http://2012.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=20&target=S.Sureka2012.igem.org - User contributions [en]2024-03-29T06:59:30ZFrom 2012.igem.orgMediaWiki 1.16.0http://2012.igem.org/File:CEA.PNGFile:CEA.PNG2013-01-10T20:02:11Z<p>S.Sureka: uploaded a new version of &quot;File:CEA.PNG&quot;: Reverted to version as of 20:00, 10 January 2013</p>
<hr />
<div></div>S.Surekahttp://2012.igem.org/File:CEA.PNGFile:CEA.PNG2013-01-10T20:01:57Z<p>S.Sureka: uploaded a new version of &quot;File:CEA.PNG&quot;</p>
<hr />
<div></div>S.Surekahttp://2012.igem.org/File:CEA.PNGFile:CEA.PNG2013-01-10T20:00:43Z<p>S.Sureka: uploaded a new version of &quot;File:CEA.PNG&quot;</p>
<hr />
<div></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/hprac/bioethicsTeam:Cornell/project/hprac/bioethics2012-10-27T03:47:33Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6 style="margin-top:32px;">Human Practices</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/CEA">Comprehensive Environmental Assessment</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/bioethics">Bioethics</a><br />
</li> <br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/oil_sands">Oil Sands</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/cayuga_watershed">Cayuga Watershed</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/safety">Safety</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row" id="ugd-members"><br />
<div class="twelve columns"><br />
<h2 class="centered">Bioethics</h2><br />
</div><br />
</div><br />
<div class="row last-ele"><br />
<div class="twelve columns"><br />
<br>Comprehensive Environmental Assessment was extremely helpful in providing guidance for research priorities; however, we thought it necessary to address ethical concerns associated with our project. As such, we designed our project in accordance with the ethical principles identified by the Presidential Commission for the Study of Bioethical Issues (2010). Our primary motive is public beneficence: to improve global public health by monitoring the safety of drinking water. We have also demonstrated responsible stewardship by considering the environmental implications of our project; the ecological impact of placing our genetically modified strain in water would be minimal because our filtration system will not allow bacteria to escape. <i>S. oneidensis</i> MR-1 is native to North America and poses no known threat to biodiversity or humans; however, before field testing, we would engineer our strains to be auxotrophic. We have spoken directly with Environment Canada representatives who confirmed our recombinant <i>S. oneidensis</i>-based biosensor is easily approvable for field deployment.</br><br />
<br />
<br>In addition, the electrochemical biosensor is an intellectually responsible pursuit: our project cannot foreseeably be used to cause people harm. In the spirit of democratic deliberation, the human practices component of our team seeks to account for others’ ethical concerns about our project. We have begun consulting with local citizens as well as public authorities in order to fully understand the possible impacts of our project. Our proposed system would be easy, cost-effective, and potentially usable on a global scale, demonstrating justice and fairness in its intended implementation. Additionally, the modularity of our biosensing platform allows it to be adapted to the needs of different communities, in order to best serve global populations and environments.</br><br />
</div><br />
<div class="twelve columns"><br />
<br><br><br />
<h6>References</h6><br />
Presidential Commission for the Study of Bioethical Issues. (2010). New directions: The ethics of synthetic biology and emerging technologies. Washington, D.C.: Presidential Commission for the Study of Bioethical Issues.<br />
</div><br />
</div><br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_hprac').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/hprac/CEATeam:Cornell/project/hprac/CEA2012-10-27T03:46:54Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6 style="margin-top:72px;">Human Practices</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac">Overview</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/CEA">Comprehensive Environmental Assessment</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/bioethics">Bioethics</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/oil_sands">Oil Sands</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/cayuga_watershed">Cayuga Watershed</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/safety">Safety</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row" id="ugd-members"><br />
<div class="twelve columns"><br />
<h2 class="centered">Comprehensive Environmental Assessment</h2><br />
</div><br />
</div><br />
<div class="row last-ele"><br />
<div class="twelve columns"><br />
<h3>Introduction to CEA</h3><br />
<br />
As scientists, we are often inclined to reduce complex procedures down to simple, step-by-step protocols. Assessing risk and evaluating environmental impact are no exception; our first instinct this year was to create a universal checklist of regulations that every environmental iGEM project could fulfill in order to ensure environmental safety, the idea being that we could easily and systematically find answers to questions of environmental safety in scientific literature. However, upon speaking with Dr. Christina Powers, a biologist at the US Environmental Protection Agency, and further exploring the concerns relating to our own project, we decided to adopt a new approach to issues of human practices: Comprehensive Environmental Assessment (CEA).<br />
</br><br />
<br>CEA differs from traditional methods of risk assessment by recognizing that risk assessment is fundamentally a decision-making process in which scientists, experts, and the public should be engaged. The goal is to foster transparent discussion and use collective judgment to evaluate limitations and trade-offs in order to arrive at holistic conclusions about the primary issues that researchers should address in their research planning.</br><br />
</div><br />
<div class="twelve columns"><br />
<h3>CEA &amp; Synthetic Biology</h3><br />
While the Environmental Protection Agency primarily uses the CEA approach for nanomaterials, the Woodrow Wilson International Center for Scholars in Washington, D.C., recently launched efforts to lay out a framework to apply CEA to synthetic biology. This groundbreaking project set out to assess the CEA approach’s relevance to synthetic biology, in anticipation of the growing demand for synthetic biology-based solutions to global issues. They arrived at the conclusion that scientists should focus on four major areas of risk assessment: altered physiology, competition and biodiversity, evolutionary prediction, and gene transfer.<br />
</br><br />
<br>The Woodrow Wilson Center’s Synthetic Biology Project recommended that CEA be applied to more developed projects that were approaching field deployment in order to evaluate it as a risk-assessment approach for synthetic biology at large. This is where we come in: can CEA be successfully used to evaluate the risks of our field-deployable device? What are its limitations? </br><br />
<br />
<br>We began by attempting to apply the Synthetic Biology Project’s modified guidelines for prioritizing research questions to our own project as it currently stands.</br><br />
<img src="https://static.igem.org/mediawiki/2012/5/5a/CEA.PNG" class="inline"><br />
Above is a simplified schematic of our risk assessment approach, as adapted from the Woodrow Wilson Center. We hope that this framework will prove useful to other environmental iGEM teams in the future.<br />
<br><br><br />
<h5>Altered Physiology</h5><br />
<br />
The current versions of our genetically modified strains have a membrane protein in the Mtr pathway for anaerobic respiration knocked out and complemented on a plasmid. They differ from wild-type <i>Shewanella oneidensis</i> MR-1 in that their capacity for anaerobic respiration is upregulated in the presence of analyte (arsenic or naphthalene). This plasmid appears to be producing mtrB in a fully functional form that successfully completes the anaerobic respiration pathway when induced. One important difference is that when uninduced, the bacteria loses much of its anaerobic respiratory activity, and must rely significantly more on aerobic respiration; this is further discussed below.<br />
<br />
<br>In addition, our salicylate reporter strain contains the nah operon, which allows the cells to constitutively degrade naphthalene into salicylate. Salicylate, a metabolic intermediate in the <i>Pseudomonas</i> strain from which the nah operon was taken, is less toxic to the environment than naphthalene. <i>P. putida</i> G7 can further degrade salicylate into a catechol, an edible carbon source using the sal operon; this second operon is not present in our cells, so our <i>Shewanella</i> strains are unable to actively degrade salicylate. This means that our cells cannot use naphthalene as a carbon source, a conclusion that is supported by our naphthalene growth assays. The effects of salicylate production on the cells appear to be negligible, but this should be further explored in future characterization work. </br><br />
<br />
<br>One of our future plans is to integrate our constructs into the chromosomes of our strains, in order to ensure that mtrB is not saturating at its uninduced, basal expression levels. This poses new questions: will chromosomal integration alter the expression patterns of this engineered pathway? Will it interfere with other functions of the cells? Functionality can be altered depending on the position of the construct within the chromosome. This is our first forthcoming research priority: determining any potential adverse effects of <b>chromosomal integration</b>, carrying it out, and thoroughly testing the functionality of our new engineered strains. </br><br />
<br />
<h5>Competition &amp; Biodiversity </h5><br />
A second concern is that engineered strains could possibly outcompete wild-type species in the environment and pose a threat to biodiversity. Our first line of defense against this possibility is physical containment: the inlet and outlet of our current prototype are equipped with 0.1 µm filters, effectively eliminating the possibility that our engineered strains may interact with natural organisms. However, imagine that there could be a mechanical error: physical breakage of the device, slight discrepancies in filter pore sizes, et cetera, that could leave a slim possibility that our strains could come into contact with natural species. What then?<br />
<br />
<br>To answer this question, we return to the altered physiology of our strains: the primary distinguishing characteristic to note is that the cells cannot carry out the wild-type levels of anaerobic respiration unless they are induced. This means that in situations where oxygen availability is limiting, and toxins are not highly prevalent, <b>our strains are less able to compete than wild-type <i>Shewanella</i></b>; this is our second line of defense. <i>S. oneidensis</i> is native to freshwater ecosystems in our area, so our strains should not be disruptive to biodiversity. In addition, we have observed that inserting the nah operon into cells seems to significantly increase their doubling time, so our salicylate reporter strains would be even less able to compete than our arsenic reporters.</br><br />
<br />
<br>However, what happens in the case that oxygen availability is not limiting? It is probable that our current engineered strains would be able to survive and thrive in aerobic conditions, and live alongside wild-type <i>Shewanella</i>. We need a third line of defense for this situation, a modification that would prevent our strains from being able to survive outside of our physical device. For this, we propose <b>auxotrophy:</b> in a truly field-deployable device, we would use a strain that had a gene for a key metabolite knocked out, so that the strain would rely upon supplementation of this nutrient in order to survive. We would then supplement this metabolite inside of the device, so that our strains would function properly within our device. If the bacteria were to somehow escape, their functionality would be severely impaired by the lack of nutritional supplementation, and they would be quickly outcompeted by wild-type strains.</br><br />
<br />
<br>This brings to the table a second research priority for field-deployability: engineer an auxotrophic strain of <i>Shewanella</i> to contain our constructs, and ensure that the likelihood of survival without nutritional supplementation is very, very low. We would also need to ensure, from a practical standpoint, that auxotrophy would not interfere with any other aspects of the physiology of the cells.<br><br />
<br />
<br><br />
<h5>Evolutionary Prediction</h5> <br />
Due to the relatively simple nature of our reporter system, we find it highly unlikely that our strains could evolve to possess any dangerous function if somehow released into the wild. However, it is still possible that the promoter regions of our constructs could mutate and alter the expected patterns of promoter activity, or that the functionality of mtrB would be impaired by a deleterious mutation. The former possibility could serve to make the strain more genetically similar to the wild-type, and thus more able to compete; this presents us with another reason to pursue auxotrophy as a solution, basically in order to ensure that our strains are not alive for long enough for mutations to accumulate. <br />
</br><br />
<br />
<br>However, we would also need to conduct extensive testing to ensure that our strains remain functional and responsive to analyte for the full 6-month period.<br />
</br><br />
<br />
<p><br />
<h5>Gene Transfer</h5> <br />
Perhaps the most pressing concern with any synthetic biology project is the possibility of horizontal gene transfer from engineered to natural strains, and vice versa. Again, our first line of defense is physical containment, but barring that, what can we do to reduce the possibility that our strains would transfer unnatural functions to natural cells? The biggest shortcoming of our current system is that antibiotic resistance is used as a selective marker on our plasmids, thus allowing for the possibility that antibiotic resistance could be spread among natural populations via conjugation or passive transformation. While we could explore the possibility of using another form of auxotrophy as a selective marker on a plasmid, we believe that a more viable solution would be to eliminate the need for a selective pressure in the first place, namely by chromosomal integration. The transfer of chromosomal DNA is much less likely than the transfer of a plasmid, and, as mentioned above, chromosomal integration would solve other problems in the functionality of our reporters.<br />
</p><br />
</div><br />
<br />
<div class="twelve columns"><br />
<h3>Limitations of CEA</h3><br />
CEA allowed us to think about crucial future work for our project in order to make it suitable for field-deployability. However, in our interactions with environmental groups, public officials in water quality management, and industrial groups, we encountered several important questions that were not built into existing CEA framework. Assessing the suitability of a synthetic biology-based device extends far beyond practical environmental risk assessment, into regulatory and economic concerns. The Presidential Commission for the Study of Bioethical Issues (PCSBI) released a report in December 2010 regarding important considerations for the ethics of synthetic biology projects, not all of which are encompassed by the CEA framework. In addition, as we approach field-deployability, the economics of the device become essential to assessing its viability as a solution to real-world water monitoring needs. These ideas are further explored in the remainder of this section.<br />
