http://2012.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=20&target=Kevinm.huie&year=&month=2012.igem.org - User contributions [en]2024-03-28T20:40:34ZFrom 2012.igem.orgMediaWiki 1.16.0http://2012.igem.org/Team:Calgary/Project/AccomplishTeam:Calgary/Project/Accomplish2012-10-27T04:02:55Z<p>Kevinm.huie: </p>
<hr />
<div>{{Team:Calgary/TemplateProjectOrange|<br />
TITLE=Accomplishments|<br />
CONTENT=<br />
<html><br />
<head><br />
<style><br />
<br />
a.green{<br />
color: #159900 !important;<br />
}<br />
a.blue{<br />
color: #1088CC !important;<br />
}<br />
a.orange{<br />
color: #FF7A00 !important;<br />
}<br />
</style><br />
</head><br />
<br />
<h2> Our team had many accomplishments throughout the summer of 2012!</h2><br />
<p>Please see the <b>Post Regional</b> page for our results between Regionals and the Finals!<br />
<br />
<p><b>In our <FONT COLOR="FF7A00">Human Practices</FONT> project, we...</b></p><br />
<img src="https://static.igem.org/mediawiki/2012/1/17/UCalgary2012_FRED_and_OSCAR_HP.png" style="float: right; width: 250px; padding: 10px;"></img><br />
<ul><li><p> Established a <a class="orange" href="https://2012.igem.org/Team:Calgary/Project/HumanPractices/Interviews">dialogue between industry experts</a> in order to inform the design of our project.</p></li><br />
<li><p>Led a discussion through the oil sands leadership initiative (OSLI) on the need and potential usefulness of <a class="orange" href="https://2012.igem.org/Team:Calgary/Project/HumanPractices/Collaborations#initiative"><br />
synthetic biology in the oil sands</a>.</p></li><br />
<li><p>Submitted <a class="orange" href="https://2012.igem.org/Team:Calgary/Project/HumanPractices/Killswitch/Regulation">novel riboswitch, promoter and regulatory parts</a> for use in the tight control of killswitch applications and beyond.</p></li><br />
<li><p><a class="orange" href="https://2012.igem.org/Team:Calgary/Project/HumanPractices/Killswitch/Regulation#killswitch">Submitted and characterized</a> both a magnesium riboswitch/promoter GFP construct and a magnesium riboswitch/promoter kill gene construct.</p></li><br />
<li><p><a class="orange" href="https://2012.igem.org/Team:Calgary/Project/OSCAR/Desulfurization#UBC">Partnered with the UBC iGEM team</a> in order to build and better optimize the <i>dsz</i> desulfurization operon.</p></li><br />
<li><p>Showcased our project to our city and the world through various outreach initiatives including a <a class="orange" href="https://2012.igem.org/Team:Calgary/Outreach/TEDxCalgary">TEDxCalgary City 2.0 talk</a>.</p></li><br />
<li><p>Premiered and beta-tested our <a class="orange" href="https://2012.igem.org/Team:Calgary/Outreach/VideoGame">video game LAB ESCAPE!</a> at the <a class="orange" href="http://www.sparkscience.ca">Calgary Telus Spark World of Science</a>.</p></li><br />
<li><p> Characterize the rhamnose and mgtA system with the S7 nuclease. <a class="orange"</a></li><br />
<li><p> Characterize a glycine auxotroph system to work in conjunction the rhamnose system.<a class="orange"</a></li> <br />
</ul><br />
<br />
<br><br />
<br />
<p><b>In terms of <FONT COLOR=#159900>FRED</FONT>, we...</b></p><br />
<img src="https://static.igem.org/mediawiki/2012/3/31/UCalgary2012_FRED_Index_Box.png" style="float: right; padding: 10px;"></img><br />
<ul><br />
<li><p> Constructed a <a class="green" href="https://2012.igem.org/Team:Calgary/Project/FRED/Detecting#library">transposon library</a> in <i>Pseudomonas</i>, identifying two positive hits sensitive to a variety of tailings pond toxins.</p></li><br />
<li><p>Submitted and electrochemically characterized the function of <a class="green" href="https://2012.igem.org/Team:Calgary/Project/FRED/Reporting#hydrolase">two novel hydrolase enzymes</a> from <i>E. coli</i>, demonstrating the validity and potential of a <a class="green" href="https://2012.igem.org/Team:Calgary/Project/FRED/Reporting#output">triple-output system</a> with high sensitivity and little background noise.</p></li><br />
<li><p>Designed and wet-lab verified a <a class="green" href="https://2012.igem.org/Team:Calgary/Project/FRED/Modelling">kinetic model</a> of electrochemical gene expression.</p></li><br />
<li><P>Designed both <a class="green" href="https://2012.igem.org/Team:Calgary/Project/FRED/Prototype#hardware">hardware</a> and <a class="green" href="https://2012.igem.org/Team:Calgary/Project/FRED/Prototype#software">software</a> for a biosensor prototype.</p></li></ul><br />
<br />
<br />
<br><br />
<br />
<p><b>In terms of <FONT COLOR=#1088CC>OCSAR</FONT>, we...</b></p><br />
<img src="https://static.igem.org/mediawiki/2012/c/c3/UCalgary2012_OSCAR_Index_Box.png" style="float: right; padding: 10px;"></img><br />
<ul><br />
<br />
<li><p>Demonstrated the successful conversion of <a class="blue" href="https://2012.igem.org/Team:Calgary/Project/OSCAR/Decarboxylation#Petrobrick"><br />
naphthenic acids into hydrocarbons</a> using Washington 2011's PetroBrick.</p></li><br />
<br />
<li><P>Documented the functionality of the enzyme <a class="blue" href="https://2012.igem.org/Team:Calgary/Project/OSCAR/Decarboxylation#OleT">OleT</a>, an alternative enzyme to the PetroBrick for producing <a class="blue" href="https://2012.igem.org/Team:Calgary/Project/OSCAR/Decarboxylation#TestingOleT"><br />
alkenes from fatty acids</a>.</p></li><br />
<li><P>Modified an <a class="blue" href="https://2012.igem.org/Team:Calgary/Project/OSCAR/CatecholDegradation">existing <i>xylE</i></a> part to show the degradation of <a class="blue" href="https://2012.igem.org/Team:Calgary/Project/OSCAR/CatecholDegradation#Catechol">catechol into a product, which is then degraded into hydrocarbons</a> using the PetroBrick or OleT.</p></li><br />
<li><P>Designed, built, and tested a <a class="blue" href="https://2012.igem.org/Team:Calgary/Project/OSCAR/Bioreactor">functioning bioreactor</a> system in which to house our toxin degrading strain.</p></li><br />
<li><P>Used flux variability analysis to <a class="blue" href="https://2012.igem.org/Team:Calgary/Project/OSCAR/FluxAnalysis#Flux"><br />
optimize the production of our hydrocarbons</a>, surpassing Washington’s previous results through modification of growth media.</p></li><br />
<li><P>Demonstrated the successful <a class="blue" href="https://2012.igem.org/Team:Calgary/Project/OSCAR/Desulfurization#Degradation">degradation of carbazole and DBT</a> by our model strains.</p></li><br />
<li><P>Submitted sequenced BioBricks for the removal of <a class="blue" href="https://2012.igem.org/Team:Calgary/Project/OSCAR/Denitrogenation#nitrogen">nitrogen</a> and <a class="blue" href="https://2012.igem.org/Team:Calgary/Project/OSCAR/Desulfurization#sulfur"><br />
sulfur</a> from various compounds and mutagenized eight separate genes to remove illegal cut sites.</p></li><br />
<li><P>Submitted and characterized a new <a class="blue" href="https://2012.igem.org/Team:Calgary/Project/OSCAR/Desulfurization#catalase">catalase generator</a> as well as a <a class="blue" href="https://2012.igem.org/Team:Calgary/Project/OSCAR/Desulfurization#catalase">novel oxido-reductase enzyme</a> for use in our desulfurization project.</p></li><br />
<li><P><b><FONT COLOR=#1088CC>Had an amazing summer and learned a ton!</FONT></b></p></li></ul><br />
<br />
</html><br />
}}</div>Kevinm.huiehttp://2012.igem.org/Team:Calgary/Project/AccomplishTeam:Calgary/Project/Accomplish2012-10-27T04:00:04Z<p>Kevinm.huie: </p>
<hr />
<div>{{Team:Calgary/TemplateProjectOrange|<br />
TITLE=Accomplishments|<br />
CONTENT=<br />
<html><br />
<head><br />
<style><br />
<br />
a.green{<br />
color: #159900 !important;<br />
}<br />
a.blue{<br />
color: #1088CC !important;<br />
}<br />
a.orange{<br />
