity of Pcar from program FANCY</p><br />
<p align="justify"><strong>&nbsp;</strong></p><br />
<p align="justify"><strong>Discussion</strong></p><br />
<p align="justify">The promoter Pcar is a promoter designed for the <em>Escherichia coli</em> and it is derived from a constitutive promoter BBa_J23119. Pcar includes the CRP-binding site and the RNA polymerase-binding site which overlap each other several base pairs. Therefore, because of the steric hindrance between CRP and RNA polymerase, gene downstream of the promoter will be repressed at high concentration of CRP. In the cells, low glucose concentration results in increasing activity by adenylate cyclase. cAMP binds to the cAMP receptor protein, which, in its bound form, is able to bind tightly to the specific DNA site in the promoter and to repress the gene downstream. On the contrary, high glucose concentration will result in the expression of the promoter.</p><br />
<p align="justify">&nbsp;</p><br />
<a name="PfadR"><br />
<h3><br />
PfadR<br />
</h3><br />
</a><br />
<h4>Outline</h4><br />
<p align="justify"> The design of <br />
<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861071"> Pcar</a> had sparkled the design of <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861060">PfadR</a>. In nature, beta oxidation needs these five genes, and is regulated by many factors besides fatty acids concentration. Therefore, there is no promoter that can meet our demand to be solely regulated by fatty acids. Therefore, we tried to develop a synthetic promoter that will be regulated by fatty acids. We found that the last 3 base pairs of constitutive promoter BBa_J23110 are the same to the first three base pairs of FadR binding site of FadL. Therefore, we thought that maybe by preventing the initiation of transcription, we can achieve our goal. </p><br />
<h4>Design of the Promoter PfadR Repressed by Fatty Acids</h4><br />
<p align="justify"> Promoter PfadR, is derived from BBa_J23110. Specifically, FadR binding site of FadL gene was placed overlapping with the last 3 base pairs of BBa_J23110. The sequence was synthesized with restriction sites for EcoRI and XbaI at the 5' terminal and SpeI at 3' terminal. We use overlapping PCR to get the double strand DNA. The sequence design of PfadR is as followed: </p><br />
<p align="justify"> Forward: GGAATTCTCTAGATTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGCTGGTCCGACCT</p><br />
<p align="justify"> Reverse: GACTAGTTCTTAGAAATCAGACCAGTGGCGAGAGTATAGGTCGGACCAGCTAGCATTGT</p></br><br />
<br />
<h4>Procedures</h4><br />
<br />
<p align="justify"> For M9 medium using oleic acid as sole carbon source, oleic acid was first emulsified 10% Triton X-100. M9 medium was then slowly added with constant vortex. M9 medium with high concentration of oleic acid was diluted by M9 medium with triton to form various concentrations. </p><br />
<p align="justify">For M9 medium using glucose as sole carbon source, M9 medium with high concentration of glucose was diluted by M9 medium to form various concentrations. </p><br />
<p align="justify"> After 24h of incubation in 24 well plates in 37°C, bacteria culture was centrifuged at 3000rmp for 5min, washed and resuspended in PBS. We detected the OD600 and fluorescence of using SpectraMax M2 plate reader (Molecular Devices) .Excitation at 584 nm and emission at 607 nm were used. All fluorescence was normalized with cell density by measuring the absorbance at 600 nm. </p><br />
<br />
<h4>Result</h4><br />
<p align="justify"> Normalized using Fluorescence/0D600</p><br />
<p align="justify"> Blue: Constitutive promoter J23110</p><br />
<p align="justify"> Red: PfadR</p><br />
<p align="justify"> Glucose Concentration gradient: 0.5, 1, 5, 10 mM</p><br />
<p align="justify"> Fatty acid Concentration gradient: 0.025, 0.05, 0.1, 0.25, 0.5, 1, 1.5 mM</p><br />
<br />
<p><img src="https://static.igem.org/mediawiki/2012/a/ae/PFADR.png" width="500" height="400" hspace="2" vspace="1" border="2" align="top" /></p><br />
<p><i> PfadR and BBa_J23110 promoter strength at different glucose and fatty acids concentration</i></p><br />
<p align="justify"> As shown from the results, the promoter shows about 3 times induction from glucose to 1.5umol/L fatty acids medium and the fluorescence of PfadR is about one sixth of <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J23110">BBa_J23110</a>. This may be because the tandem FadR binding site has made it more difficult for Polymerase to start gene transcription. Also, in medium that use glucose as sole carbon source, PfadR seems to be leaky. However, since our bacteria is wild type <i>E.coli</i>, Fab genes was not mutated, meaning that bacteria can synthesis fatty acids. Therefore, there may be a basal level fatty acids concentration inside the cell, making the transcription not being totally repressed. </p><br />
<p align="justify"> It should also be noticed that, from fatty acids concentration 0.025umol/L to 1.5umol/L, the induction is not very obvious. F0.25, 0.5 and 1 seemed to have similar fluorescence strength. The promoter is not sensitive enough. To further improve the function of PfadR, we are planning to modify the sequence of FadR binding sites to make FadR overlap more will promoter region. Also, we will try to overexpressed FadR protein to see its effects on PfadR.</p><br />
<p align="justify">&nbsp;</p><br />
<a name="Standard"><h3 align="justify">Standard</h3></a><br />