</div><br />
<div class="twelve columns"><br />
<h3>References</h3><br />
Dana, G. V., Kuiken, T., Rejeski, D., &amp; Snow, A. A. (2012). Synthetic biology: Four steps to avoid a synthetic-biology disaster. <i>Nature, 483.</i> doi:10.1038/483029a</br><br />
<br>Powers, C. M., Dana, G., Gillespie, P., Gwinn, M. R., Hendren, C. O., Long, T. C., Wang, A., Davis, J. M. (2012). Comprehensive Environmental Assessment: A Meta-Assessment Approach. <i>Environ. Sci. Technol., 46,</i> 9202−9208. http://dx.doi.org/10.1021/es3023072</br><br />
<br>Synthetic Biology Project. (2011, July 28). Comprehensive Environmental Assessment and Its Application to Synthetic Biology Applications. Retrieved from http://www.synbioproject.org/events/archive/cea/</br><br />
<br />
</div><br />
</div><br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_hprac').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/hprac/bioethicsTeam:Cornell/project/hprac/bioethics2012-10-27T03:41:21Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6 style="margin-top:32px;">Human Practices</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/CEA">Comprehensive Environmental Assessment</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/bioethics">Bioethics</a><br />
</li> <br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/oil_sands">Oil Sands</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/cayuga_watershed">Cayuga Watershed</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/safety">Safety</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row" id="ugd-members"><br />
<div class="twelve columns"><br />
<h2 class="centered">Bioethics</h2><br />
</div><br />
</div><br />
<div class="row last-ele"><br />
<div class="twelve columns"><br />
<br>Comprehensive Environmental Assessment was extremely helpful in providing guidance for research priorities; however, we thought it necessary to address ethical concerns associated with our project. As such, we designed our project in accordance with the ethical principles identified by the Presidential Commission for the Study of Bioethical Issues (2010). Our primary motive is public beneficence: to improve global public health by monitoring the safety of drinking water. We have also demonstrated responsible stewardship by considering the environmental implications of our project; the ecological impact of placing our genetically modified strain in water would be minimal because our filtration system will not allow bacteria to escape. <i>S. oneidensis</i> MR-1 is native to North America and poses no known threat to biodiversity or humans; however, before field testing, we would engineer our strains to be auxotrophic. We have spoken directly with Environment Canada representatives who confirmed our recombinant <i>S. oneidensis</i>-based biosensor is easily approvable for field deployment.</br><br />
<br />
<br>In addition, the electrochemical biosensor is an intellectually responsible pursuit: our project cannot foreseeably be used to cause people harm. In the spirit of democratic deliberation, the human practices component of our team seeks to account for others’ ethical concerns about our project. We have begun consulting with local citizens as well as public authorities in order to fully understand the possible impacts of our project. Our proposed system would be easy, cost-effective, and potentially usable on a global scale, demonstrating justice and fairness in its intended implementation. Additionally, the modularity of our biosensing platform allows it to be adapted to the needs of different communities, in order to best serve global populations and environments.</br><br />
</div><br />
<div class="twelve columns"><br />
<h6>References</h6><br />
Presidential Commission for the Study of Bioethical Issues. (2010). New directions: The ethics of synthetic biology and emerging technologies. Washington, D.C.: Presidential Commission for the Study of Bioethical Issues.<br />
</div><br />
</div><br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_hprac').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/hprac/cayuga_watershedTeam:Cornell/project/hprac/cayuga watershed2012-10-27T03:37:59Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6 style="margin-top:32px;">Human Practices</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/CEA">Comprehensive Environmental Assessment</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/bioethics">Bioethics</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/oil_sands">Oil Sands</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/cayuga_watershed">Cayuga Watershed</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/safety">Safety</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h2 class="centered">Application: Cayuga Watershed</h2><br />
</div><br />
</div><br />
<div class="row last-ele"><br />
<div class="twelve columns"><br />
<br><br />
We also focused on potential applications of our device in local areas. While upstate New York is not affected by oil sands toxicity, local groups are highly concerned with the possible implementation of hydrofracking in New York state, and any subsequent adverse effects. </br><br />
<br /><br />
In order to get a sense for the water monitoring needs in Ithaca, we spoke to a representative of the Community Science Institute, a volunteer-driven organization seeking to establish baselines for water quality in the Cayuga watershed. They are limited by the training necessary to operate laboratory equipment for chemical detection methods, manpower, viable sampling locations, and sampling frequency. They are also seriously limited by cost; it can cost $20 to detect one toxin in one discrete sample. A system such as ours, that only needs servicing twice a year, doesn’t require any special training for deployment of data collection, and is fairly cheap to implement, would be ideal for resource-limited situations where water quality databases are few and far between.<br />
<br /><br />
<br /><br />
In addition, we spoke to Bill Foster, a limnologist who conducts independent sampling of Cayuga Lake, about our device. He emphasized the importance of continuous sampling, because his own discrete sampling efforts were significantly affected by temporal fluctuations that made it hard to tease out long-term trends. He described the lake as a “bathtub,” in which fluctuations in water levels can affect contaminant levels at different depths. Our system addresses this with continuous monitoring, which can be used to distinguish daily and seasonal fluctuations from long-term trends.<br />
<br /><br />
<br /><br />
In the coming weeks, we will be meeting with representatives of the Coalition to Protect New York to get a better sense for the monitoring needs associated with hydrofracking, as well as concerns regarding the use of genetically modified strains in environmental applications. We have also submitted an abstract to the New York Water Environment Association’s Annual Conference, and hope to send a representative to this meeting to get feedback from a wide variety of water quality experts.<br />
<br><br><br />
Our project was designed to be modular; it is easily adaptable to sensing a wide variety of toxins and is housed in a rugged physical device that could be made to function in different environments and areas of the world. We believe that our project, while immediately applicable to areas affected by oil and gas extraction, is moreover a powerful platform for continuous water monitoring in a number of other situations, which we hope to explore in the future.<br />
</div><br />
</div><br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_hprac').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/hpracTeam:Cornell/project/hprac2012-10-27T03:32:19Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6 style="margin-top:32px;">Human Practices</h6><br />
</li><br />
<li class="divider"></li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/CEA">Comprehensive Environmental Assessment</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/bioethics">Bioethics</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/oil_sands">Oil Sands</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/cayuga_watershed">Cayuga Watershed</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/safety">Safety</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row" id="ugd-members"><br />
<div class="twelve columns"><br />
<h2 class="centered">Human Practices Overview</h2><br />
</div><br />
</div><br />
<div class="row last-ele"><br />
<br />
<h3>Beyond the Bench</h3><br />
This year, we set out with three main goals in mind:<br />
<ul><br />
<li>Assess the environmental risks associated with our project,</li><br />
<li>evaluate the applicability of our device to a variety of applications, and</li><br />
<li>educate the public about synthetic biology and how it pertains to everyday life.</li><br />
</ul><br />
To these ends, we adopted a novel approach to risk assessment and discussed our project in great detail with the Oil Sands Leadership Initiative, local water monitoring groups, environmental groups, scientific researchers and more. Please click the links to the left to explore!<br />
</div><br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_hprac').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/hpracTeam:Cornell/project/hprac2012-10-27T03:31:45Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6 style="margin-top:32px;">Human Practices</h6><br />
</li><br />
<li class="divider"></li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/CEA">Comprehensive Environmental Assessment</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/bioethics">Bioethics</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/oil_sands">Oil Sands</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/cayuga_watershed">Cayuga Watershed</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/safety">Safety</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row" id="ugd-members"><br />
<div class="twelve columns"><br />
<h2 class="centered">Human Practices Overview</h2><br />
</div><br />
</div><br />
<div class="row last-ele"><br />
<br />
<h3>Beyond the Bench</h3><br />
This year, we set out with three main goals in mind:<br />
<ul><br />
<li>Assess the environmental risks associated with our project,</li><br />
<li>evaluate the applicability of our device to a variety of applications, and</li><br />
<li>educate the public about synthetic biology and how it pertains to everyday life.</li><br />
</ul><br />
To these ends, we adopted a novel approach to risk assessment and discussed our project in great detail with the Oil Sands Leadership Initiative, local water monitoring groups, environmental groups, scientific researchers and more. <br />
</div><br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_hprac').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/hpracTeam:Cornell/project/hprac2012-10-27T03:30:50Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6 style="margin-top:32px;">Human Practices</h6><br />
</li><br />
<li class="divider"></li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/CEA">Comprehensive Environmental Assessment</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/bioethics">Bioethics</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/oil_sands">Oil Sands</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/cayuga_watershed">Cayuga Watershed</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/safety">Safety</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row" id="ugd-members"><br />
<div class="twelve columns"><br />
<h2 class="centered">Human Practices Overview</h2><br />
</div><br />
</div><br />
<div class="row last-ele"><br />
<br />
<br><br><br />
This year, we set out with three main goals in mind:<br />
<ul><br />
<li>Assess the environmental risks associated with our project,</li><br />
<li>evaluate the applicability of our device to a variety of applications, and</li><br />
<li>educate the public about synthetic biology and how it pertains to everyday life.</li><br />
</ul><br />
To these ends, we adopted a novel approach to risk assessment and discussed our project in great detail with the Oil Sands Leadership Initiative, local water monitoring groups, environmental groups, scientific researchers and more. <br />
</div><br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_hprac').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/hpracTeam:Cornell/project/hprac2012-10-27T03:30:22Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6 style="margin-top:32px;">Human Practices</h6><br />
</li><br />
<li class="divider"></li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/CEA">Comprehensive Environmental Assessment</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/bioethics">Bioethics</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/oil_sands">Oil Sands</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/cayuga_watershed">Cayuga Watershed</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/safety">Safety</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row" id="ugd-members"><br />
<div class="twelve columns"><br />
<h2 class="centered">Human Practices Overview</h2><br />
</div><br />
</div><br />
<div class="row last-ele"><br />
<br />
<br />
This year, we set out with three main goals in mind:<br />
<ul><br />
<li>Assess the environmental risks associated with our project,</li><br />
<li>evaluate the applicability of our device to a variety of applications, and</li><br />
<li>educate the public about synthetic biology and how it pertains to everyday life.</li><br />
</ul><br />
To these ends, we adopted a novel approach to risk assessment and discussed our project in great detail with the Oil Sands Leadership Initiative, local water monitoring groups, environmental groups, scientific researchers and more. <br />
</div><br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_hprac').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/hpracTeam:Cornell/project/hprac2012-10-27T03:29:47Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6 style="margin-top:32px;">Human Practices</h6><br />
</li><br />
<li class="divider"></li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/CEA">Comprehensive Environmental Assessment</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/bioethics">Bioethics</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/oil_sands">Oil Sands</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/cayuga_watershed">Cayuga Watershed</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/safety">Safety</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row" id="ugd-members"><br />
<div class="twelve columns"><br />
<h2 class="centered">Human Practices Overview</h2><br />
</div><br />
</div><br />
<div class="row last-ele"><br />
This year, we set out with three main goals in mind:<br />
<ul><br />
<li>Assess the environmental risks associated with our project,</li><br />
<li>evaluate the applicability of our device to a variety of applications, and</li><br />
<li>educate the public about synthetic biology and how it pertains to everyday life.</li><br />
</ul><br />