color: #FF7A00 !important;<br />
}<br />
</style><br />
</head><br />
<br />
<h2> Our team had many accomplishments throughout the summer of 2012!</h2><br />
<p>Please see the <b>Post Regional</b> page for our results between Regionals and the Finals!<br />
<br />
<p><b>In our <FONT COLOR="FF7A00">Human Practices</FONT> project, we...</b></p><br />
<img src="https://static.igem.org/mediawiki/2012/1/17/UCalgary2012_FRED_and_OSCAR_HP.png" style="float: right; width: 250px; padding: 10px;"></img><br />
<ul><li><p> Established a <a class="orange" href="https://2012.igem.org/Team:Calgary/Project/HumanPractices/Interviews">dialogue between industry experts</a> in order to inform the design of our project.</p></li><br />
<li><p>Led a discussion through the oil sands leadership initiative (OSLI) on the need and potential usefulness of <a class="orange" href="https://2012.igem.org/Team:Calgary/Project/HumanPractices/Collaborations#initiative"><br />
synthetic biology in the oil sands</a>.</p></li><br />
<li><p>Submitted <a class="orange" href="https://2012.igem.org/Team:Calgary/Project/HumanPractices/Killswitch/Regulation">novel riboswitch, promoter and regulatory parts</a> for use in the tight control of killswitch applications and beyond.</p></li><br />
<li><p><a class="orange" href="https://2012.igem.org/Team:Calgary/Project/HumanPractices/Killswitch/Regulation#killswitch">Submitted and characterized</a> both a magnesium riboswitch/promoter GFP construct and a magnesium riboswitch/promoter kill gene construct.</p></li><br />
<li><p><a class="orange" href="https://2012.igem.org/Team:Calgary/Project/OSCAR/Desulfurization#UBC">Partnered with the UBC iGEM team</a> in order to build and better optimize the <i>dsz</i> desulfurization operon.</p></li><br />
<li><p>Showcased our project to our city and the world through various outreach initiatives including a <a class="orange" href="https://2012.igem.org/Team:Calgary/Outreach/TEDxCalgary">TEDxCalgary City 2.0 talk</a>.</p></li><br />
<li><p>Premiered and beta-tested our <a class="orange" href="https://2012.igem.org/Team:Calgary/Outreach/VideoGame">video game LAB ESCAPE!</a> at the <a class="orange" href="http://www.sparkscience.ca">Calgary Telus Spark World of Science</a>.</p></li></ul><br />
<li><p> Characterize the rhamnose and mgtA system with the S7 nuclease. <a class="orange" <br />
<li><p> Characterize a glycine auxotroph system to work in conjunction the rhamnose system.<a class="orange" <br />
<br />
<br />
<br><br />
<br />
<p><b>In terms of <FONT COLOR=#159900>FRED</FONT>, we...</b></p><br />
<img src="https://static.igem.org/mediawiki/2012/3/31/UCalgary2012_FRED_Index_Box.png" style="float: right; padding: 10px;"></img><br />
<ul><br />
<li><p> Constructed a <a class="green" href="https://2012.igem.org/Team:Calgary/Project/FRED/Detecting#library">transposon library</a> in <i>Pseudomonas</i>, identifying two positive hits sensitive to a variety of tailings pond toxins.</p></li><br />
<li><p>Submitted and electrochemically characterized the function of <a class="green" href="https://2012.igem.org/Team:Calgary/Project/FRED/Reporting#hydrolase">two novel hydrolase enzymes</a> from <i>E. coli</i>, demonstrating the validity and potential of a <a class="green" href="https://2012.igem.org/Team:Calgary/Project/FRED/Reporting#output">triple-output system</a> with high sensitivity and little background noise.</p></li><br />
<li><p>Designed and wet-lab verified a <a class="green" href="https://2012.igem.org/Team:Calgary/Project/FRED/Modelling">kinetic model</a> of electrochemical gene expression.</p></li><br />
<li><P>Designed both <a class="green" href="https://2012.igem.org/Team:Calgary/Project/FRED/Prototype#hardware">hardware</a> and <a class="green" href="https://2012.igem.org/Team:Calgary/Project/FRED/Prototype#software">software</a> for a biosensor prototype.</p></li></ul><br />
<br />
<br />
<br><br />
<br />
<p><b>In terms of <FONT COLOR=#1088CC>OCSAR</FONT>, we...</b></p><br />
<img src="https://static.igem.org/mediawiki/2012/c/c3/UCalgary2012_OSCAR_Index_Box.png" style="float: right; padding: 10px;"></img><br />
<ul><br />
<br />
<li><p>Demonstrated the successful conversion of <a class="blue" href="https://2012.igem.org/Team:Calgary/Project/OSCAR/Decarboxylation#Petrobrick"><br />
naphthenic acids into hydrocarbons</a> using Washington 2011's PetroBrick.</p></li><br />
<br />
<li><P>Documented the functionality of the enzyme <a class="blue" href="https://2012.igem.org/Team:Calgary/Project/OSCAR/Decarboxylation#OleT">OleT</a>, an alternative enzyme to the PetroBrick for producing <a class="blue" href="https://2012.igem.org/Team:Calgary/Project/OSCAR/Decarboxylation#TestingOleT"><br />
alkenes from fatty acids</a>.</p></li><br />
<li><P>Modified an <a class="blue" href="https://2012.igem.org/Team:Calgary/Project/OSCAR/CatecholDegradation">existing <i>xylE</i></a> part to show the degradation of <a class="blue" href="https://2012.igem.org/Team:Calgary/Project/OSCAR/CatecholDegradation#Catechol">catechol into a product, which is then degraded into hydrocarbons</a> using the PetroBrick or OleT.</p></li><br />
<li><P>Designed, built, and tested a <a class="blue" href="https://2012.igem.org/Team:Calgary/Project/OSCAR/Bioreactor">functioning bioreactor</a> system in which to house our toxin degrading strain.</p></li><br />
<li><P>Used flux variability analysis to <a class="blue" href="https://2012.igem.org/Team:Calgary/Project/OSCAR/FluxAnalysis#Flux"><br />
optimize the production of our hydrocarbons</a>, surpassing Washington’s previous results through modification of growth media.</p></li><br />
<li><P>Demonstrated the successful <a class="blue" href="https://2012.igem.org/Team:Calgary/Project/OSCAR/Desulfurization#Degradation">degradation of carbazole and DBT</a> by our model strains.</p></li><br />
<li><P>Submitted sequenced BioBricks for the removal of <a class="blue" href="https://2012.igem.org/Team:Calgary/Project/OSCAR/Denitrogenation#nitrogen">nitrogen</a> and <a class="blue" href="https://2012.igem.org/Team:Calgary/Project/OSCAR/Desulfurization#sulfur"><br />
sulfur</a> from various compounds and mutagenized eight separate genes to remove illegal cut sites.</p></li><br />
<li><P>Submitted and characterized a new <a class="blue" href="https://2012.igem.org/Team:Calgary/Project/OSCAR/Desulfurization#catalase">catalase generator</a> as well as a <a class="blue" href="https://2012.igem.org/Team:Calgary/Project/OSCAR/Desulfurization#catalase">novel oxido-reductase enzyme</a> for use in our desulfurization project.</p></li><br />
<li><P><b><FONT COLOR=#1088CC>Had an amazing summer and learned a ton!</FONT></b></p></li></ul><br />
<br />
</html><br />
}}</div>Kevinm.huiehttp://2012.igem.org/Team:Calgary/Outreach/VideoGameTeam:Calgary/Outreach/VideoGame2012-10-27T03:47:00Z<p>Kevinm.huie: </p>
<hr />
<div>{{Team:Calgary/TemplateOutreach|<br />
TITLE=LAB ESCAPE: Can you ''escape'' the lab?|<br />
<br />
CONTENT=<html><br />
<br />
<!-- <br />
<object style="margin: 20px;" width="640" height="480"><br />
<param name="movie" value="https://static.igem.org/mediawiki/2012/5/5c/UCalgary2012_LABESCAPEv1_8.swf"> <embed src="https://static.igem.org/mediawiki/2012/5/5c/UCalgary2012_LABESCAPEv1_8.swf" width="640" height="480"><br />
</embed><br />
</object><br />
--!><br />
<br />
<br />
</html>[[Image:UCalgary2012_LABESCAPETitleLink.png|500px|center|link=http://igem.ucalgary.ca/game.html]]<html><br />
<br />
<br />
<hr style="height: 2px; color:#000000;background-color:#000000"><br />
<br />
<h2>Creating LAB ESCAPE: A Synthetic Biology Video Game</h2><br />
<br />
</html>[[Image:UCalgary2012_FRED_&amp;_OSCAR_Video Game.png|300px|right]]<html><br />
<br />