<p align="justify">To address the problem of sensing substrates in our metabolic devices, we have developed a few promoters following the strategy of modifying unconserved regions to protein binding sites. As steric hindrance can stop RNA polymerase as well as other transcription factors from correctly binding and functioning, the binding protein become the repressor of our synthetic promoters.</p><br />
<p align="justify">To different promoters, the details of modification comes in different ways. For instance, the PfadR (BBa_J861060) is modified downstream -10 region, while Pcar (BBa_J861171) is modified between -35 and -10 region. Indeed we have tried some other modifications (for more information, click on design of promoters) but without desirable functions and we still do not know why. However, all modifications aimed at the same goal, to introduce overlapping sequences between binding site of the designed repressor and the promoter.</p><br />
<p align="justify">To test the function of these promoters, we used fluorescence measurements. First, both the modified promoter and the unmodified one (as control) were assembled with mRFP genes as reporter. Hence, after culturing and testing fluorescence intensities using different methods (see direct regulation and FANCY), we can learn if the synthetic promoter is regulated as expected.</p><br />
<p align="justify">After a few successes, we are endeavoring setting up a new technical standard on design, construction and functional test of promoters. </p><br />
<p align="justify">&nbsp;</p><br />
</div><br />
<div class="passage divcell3"><br />
<h3>Fatty Acid Degradation Device</h3></a><br />
<p><br />
<iframe width="420" height="315" src="http://www.youtube.com/embed/bauWVfxu_nA" frameborder="0" allowfullscreen></iframe><br />
</p><br />
<p>The above is the video introduction of fatty acid degradation device. For Chinese mainland visitor, please visit <a href="http://v.youku.com/v_show/id_XNDY2MTM3Mjc2.html">here</a> for the video</p><br />
<a name="Purpose"><h3>Purpose</h3></a><br />
</p><br />
<p align="justify"><br />
To help people lose weight without the need of food restriction, we designed a genetically modified <br />
<br />
<i>E.coli</i> that can sense and degrade excessive fatty acid intake by the host. We hope that, together with other two <br />
<br />
devices we designed, we can introduce our <i>E.coslim</i> as resident in intestine to consume the excessive calories intake <br />
<br />
by the host and regulate intestinal microbiota.<br />
</p><br />
<a name="Outline"><h3>Outline</h3></a><br />
<P align="justify"><br />
<img src="https://static.igem.org/mediawiki/2012/7/76/Fatty_Acid_M.png" width="300" height="400" hspace="2" vspace="1" border="2" <br />
<br />
style="float:left" /><br />
<br />
Genes that are responsible for degradation and transportation of fatty acids (FAs) from <i>E.coli K12</i> and from <br />
<br />
<i>Salmonella enterica LT2</i> were cloned. Also, a promoter named PfadR that can be regulated solely by fatty acids was also <br />
<br />
designed. By placing those fatty acid degradation genes downstream of the artificially designed promoter PfadR (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861060">BBa_K861060</a>), we hope to create a device that degrades FAs only when the concentration of FAs is high.<br />
</p><br />
<p align="justify"><br />
Long chain fatty acids are firstly imported by the transmembrane protein <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861500">FadL</a>. After FAs get into cells, a CoA will <br />
<br />
be added by inner membrane-associated <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861010">FadD</a> (acyl-CoA synthase). β-oxidation is initiated by <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861020">FadE</a>(acyl-CoA dehydrogenase), <br />
<br />
which will convert acyl-CoA into enoyl-CoA. The following cycles of hydration, oxidation, and thiolytic cleavage are carried <br />
<br />
out by tetrameric complex consisting of two <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861400">FadA</a> and two <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861030">FadB</a> proteins or two <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861041">FadI</a> and two <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861031">FadJ</a> in anaerobic condition. <br />
<br />
<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861050">FadR</a> is a transcriptional regulator that, when not binds to acyl-CoA, can either serve as an activator for fatty acid <br />
<br />
synthesis gene like FabA, FabB and etc., or a repressor for fatty acid degradation gene like FadA, FadB, FadD FadE, FadL, <br />
<br />
FadI, FadJ and etc. After long chain fatty acids are converted to fatty acyl- CoA by FadD, it can bind to FadR. The binding <br />
<br />
will alter the conformation of FadR, making FadR unable to bind to the DNA sequence it recognizes to fulfill its function. <br />
<br />
Therefore, FadR can no longer activate or repress the transcription of genes downstream FadR binding sites. However, to our <br />
<br />
knowledge, there is no promoter available in nature that can respond solely to FadR since those promoters are often regulated <br />
<br />
by glucose concentration or oxidative stress and many other factors.</br><br />
In our design, FadL, FadD, FadE, FadA, FadB, FadI and FadJ from <i>Escherichia coli K12</i>, and <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861042">FadA</a>, <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861032">FadB</a> and <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861021">FadE</a> <br />