To these ends, we adopted a novel approach to risk assessment and discussed our project in great detail with the Oil Sands Leadership Initiative, local water monitoring groups, environmental groups, scientific researchers and more. <br />
</div><br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_hprac').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/wetlab/results/currentresponseTeam:Cornell/project/wetlab/results/currentresponse2012-10-27T03:15:00Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6>Wet Lab</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly">DNA Assembly</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/arsenic">Arsenic Reporter</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/naphthalene">Naphthalene Reporter</a><br />
</li><br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results">Testing &amp; Results</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/biobricks">BioBricks</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/transcription">Transcriptional Characterization</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/currentresponse">Current Response</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/protein">MtrB Protein Expression</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/nah_operon"><i>nah</i> Operon Expression</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/artificial_river_media">Artificial River Media</a><br />
</li><br />
<br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/future_work">Future Work</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/animation">Animation</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row" id="ugd-members"><br />
<div class="twelve columns"><br />
<h2 class="centered">Current Response</h2><br />
</div><br />
</div><br />
<div class="row" id="item1"><br />
<div class="nine columns"><br />
<h3>Overview of Characterization in Bioelectrochemical Systems</h3><br />
As described in the <a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a> section, <i>S. oneidensis</i> MR-1 is capable of shuttling electrons through the Mtr pathway to reduce extracellular metals because of the negative free energy change associated with these redox reactions. Thus, to encourage <i>Shewanella</i> to transfer electrons to an electrode, we poise the potential of an electrode in a three electrode system, controlled by a potentiostat, so that electron transfer is energetically favorable to the organism. In short, a potentiostat works by setting the potential of a working electrode (WE) with respect to a Ag/AgCl reference electrode (RE) by injecting current through a counter electrode (CE). (To read about how we made our own field-deployable potentiostats, read our <a href="https://2012.igem.org/Team:Cornell/project/drylab/components">drylab components</a> page.) These electrodes can be seen in the schematic representation of our single-compartment bioelectrochemical reactors shown to the right.<br />
<br><br><br />
Because we are interested in continuous monitoring of contaminants, we characterized the current response to analyte of all engineered strains by operating reactors in continuous flow setup such that steady-state current output could be reached. In general, all experiments were performed in bench-scale reactors provided by the Angenent Lab&#8212;with a constant fluid volume of 120 mL and a consistent electrode-surface area. All characterization experiments began at an analyte concentration of zero, while media was fed to the system at a constant rate of 18 mL/min. Once reached steady state was reached&#8212;for a period of greater than three system retention times&#8212;the analyte concentration in the feed tank was increased so that a new steady state&#8212;corresponding to the higher analyte concentration&#8212;could be reached. By iteratively repeating this process, we were able to characterize the current response of our reporter strains to either arsenic-containing compounds or naphthalene, as appropriate. <br />
<br><br><br />
After initial characterization of our arsenic- and naphthalene-sensing strains, <b>we have shown that our arsenic sensor works as expected</b>, producing higher levels of steady-state current in response to arsenite salts. However, more trials are needed in order to construct a reliable calibration curve.<br />
<br />
<br />
<br />
</div><br />
<br />
<div class="three columns" style="text-align:center;"><br />
<a href="https://static.igem.org/mediawiki/2012/b/b5/Reactor_SCH.png" rel="lightbox"><br />
<img src="https://static.igem.org/mediawiki/2012/1/1d/Reactor_SCH_250.png">Click to Enlarge</a><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<div class="row" id="item1"><br />
<div class="three columns" style="text-align:center;"><br />
<img style="margin-bottom:5px;" src="<br />
https://static.igem.org/mediawiki/2012/9/98/Cornell_pstat.jpg"><br />
Potentiostats <br />
</div><br />
<br />
<br />
<br />
<br />
<div class="nine columns"><br />
<h3>First Lessons Learned: Control Reactors</h3><br />
<br />
<br />
<br />
In order to enhance the field-deployability of our final device, we initially decided to feed our reactors with LB, since a very concentrated LB source fed at a low flow rate could sustain our field reactors for extended periods of time without taking up much physical space. However, upon setting up control reactors&#8212;both in batch and continuous flow operation&#8212;we discovered that wild type <i>S. oneidensis</i> MR-1 produced significantly less current when fed with LB than M4&#8212;a commonly used media for <i>Shewanella</i>-inoculated bioelectrochemical systems, as illustrated for batch operation by the figure below.<br><br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/1/1c/LBvM4_small.png"><br />
<h6> Fig. 1. Current production over time is plotted for batch reactors inoculated with wildtype <i>S. oneidensis</i> MR-1 growing on M4 media (blue) and LB media (green). Maximum current production from M4-fed <i>Shewanella</i> is much greater than that from LB-fed.</h6><br><br><br />
<br />
When operated in a continuous flow setup, we observed the steady state current production from an LB fed reactor to be within the background noise of the setupM4&#8212;<i>i.e.</i>, an un-incoluated reactor was indistinguishable from a reactor inoculated with wildtype <i>S. oneidensis</i> MR-1. Because of this, we chose to use M4 media for all future characterization experiments, since optimization of signal-to-noise ratio is essential in the development of any sensing system.<br />
<br />
</div><br />
</div><br />
<br />
<div class="row" id="item3"><br />
<br />
<div class="nine columns"><br />
<h3>Arsenic Sensing</h3><br />
We chose to initially characterize our arsenic-sensing <i>Shewanella</i> by dosing with sodium arsenite, since the organism's native arsenate reductase activity would introduce a confounding variable in part characterization. After this initial characterization , we have shown that current is, indeed, upregulated in response to our analyte of interest. However, we should emphasize that this data is preliminary: Because of the care we took to establish a thorough Standard Operation Procedure for the handling of arsenic, we only had time for a single characterization trial, shown below in Fig. 4. Additionally, we plan on characterizing in response to both arsenate salts (to determine whether arsenate reductase activity is indeed confounding) and antimonite (to estimate the likelyhood of false positives).<br />
<br />
<br />
<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/0/04/ARS_new2.png"><br />
<h6> Fig. 3. Current production over time is plotted for continuous flow reactors inoculated with our arsenic-sensing strain (JG700+p14k). Transient phases corresponding to arsenite concentrations of 100 &mu;M (blue) and 500 &mu;M (green)are shown. Before a potentiostat channel restart at time zero, basal current was recorded at approximately 4 &mu;A. We report induced current in percent of this basal response. </h6><br><br><br />
<br />
It is also important to point out that we have not normalized any data to a per-cell basis. Because we are interested in a field-deployable system that produces greater <i>absolute</i> current in response to analyte, we did not record either optical density or colony forming units over time. However, while not a rigorous, we have observed a visible decrease in biomass for increasing concentrations of arsenite&#8212;as would be expected. Therefore, it is likely that an a per-cell basis, our arsenic sensing strains produce much more current that Fig. 4 would suggest. We plan on repeating characterization experiments in response to arsenite&#8212;both to generate a reliable transfer function relating current to arsenite concentration and to better understand the relationship between specific growth rate and MtrB production as a function of analyte concentration.<br />
</div><br />
<br />
<div class="three columns"><br />
<img src="<br />
https://static.igem.org/mediawiki/2012/b/be/Cornell_reactor_real_square.jpg"></div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<div class="row" id="item4"><br />
<div class="three columns"><br />
<img src="https://static.igem.org/mediawiki/2012/a/aa/Cornell_inject.jpg"><br />
</div><br />
<div class="nine columns"><br />
<h3>Naphthalene &amp; Salicylate Sensing</h3><br />
<br />
Because we did not have time to confirm successful conjugation of our naphthalene-degrading plasmid into <i>Shewanella</i>, we focused our efforts on observing the response to salicylate of our naphthalene-sensing precursor strain (JG700 + pSAL). This strain contains the molecular machinery requisite to respond to salicylate, which&#8212;in our final system&#8212;is a metabolite produced as a result of naphthalene catabolism via the enzymes encoded by the <i>nah</i> operon. (To read more about our naphthalene sensor design, see our <a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/salicylate">DNA Assembly</a> page.) <br><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/6/60/SAME_I_invis_small.png"><br />
<h6> Fig. 3. Current production over time is plotted for continuous flow reactors inoculated with our salicylate reporter strain (blue) and wildtype <i>S. oneidensis</i> MR-1 (green). Both duration of transient period and value of saturating current are approximately equal for reactors corresponding to both strains. </h6><br><br><br />
<br />
<br />
<br />
As seen above, our un-induced salicylate sensing strain produces approximately the same steady state current as wildtype <i>Shewanella</i>, suggesting that leaky expression of MtrB from uninduced promoter activity is enough to saturate current output. This can be understood in terms of the complete Mtr pathway, since metal-reduction activity requires a functional complex of MtrA, MtrB, and MtrC&#8212;as described in the <a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a> section page. Since there is only so much MtrC and MtrA in the cell, increasing MtrB activity saturates as free MtrC and MtrA is sequestered and localized. <br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/8/80/Point3_invis_small.png"><br />
<h6> Fig. 4. Current production over time is plotted for continuous flow reactors inoculated with our salicylate reporter strain (blue) and wildtype <i>S. oneidensis</i> MR-1 (green). Both duration of transient period and value of saturating current are approximately equal for reactors corresponding to both strains. </h6><br><br><br />
<br />
<br />
<br />
</div><br />
</div><br />
<div class="row last-ele" id="item5"><br />
<div class="twelve columns"><br />
<h3>Ferrozine Assays</h3><br />
We are also in the process of conducting ferrozine assays to demonstrate the functionality of our reporter strains at the system level. This assay quantifies the reduction of iron (III) to iron (II), an energetically favorable process for <i>Shewanella</i> expressing the Mtr pathway. We will test each of our reporter strains at various analyte concentrations, incubated with iron(III) in an anaerobic environment for extended periods of time. Increased reduction of iron (III) is a proxy for increased current production in bioreactors, and can thus be used as a reliable indicator that our sensing strains are functioning at the system level.<br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/lightbox?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_wetlab').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/wetlab/results/currentresponseTeam:Cornell/project/wetlab/results/currentresponse2012-10-27T03:12:55Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6>Wet Lab</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly">DNA Assembly</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/arsenic">Arsenic Reporter</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/naphthalene">Naphthalene Reporter</a><br />
</li><br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results">Testing &amp; Results</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/biobricks">BioBricks</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/transcription">Transcriptional Characterization</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/currentresponse">Current Response</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/protein">MtrB Protein Expression</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/nah_operon"><i>nah</i> Operon Expression</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/artificial_river_media">Artificial River Media</a><br />
</li><br />
<br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/future_work">Future Work</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/animation">Animation</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row" id="ugd-members"><br />
<div class="twelve columns"><br />
<h2 class="centered">Current Response</h2><br />
</div><br />
</div><br />
<div class="row" id="item1"><br />
<div class="nine columns"><br />
<h3>Overview of Characterization in Bioelectrochemical Systems</h3><br />
As described in the <a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a> section, <i>S. oneidensis</i> MR-1 is capable of shuttling electrons through the Mtr pathway to reduce extracellular metals because of the negative free energy change associated with these redox reactions. Thus, to encourage <i>Shewanella</i> to transfer electrons to an electrode, we poise the potential of an electrode in a three electrode system, controlled by a potentiostat, so that electron transfer is energetically favorable to the organism. In short, a potentiostat works by setting the potential of a working electrode (WE) with respect to a Ag/AgCl reference electrode (RE) by injecting current through a counter electrode (CE). (To read about how we made our own field-deployable potentiostats, read our <a href="https://2012.igem.org/Team:Cornell/project/drylab/components">drylab components</a> page.) These electrodes can be seen in the schematic representation of our single-compartment bioelectrochemical reactors shown to the right.<br />
<br><br><br />
Because we are interested in continuous monitoring of contaminants, we characterized the current response to analyte of all engineered strains by operating reactors in continuous flow setup such that steady-state current output could be reached. In general, all experiments were performed in bench-scale reactors provided by the Angenent Lab&#8212;with a constant fluid volume of 120 mL and a consistent electrode-surface area. All characterization experiments began at an analyte concentration of zero, while media was fed to the system at a constant rate of 18 mL/min. Once reached steady state was reached&#8212;for a period of greater than three system retention times&#8212;the analyte concentration in the feed tank was increased so that a new steady state&#8212;corresponding to the higher analyte concentration&#8212;could be reached. By iteratively repeating this process, we were able to characterize the current response of our reporter strains to either arsenic-containing compounds or naphthalene, as appropriate. <br />