<p>The iGEM 2012 Calgary team ventured into new territory by developing a video game centered on synthetic biology called <b>LAB ESCAPE</b>. As scientists, we are often asked, “What exactly do you do all day?” and “What do you mean you can see DNA?” Our video game provides an opportunity to educate and entertain the player by guiding them through a routine experiment used by the iGEM 2012 Calgary team. LAB ESCAPE focuses on gel electrophoresis – a common molecular biology technique used to separate and visualize DNA from PCR and restriction digests. We also incorporated basic laboratory safety procedures to further immerse the player in the research experience. </p><br />
<br />
<p><b><FONT COLOR="FF7A00">LAB ESCAPE is part science, part fun, and all iGEM.</FONT></b></p><br />
<br />
<br />
<br />
<h2>From Storyboard to Application</h2><br />
<br />
<p>The initial stage in the development of LAB ESCAPE focused on creating an engaging environment resembling a typical synthetic biology research lab. We then created a script outlining the player's actions as they find themselves locked in the lab, progress through the tasks to find the secret code, and (hopefully) escape. We originally wanted to incorporate numerous experimental techniques, but we decided to focus on one common technique - gel electrophoresis. This avoided overwhelming the player with multiple experiments and also kept the time required to an optimal level. Once the scene was set we jumped into the world of video game creation.</p><br />
<br />
</html>[[Image:UCalgary_App_Icon.png|96px|right]]<html><br />
<br />
<p>The iGEM 2012 Calgary team created all the graphical images for LAB ESCAPE using Adobe Illustrator. Adobe Flash was used as the platform for the programming code creating LAB ESCAPE, with some programming code being modified from open-source repositories. With these tools, we designed a ‘point-and-click’ adventure video game, where the player collects items hidden throughout the virtual environment, then complete a task to obtain the code required to open the locked lab door. We even composed our own musical soundtrack!!</p><br />
<br />
<p>By using Adobe Flash we were also able to simultaneously make a game that could be run on mobile devices. We are also in the process of submitting our game as an iPad application that can be downloaded from </html>[http://itunes.apple.com/us/app/igem-lab-escape/id566996098?ls=1&mt=8 Apple's iTunes App Store].<html></p><br />
<br />
</html><br />
[[Image:LABESCAPE-Main.png|230px]]<br />
[[Image:UCalgary2012_LABESCAPE-Lab.png|230px]]<br />
[[Image:UCalgary2012_LABESCAPEGel.png|230px]]<br />
<html><br />
<br />
<p>After completing the first build of LAB ESCAPE, we challenged members of the iGEM 2012 Calgary team to <i>escape from the lab</i>. After incorporating the comments from our teammates, we then released the game to our friends, family and other willing volunteers to gather further feedback from people with a wide variety of backgrounds and experiences.</p><br />
<br />
<p>By September 2012, we had a completely functional video game to share with the world. We premiered LAB ESCAPE at the <a href="http://www.sparkscience.ca">TELUS SPARK </a> science centre in Calgary on September 29 and 30, 2012. During the premier event, people of all ages enjoyed LAB ESCAPE and learned about synthetic biology. With our iGEM wiki going live in early October even more people have enjoyed LAB ESCAPE. On October 13, our video game was accepted by the App Store and is FREE to download for iPads. </p><br />
<p><br />
</html><br />
[[Image:UCalgary2012_TelusSparkLABESCAPE.jpg|230px]]<br />
[[Image:UCalgary2012_TelusSparkLABESCAPE2.jpg|230px]]<br />
[[Image:UCalgary2012_LABESCAPE3.jpg|230px]]<br />
<html><br />
</p><br />
<h2>The Challenge: Can you escape LAB ESCAPE?</h2><br />
<br />
<p>Now that you have all the background information on the creation of LAB ESCAPE, it's time to see if you can escape! All you have to do is collect all the misplaced items needed to run your gel electrophoresis, find the code and escape the lab. It may sound easy, but science is often easy - in theory. One hint for those of you that made it this far: remember that many chemicals in research labs can be quite dangerous. Appropriate safety equipment is always required before working on any experiments.</p><br />
<br />
<p>Finally, while good science should never be rushed, competition often leads to greatness. Keep an eye on the timer and see how quickly you can escape LAB ESCAPE. </p><br />
<br />
<p>Note: The game is stored on the University of Calgary's server because it is larger than the 2 megabyte limit imposed by the iGEM wiki.</p><br />
</html><br />
}}</div>Kevinm.huiehttp://2012.igem.org/Team:Calgary/Project/HumanPractices/Killswitch/RegulationTeam:Calgary/Project/HumanPractices/Killswitch/Regulation2012-10-27T03:33:41Z<p>Kevinm.huie: </p>
<hr />
<div>{{Team:Calgary/TemplateProjectOrange|<br />
TITLE=Regulation/Expression Platform|<br />
CONTENT=<br />
<html><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/8c/UCalgary2012_FRED_Killswitch_Regulation_Low-Res.png" style="float: right; padding: 10px; height: 200px;"></img><br />
<div align="justify"><br />
<br />
<h2> Tight Regulation </h2><br />
<p>Inducible kill systems are not new to iGEM. Looking through the registry, there are several constructs such as the inducible BamHI system contributed by Berkley in 2007 (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_I716462">BBa_I716462</a>) and <a href="http://partsregistry.org/Image:UoflBamHIdatasheet.png">tested by Lethbridge in 2011</a>. This uses a <i>BamHI</i> gene downsteam of an arabinose-inducible promoter. Another example is an IPTG inducible Colicin construct (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K117009">BBa_K117009</a>) submitted by NTU-Singapore in 2008. One major problem with these systems however is a lack of tight control. As was demonstrated by the Lethbridge 2011 team, this part has leaky expression when inducer compound is not present. The frequently used lacI promoter has similar problems when not used in conjunction with strong plasmid-mediated expression of lacI. This can be seen in our electrochemical characterization of the UidA hydrolase enzyme (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902002">BBa_K902002</a>) shown here. Tight control is not only a problem for kill switch application, but for any application requiring strict regulation. As such, we decided that expanding the registry repertoire of control elements would be useful for our system as well as a variety of other applications. Therefore we added a new level of regulation in addition to the promoter, a riboswitch.</p><br />
<h2> Introducing the Riboswitch </h2><br />
<p>Riboswitches are small pieces of mRNA which bind ligands to modify translation of downstream genes. These sites are engineered into circuits by replacing traditional ribosome binding sites with riboswitches. The riboswitch is able to bind its respective ligand to inhibit or promote binding of translational machinery (Vitreschak <i>et al</i>, 2004). Riboswitches can be used in tandem with an appropriate promoter to enable tighter control of gene expression. Given this opportunity for control, and that ligands for riboswitches are often inexpensive small ions, these methods might be a feasible solution for controlling the kill switch in our industrial bioreactor.</p><br />
<br />
</html> [[File:UofC_RIBOSWITCH.png|thumb|350px|centre|Figure 1: A simple diagram illustrating the riboswitch and the three metabolite, magnesium, manganese and molybdenum, we have tested.]] <html><br />
<br />