<br />
from <i>Salmonella enterica LT2</i> are placed downstream a synthetic promoter PfadR to make them solely regulated by fatty acid concentration.</br><br />
</br><br />
<br />
</p><br />
<br />
<br />
<a name="Progress"><h3>Progress</h3></a><br />
<h4><br />
Cloning of the gene<br />
</h4><br />
<p align="justify"><br />
First, the genome of <i>Escherichia coli K12 str. DH5ɑ</i> and <i>Salmonella enterica LT2</i> (symbolized as S-) were extracted <br />
<br />
and amplified by PCR using primers for each gene. The sequences of the primers used are as bellow (5’---3’).</br><br />
<br />
FadR Forward: GGAATTCTCTAGAATGGTCATTAAGGCGCAAAG</br><br />
Reverse: GACTAGTCTTATCGCCCCTGAATGGCTAAATC</br><br />
<br />
FadA Forward: GGAATTCTCTAGAATGGAACAGGTTGTCATTGTCG</br><br />
Reverse: GACTAGTTTAAACCCGCTCAAACACCGT</br><br />
<br />
FadB Forward: GGAATTCTCTAGAATGCTTTACAAAGGCGACACC</br><br />
Reverse: GACTAGTTTAAGCCGTTTTCAGGTCGCC</br><br />
<br />
FadD Forward: GGAATTC TCTAGATTGAAGAAGGTTTGGCTTAACCG</br><br />
Reverse: GACTAGTTCAGGCTTTATTGTCCACTTTGC</br><br />
<br />
FadE Forward: GGAATTC TCTAGAATGATGATTTTGAGTATTCTCG</br><br />
Reverse: GACTAGTTTACGCGGCTTCAACTTTCCG</br><br />
<br />
FadL Forward: GGAATTC TCTAGAATGAGCCAGAAAACCCTG</br><br />
Reverse: GACTAGTTAGAACGCGTAGTTAAAGTTAG</br><br />
<br />
FadI Forward: GGAATTC TCTAGA ATGGGTCAGGTTTTACC</br><br />
Reverse: GACTAGTTTATTCCGCCTCCAGAACCA</br><br />
<br />
FadJ Forward: GGAATTCTCTAGAATGGAAATGACATCAGC</br><br />
Reverse: GACTAGTTTATTGCAGGTCAGTTGCAGTTG</br><br />
<br />
S-FadA Forward: GGAATTCTCTAGAATGGTCATTAAGGCGCAAAG</br><br />
Reverse: GACTAGTCTTATCGCCCCTGAATGGCTAAATC</br><br />
<br />
S-FadB Forward: GGAATTCTCTAGAATGCTTTATAAAGGCGACACC</br><br />
Reverse: GACTAGTTAAGCCGTTTTCAGAGAACC</br><br />
<br />
S-FadE Forward: GGAATTCTCTAGAATGATGATTTTGAGTATTATCG</br><br />
Reverse: GACTAGTTATGCGGCTTCGACTTTACGC</br><br />
<br />
</p><br />
<h4><br />
Design of the Promoter PfadR Repressed by Fatty Acids <br />
</h4><br />
<p align="justify"><br />
Promoter PfadR, is derived from <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J23110">BBa_J23110</a>. Specifically, FadR binding site of FadL gene is placed overlapping with the last <br />
<br />
3 base pairs of BBa_J23110. The sequence was synthesized with restriction sites for EcoRI and XbaI at the 5' terminal and SpeI at <br />
<br />
3' terminal. We used overlapping PCR to get the double strand DNA. The primer design of PfadR is as followed:</br><br />
Forward:<br />
GGAATTCTCTAGATTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGCTGGTCCGACCT</br><br />
Reverse:<br />
GACTAGTTCTTAGAAATCAGACCAGTGGCGAGAGTATAGGTCGGACCAGCTAGCATTGT<br />
<br />
</p><br />
<br />
<h4><br />
Construction of Biobricks<br />
</h4><br />
<p align="justify"><br />
Fatty acid degradation project is divided into two parts: promoter, and gene function.</br><br />
<br />
To discover the optimal combination of those fatty acid genes, we:</br><br />
<br />
(1) use PCR to clone those genes in <i>E.coli K12</i> and <i>Salmonella enterica LT2</i></br>,<br />
(2) restriction digest and ligate those gene into pSB1C3,</br><br />
(3) restriction digest and ligate those gene with RBS(<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_B0030">B0030</a>),</br><br />
(4) RBS-FadA, RBS-FadI, and RBS-S-FadA is ligated with both <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_R0011">BBa_R0011</a> promoter and our PfadR</br><br />
RBS-FadR, RBS-FadB, RBS-FadJ, RBS-FadE, RBS-FadD, RBS-FadL, RBS-S-FadB, and RBS-S-FadE are ligated with <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_B0034">B0034</a>,</br><br />
(5) Promoter-RBS-FadA is ligated with RBS-FadB-Terminator, PROMOTER-RBS-FadI is ligated with RBS-FadJ-Terminator and <br />
<br />
Promoter-RBS-S-FadA is ligated with RBS-S-FadB-Terminator. RBS-FadE-Terminator, RBS-FadD-Terminator, RBS-FadL-Terminator, <br />
<br />
and RBS-S-FadE-Terminator, are ligated with BBa_R0011 promoter, PfadR and various constitutive promoters.<br />
<br />
<br />
For Promoter PfadR</br><br />
(1) promoter PfadR was synthesized using overlapping PCR</br><br />
(2) RFP reporter was ligated downstream the promoter and ligted into pSB6A1</br><br />
(3) J23116+ RBS+ FadR+ Terminator was ligated to PfadR+ RFP in pSB6A1</br><br />
</p><br />
<br />
<br />
<a name="Experimental Procedure"><h3>Experimental Procedure</h3></a><br />
<br />
<p align="justify"><br />
<img src="http://partsregistry.org/wiki/images/2/28/Cupric_acetate.png" width="500" height="250" hspace="2" vspace="1" border="2" <br />
<br />
align="left" /><br />
<p align="center"><i>Cupric acetate-pyridine reaction</i></p><br />
<p><br />
We used cupric acetate-pyridine as a color developing reagent to determine fatty acid consumption of genetically modified bacteria. We had modified existing methods to extract free fatty acid in M9 medium. Also, we used IPTG induced promoter BBa_R0011 to see the expression of those proteins and extract proteins from cells. For more details, please see protocol: <a href="https://2012.igem.org/Team:WHU-China/Notebooks?catalog=2#Protocols of Cupric-Soap Reaction">Cupric-Soap Reaction</a> for more details.<br />
</p><br />
<p align="justify">We also conducted <em>in vitro</em> experienments in which we characterized fatty acid degradation capabilities of combination of enzymes using a cell free system. Please see protocol: <a href="https://2012.igem.org/Team:WHU-China/Notebooks?catalog=2#In vitro experiment"><i>In vitro</i> Experiment</a> for more details.<br />