<br><br><br />
After initial characterization of our arsenic- and naphthalene-sensing strains, <b>we have shown that our arsenic sensor works as expected</b>, producing higher levels of steady-state current in response to arsenite salts. However, more trials are needed in order to construct a reliable calibration curve.<br />
<br />
<br />
<br />
</div><br />
<br />
<div class="three columns" style="text-align:center;"><br />
<a href="https://static.igem.org/mediawiki/2012/b/b5/Reactor_SCH.png" rel="lightbox"><br />
<img src="https://static.igem.org/mediawiki/2012/1/1d/Reactor_SCH_250.png">Click to Enlarge</a><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<div class="row" id="item1"><br />
<div class="three columns" style="text-align:center;"><br />
<img style="margin-bottom:5px;" src="<br />
https://static.igem.org/mediawiki/2012/9/98/Cornell_pstat.jpg"><br />
Potentiostats <br />
</div><br />
<br />
<br />
<br />
<br />
<div class="nine columns"><br />
<h3>First Lessons Learned: Control Reactors</h3><br />
<br />
<br />
<br />
In order to enhance the field-deployability of our final device, we initially decided to feed our reactors with LB, since a very concentrated LB source fed at a low flow rate could sustain our field reactors for extended periods of time without taking up much physical space. However, upon setting up control reactors&#8212;both in batch and continuous flow operation&#8212;we discovered that wild type <i>S. oneidensis</i> MR-1 produced significantly less current when fed with LB than M4&#8212;a commonly used media for <i>Shewanella</i>-inoculated bioelectrochemical systems, as illustrated for batch operation by the figure below.<br><br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/1/1c/LBvM4_small.png"><br />
<h6> Fig. 1. Current production over time is plotted for batch reactors inoculated with wildtype <i>S. oneidensis</i> MR-1 growing on M4 media (blue) and LB media (green). Maximum current production from M4-fed <i>Shewanella</i> is much greater than that from LB-fed.</h6><br><br><br />
<br />
When operated in a continuous flow setup, we observed the steady state current production from an LB fed reactor to be within the background noise of the setupM4&#8212;<i>i.e.</i>, an un-incoluated reactor was indistinguishable from a reactor inoculated with wildtype <i>S. oneidensis</i> MR-1. Because of this, we chose to use M4 media for all future characterization experiments, since optimization of signal-to-noise ratio is essential in the development of any sensing system.<br />
<br />
</div><br />
</div><br />
<br />
<div class="row" id="item3"><br />
<br />
<div class="nine columns"><br />
<h3>Arsenic Sensing</h3><br />
We chose to initially characterize our arsenic-sensing <i>Shewanella</i> by dosing with sodium arsenite, since the organism's native arsenate reductase activity would introduce a confounding variable in part characterization. After this initial characterization , we have shown that current is, indeed, upregulated in response to our analyte of interest. However, we should emphasize that this data is preliminary: Because of the care we took to establish a thorough Standard Operation Procedure for the handling of arsenic, we only had time for a single characterization trial, shown below in Fig. 4. Additionally, we plan on characterizing in response to both arsenate salts (to determine whether arsenate reductase activity is indeed confounding) and antimonite (to estimate the likelyhood of false positives).<br />
<br />
<br />
<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/0/04/ARS_new2.png"><br />
<h6> Fig. 3. Current production over time is plotted for continuous flow reactors inoculated with our arsenic-sensing strain (JG700+p14k). Transient phases corresponding to arsenite concentrations of 100 &mu;M (blue) and 500 &mu;M (green)are shown. Before a potentiostat channel restart at time zero, basal current was recorded at approximately 4 &mu;A. We report induced current in percent of this basal response. </h6><br><br><br />
<br />
It is also important to point out that we have not normalized any data to a per-cell basis. Because we are interested in a field-deployable system that produces greater <i>absolute</i> current in response to analyte, we did not record either optical density or colony forming units over time. However, while not a rigorous, we have observed a visible decrease in biomass for increasing concentrations of arsenite&#8212;as would be expected. Therefore, it is likely that an a per-cell basis, our arsenic sensing strains produce much more current that Fig. 4 would suggest. We plan on repeating characterization experiments in response to arsenite&#8212;both to generate a reliable transfer function relating current to arsenite concentration and to better understand the relationship between specific growth rate and MtrB production as a function of analyte concentration.<br />
</div><br />
<br />
<div class="three columns"><br />
<img src="<br />
https://static.igem.org/mediawiki/2012/b/be/Cornell_reactor_real_square.jpg"></div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<div class="row" id="item4"><br />
<div class="three columns"><br />
<img src="https://static.igem.org/mediawiki/2012/a/aa/Cornell_inject.jpg"><br />
</div><br />
<div class="nine columns"><br />
<h3>Naphthalene &amp; Salicylate Sensing</h3><br />
<br />
Because we did not have time to confirm successful conjugation of our naphthalene-degrading plasmid into <i>Shewanella</i>, we focused our efforts on observing the response to salicylate of our naphthalene-sensing precursor strain (JG700 + pSAL). This strain contains the molecular machinery requisite to respond to salicylate, which&#8212;in our final system&#8212;is a metabolite produced as a result of naphthalene catabolism via the enzymes encoded by the <i>nah</i> operon. (To read more about our naphthalene sensor design, see our <a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/salicylate">DNA Assembly</a> page.) <br><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/6/60/SAME_I_invis_small.png"><br />
<h6> Fig. 3. Current production over time is plotted for continuous flow reactors inoculated with our salicylate reporter strain (blue) and wildtype <i>S. oneidensis</i> MR-1 (green). Both duration of transient period and value of saturating current are approximately equal for reactors corresponding to both strains. </h6><br><br><br />
<br />
<br />
<br />
As seen above, our un-induced salicylate sensing strain produces approximately the same steady state current as wildtype <i>Shewanella</i>, suggesting that leaky expression of MtrB from uninduced promoter activity is enough to saturate current output. This can be understood in terms of the complete Mtr pathway, since metal-reduction activity requires a functional complex of MtrA, MtrB, and MtrC&#8212;as described in the <a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a> section page. Since there is only so much MtrC and MtrA in the cell, increasing MtrB activity saturates as free MtrC and MtrA is sequestered and localized. <br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/8/80/Point3_invis_small.png"><br />
<h6> Fig. 4. Current production over time is plotted for continuous flow reactors inoculated with our salicylate reporter strain (blue) and wildtype <i>S. oneidensis</i> MR-1 (green). Both duration of transient period and value of saturating current are approximately equal for reactors corresponding to both strains. </h6><br><br><br />
<br />
<br />
<br />
</div><br />
</div><br />
<div class="row last-ele" id="item5"><br />
<div class="twelve columns"><br />
<h3>Ferrozine Assays</h3><br />
We are also in the process of conducting ferrozine assays to demonstrate the functionality of our reporter strains at the system level. This assay quantifies the reduction of iron (III) to iron (II), an energetically favorable process for <i>Shewanella</i> expressing the Mtr pathway. We will test each of our reporter strains at various analyte concentrations, incubated with iron(III) in an anaerobic environment for extended periods of time. Increased reduction of iron (III) is a proxy for increased current production in bioreactors.<br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/lightbox?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_wetlab').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/wetlab/results/currentresponseTeam:Cornell/project/wetlab/results/currentresponse2012-10-27T03:03:26Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6>Wet Lab</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly">DNA Assembly</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/arsenic">Arsenic Reporter</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/naphthalene">Naphthalene Reporter</a><br />
</li><br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results">Testing &amp; Results</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/biobricks">BioBricks</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/transcription">Transcriptional Characterization</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/currentresponse">Current Response</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/protein">MtrB Protein Expression</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/nah_operon"><i>nah</i> Operon Expression</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/artificial_river_media">Artificial River Media</a><br />
</li><br />
<br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/future_work">Future Work</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/animation">Animation</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row" id="ugd-members"><br />
<div class="twelve columns"><br />
<h2 class="centered">Current Response</h2><br />
</div><br />
</div><br />
<div class="row" id="item1"><br />
<div class="nine columns"><br />
<h3>Overview of Characterization in Bioelectrochemical Systems</h3><br />
As described in the <a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a> section, <i>S. oneidensis</i> MR-1 is capable of shuttling electrons through the Mtr pathway to reduce extracellular metals because of the negative free energy change associated with these redox reactions. Thus, to encourage <i>Shewanella</i> to transfer electrons to an electrode, we poise the potential of an electrode in a three electrode system, controlled by a potentiostat, so that electron transfer is energetically favorable to the organism. In short, a potentiostat works by setting the potential of a working electrode (WE) with respect to a Ag/AgCl reference electrode (RE) by injecting current through a counter electrode (CE). (To read about how we made our own field-deployable potentiostats, read our <a href="https://2012.igem.org/Team:Cornell/project/drylab/components">drylab components</a> page.) These electrodes can be seen in the schematic representation of our single-compartment bioelectrochemical reactors shown to the right.<br />
<br><br><br />
Because we are interested in continuous monitoring of contaminants, we characterized the current response to analyte of all engineered strains by operating reactors in continuous flow setup such that steady-state current output could be reached. In general, all experiments were performed in bench-scale reactors provided by the Angenent Lab&#8212;with a constant fluid volume of 120 mL and a consistent electrode-surface area. All characterization experiments began at an analyte concentration of zero, while media was fed to the system at a constant rate of 18 mL/min. Once reached steady state was reached&#8212;for a period of greater than three system retention times&#8212;the analyte concentration in the feed tank was increased so that a new steady state&#8212;corresponding to the higher analyte concentration&#8212;could be reached. By iteratively repeating this process, we were able to characterize the current response of our reporter strains to either arsenic-containing compounds or naphthalene, as appropriate. <br />
<br><br><br />
After initial characterization of our arsenic- and naphthalene-sensing strains, <b>we have shown that our arsenic sensor works as expected</b>, producing higher levels of steady-state current in response to arsenite salts. However, more trials are needed in order to construct a reliable calibration curve.<br />
<br />
<br />
<br />
</div><br />
<br />
<div class="three columns" style="text-align:center;"><br />
<a href="https://static.igem.org/mediawiki/2012/b/b5/Reactor_SCH.png" rel="lightbox"><br />
<img src="https://static.igem.org/mediawiki/2012/1/1d/Reactor_SCH_250.png">Click to Enlarge</a><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<div class="row" id="item1"><br />
<div class="three columns" style="text-align:center;"><br />
<img style="margin-bottom:5px;" src="<br />
https://static.igem.org/mediawiki/2012/9/98/Cornell_pstat.jpg"><br />
Potentiostats <br />
</div><br />
<br />
<br />
<br />
<br />
<div class="nine columns"><br />
<h3>First Lessons Learned: Control Reactors</h3><br />
<br />
<br />
<br />
In order to enhance the field-deployability of our final device, we initially decided to feed our reactors with LB, since a very concentrated LB source fed at a low flow rate could sustain our field reactors for extended periods of time without taking up much physical space. However, upon setting up control reactors&#8212;both in batch and continuous flow operation&#8212;we discovered that wild type <i>S. oneidensis</i> MR-1 produced significantly less current when fed with LB than M4&#8212;a commonly used media for <i>Shewanella</i>-inoculated bioelectrochemical systems, as illustrated for batch operation by the figure below.<br><br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/1/1c/LBvM4_small.png"><br />
<h6> Fig. 1. Current production over time is plotted for batch reactors inoculated with wildtype <i>S. oneidensis</i> MR-1 growing on M4 media (blue) and LB media (green). Maximum current production from M4-fed <i>Shewanella</i> is much greater than that from LB-fed.</h6><br><br><br />
<br />
When operated in a continuous flow setup, we observed the steady state current production from an LB fed reactor to be within the background noise of the setupM4&#8212;<i>i.e.</i>, an un-incoluated reactor was indistinguishable from a reactor inoculated with wildtype <i>S. oneidensis</i> MR-1. Because of this, we chose to use M4 media for all future characterization experiments, since optimization of signal-to-noise ratio is essential in the development of any sensing system.<br />
<br />
</div><br />
</div><br />
<br />
<div class="row" id="item3"><br />
<br />
<div class="nine columns"><br />
<h3>Arsenic Sensing</h3><br />
We chose to initially characterize our arsenic-sensing <i>Shewanella</i> by dosing with sodium arsenite, since the organism's native arsenate reductase activity would introduce a confounding variable in part characterization. After this initial characterization , we have shown that current is, indeed, upregulated in response to our analyte of interest. However, we should emphasize that this data is preliminary: Because of the care we took to establish a thorough Standard Operation Procedure for the handling of arsenic, we only had time for a single characterization trial, shown below in Fig. 4. Additionally, we plan on characterizing in response to both arsenate salts (to determine whether arsenate reductase activity is indeed confounding) and antimonite (to estimate the likelyhood of false positives).<br />