<p>We explored 3 different riboswitches, each responsive to a different metabolite (magnesium, manganese or molybdate co-factor) that would be inexpensive to implement into a bioreactor environment. Additionally, we also investigated a repressible and inducible promoter, responsive to glucose and rhamnose respectively.</p><br />
<p>The general approach taken to build the system was constructing the promoter with the respective riboswitch followed by the kill genes. </p><br />
<h2>Magnesium riboswitch</h2><br />
<p>The magnesium riboswitch that we looked at is repressed in the presence of magnesium ions. This system has two control components – a promoter and a riboswitch. Normally the magnesium (mgtA) promoter (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902009">BBa_K902009</a>) and the magnesium (mgtA) riboswitch (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902008">BBa_K902009</a>) are activated if there is a deficiency of magnesium in the cell (Winnie and Groisman, 2010). The sequence of the <i>mgtA</i> promoter and riboswitch was obtained from Winnie and Groisman. A lack of magnesium activates other genes in <i>E. coli </i>to allow influx of magnesium into the cell. The two proteins in the cascade that activate the system are <i>PhoP</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902010">BBa_K902010</a>) and <i>PhoQ</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902011">BBa_K902011</a>). <i>PhoQ</i> is the trans-membrane protein which gets activated in the absence of magnesium and phosphorylates <i>PhoP</i>. <i>PhoP</i> in turn binds to the mgtA promoter and transcribes genes downstream (Winnie and Groisman, 2010).</p><br />
<br />
<h2>Manganese riboswitch</h2><br />
<p> Manganese is an essential micronutrient. It is an important co-factor for enzymes and it also reduces oxidative stress in the cell (Waters <i>et al</i>. 2011). Despite being an important micronutrient, it is toxic to cells at high levels. MntR protein detects the level of manganese in the cell and acts as a transcription factor to control the expression of manganese transporter such as MntH, MntP and MntABCDE. In order to regulate these genes <i>mntR</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902030">BBa_K902030</a>) binds to the mntP promoter (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902073">BBa_K902073</a>). The manganese homeostasis is also controlled by the manganese riboswitch <i>mntPrb</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902074">BBa_K90274</a>). The sequences of the <i>mntP</i> promoter and the <i>mntP</i> riboswitch was obtained from the Waters et al, 2011.</p><br />
<br />
</html><br />
[[File:Ucalgary2012 KillswitchstuffsystemsAandB.png|thumb|800px|left|Figure 2: '''A)''' MgtA pathway in <i>E. coli</i>. <i>PhoQ</i> is the transmembrane receptor which, upon detecting low magnesium concentrations, phosphorylates <i>PhoP</i> which acts as a transcription factor, transcribing genes downstream of the MgtA promoter necessary for bringing magnesium into the cell. There is a second level of control with the magnesium riboswitch. In the presence of high magnesium the riboswitch forms a secondary structure which does not allow the ribosome to bind to the transcript, thus inhibiting translation. '''B)''' In the presence of manganese, the <i>MntR</i> protein represses the <i>mntH</i> transporter, preventing the movement of manganese and also upregulating the putative efflux pump. Genes downstream of the mntP promoter are thus transcribed in the presence of manganese. The addition of the <i>MntR</i> protein in this system allows for tighter regulation of the system.]]<html><br />
<br />
<h2> The Moco Riboswitch </h2><br />
<br />
<p>The molybdenum cofactor riboswitch (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902023">BBa_K902023</a>) is an RNA element which responds to the presence of the metabolite molybdenum cofactor (MOCO) (Regulski et al, 2008). This RNA element is located in the <i>E.coli</i> genome just upstream of the <i>moaABCDE</i> operon (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902024">BBa_K902024</a>), containing the MOCO synthesis genes. MOCO is an important co-factor in many different enzymes. The MOCO riboswitch has 2 regions: an aptamer domain and the expression platform. When MOCO is present in the cell it will bind to the aptamer region in the riboswitch causing an allosteric change. This allosteric change affects the expression platform by physically hiding the ribosome binding site which prevents translation.</p><br />
<br />
<br />
<br />
</html><br />
[[File:Moco_riboswitchCalgary2012.jpg|thumb|750px|center|Figure 3: This picture depicts the MOCO RNA motif which is upstream of the <i>moaABCDE</i> operon. ]]<html> <br />
<br />
<h2> Building the Systems </h2><br />
<br />
<p> Using these riboswitches, we wanted to design a system where we would place our kill genes downstream, and then supplement our bioreactor with the appropriate ions to keep the systems turned off. We biobricked and submitted DNA for the the <i>mgtaP</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902009">BBa_K902009</a>) and mntP promoter (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902073">BBa_K902073</a>) as well as their respective riboswitches (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902008">BBa_K902008</a>) (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902074">BBa_K902074</a>) and the MOCO riboswitch (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902023">BBa_K902023</a>). In addition, we also biobricked some of the regulatory proteins: <i>PhoP</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902010">BBa_K902010</a>), <i>PhoQ</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902011">BBa_K902011</a>), <i>mntR</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902030">BBa_K902030</a>) and the Moa Operon (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902024">BBa_K902024</a>) . Our final system would inovolve constitutive expression of these necessary regulatory elements upstream of our riboswitches and kill genes. An example of the manganese system is shown in figure 4. </p><br />
<br />
</html>[[File:U.Calgary.2012_10.02.2012_Final_Construct_1.png|thumb|600px|center|Figure 4: Final construct for the manganese system. The circuit includes a TetR promoter, RBS, mntR, double terminator, mntP promoter, mntP riboswitch, <i>S7</i>, mntP riboswitch and <i>CViAII</i>.]]<html><br />
<br />
<br />
<a name="killswitch"></a><h2> Characterizing the riboswitches </h2><br />
<br />
<h3> GFP testing</h3><br />
<br />
</html>[[File:MgtA circuits Ucalgary1.png|thumb|150px|right|Figure 5: In these sets of circuits, <i>TetR</i>-RBS-K082003 serves as a positive control and the <i>mgtAp-mgtArb</i> serves as a negative control.]]<html><br />
<br />
<p> In order to test the control of these promoters and riboswitches, we constructed them independently and together upstream of GFP (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K082003">BBa_K082003</a>) with an LVA tag. Figure 5 shows these circuits for the mgtA system. Identical circuits were designed for all three systems, however only the top two were needed for the MOCO riboswitch system.</p><br />
<br />
<p>We then tested the aforementioned circuits by growing cells containing our circuits with varying concentrations of their respective ions. Our detailed protocols can be found <a href="https://2012.igem.org/Team:Calgary/Notebook/Protocols/mgcircuit">here</a>. We then measured fluorescent output, normalizing to a negative control not expressing GFP.</p><br />
<br />
<h3> Results </h3><br />
<br />
<p>So far, we have been able to obtain results for our magnesium system, as can be seen in Figure 6. </html><br />