<a name="Results"><h3>Results</h3></a><br />
<h4><br />
Characterization of each gene<br />
</h4><br />
<p align="justify"><br />
In this experiment, we wanted to test whether the ability of degrading fatty acids of our genetically modified bacteria was enhanced as expected by transforming plasmids constitutively expressing related genes in the β-oxidation pathway. The effects of the genes we tested is listed in the following chart I. The ability was reflected by the change of the concentration of the fatty acids in the medium. It was measured by cupric-acetate soap reaction as described in Protocols section. Each time we inoculated 50mg bacteria into 30ml M9 medium using fatty acid as sole carbon source, collecting the sample at the time as shown in the picture. Then the analysis of the free fatty acids was performed.<br />
</p><br />
<p align="justify"><br />
The following figures shows the effects on degrading fatty acids by expressing different genes in β-oxidation pathway in <em>E.coli</em>. They are under the regulation of promoters with different kinds of strength. J23107 and J23114 are constitutive promoters provided by the committee. PfadR is the promoter designed by ourselves. It consists of the sequence of a constitutive promoter and the binding sequence of the transcription factor, FadR, which is the sensor of the fatty acids. FadE is the acyl-CoA dehydrogenase, which have been proved as performing the rate limiting reaction in the pathway. S-FadE is the counterpart of FadE in the bacteria Samonella. FadD is the acyl-CoA synthase. FadL, a transmembrane protein, is responsible for transporting fatty acids into the bacteria. The control we used is the E.coli expressing galU, a gene responsible for synthesize cellulose.</p><br />
<img src="https://static.igem.org/mediawiki/2012/8/82/6h.png" width="500" height="400" hspace="2" vspace="1" border="2" <br />
<br />
align="left" /><p><i>Fatty acid degradation at 6h</i></p><br />
<img src="https://static.igem.org/mediawiki/2012/a/a1/12h.png" width="500" height="400" hspace="2" vspace="1" border="2" <br />
<br />
align="left" /><p><i>Fatty acid degradation at 12h</i></p><br />
<img src="https://static.igem.org/mediawiki/2012/2/28/18H.png" width="500" height="400" hspace="2" vspace="1" border="2" <br />
<br />
align="left" /><p><i>Fatty acid degradation at 18h</i></p><br />
<img src="https://static.igem.org/mediawiki/2012/8/8c/24h.png" width="500" height="400" hspace="2" vspace="1" border="2" <br />
<br />
align="left" /><p><i>Fatty acid degradation at 24h</i></p><br />
<img src="http://partsregistry.org/wiki/images/b/bb/Degradation_according_to_time.jpg" width="500" height="450" hspace="2" vspace="1" border="2" align="left" /><p><i>Fatty acid degradation of bacteria overexpressing each gene in 24h</i></p><br />
<br />
<p align="justify">Based on the measurements of the consumption at given time, we conclude that overexpressing FadL increases the metabolizing ability no matter under the regulation of J23114 (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861002">BBa_K861002</a>) or our designed promoter, PfadR(<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861003">BBa_K861003</a>). The advantage is more obvious when the time expands (consumption at 18h and 24h). It's plausible because more fadL may transport more fatty acids into the bacteria. The increased inner fatty acids concentration is quite favorable. We also notice that the later one's consumption is lower. It may attribute to the fact that our promoter is weaker than the J23114. If the copy number of FadL is less, its metabolizing rate will be slower. And the fact that the PfadR needs to be induced may also make the time needed to synthesize protein longer, which may make it less competitive. These data opposes to our assumption that overexpressing the rate limiting enzyme FadE ((<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861025">BBa_K861025</a> and (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861026">BBa_K861026</a>) doesn't have obvious effect. It may be because the original level of FadE is enough, thus overexpression is not needed. The strength of the promoter doesn't affects the rate much, which partially suggests the reason above.</p><br />
<p align="justify">We found that the slope between 12h and 18h and between 18 and 24h are less than the others. It may be because the bacteria have entered static status, the amount of bacteria becomes consistent. Also, after the first death phase, they entered logarithmic phase again. Since our inoculation is relatively large and the oleate is excessive, the situation that the bacteria has experience two life cycle is possible. A growth curve in the future can test the theory.<br />
<h4><br />
<em>In vitro</em> Experiment</h4><br />
<p align="justify">The <em>in vitro</em> experiment was designed to make up for the limitation of time to test the combination of expressing different genes together (We are short of time assembling the genes together). So we used the cell extracts to do the enzyme assay. The advantage is that we can easily mix the enzyme we want together. Since the purpose of this experiment is to test whether overexpressing multiple genes are superior to a single gene, we set the amount of every gene the same in the combination for simplicity. In the future, we can test more combinations to find the best ratio.</p><br />
<br />
<img src="http://partsregistry.org/wiki/images/8/83/In_vitro.png" width="500" height="400" hspace="2" vspace="1" border="2" <br />