<br />
<br />
<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/0/04/ARS_new2.png"><br />
<h6> Fig. 3. Current production over time is plotted for continuous flow reactors inoculated with our arsenic-sensing strain (JG700+p14k). Transient phases corresponding to arsenite concentrations of 100 &mu;M (blue) and 500 &mu;M (green)are shown. Before a potentiostat channel restart at time zero, basal current was recorded at approximately 4 &mu;A. We report induced current in percent of this basal response. </h6><br><br><br />
<br />
It is also important to point out that we have not normalized any data to a per-cell basis. Because we are interested in a field-deployable system that produces greater <i>absolute</i> current in response to analyte, we did not record either optical density or colony forming units over time. However, while not a rigorous, we have observed a visible decrease in biomass for increasing concentrations of arsenite&#8212;as would be expected. Therefore, it is likely that an a per-cell basis, our arsenic sensing strains produce much more current that Fig. 4 would suggest. We plan on repeating characterization experiments in response to arsenite&#8212;both to generate a reliable transfer function relating current to arsenite concentration and to better understand the relationship between specific growth rate and MtrB production as a function of analyte concentration.<br />
</div><br />
<br />
<div class="three columns"><br />
<img src="<br />
https://static.igem.org/mediawiki/2012/b/be/Cornell_reactor_real_square.jpg"></div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<div class="row" id="item4"><br />
<div class="three columns"><br />
<img src="https://static.igem.org/mediawiki/2012/a/aa/Cornell_inject.jpg"><br />
</div><br />
<div class="nine columns"><br />
<h3>Naphthalene &amp; Salicylate Sensing</h3><br />
<br />
Because we did not have time to confirm successful conjugation of our naphthalene-degrading plasmid into <i>Shewanella</i>, we focused our efforts on observing the response to salicylate of our naphthalene-sensing precursor strain (JG700 + pSAL). This strain contains the molecular machinery requisite to respond to salicylate, which&#8212;in our final system&#8212;is a metabolite produced as a result of naphthalene catabolism via the enzymes encoded by the <i>nah</i> operon. (To read more about our naphthalene sensor design, see our <a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/salicylate">DNA Assembly</a> page.) <br><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/6/60/SAME_I_invis_small.png"><br />
<h6> Fig. 3. Current production over time is plotted for continuous flow reactors inoculated with our salicylate reporter strain (blue) and wildtype <i>S. oneidensis</i> MR-1 (green). Both duration of transient period and value of saturating current are approximately equal for reactors corresponding to both strains. </h6><br><br><br />
<br />
<br />
<br />
As seen above, our un-induced salicylate sensing strain produces approximately the same steady state current as wildtype <i>Shewanella</i>, suggesting that leaky expression of MtrB from uninduced promoter activity is enough to saturate current output. This can be understood in terms of the complete Mtr pathway, since metal-reduction activity requires a functional complex of MtrA, MtrB, and MtrC&#8212;as described in the <a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a> section page. Since there is only so much MtrC and MtrA in the cell, increasing MtrB activity saturates as free MtrC and MtrA is sequestered and localized. <br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/8/80/Point3_invis_small.png"><br />
<h6> Fig. 4. Current production over time is plotted for continuous flow reactors inoculated with our salicylate reporter strain (blue) and wildtype <i>S. oneidensis</i> MR-1 (green). Both duration of transient period and value of saturating current are approximately equal for reactors corresponding to both strains. </h6><br><br><br />
<br />
<br />
<br />
</div><br />
</div><br />
<div class="row last-ele" id="item5"><br />
<div class="nine columns"><br />
<h3>Ferrozine Assays</h3><br />
<br />
</div><br />
<div class="three columns"><br />
<img src="https://static.igem.org/mediawiki/2012/a/aa/Cornell_inject.jpg"><br />
</div><br />
<br />
<br />
</div><br />
<br />
<br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/lightbox?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_wetlab').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/wetlab/results/currentresponseTeam:Cornell/project/wetlab/results/currentresponse2012-10-27T03:02:31Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6>Wet Lab</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly">DNA Assembly</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/arsenic">Arsenic Reporter</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/naphthalene">Naphthalene Reporter</a><br />
</li><br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results">Testing &amp; Results</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/biobricks">BioBricks</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/transcription">Transcriptional Characterization</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/currentresponse">Current Response</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/protein">MtrB Protein Expression</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/nah_operon"><i>nah</i> Operon Expression</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/artificial_river_media">Artificial River Media</a><br />
</li><br />
<br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/future_work">Future Work</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/animation">Animation</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row" id="ugd-members"><br />
<div class="twelve columns"><br />
<h2 class="centered">Current Response</h2><br />
</div><br />
</div><br />
<div class="row" id="item1"><br />
<div class="nine columns"><br />
<h3>Overview of Characterization in Bioelectrochemical Systems</h3><br />
As described in the <a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a> section, <i>S. oneidensis</i> MR-1 is capable of shuttling electrons through the Mtr pathway to reduce extracellular metals because of the negative free energy change associated with these redox reactions. Thus, to encourage <i>Shewanella</i> to transfer electrons to an electrode, we poise the potential of an electrode in a three electrode system, controlled by a potentiostat, so that electron transfer is energetically favorable to the organism. In short, a potentiostat works by setting the potential of a working electrode (WE) with respect to a Ag/AgCl reference electrode (RE) by injecting current through a counter electrode (CE). (To read about how we made our own field-deployable potentiostats, read our <a href="https://2012.igem.org/Team:Cornell/project/drylab/components">drylab components</a> page.) These electrodes can be seen in the schematic representation of our single-compartment bioelectrochemical reactors shown to the right.<br />
<br><br><br />
Because we are interested in continuous monitoring of contaminants, we characterized the current response to analyte of all engineered strains by operating reactors in continuous flow setup such that steady-state current output could be reached. In general, all experiments were performed in bench-scale reactors provided by the Angenent Lab&#8212;with a constant fluid volume of 120 mL and a consistent electrode-surface area. All characterization experiments began at an analyte concentration of zero, while media was fed to the system at a constant rate of 18 mL/min. Once reached steady state was reached&#8212;for a period of greater than three system retention times&#8212;the analyte concentration in the feed tank was increased so that a new steady state&#8212;corresponding to the higher analyte concentration&#8212;could be reached. By iteratively repeating this process, we were able to characterize the current response of our reporter strains to either arsenic-containing compounds or naphthalene, as appropriate. <br />
<br><br><br />
After initial characterization of our arsenic- and naphthalene-sensing strains, <b>we have shown that our arsenic sensor works as expected</b>, producing higher levels of steady-state current in response to arsenite salts. However, more trials are needed in order to construct a reliable calibration curve.<br />
<br />
<br />
<br />
</div><br />
<br />
<div class="three columns" style="text-align:center;"><br />
<a href="https://static.igem.org/mediawiki/2012/b/b5/Reactor_SCH.png" rel="lightbox"><br />
<img src="https://static.igem.org/mediawiki/2012/1/1d/Reactor_SCH_250.png">Click to Enlarge</a><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<div class="row" id="item1"><br />
<div class="three columns" style="text-align:center;"><br />
<img style="margin-bottom:5px;" src="<br />
https://static.igem.org/mediawiki/2012/9/98/Cornell_pstat.jpg"><br />
Potentiostats <br />
</div><br />
<br />
<br />
<br />
<br />
<div class="nine columns"><br />
<h3>First Lessons Learned: Control Reactors</h3><br />
<br />
<br />
<br />
In order to enhance the field-deployability of our final device, we initially decided to feed our reactors with LB, since a very concentrated LB source fed at a low flow rate could sustain our field reactors for extended periods of time without taking up much physical space. However, upon setting up control reactors&#8212;both in batch and continuous flow operation&#8212;we discovered that wild type <i>S. oneidensis</i> MR-1 produced significantly less current when fed with LB than M4&#8212;a commonly used media for <i>Shewanella</i>-inoculated bioelectrochemical systems, as illustrated for batch operation by the figure below.<br><br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/1/1c/LBvM4_small.png"><br />
<h6> Fig. 1. Current production over time is plotted for batch reactors inoculated with wildtype <i>S. oneidensis</i> MR-1 growing on M4 media (blue) and LB media (green). Maximum current production from M4-fed <i>Shewanella</i> is much greater than that from LB-fed.</h6><br><br><br />
<br />
When operated in a continuous flow setup, we observed the steady state current production from an LB fed reactor to be within the background noise of the setupM4&#8212;<i>i.e.</i>, an un-incoluated reactor was indistinguishable from a reactor inoculated with wildtype <i>S. oneidensis</i> MR-1. Because of this, we chose to use M4 media for all future characterization experiments, since optimization of signal-to-noise ratio is essential in the development of any sensing system.<br />
<br />
</div><br />
</div><br />
<br />
<div class="row" id="item3"><br />
<br />
<div class="nine columns"><br />
<h3>Arsenic Sensing</h3><br />
We chose to initially characterize our arsenic-sensing <i>Shewanella</i> by dosing with sodium arsenite, since the organism's native arsenate reductase activity would introduce a confounding variable in part characterization. After this initial characterization , we have shown that current is, indeed, upregulated in response to our analyte of interest. However, we should emphasize that this data is preliminary: Because of the care we took to establish a thorough Standard Operation Procedure for the handling of arsenic, we only had time for a single characterization trial, shown below in Fig. 4. Additionally, we plan on characterizing in response to both arsenate salts (to determine whether arsenate reductase activity is indeed confounding) and antimonite (to estimate the likelyhood of false positives).<br />
<br />
<br />
<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/0/04/ARS_new2.png"><br />
<h6> Fig. 3. Current production over time is plotted for continuous flow reactors inoculated with our arsenic-sensing strain (JG700+p14k). Transient phases corresponding to arsenite concentrations of 100 &mu;M (blue) and 500 &mu;M (green)are shown. Before a potentiostat channel restart at time zero, basal current was recorded at approximately 4 &mu;A. We report induced current in percent of this basal response. </h6><br><br><br />
<br />
It is also important to point out that we have not normalized any data to a per-cell basis. Because we are interested in a field-deployable system that produces greater <i>absolute</i> current in response to analyte, we did not record either optical density or colony forming units over time. However, while not a rigorous, we have observed a visible decrease in biomass for increasing concentrations of arsenite&#8212;as would be expected. Therefore, it is likely that an a per-cell basis, our arsenic sensing strains produce much more current that Fig. 4 would suggest. We plan on repeating characterization experiments in response to arsenite&#8212;both to generate a reliable transfer function relating current to arsenite concentration and to better understand the relationship between specific growth rate and MtrB production as a function of analyte concentration.<br />
</div><br />
<br />
<div class="three columns"><br />
<img src="<br />
https://static.igem.org/mediawiki/2012/b/be/Cornell_reactor_real_square.jpg"></div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<div class="row" id="item4"><br />
<div class="three columns"><br />
<img src="https://static.igem.org/mediawiki/2012/a/aa/Cornell_inject.jpg"><br />
</div><br />
<div class="nine columns"><br />
<h3>Naphthalene &amp; Salicylate Sensing</h3><br />
<br />
Because we did not have time to confirm successful conjugation of our naphthalene-degrading plasmid into <i>Shewanella</i>, we focused our efforts on observing the response to salicylate of our naphthalene-sensing precursor strain (JG700 + pSAL). This strain contains the molecular machinery requisite to respond to salicylate, which&#8212;in our final system&#8212;is a metabolite produced as a result of naphthalene catabolism via the enzymes encoded by the <i>nah</i> operon. (To read more about our naphthalene sensor design, see our <a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/salicylate">DNA Assembly</a> page.) <br><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/6/60/SAME_I_invis_small.png"><br />
<h6> Fig. 3. Current production over time is plotted for continuous flow reactors inoculated with our salicylate reporter strain (blue) and wildtype <i>S. oneidensis</i> MR-1 (green). Both duration of transient period and value of saturating current are approximately equal for reactors corresponding to both strains. </h6><br><br><br />
<br />
<br />
<br />
As seen above, our un-induced salicylate sensing strain produces approximately the same steady state current as wildtype <i>Shewanella</i>, suggesting that leaky expression of MtrB from uninduced promoter activity is enough to saturate current output. This can be understood in terms of the complete Mtr pathway, since metal-reduction activity requires a functional complex of MtrA, MtrB, and MtrC&#8212;as described in the <a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a> section page. Since there is only so much MtrC and MtrA in the cell, increasing MtrB activity saturates as free MtrC and MtrA is sequestered and localized. <br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/8/80/Point3_invis_small.png"><br />