[[File:Magmesium graph ucalgary2.png|thumb|500px|left|Figure 6: This graph represents the relative fluorescence units from the mgtA promoter riboswitch construct as well as the riboswitch construct under the TetR promoter (BBa_R0040). We can see a decrease in the level of GFP output with increasing concentrations of magnesium. There is much steeper decrease in the GFP output in the construct with the magnesium promoter and riboswitch compared to the construct with just the riboswitch alone.]]<html></p><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br />
<br />
<br />
<p>As the graph shows, there is a much larger decrease in the GFP output when the mgtA promoter and riboswitch are working together as compared to the <i>mgtA</i> riboswitch alone under the control of TetR promoter (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_J13002">BBa_J13002</a>). This suggests that having both the promoter and the riboswitch together provides a tighter control over the genes expressed downstream. This also suggests that the magnesium riboswitch alone is sufficient in reducing gene expression downstream of a constitutive promoter.</p><br />
<br />
<p> It is important to consider however that the control elements of the system, <a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902010"><i>PhoP</i> </a> and <a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902011"> <i>PhoQ</i></a>, that were described above were not present in the circuits tested and therefore there is GFP expression in at the inhibitory concentration (10 mM MgCl<sub>2</sub>). We believe that having the regulatory elements would give us better control and limit the leakiness.</p><br />
<br />
<p>Although the magnesium system is highly regulated, it is not a suitable system for the purposes of our bioreactor. The tailings are composed of very high concentration of magnesium, as high as 120 mM (Kim <i>et al</i>. 2011). As can be seen, this would inhibit the system. Therefore, if our bacteria were to escape into the tailings, the kill genes would not be activated and the bacteria would be able to survive. However, we feel that this could still be an incredibly useful system for other teams for both killswitch and non-killswitch-related applications, making it still a valuable contribution to the registry. </p><br />
<br />
<h3> Kill Gene Testing </h3><br />
<br />
<p> While building our systems with GFP in order to test their control, we also constructed them with our kill genes. This was delayed substantially however due to problems in their synthesis. Specifically, the micrococcal nuclease that arrived from IDT had a 1bp point mutation which changed an isoleucine residue into a lysine. Initially, our systems resulted in no killing of cells. Therefore we had to mutate this residue using <a href="https://2012.igem.org/Team:Calgary/Notebook/Protocols/mutagenesis"> site-directed mutagenesis</a>. Once completed, we were able to begin testing. With our GFP data collected, we moved on to characterizing the mgtA control system upstream of our <i>S7</i> kill gene (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902019">BBa_K902019</a>). To test the circuits, we incubated cells expressing our construct with varying concentrations of magnesium. We then measured both Colony Forming Units (CFU) and OD 600. For a detailed protocol, see <a href="https://2012.igem.org/Team:Calgary/Notebook/Protocols/mgtacircuit">here</a>.</p><br />
<br />
<h3> Results </h3><br />
<br />
</html>[[File: 24 hour assay with mgtap-rb-S7-1.png|thumb|750px|center| Figure 7: This shows the OD600 values of mgtA circuits with S7 both mutated and unmutated. The negative control consists of <i>mgtAp-mgtArb</i>.]]<html><br />
<p> Figure 7 shows that the mgtAp-mgtArb-S7 (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902018">BBa_K902018</a>) starts acting approximately 4 hours after induction. However, it also shows that 10mM MgCl<sub>2</sub> is not enough salt to inhibit the entire system because there is no difference in OD600 measurement at 4hr time point between 10mM and the 0mM concentrations. This test needs to be repeated with higher concentrations of Mg<sup>2+</sup> however this data suggests that the mutagenesis was successful and <i>S7</i> is active and killing the cells at approximately 4hr which does not necessarily reflect solely upon the activity of <i>S7</i> but also on the response time of the mgtA system.</p><br />
<br />
<br />
<h2>An alternative: a glucose repressible system</h2><br />
<br />
<p>Based on the problem with the magnesium system in relation to tailings pond conditions, we wanted to find an alternative. We found a promoter that was induced by rhamnose and repressed by glucose. This seemed to be a very suitable candidate for controlling the kill switch in the bioreactor since the promoter was shown to be tightly repressed by glucose. We could supplement the bioreactor with glucose to inhibit expression of the kill genes in the bioreactor. Escape of bacteria into the tailings ponds would cause expression of the kill genes due to lack of glucose in the surrounding environment.<br />
</p> <br />
<p>This promoter, known as <i>pRha</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902065">BBa_K902065</a>), is responsible for regulating genes related to rhamnose metabolism and contains a separate promoter on its leading and reverse strands (see figure 8). <i>RhaR</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902069">BBa_K902069</a>) and <i>RhaS</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902068">BBa_K902068</a>) serve to regulate expression of the rhamnose metabolism operon <i>rhaBAD</i>. The <i>RhaR</i> transcription factor is activated by L-rhamnose to up-regulate expression <i>rhaSR</i> operon. In turn, the resulting <i>RhaS</i> activates the <i>rhaBAD</i> operon to generate the rhamnose metabolism genes (Egan & Schleif, 1993).</p><br />
<br />
</html>[[File:NativeRhamnosePromoter_Calgary2012.jpg|thumb|600px|center|Figure 8: The rhamnose metabolism genes as they exist in Top Ten <i>E. coli</i>]]<br />
<html><br />
<br />
</html>[[File:PrhaFinal.png|thumb|750px|center|Figure 9: The rhamnose metabolism genes native to <i>E. coli</i>]]<br />
<html><br />
<p>Our kill system is different from the native rhamnose system with the <i>rhaR</i> and <i>rhaS</i> control genes. We have constitutively expressed <i>RhaS</i> to overcome dependency on rhamnose to cause activation of the kill switch. While <i>RhaS</i> is continuously present, the system is shut off in the presence of glucose. However, in the outside environment glucose levels are lower such that <i>RhaS</i> is able to activate the kill genes.</p><br />
<h3>Building the system</h3><br />
<p>Our team had <i>pRha</i> promoter (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902065">BBa_K902065</a>) commercially synthesized as per the sequence given by Jeske and Altenbuchner (2010). The <i>rhaS</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902068">BBa_K902068</a>) and <i>rhaR</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902069">BBa_K902069</a>) genes were amplified via PCR from Top 10 <i>E. coli</i> using Kapa HiFi polymerase. </p><br />
<p>We tested the unoptimized rhamnose system using a fluorescent output. </html> [[File:Calgary_RhaGFPFinal.png|thumb|600px|centre|Figure 10: This has Prha-RBS-GFP that was incubated under different conditions. We can see a large increase with 0.2% rhamnose, 0.5% rhamnose whereas there is no GFP expression in the cells incubated with glucose.]] <html> </p><br />
<br />