<br />
align="left" /> <p><i>Fatty acids remaining after 6 hours of reaction</i></p> <br />
<br />
<p align="justify">The result was that the cell extract of bacteria overexpressing FadE (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861024">BBa_K861024</a>), FadD (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861013">BBa_K861013</a>), S- FadA S- FadB(<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861038">BBa_K861038</a>) (a regulon), FadI FadJ(<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861037">BBa_K861037</a>) (a regulon) separately all degraded oleate obviously faster than the control. This may be somewhat contrasting to the result of our <em>in vivo</em> assay, in which overexpressing the FadD and FadE did not have obvious results. However, it can be explained. The promoter is not that strong in the <em>in vivo</em> assay, otherwise the growth of the bacteria would be inhibited. However, in the <em>in vitro</em> assay, this consideration was not necessary. Also, the concentration in the final reaction system was quite high by collecting 1L medium, which may improve the metabolizing rate. </p><br />
<p align="justify">It also showed that simultaneously increasing the concentration of FadE, FadD, S- FadA and S- FadB significantly improved the degrading ability. Increasing the doze of the FadI and FadJ on the basis of above did not make any difference, while increasing FadA and FadB may be indispensible because only expressing FadD and FadE is worse than expressing the gene alone. </p><br />
<br />
</div><br />
<div class="passage divcell4"><br />
<h3>Device II: Cellulose Synthesis</h3><br />
<p><br />
<iframe width="420" height="315" src="http://www.youtube.com/embed/Sm5NzacV7hA" frameborder="0" allowfullscreen></iframe><br />
</p><br />
<p>The above is the video introduction of cellulose synthesis degradation device. For Chinese mainland visitor, please visit <a href="http://v.youku.com/v_show/id_XNDY2MTQwNTI0.html">here</a> for the video.</p><br />
<h4 align="justify">Outline</h4><br />
<p align="justify"><br />
Cellulose is an essential material for keeping intestine peristalsis without producing energy, as prebiotics, feeding vegetarian bacteria flora (including Bacteroides, whose appropriate amount has proved important to prevent obesity) of intestine as well. Thus, cellulose helps people keep slim and healthy.</p><br />
<br />
<p align="justify"><br />
The developing device aims at transforming glucose into cellulose, thus producing cellulose as well as reducing energy intake. To achieve this goal, we cloned genes of enzymes responding to cellulose synthesis from the <i>Escherichia coli</i> str. DH5&alpha;, constructing functional expressional elements with these genes respectively downstream of promoter activated by glucose. In this way, cellulose synthetase complex is built artificially under regulation of glucose, repressed under low concentration of glucose and activated under high concentration of glucose.</p><br />
<br />
<br />
<p align="justify"><br />
In the future, this device can be integrated to the assembled <em>E. coslim</em>, activated when excess glucose is sensed in intestine, converting it to cellulose.</p><br />
<br />
<p align="justify"><br />
The same as device I (fatty acid degradation), on one hand, we divide our work into two parallel sections.<em> Function</em> section includes a series of molecular biological manipulation on four genes of the cellulose synthetase complex and another two genes responding to produce substrates for cellulose synthesis. On the other hand, the design, construction and function tests of glucose-activated promoter belong to <em>regulation</em> section.</p><br />
<br />
<br />
<h4 align="justify"><br />
Description</h4><br />
<br />
<h5 align="justify">Genes to be Cloned</h5><br />
<br />
<p align="justify"><br />
4 genes, <em>bcsA</em>, <em>bcsB</em>, <em>bcsZ</em> and <em>bcsC</em>, from the rdar morphotype bacterium, are involved in cellulose biosynthesis.<br />
<p align="justify"> BcsA is considered to be the catalytic subunit.<br />
<p align="justify">BcsB can be activated the soon it binds to c-di-GMP.<br />
<p align="justify">BcsZ encodes endo-1,4-D-glucanase which belongs to glycosyl hydrolase family Ⅷ. Activation of BcsZ is required for optimal synthesis and membrane translocation of cellulose.<br />
<p align="justify">Although <em>BcsC</em> is transcribed constitutively, cellulose synthesis occurs only in the circumstances of AdrA.<br />
<p align="justify">AdrA ,a diguanylate cyclase (DGC), cyclizestwo GTPs into c-di-GMP. In turn, the activity of cellulose synthase can be increased when binds to c-di-GMP.<br />
<p align="justify">GalU catalyzes the addition of UTP to α-D-glucose 1-phosphate to yield UDP-D-glucose, which is the substrate for cellulose synthase complex<br />
<p align="justify">GalF is a predicted subunit of a GalU/GalF protein complex involved in colanic acid building blocks biosynthesis<br />
</p><br />
<br />
<br />
<br />
<h5 align="justify">Indirect Regulation Pathway Design</h5><br />
<p align="justify"><br />
In a cell, total amount of ATP, ADP and AMP remains constant. Low glucose concentration results in high activity of adenylate cyclase converting ATP into cAMP, who binds and converts cAMP receptor protein (abbreviated as CRP) to DNA-binding configuration. Conversely, when glucose concentration gets high, more ATP and less cAMP will be produced, resulting in low DNA-binding activity of CRP.</p><br />
<br />