<h6> Fig. 4. Current production over time is plotted for continuous flow reactors inoculated with our salicylate reporter strain (blue) and wildtype <i>S. oneidensis</i> MR-1 (green). Both duration of transient period and value of saturating current are approximately equal for reactors corresponding to both strains. </h6><br><br><br />
<br />
<br />
<br />
</div><br />
<br />
<div class="row last-ele" id="item5"><br />
<div class="nine columns"><br />
<h3>Ferrozine Assays</h3><br />
<br />
</div><br />
<div class="three columns"><br />
<img src="https://static.igem.org/mediawiki/2012/a/aa/Cornell_inject.jpg"><br />
</div><br />
<br />
<br />
</div><br />
<br />
<br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/lightbox?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_wetlab').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/gallery/outreachTeam:Cornell/project/gallery/outreach2012-10-27T02:02:52Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6>Photo Galleries</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/gallery">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/gallery/device">The Device</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/gallery/drylab">Dry Lab</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/gallery/wetlab">Wet Lab</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/gallery/outreach">Outreach</a><br />
</li><br />
<br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h2 class="centered">Outreach Gallery</h2><br />
</div><br />
</div><br />
<div class="row last-ele"><br />
<div class="twelve columns"><br />
<ul class="block-grid four-up"><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/b/bd/Sciencenter_6_900.png" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/2/22/Sciencenter_6_small.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/4/44/Sciencenter_7.JPG" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/8/80/Sciencenter_7_small.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/e/e1/Sciencenter_8.JPG" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/7/71/Sciencenter_8_small.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/e/ed/Sciencenter_9.JPG" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/2/2c/Sciencenter_9_small.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/6/65/CIBT_2.JPG" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/9/98/CIBT_2_small.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/c/c2/PSP_4.JPG" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/2/25/Psp_4_small.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/e/ea/PSP_5.JPG" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/1/13/Psp_5_small.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/b/b2/Gallery1.png" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/e/e1/Gallery1crop.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/d/d9/Gallery2.png" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/f/f4/Gallery2crop.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/6/6f/Gallery3.png" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/e/eb/Gallery3crop.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/3/3d/Gallery4.png" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/c/ca/Gallery4crop.png"></a><br />
</li><br />
<li><br />
<a href="https://static.igem.org/mediawiki/2012/5/59/Gallery5.png" rel="lightbox[outreach]"><img src="https://static.igem.org/mediawiki/2012/1/18/Gallery5crop.png"></a><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/lightbox?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_gallery').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/wetlab/results/transcriptionTeam:Cornell/project/wetlab/results/transcription2012-10-27T01:40:32Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6>Wet Lab</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly">DNA Assembly</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/arsenic">Arsenic Reporter</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/naphthalene">Naphthalene Reporter</a><br />
</li><br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results">Testing &amp; Results</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/biobricks">BioBricks</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/transcription">Transcriptional Characterization</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/currentresponse">Current Response</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/protein">MtrB Protein Expression</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/nah_operon"><i>nah</i> Operon Expression</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/artificial_river_media">Artificial River Media</a><br />
</li><br />
<br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/future_work">Future Work</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/animation">Animation</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h2 class="centered">Transcriptional Characterization</h2><br />
</div><br />
</div><br />
<div class="row"><br />
<div class="twelve columns"><br />
<br><br />
<h2> Fluorescence </h2><br />
In order to characterize promoter activity in response to arsenic and salicylate, we appended mRFP downstream of mtrB in our reporter parts. We used these constructs to test the level of promoter activity at increasing arsenic and salicylate concentrations. <br />
<h3>Control</h3><br />
To optimize experimental parameters and verify that fluorescence of <i>S. oneidensis</i> could be measured reliably, we began by measuring the fluorescence of mRFP with Anderson series promoters in <i>Shewanella oneidensis</i> MR-1. After adjusting the parameters of our tests to get a consistent response from control strains, we saw increasing relative fluorescence with increasing promoter strength. This suggests that the Anderson series constitutive promoters show similar activity in <i>S. oneidensis</i> as they do in <i>E. coli</i>.<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/9/9b/Fluorescence_controls.png"><br />
<font size="2"><b>mRFP fluorescence increases with increasing promoter strength.</b> Relative fluorescence of four strains, normalized to optical density, averaged over 8 replicates after a 16-hour incubation period. <i>S. oneidensis</i> with mtrB knocked out, and three strains of <i>S. oneidensis</i> expressing mRFP with Anderson series promoters strength 0.1, 0.7, and 1.0, were tested.</font><br />
</div><br />
</div><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h3>Arsenic</h3><br />
In order to determine if gene expression is increased in the presence of arsenic, we incubated our reporter strains with varying concentrations of either arsenite or arsenate and measured fluorescence using the BioTek Instruments Synergy™ HT Multi-Mode Microplate Reader. Trials were run using blank LB medium and <i>S. oneidensis</i> &Delta;mtrB as negative controls, while <i>S. oneidensis</i> &Delta;mtrB strains with Anderson promoters (0.1, 0.4, 1.0) upstream of mRFP were used as positive controls. Background fluorescence from LB was subtracted and fluorescence normalized to optical density in order to obtain relative fluorescence per cell mass. Fluorescence data for three replicates was averaged over time courses of 4.5 hours, after the cells had grown to a steady OD.<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/a/a7/FluorescenceArsenite1001.png"><br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/9/92/FluorescenceArsenate1001.png"><br />
<br />
<font size="2"><b>Arsenic reporter responds positively to arsenite, but not arsenate.</b> Preliminary data of relative fluorescence at 0, 10, 50, 100, and 500 µM of (a) arsenite, and (b) arsenate. Relative fluorescence is reported after normalization to optical density.</font><br />
<br />
<br><br><br />
<br />
Our preliminary data shows that as arsenite concentration is increased, relative fluorescence increases by over two-fold in both reporter strains! Our arsenic reporters are upregulating mRFP expression in response to arsenite, which suggests that mtrB transcription is also being upregulated.<br />
<br />
<br/><br><br />
<br />
However, our preliminary data from arsenate treatment shows no clear trend. As <i>S. oneidensis</i> has the native ability to reduce arsenates to arsenites, this may contribute to the lack of an obvious trend.<br />
<br />
<br/><br><br />
<br />
Because relative fluorescence is an average of only 3 replicates over 4.5 hour time courses, error bars are not included. We are currently continuing fluorescence assays to ensure statistical significance and to further define the dynamic range of our constructs.<br />
<br />
</div><br />
</div><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h3>Salicylate</h3><br />
<br />
Our fluorescence assays confirm that the salicylate reporter construct without a BamHI cut-site, SAL2, responds to salicylate in a range of 10-100 µM. As with tests characterizing response to arsenites and arsenates, we measured fluorescence while varying concentration of salicylate in LB medium.<br />
<br />
Trials were run using blank LB medium and <i>S. oneidensis</i> &Delta;mtrB as negative controls, while <i>S. oneidensis</i> &Delta;mtrB strains with Anderson promoters (0.1, 0.4, 1.0) upstream of mRFP were used as positive controls.<br />
Background fluorescence from LB was subtracted and fluorescence normalized to optical density in order to obtain relative fluorescence per cell mass. Fluorescence data for three replicates was averaged over a time course of 7.5 hours, after the cells had grown to a steady OD.<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/5/56/FluorescenceSalicylate930.png"><br />
<br />
<font size="2"><b>Salicylate reporter upregulates transcription of downstream genes in response to induction with salicylate.</b> Preliminary data of relative fluorescence of salicylate reporter in <i>S. oneidensis</i> at 0, 10, 100, and 500 µM of salicylate is shown. Relative fluorescence is reported after normalization to optical density.</font><br />
<br />
<br><br><br />
<br />
Preliminary data strongly suggests that SAL2 responds to salicylate at concentrations in the order of hundreds of µM. SAL2 fluorescence is averaged over 3 replicates in addition to averaging replicate individually over a time course of 7.5 hours. Error bars are excluded, pending additional replicates to ensure statistical significance. However, we are confident that our salicylate reporter is functioning as expected on the transcriptional level.<br />
</div><br />
</div><br />
<br />
<br><br><br />
<div class="row last-ele"><br />
<br />
<div class="nine columns"><br />
<h2>RT-qPCR</h2><br />
We are currently using two-step RT-qPCR to confirm that our engineered Shewanella strains respond to arsenic and naphthalene. Total RNA will be isolated using the E.Z.N.A.™ Bacterial RNA Isolation Kit from Omega bio-tek; cDNA will be synthesized using the qScript™ Flex cDNA Kit from Quanta Biosciences; and we are using the ABI ViiA7 platform along with the KAPA SYBR(R) FAST qPCR Kit from KAPA Biosystems. Our primers are as follows: <br />
<br><br><br />
FOR_enzA: CAGCCTTTTACCCAAGGTGA<br />
<br><br />
REV_enzA: CACGATTCGAGAGGGTGATT<br />
<br><br />
FOR_RecA: TTCCCCTCGACATTGTCATCATCGGA<br />
<br><br />
REV_RecA: AAGGGCGATAAAATTGGTCAAGGCCG<br />
<br><br />
3'_FOR_qPCR_mtrB: ACGCTCAATATCAAGCCACCGAGA<br />
<br><br />
3'_REV_qPCR_mtrB: TGTGCGGTGTAGTCATGGCTGT<br />
</div><br />
<div class="three columns"><br />
<img src="https://static.igem.org/mediawiki/2012/c/ce/Cornell12_Stock_4.jpg"><br />
</div><br />
</div><br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/lightbox?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_wetlab').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/hprac/CEATeam:Cornell/project/hprac/CEA2012-10-27T01:26:10Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6 style="margin-top:72px;">Human Practices</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac">Overview</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/CEA">Comprehensive Environmental Assessment</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/bioethics">Bioethics</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/oil_sands">Oil Sands</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/cayuga_watershed">Cayuga Watershed</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/safety">Safety</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row" id="ugd-members"><br />
<div class="twelve columns"><br />
<h2 class="centered">Comprehensive Environmental Assessment</h2><br />
</div><br />
</div><br />
<div class="row last-ele"><br />
<div class="twelve columns"><br />
<h3>Introduction to CEA</h3><br />
<br />
As scientists, we are often inclined to reduce complex procedures down to simple, step-by-step protocols. Assessing risk and evaluating environmental impact are no exception; our first instinct this year was to create a universal checklist of regulations that every environmental iGEM project could fulfill in order to ensure environmental safety, the idea being that we could easily and systematically find answers to questions of environmental safety in scientific literature. However, upon speaking with Dr. Christina Powers, a biologist at the US Environmental Protection Agency, and further exploring the concerns relating to our own project, we decided to adopt a new approach to issues of human practices: Comprehensive Environmental Assessment (CEA).<br />
</br><br />
<br>CEA differs from traditional methods of risk assessment by recognizing that risk assessment is fundamentally a decision-making process in which scientists, experts, and the public should be engaged. The goal is to foster transparent discussion and use collective judgment to evaluate limitations and trade-offs in order to arrive at holistic conclusions about the primary issues that researchers should address in their research planning.</br><br />
</div><br />
<div class="twelve columns"><br />
<h3>CEA &amp; Synthetic Biology</h3><br />
While the Environmental Protection Agency primarily uses the CEA approach for nanomaterials, the Woodrow Wilson International Center for Scholars in Washington, D.C., recently launched efforts to lay out a framework to apply CEA to synthetic biology. This groundbreaking project set out to assess the CEA approach’s relevance to synthetic biology, in anticipation of the growing demand for synthetic biology-based solutions to global issues. They arrived at the conclusion that scientists should focus on four major areas of risk assessment: altered physiology, competition and biodiversity, evolutionary prediction, and gene transfer.<br />
</br><br />
<br>The Woodrow Wilson Center’s Synthetic Biology Project recommended that CEA be applied to more developed projects that were approaching field deployment in order to evaluate it as a risk-assessment approach for synthetic biology at large. This is where we come in: can CEA be successfully used to evaluate the risks of our field-deployable device? What are its limitations? </br><br />
<br />
<br>We began by attempting to apply the Synthetic Biology Project’s modified guidelines for prioritizing research questions to our own project as it currently stands.</br><br />
<img src="https://static.igem.org/mediawiki/2012/5/5a/CEA.PNG" class="inline"><br />
Above is a simplified schematic of our risk assessment approach, as adapted from the Woodrow Wilson Center. We hope that this framework will prove useful to other environmental iGEM teams in the future.<br />
<br><br><br />
<h5>Altered Physiology</h5><br />
<br />