<p> Figure 10 shows that the rhamnose system works as expected. The system is turned off with 0.2% glucose whereas GFP is significantly upregulated with 0.2% rhamnose and even more with 0.5% rhamnose. In this system we do not have the RhaS constitutively expressed and therefore GFP may not be expressed in the the control without either glucose or rhamnose. But, we are currently working on building this circuit and will be characterizing the RhaS with Prha and Prha by itself using GFP as a reporter.<br />
<br />
</p><br />
<p>Additionally, we also tested the rhamnose system with micrococcal nuclease in the presence of glucose and rhamnose in both Top10 cells as well as glyA knockout from the Keio knockout collection on the <a href="https://2012.igem.org/Team:Calgary/Project/Synergy">Synergy Page</a>. </p><br />
<br />
<p><br />
<h2> The Glycine Auxotroph </h2><br />
<p> The idea of using an auxotropic system was initially considered, however due to the pricing of this system we felt it to be inappropriate for a large scale bioreactor. Auxotrophic systems that we had looked into included the 5-fluoro-orotic acid and histidine, which were both found to be expensive. This idea was reconsidered when our <a href="https://2012.igem.org/Team:Calgary/Project/OSCAR/FluxAnalysis">Flux Variability Analysis</a> showed that the Petrobrick system can be optimized with glycine added to the media. The production of hydrocarbons increased by a factor of 3 with our glycine media when compared to Washington’s production media. This finding justified our introduction of a glycine auxotrophic system as the increased efficiency of the Petrobrick in addition to another safety feature far outweighed the cost of implementing the system. This is feasible because glycine is not readily found in the environment and is relatively inexpensive to supplement on a large scale. </p> <p> We used a knockout strain JW2535-1 from the Keio collection in which the gene responsible for the synthesis of glycine was knocked out. The bacteria become dependent on glycine in the environment. The JW2535-1 knockout strain used works directly on glyA which is a component of the glycine hydroxymethyltransferase by mutating the glyA into Kan which overall prevents the bacteria’s growth. A glycine assay was set up to determine concentrations of glycine needed for the survival of the bacteria. The bacteria were grown on minimal media plate with glycine concentrations ranging from 1nM to 100mM. When zero glycine was added to the media there was some bacterial growth over time. This system will therefore need to work in conjunction with the kill switch system as another layer of security to reduce possibility of escapers. Please see our <a href="https://2012.igem.org/Team:Calgary/Project/Synergy">Synergy Page</a> for more information. </p><br />
</html><br />
}}</div>Kevinm.huiehttp://2012.igem.org/Team:Calgary/Notebook/KillswitchTeam:Calgary/Notebook/Killswitch2012-10-27T03:23:09Z<p>Kevinm.huie: </p>
<hr />
<div>{{Team:Calgary/TemplateNotebookOrange|<br />
TITLE=Team Killswitch|<br />
CONTENT =<br />
<html><br />
<!--<br />
NOTE: This is a template for entering things for the time being. All dates should be enclosed in <h2> tags and all paragraphs should be enclosed in <p> tags. For bulleted lists, <ul> tags will create the list and <li> tags will surround each list item. If there are any questions, please let me know.<br />
<br />
Patrick.<br />
--><br />
<br />
<h2>Week 1 (May 1-4)</h2><br />
<p>This was the first week where we met with other team members and summarized the primary subprojects the team will be tackling this coming summer.</p><br />
<br />
<h2>Week 2 (May 7-11)</h2><br />
<p>Members were assigned to the killswitch team. We spent a majority of this week performing literature searches and narrowing the killswitch to a few ideas.</p><br />
<br />
<p>The mechanism of death is still settled upon the micrococcal nuclease, but regulation of the death genes will be difficult. Existing repressible promoters in the registry still tend to be leaky in their expression, but we need to test this out. We may look into the TetR-repressible promoter (<a href="http://partsregistry.org/Part:BBa_R0040">R0040</a>) and also the cl&lambda; regulated promoter (<a href="http://partsregistry.org/Part:BBa_R0051">R0051</a>).</p><br />
<br />
<p>We also found a few riboswitches responsible to various metal ions such as Mg<sup>2+</sup> and Mn<sup>2+</sup>. The <i>mgtA</i> riboswitch activates translation of the death gene when magnesium ions are not present in the solution. The <i>mntA</i> riboswitch deactivates translation of the death gene when manganese ions are not present. Considering this, we may be able to find a method of precipitating or otherwise sequestering Mn<sup>2+</sup> ions out of the tailings water prior to entering the bioreactor. This way, our bacteria would not die when they come into contact with the manganese in the tailings water. Possible additives include carbonate (CO<sub>3</sub><sup>2-</sup>) or hydroxide (OH<sup>-</sup>), though this may alter the pH greatly.</p><br />
<br />
<p>One other proposal would be to use promoters that activate when the bacteria detect the formation of a biofilm, for example, on glass beads. Engineering a monolayer of cells on a bead means that if a cell detaches, its death genes will activate. Further research into this is needed.</p><br />
<br />
<h2>Week 3 (May 14-18)</h2><br />
<p>We are continuing to look in to various other pathways. We discussed the possibility of a NOR-gated system to add a second layer of regulation to the kill gene. It would require the production of riboswitch ligands. Possible ligands include glucose, amino acids, and molybdenum cofactor.</p><br />
<br />
<p>We also looked into a co-dependent system where we would transform <i>E. coli</i> with two different plasmids and put them in the same bioreactor such that they produce ligands for each other that would repress the expression of the restriction enzyme and the nuclease. For this we explored riboswitches further and came up with the idea of using MOCO and SAM riboswitches as SAM is soluble in water and not found in the tailings ponds.</p> <br />
</html> [[File:Ucalgary_2012_Codependence_Mechanism_V2.png|thumb|400px|center|Proposed method of codependence. Two plasmids in two separate strains will produce ligands that repress the riboswitch controlling each other's death genes.]]<html><br />
<br />
<p> We also found a glucose repressible promoter that we could have potentially used upstream of the kill switch. This promoter is found in <i>F. tularensis</i>. However we also found that this promoter is not found in <i>E. coli</i>, and <i>F. tularensis</i> has a unique polymerase which used this promoter. Hence using this promoter does not seem feasible. <br />
<br />
Next week we will be looking into further possibilities for the kill switch.<br />
<br />
<h2>Week 4 (May 21-25)</h2><br />
<br />
<p>In terms of our literature search we decided against the glucose repressible promoter from F. tularensis because it was not native to E.coli and upon contact with the authors of the paper, we found that the promoter did not work in E.coli. We also came upon two systems that we are interested in further investigating. The first one was a glucose activated promoter that was found in the registry which we are thinking of coupling to an inverter and the second one is a rhamnose-based regulatory system.</p> <br />
<br />
<p>On Tuesday, in addition to our literature research, we decided on some of the circuits that we will be building over the next couple of weeks and came up with a plan detailing what will be done each day. These are the circuits:<br />
</p><br />
<br />
</html> [[File:Ucalgary2012_Pathways.jpg|thumb|400px|center]]<html><br />
<br />