<p align="justify"><br />
We embeded gene <i>cI</i> of lambda phage downstream promoter PcstA (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K118011">BBa_K118011</a>) activated by the binding of CRP, and genes of cellulose synthesis respectively downstream the promoter <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_R0051">BBa_R0051</a> repressed by protein cI. In this way ,we constructed an indirect regulation pathway with sensus glucose, transcription activator CRP and transcription repressor cI. If the device works as supposed, cellulose production will be increased following the elevation of glucose concentration, and vice versa. For more information, click <a href="https://2012.igem.org/Team:WHU-China/Project?catalog=2#Indirect Pathway Design">Here</a>.</p><br />
<br />
<P><br />
<img src="https://static.igem.org/mediawiki/2012/3/38/Cellulose_1.png" width="500" height="421" hspace="2" vspace="1" border="2" align="center" /></P><br />
<br />
<h5 align="justify">Direct Regulation Pathway Design</h5><br />
<br />
<p align="justify"><br />
Although the indirect regulation pathway was tested effective, we went on attempting a more compact and widely useful direct regulation design. Hence we modified a constitutive promoter (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J23119">BBa_J23119</a>) to CRP repressible ones. We have established a new technical standard for our strategy of repressible promoter design (for more information, click on <a href="https://2012.igem.org/Team:WHU-China/Project?catalog=2#Standard">Standard</a>), but we shall focus on the design itself now.</p><br />
<br />
<p align="justify">We designed promoter Pcar(<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861171">BBa_K861171</a>) based on promoter BBa_J23119, inserting CRP-binding site to overlap on six base pairs with promoter -10 region. Since steric hindrance of CRP dimer blocks the function of -10 region, genes downstream will be repressed when glucose concentration is low. That is, most CRP appears in DNA-binding configuration. The repressive effect is undermined when glucose concentration increases. Accordingly, we changed CRP from an activator to a repressor, simplifying the device with potential advantages of higher sensibility and efficiency. As experimental results show, promoter Pcar works as we expect. For more information, please click <a href="https://2012.igem.org/Team:WHU-China/Project?catalog=2#Pcar">Here</a>.</p><br />
<p align="left"> <img src="https://static.igem.org/mediawiki/2012/9/9b/Cellulose_2.png" width="382" height="584" hspace="2" vspace="1" border="2" align="middle" /></p><br />
<h4 align="justify">Progress</h4><br />
<h5 align="justify">Clone of genes</h5><br />
<br />
<p align="justify"><br />
As for the genes that we cloned, there is no difference between <i>E. Coli</i> str. K12 MG1655 and more available DH5&alpha;. we purified and amplified these genes from genome of <i>Escherichia coli</i> str. DH5&alpha; using PCR. The primers contain standard restriction enzyme cutting sites. The sequences of the primers used are as below.<br />
<p align="justify"> <em>bcsA</em> Antisense CCTGCAGTACTAGTATCATTGTTGAGCCAAAGCCTG <br/><br />
Sense CGAATTCTTCTAGAGATGAGTATCCTGACCCGGTGG<br />
<p align="justify"> <em>bcsB</em> Antisense CCTGCAGTACTAGTATTACTCGTTATCCGGGTTAAGAC <br/><br />
Sense CGAATTCTTCTAGAGATGAAAAGAAAACTATTCTGGATTTG<br />
<p align="justify"> <em>bcsZ</em> Antisense CCTGCAGTACTAGTATTAGTGTGAATTTGCGCATTCCTGG <br/><br />
Sense CGAATTCTTCTAGAGATGAATGTGTTGCGTAGTGGAATCG<br />
<p align="justify"> <em>bcsC</em> Antisense CCTGCAGTACTAGTATTACCAGTCGGCGTAAGGTATCA <br/><br />
Sense CGAATTCTTCTAGAGATGCGCAAATTCACACTAAACATATTC<br />
<p align="justify"> <em>galF</em> Antisense CCTGCAGTACTAGTATTATTCGCTTAACAGCTTCTCG <br/><br />
Sense CGAATTCTTCTAGAGATGACGAATTTAAAAGCAGTTATACC<br />
<p align="justify"> <em>galU</em> Antisense CCTGCAGTACTAGTATTACTTCTTAATGCCCATCTCTTCT <br/><br />
Sense CGAATTCTTCTAGAGATGGCTGCCATTAATACGAAAG<br />
<br />
<p>&nbsp;</p><br />
<p align="justify">Then the genes were digested with restriction enzymes and assembled to RBS (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_B0030">BBa_B0030</a>) and terminator (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_B0024">BBa_B0024</a>).<br />
</p><br />
<br />
<br />
<br />
</p><br />
<h5 align="justify">Construction of the plasmid expressing cellulose synthetase controlled by promoter we designed</h5><br />
<br />
<p align="justify"><br />
All coding sequences were assembled to RBS and terminator, afterwards, they were embedded downstream the promoter Pcar, which can be activated at high glucose concentration.<br />
<br>The biobricks constructed were showed as bellow:<br />
<br><br />
<p align="justify"> <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861102">BBa_K861102</a>: Pcar+RBS+<i>bcsA</i>+terminator<br />
<p align="justify"> <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861112">BBa_K861112</a>: Pcar+RBS+<i>bcsB</i>+terminator<br />
<p align="justify"> <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861122">BBa_K861122</a>: Pcar+RBS+<i>bcsZ</i>+terminator<br />
<p align="justify"> <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861132">BBa_K861132</a>: Pcar+RBS+<i>bcsC</i>+terminator<br />
<p align="justify"> <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861142">BBa_K861142</a>: Pcar+RBS+<i>galU</i>+terminator<br />
<p align="justify"> <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861152">BBa_K861152</a>: Pcar+RBS+<i>galF</i>+terminator<br />