The current versions of our genetically modified strains have a membrane protein in the Mtr pathway for anaerobic respiration knocked out and complemented on a plasmid. They differ from wild-type <i>Shewanella oneidensis</i> MR-1 in that their capacity for anaerobic respiration is upregulated in the presence of analyte (arsenic or naphthalene). This plasmid appears to be producing mtrB in a fully functional form that successfully completes the anaerobic respiration pathway when induced. One important difference is that when uninduced, the bacteria loses much of its anaerobic respiratory activity, and must rely significantly more on aerobic respiration; this is further discussed below.<br />
<br />
<br>In addition, our salicylate reporter strain contains the nah operon, which allows the cells to constitutively degrade naphthalene into salicylate. Salicylate, a metabolic intermediate in the <i>Pseudomonas</i> strain from which the nah operon was taken, is less toxic to the environment than naphthalene. <i>P. putida</i> G7 can further degrade salicylate into a catechol, an edible carbon source using the sal operon; this second operon is not present in our cells, so our <i>Shewanella</i> strains are unable to actively degrade salicylate. This means that our cells cannot use naphthalene as a carbon source, a conclusion that is supported by our naphthalene growth assays. The effects of salicylate production on the cells appear to be negligible, but this should be further explored in future characterization work. </br><br />
<br />
<br>One of our future plans is to integrate our constructs into the chromosomes of our strains, in order to ensure that mtrB is not saturating at its uninduced, basal expression levels. This poses new questions: will chromosomal integration alter the expression patterns of this engineered pathway? Will it interfere with other functions of the cells? Functionality can be altered depending on the position of the construct within the chromosome. This is our first forthcoming research priority: determining any potential adverse effects of chromosomal integration, carrying it out, and thoroughly testing the functionality of our new engineered strains. </br><br />
<br />
<h5>Competition &amp; Biodiversity </h5><br />
A second concern is that engineered strains could possibly outcompete wild-type species in the environment and pose a threat to biodiversity. Our first line of defense against this possibility is physical containment: the inlet and outlet of our current prototype are equipped with 0.1 µm filters, effectively eliminating the possibility that our engineered strains may interact with natural organisms. However, imagine that there could be a mechanical error: physical breakage of the device, slight discrepancies in filter pore sizes, et cetera, that could leave a slim possibility that our strains could come into contact with natural species. What then?<br />
<br />
<br>To answer this question, we return to the altered physiology of our strains: the primary distinguishing characteristic to note is that the cells cannot carry out the wild-type levels of anaerobic respiration unless they are induced. This means that in situations where oxygen availability is limiting, and toxins are not highly prevalent, our strains are less able to compete than wild-type Shewanella; this is our second line of defense. <i>S. oneidensis</i> is native to freshwater ecosystems in our area, so our strains should not be disruptive to biodiversity. In addition, we have observed that inserting the nah operon into cells seems to significantly increase their doubling time, so our salicylate reporter strains would be even less able to compete than our arsenic reporters.</br><br />
<br />
<br>However, what happens in the case that oxygen availability is not limiting? It is probable that our current engineered strains would be able to survive and thrive in aerobic conditions, and live alongside wild-type <i>Shewanella</i>. We need a third line of defense for this situation, a modification that would prevent our strains from being able to survive outside of our physical device. For this, we propose auxotrophy: in a truly field-deployable device, we would use a strain that had a gene for a key metabolite knocked out, so that the strain would rely upon supplementation of this nutrient in order to survive. We would then supplement this metabolite inside of the device, so that our strains would function properly within our device. If the bacteria were to somehow escape, their functionality would be severely impaired by the lack of nutritional supplementation, and they would be quickly outcompeted by wild-type strains.</br><br />
<br />
<br>This brings to the table a second research priority for field-deployability: engineer an auxotrophic strain of <i>Shewanella</i> to contain our constructs, and ensure that the likelihood of survival without nutritional supplementation is very, very low. We would also need to ensure, from a practical standpoint, that auxotrophy would not interfere with any other aspects of the physiology of the cells.<br><br />
<br />
<br><br />
<h5>Evolutionary Prediction</h5> <br />
Due to the relatively simple nature of our reporter system, we find it highly unlikely that our strains could evolve to possess any dangerous function if somehow released into the wild. However, it is still possible that the promoter regions of our constructs could mutate and alter the expected patterns of promoter activity, or that the functionality of mtrB would be impaired by a deleterious mutation. The former possibility could serve to make the strain more genetically similar to the wild-type, and thus more able to compete; this presents us with another reason to pursue auxotrophy as a solution, basically in order to ensure that our strains are not alive for long enough for mutations to accumulate. <br />
</br><br />
<br />
<br>However, we would also need to conduct extensive testing to ensure that our strains remain functional and responsive to analyte for the full 6-month period.<br />
</br><br />
<br />
<p><br />
<h5>Gene Transfer</h5> <br />
Perhaps the most pressing concern with any synthetic biology project is the possibility of horizontal gene transfer from engineered to natural strains, and vice versa. Again, our first line of defense is physical containment, but barring that, what can we do to reduce the possibility that our strains would transfer unnatural functions to natural cells? The biggest shortcoming of our current system is that antibiotic resistance is used as a selective marker on our plasmids, thus allowing for the possibility that antibiotic resistance could be spread among natural populations via conjugation or passive transformation. While we could explore the possibility of using another form of auxotrophy as a selective marker on a plasmid, we believe that a more viable solution would be to eliminate the need for a selective pressure in the first place, namely by chromosomal integration. The transfer of chromosomal DNA is much less likely than the transfer of a plasmid, and, as mentioned above, chromosomal integration would solve other problems in the functionality of our reporters.<br />
</p><br />
</div><br />
<br />
<div class="twelve columns"><br />
<h3>Limitations of CEA</h3><br />
CEA allowed us to think about crucial future work for our project in order to make it suitable for field-deployability. However, in our interactions with environmental groups, public officials in water quality management, and industrial groups, we encountered several important questions that were not built into existing CEA framework. Assessing the suitability of a synthetic biology-based device extends far beyond practical environmental risk assessment, into regulatory and economic concerns. The Presidential Commission for the Study of Bioethical Issues (PCSBI) released a report in December 2010 regarding important considerations for the ethics of synthetic biology projects, not all of which are encompassed by the CEA framework. In addition, as we approach field-deployability, the economics of the device become essential to assessing its viability as a solution to real-world water monitoring needs. These ideas are further explored in the remainder of this section.<br />
</div><br />
<div class="twelve columns"><br />
<h3>References</h3><br />
Dana, G. V., Kuiken, T., Rejeski, D., &amp; Snow, A. A. (2012). Synthetic biology: Four steps to avoid a synthetic-biology disaster. <i>Nature, 483.</i> doi:10.1038/483029a</br><br />
<br>Powers, C. M., Dana, G., Gillespie, P., Gwinn, M. R., Hendren, C. O., Long, T. C., Wang, A., Davis, J. M. (2012). Comprehensive Environmental Assessment: A Meta-Assessment Approach. <i>Environ. Sci. Technol., 46,</i> 9202−9208. http://dx.doi.org/10.1021/es3023072</br><br />
<br>Synthetic Biology Project. (2011, July 28). Comprehensive Environmental Assessment and Its Application to Synthetic Biology Applications. Retrieved from http://www.synbioproject.org/events/archive/cea/</br><br />
<br />
</div><br />
</div><br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_hprac').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/hprac/CEATeam:Cornell/project/hprac/CEA2012-10-27T01:25:14Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6 style="margin-top:72px;">Human Practices</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac">Overview</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/CEA">Comprehensive Environmental Assessment</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/bioethics">Bioethics</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/oil_sands">Oil Sands</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/cayuga_watershed">Cayuga Watershed</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/hprac/safety">Safety</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row" id="ugd-members"><br />
<div class="twelve columns"><br />
<h2 class="centered">Comprehensive Environmental Assessment</h2><br />
</div><br />
</div><br />
<div class="row last-ele"><br />
<div class="twelve columns"><br />
<h3>Introduction to CEA</h3><br />
<br />
As scientists, we are often inclined to reduce complex procedures down to simple, step-by-step protocols. Assessing risk and evaluating environmental impact are no exception; our first instinct this year was to create a universal checklist of regulations that every environmental iGEM project could fulfill in order to ensure environmental safety, the idea being that we could easily and systematically find answers to questions of environmental safety in scientific literature. However, upon speaking with Dr. Christina Powers, a biologist at the US Environmental Protection Agency, and further exploring the concerns relating to our own project, we decided to adopt a new approach to issues of human practices: Comprehensive Environmental Assessment (CEA).<br />
</br><br />
<br>CEA differs from traditional methods of risk assessment by recognizing that risk assessment is fundamentally a decision-making process in which scientists, experts, and the public should be engaged. The goal is to foster transparent discussion and use collective judgment to evaluate limitations and trade-offs in order to arrive at holistic conclusions about the primary issues that researchers should address in their research planning.</br><br />
</div><br />
<div class="twelve columns"><br />
<h3>CEA &amp; Synthetic Biology</h3><br />
While the Environmental Protection Agency primarily uses the CEA approach for nanomaterials, the Woodrow Wilson International Center for Scholars in Washington, D.C., recently launched efforts to lay out a framework to apply CEA to synthetic biology. This groundbreaking project set out to assess the CEA approach’s relevance to synthetic biology, in anticipation of the growing demand for synthetic biology-based solutions to global issues. They arrived at the conclusion that scientists should focus on four major areas of risk assessment: altered physiology, competition and biodiversity, evolutionary prediction, and gene transfer.<br />
</br><br />
<br>The Woodrow Wilson Center’s Synthetic Biology Project recommended that CEA be applied to more developed projects that were approaching field deployment in order to evaluate it as a risk-assessment approach for synthetic biology at large. This is where we come in: can CEA be successfully used to evaluate the risks of our field-deployable device? What are its limitations? </br><br />
<br />
<br>We began by attempting to apply the Synthetic Biology Project’s modified guidelines for prioritizing research questions to our own project as it currently stands.</br><br />
<img src="https://static.igem.org/mediawiki/2012/5/5a/CEA.PNG" class="inline"><br />
Above is a simplified schematic of our risk assessment approach, as adapted from the Woodrow Wilson Center. We hope that this framework will prove useful to other environmental iGEM teams in the future.<br />
<h5>Altered Physiology</h5><br />
<br />
The current versions of our genetically modified strains have a membrane protein in the Mtr pathway for anaerobic respiration knocked out and complemented on a plasmid. They differ from wild-type <i>Shewanella oneidensis</i> MR-1 in that their capacity for anaerobic respiration is upregulated in the presence of analyte (arsenic or naphthalene). This plasmid appears to be producing mtrB in a fully functional form that successfully completes the anaerobic respiration pathway when induced. One important difference is that when uninduced, the bacteria loses much of its anaerobic respiratory activity, and must rely significantly more on aerobic respiration; this is further discussed below.<br />
<br />
<br>In addition, our salicylate reporter strain contains the nah operon, which allows the cells to constitutively degrade naphthalene into salicylate. Salicylate, a metabolic intermediate in the <i>Pseudomonas</i> strain from which the nah operon was taken, is less toxic to the environment than naphthalene. <i>P. putida</i> G7 can further degrade salicylate into a catechol, an edible carbon source using the sal operon; this second operon is not present in our cells, so our <i>Shewanella</i> strains are unable to actively degrade salicylate. This means that our cells cannot use naphthalene as a carbon source, a conclusion that is supported by our naphthalene growth assays. The effects of salicylate production on the cells appear to be negligible, but this should be further explored in future characterization work. </br><br />
<br />
<br>One of our future plans is to integrate our constructs into the chromosomes of our strains, in order to ensure that mtrB is not saturating at its uninduced, basal expression levels. This poses new questions: will chromosomal integration alter the expression patterns of this engineered pathway? Will it interfere with other functions of the cells? Functionality can be altered depending on the position of the construct within the chromosome. This is our first forthcoming research priority: determining any potential adverse effects of chromosomal integration, carrying it out, and thoroughly testing the functionality of our new engineered strains. </br><br />
<br />
<h5>Competition &amp; Biodiversity </h5><br />
A second concern is that engineered strains could possibly outcompete wild-type species in the environment and pose a threat to biodiversity. Our first line of defense against this possibility is physical containment: the inlet and outlet of our current prototype are equipped with 0.1 µm filters, effectively eliminating the possibility that our engineered strains may interact with natural organisms. However, imagine that there could be a mechanical error: physical breakage of the device, slight discrepancies in filter pore sizes, et cetera, that could leave a slim possibility that our strains could come into contact with natural species. What then?<br />