<p> On Wednesday we proceeded with the transformation of 3 parts from the iGEM kit into our E.coli: a tetR promoter, a GFP-double terminator, and a RBS-GFP-double terminator. <br />
On Thursday we verified our transformation process with a cPCR where we ran 10 colonies from each plate with our controls. We ran a gel of the PCR products and viewed it to verify the transformation and to decide which of the successful colonies to plate and grow overnight. </p><br />
<br />
</html> [[File:UCalgary_Wrong_Gel_1.jpg|thumb|400px|center]]<html><br />
</html> [[File:UCalgary2012_Wrong_Gel_2.jpg|thumb|400px|center]]<html><br />
<br />
<p> On Friday we isolated the plasmids through a mini prep. <br />
The plan for next week is to do a restriction digest and run it on a gel to confirm that the plasmids have the part. We also want to start more transformation of our parts into E.coli such as the riboswitches and the promoters. We want to verify the transformation, isolate the plasmids and verify, and start the DNA construction digest to start building our circuit.</p><br />
<br />
<br />
<br />
<h2><br />
Week 5 (May 28-June 1)<br />
</h2><br />
<br />
<p><br />
During the week of May 28th, the killswitch team made progress toward transforming/verifying nine different parts in <i>E. coli</i>. Work began with continuation of the previous week's transformation of R0040 (TetR promoter), I13401 (GFP terminator), and I13504 (RBS GFP terminator). Note that these three parts will be necessary for characterization of the four different kill system triggers being explored by the killswitch team. Verification procedures (ie, colony PCR) showed successful transformation of I13401. Results for the other two parts were inconclusive and cloning of R0040 and I13504 will continue next week. <br />
</p><br />
<br />
<br />
<p><br />
The commercially synthesized mntA promoter, mgtA promoter, and mgtA riboswitch for the magnesium and manganese riboswitches were also transformed into <i>E. coli</i>. While colonies were successfully isolated, colony PCR was inconclusive because incorrect primers were used for the commercial plasmids. The team proceeded to isolate the plasmids from <i>E. coli</i>, perform a restriction digest of the parts, and ligation of these components into biobrick vectors. These products were transformed into other <i>E. coli</i> and the team is ready to verify presence of the cloned digest products.<br />
</p><br />
<br />
<p><br />
In continuation with magnesium and manganese riboswitches, the team attempted to biobrick mntR (a repressor of a manganese transporter activated by manganese), PhoP (a transcriptional regulator of mgtA), and PhoQ (a signal transducer which activated PhoP in the presence of divalent cations). The below PCR indicates that while PhoQ and mntR were successfully isolated, PhoP was not. The former two were transformed into <i>E. coli</i>; the transformed samples grew into a lawn and colony PCR will thus be performed next with re-streaked plates. Finally, gradient PCR was used in an attempt to biobrick PhoP.<br />
</p><br />
<br />
</html>[[File:HimikaGelGradient.jpg|thumb|400px|center]]<html><br />
<br />
<p>Lanes 6-9: PhoQ (~671 bp) <br /> Lanes 10-13: mntR (~500 bp)</p><br />
<br />
<p><br />
Primers for the MOCO and rhamnose killswitch actuators were also designed. With respect to the MOCO synthesis operon and MOCO riboswitch, primers were finalized and sent to senior members of the team. While primers for isolation of rhaSR and the rhaT promoter from <i>E. coli</i> were given in the paper which inspired the rhamnose promoter idea, the team was resistant to using the sequences since they did not seem to correlate with genes of interest in a BLAST search. Closer inspection revealed that the forward primer listed in the paper added a number of bases (>50) which were not native to the <i>E. coli</i> genome. Only 18 base pairs of the primer were complementary to <i>E. coli</i>—this discrepancy was responsible for the negative results of the BLAST alignment. Work will continue next week to optimize the rhamnose primers. They hope to order both the MOCO and rhamnose primers next week so that they may proceed with construction of the kill switch. <br />
</p><br />
<br />
<h2> Week 6 (June 4th-8th)</h2><br />
<br />
<p>This week we continued our attempt to biobrick PhoP, PhoQ and mntR. A gradient PCR was run with temperature and salt gradient (0.5mM-3.0mM). however this PCR showed no success whatsoever. We discovered that the primers designed for these parts were faulty and were binding in several places in the gene and thereby favouring products that are smaller in size. </p><br />
<p><br />
<br />
phoP-S GTTTCTTCGAATTCGCGGCCGCTTCTAGatgCGCGTACTGGTTGTTG</p><br />
<p><br />
phoP-AS GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTAtcaGCGCAATTCGAACAGATAG</p><br />
<p><br />
phoQ-S GTTTCTTCGAATTCGCGGCCGCTTCTAGatgaaaaaattactgcgtc</p><br />
<p><br />
phoQ-AS GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTAttattcatctttcggcgcag</p><br />
<p><br />
mntR-S GTTTCTTCGAATTCGCGGCCGCTTCTAGatgagtcgtcgcgcaggtac</p><br />
<p><br />
mntR-AS GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTAtcatttggcaccgtgtttc<br />
</p><br />
<br />
<p>Hence new primers were designed. </p><br />
<br />
<p> PhoPNEW-AS CTGCAGCGGCCGCTACTAGTAGCAGTAATTTTTTCATCAGCGCAATTCG</p><br />
<p> PhoQNEW-AS CTGCAGCGGCCGCTACTAGTAGCATATTTATTCATCTTTCGG </p><br />
<p> mntRNEW-S gaattcgcggccgcttctagGAGGAAGCACAATGAGTC </p><br />
<p> mntRNEW-AS CTGCAGCGGCCGCTACTAGTAGCGTGCGTAAAAAAGG</p><br />
<br />
<p>The killswitch team also focused on verification of both the magnesium/manganese (MgtA promoter, MgtA riboswitch and MntP promoter) and registry parts (R0040, I13401 and I13504).</p><br />
<br />
<p>For the magnesium/manganese parts this week we insert them in biobrick vectors in order to carry out colony PRR. Colony PCR of the magnesium/manganese parts could not have been done first since we did not have the right primer , therefore by doing a construction digest we could use the standard biobrick primers. From the gel, the results were inconclusive as the ladder was not clear and the parts were too small to tell the difference between them and primer dimers, therefore next week goal is to perform another CPCR of the parts. As well as doing colony PCR of the MgtA promoter, a restriction digest of this part was done. The gel showed good results as the bands were bright and the right size.</p><br />
<br />
</html>[[File:U.calgary.2012_06.08.2012_MgtA_Promoter_Restriction_Digest_2.jpg|thumb|400px|center|Restriction Digest of MgtA Promoter]]<html><br />
<br />
<p>For the registry parts R0040 no results were shown in the initial colony PCR, however another gel was done with R0040 from the 2010 and 2011 registry plate. The colony PCR of R0040 from 2011 showed the rights bands, however the results are inconclusive as the negative was contaminated, therefore most likely another colony PCR needs to be done.</p><br />
<br />
<p>The registry part I13401 had a successful week as both the colony PCR and the restriction digest verified our parts. Since the result was successful we performed glycerol stocks of the plasmid and prepared it for sequencing the following week.</p><br />
<br />
</html>[[File:U.calgary_2012.06.04.2012-CPCR_Registry_Parts.jpg|thumb|400px|center|Colony PCR of Registry Part I13401]]<html><br />
<br />
</html>[[File:U.Calgary.2012_06.05.2012-Emily_gelb_Registriction_Digest_I13401.jpg|thumb|400px|center|Restriction Digest of Registry Part I13401]]<html><br />
<br />
<p>The part I13504 showed no results this week therefore the goal next week is to find another part that is similar to I13504 and test its verification.</p><br />
<br />
<h2>Week 7 (June 11-14)</h2><br />
<br />
<p><br />
<br />