<p align="justify"> <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861074">BBa_K861074</a>: Pcar+RBS+<i>adrA</i>+terminator<br />
</p><br />
<br />
<p align="justify"><br />
All new composite parts mentioned above were transformed to competent cells of <i>Escherichia coli</i> str. DH5&alpha;. All positive clones are validated using PCR, restriction enzyme digestion and DNA sequencing.</p><br />
<br />
<h5 align="justify">Detection of Cellulose Synthesis</h5><br />
<p align="justify"><br />
To detect the cellulose synthesis, we used cellulase to degrade cellulose in the cell culture. Then total reducing sugar in the culture was measured. So the difference of total reducing sugar between culture before and after treated with cellulase represents the total cellulose synthetised by the cell. For detailed information, please click <a href="https://2012.igem.org/Team:WHU-China/Notebooks?catalog=2">Here</a>.</p><br />
<br />
<h4 align="justify">Results</h4><br />
<br />
<h5 align="justify"><br />
Clone of genes</h5><br />
<p align="justify"><br />
The gene <i>bcsA</i> is 2619bp, <i>bcsB</i> is 2340bp, <i>bcsZ</i> is 1107 bp, <i>bcsC</i> is 3474bp, <i>galU</i> is 909bp and <i>galF</i> is 894 bp. After PCR amplification, DNA fragments were examined by agarose gel electrophoresis. All genes proved correct. Then the genes were digested with restriction enzymes and embedded into plasmid backbone pSB1A2. To confirm the accuracy of sequences, positive clones were sent for sequencing after transformation. And the results showed that no mutation existed in genes.</p><br />
<br />
<P align="center"><br />
<img src="https://static.igem.org/mediawiki/2012/3/30/BcsA_B_Z_C_U_F.tif" width="500" height="416" hspace="2" vspace="1" border="2" align="middle" /></P><br />
<br />
<h5 align="justify">Detection of Cellulose Synthesis</h5><br />
<br />
<p align="justify">After treating with cellulase, total reducing sugar in supernatant and deposits was measured by methods described in our protocol. Colors in the tubes <br /><br />
becoming darker meant that reducing sugar increased with time. Amount of reducing sugar was calculated according to standard curve of glucose.</p><br />
<p align="justify">The formula of standard curve is as bellow:</p><br />
<p align="justify"><i>y</i>=1.3795<i>x</i>+0.0373</p><br />
<p align="justify">In our experiment, cells that expressed protein which was nothing to do with cellulose synthesis was used as a control. Cellulose output in both supernatant and deposit were show in the following figure. The cellulose production in <em>adrA</em>+<em>bcsA</em> is more than 0.6 mg/mL, which is almost two times higher than that of control.</p><br />
<p align="center"><img src="https://static.igem.org/mediawiki/igem.org/f/ff/Cellulose_Fig_1.jpg" alt="" name="CelluloseFig1" width="520" height="1247" align="middle" id="CelluloseFig1" /></p><br />
<p align="center">&nbsp;</p><br />
<p align="justify">The expression of <em>adrA</em> and <em>bcsA</em> could improve the yield of cellulose. Then what is the effect of each gene on cellulose synthesis? We transformed the seven genes involved in cellulose synthesis into <em>E.coli</em> and meaaured cellulose production. In the step of measuring total cellulose production, exceed cellulase was appended and incubated at 50 ℃ for 1 hour, and results show that all these genes help increase the ability of cellulose synthesis.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="center"><img src="https://static.igem.org/mediawiki/igem.org/2/23/Cellulose_Fig_2.png" alt="" name="CelluloseFig2" width="506" height="440" align="middle" id="CelluloseFig2" /></p><br />
<h4 align="justify"><strong>Disscusion</strong></h4><br />
<p align="justify">In our experiment, results show that cellulose yield in <em>adrA</em>+<em>bcsA</em> is much less than that of the single gene. It was because that cellulase amount and reaction time were both less than the latter one.</p><br />
<p align="justify">Actually, BcsB can be activated by c-di-GMP. But till the deadline, we have not successfully assembled Pcar and <em>bcsB</em>. In the following work, we are going to assemble a plasmid including all of the seven genes. Maybe in this way, cellulose production will increase greatly.</p><br />
<p align="justify">Other than application in the project of <em>E.coslim</em>, the cellulose device can also be used in many other fields, such as papermaking industry, biomedical materials, audio equipment and so on.</p><br />
<br />
</div><br />
<div class="passage divcell5"><br />
<h3>Colonization</h3></a><br />
<p><br />
<iframe width="420" height="315" src="http://www.youtube.com/embed/5GHyA3mUgaM" frameborder="0" allowfullscreen></iframe><br />
</p><br />
<p>The above is the video introduction of colonization device. For Chinese mainland visitor, please visit <a href="http://v.youku.com/v_show/id_XNDY2MTQwNDc2.html">here</a> for the video</p><br />
<br />
<br />
<a name="Purpose2"><h3>Purpose</h3></a><br />
<p align="justify"><br />
One big challenge of probiotics is their survival in intestine. We respond to this challenge by expressing gene <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861070">adrA</a> responsible for manufacturing the second messager c-di-GMP, a magic molecule that leads to inhibition of motility and increase of adhesion and division of <i>E.coli</i>. </p><br />
<br />
<a name="Outline2"><h3><br />
Outline<br />
</h3></a><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/8d/Biobrick04.png" width="350" height="350" hspace="2" vspace="1" border="2" style="float:left" /><br />