<br />
<br>To answer this question, we return to the altered physiology of our strains: the primary distinguishing characteristic to note is that the cells cannot carry out the wild-type levels of anaerobic respiration unless they are induced. This means that in situations where oxygen availability is limiting, and toxins are not highly prevalent, our strains are less able to compete than wild-type Shewanella; this is our second line of defense. <i>S. oneidensis</i> is native to freshwater ecosystems in our area, so our strains should not be disruptive to biodiversity. In addition, we have observed that inserting the nah operon into cells seems to significantly increase their doubling time, so our salicylate reporter strains would be even less able to compete than our arsenic reporters.</br><br />
<br />
<br>However, what happens in the case that oxygen availability is not limiting? It is probable that our current engineered strains would be able to survive and thrive in aerobic conditions, and live alongside wild-type <i>Shewanella</i>. We need a third line of defense for this situation, a modification that would prevent our strains from being able to survive outside of our physical device. For this, we propose auxotrophy: in a truly field-deployable device, we would use a strain that had a gene for a key metabolite knocked out, so that the strain would rely upon supplementation of this nutrient in order to survive. We would then supplement this metabolite inside of the device, so that our strains would function properly within our device. If the bacteria were to somehow escape, their functionality would be severely impaired by the lack of nutritional supplementation, and they would be quickly outcompeted by wild-type strains.</br><br />
<br />
<br>This brings to the table a second research priority for field-deployability: engineer an auxotrophic strain of <i>Shewanella</i> to contain our constructs, and ensure that the likelihood of survival without nutritional supplementation is very, very low. We would also need to ensure, from a practical standpoint, that auxotrophy would not interfere with any other aspects of the physiology of the cells.<br><br />
<br />
<br><br />
<h5>Evolutionary Prediction</h5> <br />
Due to the relatively simple nature of our reporter system, we find it highly unlikely that our strains could evolve to possess any dangerous function if somehow released into the wild. However, it is still possible that the promoter regions of our constructs could mutate and alter the expected patterns of promoter activity, or that the functionality of mtrB would be impaired by a deleterious mutation. The former possibility could serve to make the strain more genetically similar to the wild-type, and thus more able to compete; this presents us with another reason to pursue auxotrophy as a solution, basically in order to ensure that our strains are not alive for long enough for mutations to accumulate. <br />
</br><br />
<br />
<br>However, we would also need to conduct extensive testing to ensure that our strains remain functional and responsive to analyte for the full 6-month period.<br />
</br><br />
<br />
<p><br />
<h5>Gene Transfer</h5> <br />
Perhaps the most pressing concern with any synthetic biology project is the possibility of horizontal gene transfer from engineered to natural strains, and vice versa. Again, our first line of defense is physical containment, but barring that, what can we do to reduce the possibility that our strains would transfer unnatural functions to natural cells? The biggest shortcoming of our current system is that antibiotic resistance is used as a selective marker on our plasmids, thus allowing for the possibility that antibiotic resistance could be spread among natural populations via conjugation or passive transformation. While we could explore the possibility of using another form of auxotrophy as a selective marker on a plasmid, we believe that a more viable solution would be to eliminate the need for a selective pressure in the first place, namely by chromosomal integration. The transfer of chromosomal DNA is much less likely than the transfer of a plasmid, and, as mentioned above, chromosomal integration would solve other problems in the functionality of our reporters.<br />
</p><br />
</div><br />
<br />
<div class="twelve columns"><br />
<h3>Limitations of CEA</h3><br />
CEA allowed us to think about crucial future work for our project in order to make it suitable for field-deployability. However, in our interactions with environmental groups, public officials in water quality management, and industrial groups, we encountered several important questions that were not built into existing CEA framework. Assessing the suitability of a synthetic biology-based device extends far beyond practical environmental risk assessment, into regulatory and economic concerns. The Presidential Commission for the Study of Bioethical Issues (PCSBI) released a report in December 2010 regarding important considerations for the ethics of synthetic biology projects, not all of which are encompassed by the CEA framework. In addition, as we approach field-deployability, the economics of the device become essential to assessing its viability as a solution to real-world water monitoring needs. These ideas are further explored in the remainder of this section.<br />
</div><br />
<div class="twelve columns"><br />
<h3>References</h3><br />
Dana, G. V., Kuiken, T., Rejeski, D., &amp; Snow, A. A. (2012). Synthetic biology: Four steps to avoid a synthetic-biology disaster. <i>Nature, 483.</i> doi:10.1038/483029a</br><br />
<br>Powers, C. M., Dana, G., Gillespie, P., Gwinn, M. R., Hendren, C. O., Long, T. C., Wang, A., Davis, J. M. (2012). Comprehensive Environmental Assessment: A Meta-Assessment Approach. <i>Environ. Sci. Technol., 46,</i> 9202−9208. http://dx.doi.org/10.1021/es3023072</br><br />
<br>Synthetic Biology Project. (2011, July 28). Comprehensive Environmental Assessment and Its Application to Synthetic Biology Applications. Retrieved from http://www.synbioproject.org/events/archive/cea/</br><br />
<br />
</div><br />
</div><br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_hprac').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Surekahttp://2012.igem.org/Team:Cornell/project/wetlab/results/transcriptionTeam:Cornell/project/wetlab/results/transcription2012-10-27T01:06:47Z<p>S.Sureka: </p>
<hr />
<div>{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lang="en"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8" lang="en"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9" lang="en"> <![endif]--><br />
<!--[if gt IE 8]><!--><br />
<html class="no-js" lang="en"><br />
<!--<![endif]--><br />
<div class="row"><br />
<div class="two columns"><br />
<ul class="side-nav"><br />
<li><br />
<h6>Wet Lab</h6><br />
</li><br />
<li class="divider"></li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab">Overview</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/chassis">Chassis</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly">DNA Assembly</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/arsenic">Arsenic Reporter</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/assembly/naphthalene">Naphthalene Reporter</a><br />
</li><br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results">Testing &amp; Results</a><br />
<ul><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/biobricks">BioBricks</a><br />
</li><br />
<li class="active"><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/transcription">Transcriptional Characterization</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/currentresponse">Current Response</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/protein">MtrB Protein Expression</a><br />
</li><br />
<br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/nah_operon"><i>nah</i> Operon Expression</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/results/artificial_river_media">Artificial River Media</a><br />
</li><br />
<br />
</ul><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/future_work">Future Work</a><br />
</li><br />
<li><br />
<a href="https://2012.igem.org/Team:Cornell/project/wetlab/animation">Animation</a><br />
</li><br />
</ul><br />
</div><br />
<div class="ten columns team-bios-container"><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h2 class="centered">Transcriptional Characterization</h2><br />
</div><br />
</div><br />
<div class="row"><br />
<div class="twelve columns"><br />
<br><br />
<h2> Fluorescence </h2><br />
In order to characterize promoter activity in response to arsenic and salicylate, we appended mRFP downstream of mtrB in our reporter parts. We used these constructs to test the level of promoter activity at increasing arsenic and salicylate concentrations. <br />
<h3>Control</h3><br />
To optimize experimental parameters and verify that fluorescence of <i>S. oneidensis</i> could be measured reliably, we began by measuring the fluorescence of mRFP with Anderson series promoters in <i>Shewanella oneidensis</i> MR-1. After adjusting the parameters of our tests to get a consistent response from control strains, we saw increasing relative fluorescence with increasing promoter strength. This suggests that the Anderson series constitutive promoters show similar activity in <i>S. oneidensis</i> as they do in <i>E. coli</i>.<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/9/9b/Fluorescence_controls.png"><br />
<font size="2"><b>mRFP fluorescence increases with increasing promoter strength.</b> Relative fluorescence of four strains, normalized to optical density, averaged over 8 replicates after a 16-hour incubation period. <i>S. oneidensis</i> with mtrB knocked out, and three strains of <i>S. oneidensis</i> expressing mRFP with Anderson series promoters strength 0.1, 0.7, and 1.0, were tested.</font><br />
</div><br />
</div><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h3>Arsenic</h3><br />
In order to determine if gene expression is increased in the presence of arsenic, we incubated our reporter strains with varying concentrations of either arsenite or arsenate and measured fluorescence using the BioTek Instruments Synergy™ HT Multi-Mode Microplate Reader. Trials were run using blank LB medium and <i>S. oneidensis</i> &Delta;mtrB as negative controls, while <i>S. oneidensis</i> &Delta;mtrB strains with Anderson promoters (0.1, 0.4, 1.0) upstream of mRFP were used as positive controls. Background fluorescence from LB was subtracted and fluorescence normalized to optical density in order to obtain relative fluorescence per cell mass. Fluorescence data was averaged over a time course of 4.5 hours, after the cells had grown to a steady OD.<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/a/a7/FluorescenceArsenite1001.png"><br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/9/92/FluorescenceArsenate1001.png"><br />
<br />
<font size="2"><b>Arsenic reporter responds positively to arsenite, but not arsenate.</b> Preliminary data of relative fluorescence at 0, 10, 50, 100, and 500 µM of (a) arsenite, and (b) arsenate. Relative fluorescence is reported after normalization to optical density.</font><br />
<br />
<br><br><br />
<br />
Our preliminary data shows that as arsenite concentration is increased, relative fluorescence increases by over two-fold in both reporter strains! Therefore, our arsenic reporters are responding to arsenite.<br />
<br />
<br/><br/><br />
<br />
However, our preliminary data from arsenate treatment shows no clear trend. As <i>S. oneidensis</i> has the native ability to reduce arsenates to arsenites, this may contribute to the lack of an obvious trend.<br />
<br />
<br/><br/><br />
<br />
Because relative fluorescence is an average of only 3 replicates over 4.5 hour time courses, error bars are not included. We are currently continuing fluorescence assays to ensure statistical significance and to further define the dynamic range of our constructs.<br />
<br />
</div><br />
</div><br />
<div class="row"><br />
<div class="twelve columns"><br />
<h3>Salicylate</h3><br />
<br />
Our fluorescence assays confirm that the salicylate reporter construct without a BamHI cut-site, SAL2, responds to salicylate in a range of 10-100 µM. As with tests characterizing response to arsenites and arsenates, we measured fluorescence while varying concentration of salicylate in LB medium.<br />
<br />
Trials were run using blank LB medium and JG700 as negative controls, while conjugated JG700 strains with Anderson promoters (0.1, 0.4, 1.0) upstream of mRFP were used as positive controls.<br />
Background fluorescence from LB was subtracted and fluorescence normalized to optical density in order to obtain relative fluorescence per cell mass. Fluorescence data was averaged over a time course of 7.5 hours, after the cells had grown to a steady OD.<br />
<br />
<img class="inline" src="https://static.igem.org/mediawiki/2012/5/56/FluorescenceSalicylate930.png"><br />
<br />
<font size="2">Preliminary data of relative fluorescence of salicylate reporter in <i>S. oneidensis</i> at 0, 10, 100, and 500 µM of salicylate. Relative fluorescence is reported after normalization to optical density.</font><br />
<br />
<br><br><br />
<br />
Preliminary data strongly suggests that SAL2 responds to salicylate at concentrations in the order of hundreds of µM. Additionally, comparison to fluorescence from the Anderson 0.1 promoter (not shown in graph) suggests that the induced promoter activity may have similar strength to 0.1 on the Anderson series scale.<br />
<br />
<br/><br/><br />
<br />
SAL2 fluorescence is averaged over 3 replicates in addition to averaging replicate individually over a time course of 7.5 hours. We are continuing to characterize our salicylate reporter strains.<br />
</div><br />
</div><br />
<br />
<br><br><br />
<div class="row last-ele"><br />
<br />
<div class="nine columns"><br />
<h2>RT-qPCR</h2><br />
We are currently using two-step RT-qPCR to confirm that our engineered Shewanella strains respond to arsenic and naphthalene. Total RNA will be isolated using the E.Z.N.A.™ Bacterial RNA Isolation Kit from Omega bio-tek; cDNA will be synthesized using the qScript™ Flex cDNA Kit from Quanta Biosciences; and we are using the ABI ViiA7 platform along with the KAPA SYBR(R) FAST qPCR Kit from KAPA Biosystems. Our primers are as follows: <br />
<br><br><br />
FOR_enzA: CAGCCTTTTACCCAAGGTGA<br />
<br><br />
REV_enzA: CACGATTCGAGAGGGTGATT<br />
<br><br />
FOR_RecA: TTCCCCTCGACATTGTCATCATCGGA<br />
<br><br />
REV_RecA: AAGGGCGATAAAATTGGTCAAGGCCG<br />
<br><br />
3'_FOR_qPCR_mtrB: ACGCTCAATATCAAGCCACCGAGA<br />
<br><br />
3'_REV_qPCR_mtrB: TGTGCGGTGTAGTCATGGCTGT<br />
</div><br />
<div class="three columns"><br />
<img src="https://static.igem.org/mediawiki/2012/c/ce/Cornell12_Stock_4.jpg"><br />
</div><br />
</div><br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
<br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/foundation.min?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/app?action=raw&amp;ctype=text/javascript"></script><br />
<script src="https://2012.igem.org/Team:Cornell/javascripts/lightbox?action=raw&amp;ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('li.pg-project_wetlab').addClass('active');<br />
});<br />
</script><br />
</body><br />
</html></div>S.Sureka