AdrA protein can convert GTP into c-di-GMP, a magic second massager that, besides promoting the production of cellulose(for more details, see our celluose synthesis device), can reduce the expression of flagella and acute virulence gene simultaneously. In the same time, c-di-GMP can facilitate the synthesis of various adhesins and exopolysaccharides and can promote the proteolysis of replication inhibitors. As a result, AdrA makes cells become adhesive and promote the formation of biofilm, making the bacteria gain advantages to survive in the hostile environment of intestine.<br />
</p><br />
<br />
<a name="Experimental Procedure2"><h3><br />
Experimental Procedure<br />
</h3></a><br />
<p align="justify"><br />
We tested the function of AdrA gene by plate assay. Formore details, please visit our protocol page.<br />
</p><br />
<a name="Results2"><h3><br />
Results<br />
</h3></a><br />
<p><img src="http://partsregistry.org/wiki/images/e/e7/AdrA.jpg" width="500" height="620" hspace="2" vspace="1" border="2" align="top" /></p></br><br />
<p align="justify">As can be seen from the plate. Clone with AdrA constitutively expressed using <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J23107">BBa_J23107</a> is much more smaller compared to the control that only contain <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_B0030">the plasmids of RBS</a>, though the amount of bacteria is similar. This result showed that the AdrA was successfully expressed, elevating c-di-GMP level, leading to the increase expression of adhesins and inhibition of motility.</p><br />
</div><br />
<div class="passage divcell6"><br />
<br />
<h3>Death Device</h3><br />
<p><br />
<iframe width="420" height="315" src="http://youtu.be/BpK0gitnaFU" frameborder="0" allowfullscreen></iframe><br />
</p><br />
<p>The above is the video introduction of death device. For Chinese mainland visitor, please visit <a href="http://v.youku.com/v_show/id_XNDY2MTQwNDIw.html">here</a> for the video</p><br />
<a name="Outline"><h4> Outline </h4></a><br />
<p align="justify"><br />
We plan to place endonuclease and YhjH gene downstream the xylR repressed promoter<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861200"> (BBa_K861200)</a> to make bacteria die and lose their adhesion when exposed to xylose.<br />
</p><br />
<br />
<a name="Description"><h4> Description </h4></a><br />
<p align="justify"><br />
<img src="https://static.igem.org/mediawiki/2012/c/c3/Death.png" width="500" height="300" hspace="2" vspace="1" border="2" <br />
<br />
style="float:left" /></p><br />
<br />
<br />
<p align="justify"><br />
In order to terminate the overreaction of fatty acid metabolism and cellulose synthesis, we design an elaborate device. Firstly, we determined to use endonuclease YhjH<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861090"> (BBa_K861090)</a> responsible for c-di-GMP degradation to counteract the impact of AdrA and BglII(<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K112106"> (BBa_K112106)</a>), a protein that can kill the microbe without inducing cell lysis. Since AdrA but not YhjH contains this restriction site, our E.coslim will lose their adhesion more easily. To control the expression of endonuclease and YhjH, a regulator is <br />
<br />
necessary. We selected xylose as the inducer because this monomer hardly exists in nature, so the GMOs will not be killed under natural condition. Also, it is healthy and hard to be absorbed by human beings so the concentration of xylose in the gut can keep high for a long time. We are planning to device another synthetic promoter repressed by XylR from <i>B.subtilis</i>. We hope that eating xylose will <br />
<br />
subsequently derepress the expression of endonuclease and YhjH, ending up with the loss of adhesion and the death of our E.coslim, therefore efficiently terminate the process of lossing weight. For more information and for a brief introduction of our two-capsule design, please visit our <a href="https://2012.igem.org/Team:WHU-China/Modeling?catalog=0">Future Perspective </a>.<br />
<br />
</p><br />
</br></br><br />
<br />
<a name="Prevention of HGT"><h4> Prevention of HGT </h4></a><br />
<p align="justify"><br />
In human gut, there are billions of microbes. Horizontal gene transfer of those high efficient metabolic genes between GMOs <br />
<br />
and normal intestine residents may get out of control and cause disastrous effects. Therefore, a mechanism to prevent HGT <br />
<br />
is highly necessary.<br />
To prevent horizontal gene transfer, we designed a two-plasmids system. In one plasmid, xlyR repressor encoding gene<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K143036"> (BBa_K143036)</a> from <br />
<br />
<i>Bacillus subtilis</i> will be assembled with constitutively expressed promoter. On the other plasmid, metabolic gene will be coupled with xylR repressed death system. In <br />
<br />
our GMOs, since death system is suppressed by xylR in low xylose concentration, the bacteria will not die. However, when <br />
<br />
the HGT of those high efficient metabolic genes happens, the death system will not be suppressed, and the recipient will <br />
<br />
be killed.<br />
</p><br />
<br />
</div><br />
<br />
</div><br />
<em class="clear"><br />
</em><br />
</div><br />
<div class="footer"><br />
</div><br />
</div><br />
<script src="http://www.yichengliu.com/code/igem/project.js"><br />
</script><br />
</body><br />
</html></div>Nanhai