This week we continued the insertion of magnesium promoter (MgtA) into biobrick plasmid (PSB1C3) to carry out the colony PCR to confirm the presence of the Mgta part in the plasmid using Bbk_CP_F and Bbk_CP_R primers. We are currently in the process of further verification by using a mini prep.<br />
We also transformed four registry parts (J06702 [RBS-mCherry-dTerm], I13507 [RBS-RFP-dTerm], E0840 [RBS-GFP-dTerm] and E0240 [RBS-GFP-dTerm]) directly from the kit plates and verified the parts using colony PCR the following day. The primers used to verify these parts were Bbk_CP_F and Bbk_CP_R. These parts were successfully transformed but we still saw some contaminant bands in the gels (see below). <br />
</p><br />
<p><br />
<br />
</html>[[File:CPCRmntPpromoterUCALGARY.jpeg|thumb|400px|center]]<html>]</p><br />
<br />
<p><br />
<br />
Transformation of MntP in PSB1C3 vector was verified using colony PCR. However, the results indicated that the presence of MntP as well as a contaminant band around 3000 bp.</p><br />
<br />
<p></html>[[File:FourGlowingReportersUCLAGARY.jpeg|thumb|400px|center|Colony PCR of Registry Parts where J04650 was successful]]<html>]</p><br />
</p><br />
<br />
<p><br />
Transformation of registry parts I13521 [TetR-B0034-RFP-dTerm], I13507 and J04650 [RFP-dTerm] were performed and colony PCR was carried out to verify the presence of the parts in the cells. J04650 was the only part that was successfully transformed. Though the other parts were not successfully transformed, we can still see non-specific bands in the gel (see below). We are currently doing mini prep to additionally verify the success of transformation.</p><br />
<br />
</html>[[File:06.13.2012-transformedpartsHGD.jpg|thumb|400px|center|Colony PCR of Registry Parts where J04650 was successful]]<html><br />
<br />
<h2>Week 8 (June 18-June 22)</h2><br />
<br />
<p> This week we did a restriction digest of all the plasmids that were isolated. We confirmed that we had J04650, I13507, E0240 and mgtA riboswitch. Hence these were sent to sequencing. We got sequencing results back and confirmed that we have J04650, I13507, J06702, R0040, E0240 and mgtA riboswitch. Henceforth, we started constructing the mgtA riboswitch with J04650. </p> <br />
<br />
</html>[[File:06.21.12 Mgta Construct Digest Himika(1).jpg|thumb|400px|center|Restriction digest of mgtA riboswitch and J04650 construction]]<html><br />
<p> The mgtA riboswitch with J04650 was confirmed using PCR as well as restriction digest. We plan on sequencing it when we are able to construct it with a promoter. </p><br />
<br />
<br />
<h2>Week 9 (June 25-June 29)</h2><br />
<br />
<p> This week we attempted to construct the mgtA riboswith and J04650 construct with promoters such as MgtA and TetR. We also tried to plasmid switch I13507 such that we can put mgtA promoter on to that composite part. So far we have verified through colony PCR that it worked. This was verified again with restriction digest however the gel did not look too good therefore we ran the inserts and vectors to see how they looked. We will reattempt this again next week. </p><br />
<br />
<h2>Week 10 (July 3-July 6)</h2><br />
<br />
<p> This week, we attempted to religate our constructions from the previous week as they were not verified as positive in our colony PCR. We had run a gel to see if the inserts and vectors were digested properly and they were. Following transformation, we verified it through cPCR. The two gels show the results of construction involving two promoters (Mgta Promoter and a constitutive tetR promoter, R0040) and the mgta rbsw with different reporter gene constructs from the previous week. There are also some plasmid switches and constructions of the promoters and just the riboswitch. Based on these results, we isolated plasmids of R0040 + (Mgta RBSW and I13401) from L6 and L7 as well as I13507 from L8 from the first gel and R0040 + (Mgta RBSW and J04650) from the second gel (circled in red). We also transformed B0034, a ribosome binding site and constructed Mgta rbsw with a reporter construct with fast degrading GFP. </p><br />
<br />
</html>[[File:iGEMCalgary2012.07.04.2012 Construction cPCR.jpg|thumb|400px|center|Gel 1: Colony PCR of Constructions]]<html><br />
</html>[[File:iGEMCalgary2012.07.04.2012 Construction cPCR 2 (1) with label.jpg|thumb|400px|center|Gel 2: Colony PCR of Constructions]]<html><br />
<br />
<p> We verified these constructions with a digest. The third gel shows the digest and the lanes circled are the ones that look good and were sent to sequencing. </p><br />
<br />
</html>[[File:iGEMCalgary2012.07.06.2012 verification of overnight digest with labels.jpg|thumb|400px|center|Verification digest of constructions]]<html><br />
<br />
<h2>Week 11 (July 9-July 13)</h2><br />
<br />
<p> During the week of July 9th, construction was done on R0040 with J04650 and K082003 constructs as well as E0240 and B0034. Similarly the MgtA promoter was constructed with either J04650 construct, K082003 construct, E0240 or B0034. Furthermore a gel was run on the J04650 and K082003 constructs to check for genomic contamination which showed positive results for sequencing. </p><br />
<br />
</html>[[File:Uofcalgary_07.11.2012_MINI_PREP_RESULTS_2.jpg|thumb|400px|center|Gel of the Mini Prep to check for genomic contamination]]<html><br />
<br />
<p> From the restriction digest of the construction R0040 or MgtA promoter with the J04650 or K082003 constructs little results was shown, however some of the sequencing presented varying results. Sequencing of the R0040 with MgtA riboswitch and J04650 worked beside for weird sequencing around the scar site while both registry part E0240 and B0034 were good. The construct with MgtA promoter did not work as sequencing showed that the promoter was not part of the construct therefore the construction of these parts will have to continue another week. </p><br />
<br />
<p> Results from colony PCR showed positive bands for R0040 (vector) with B0034 (insert), R0040 (vector) with E0240 (insert) and B0034 (vector) with R0040 (insert). </p><br />
<br />
</html>[[File:U.Calgary.2012.07.12.2012_kevin_%26_rai_%27s_july10_constructs_CPCR_2.jpg|thumb|400px|center|Colony PCR of R0040 constructions]]<html><br />
<br />
<p> Construction of these constructs will be done another week as the restriction digest did not look good at the same time the ladder was not readable. </p><br />
<br />
</html>[[File:U.Calgary.2012.07.13.2012_CPCR_overnight_digest_and_RD_2.jpg|thumb|400px|center|Unreadable gel due to the ladder smearing]]<html><br />
<br />
<br />
<br />
<h2>Week 12 (July 16 to July 20)</h2><br />
<br />
<p>During week twelve (July 16th to July 20th), the kill switch team worked on three different projects: first, transformation/verification of kill genes; second, transformation and PCR of parts for the rhamnose inducible kill system; and third, construction of parts for characterization of the magnesium riboswitch kill system.</p><br />
<br />
<p>The commercially synthesized kill genes K131009 (colicin E2 operon w/o SOS promoter) and S7 nuclease (micrococal nuclease gene) were transformed into E. coli. Colonies transformed with these genes, along with the previously transformed K117000 (for colicin activation), K112808 (holin-antiholin lysis system), and endolysin, were subjected to verification procedures including colony PCR and verification digests. Successful transformants were sent off for commercial sequencing.</p><br />
<br />
<p>The team also began work on the the rhamnose inducible kill system since primers for rhaR and rhaS genes were received along with the synthesized rhamnose promoter. Temperature gradient PCRs (54C-59C; also 54C-65C with phusion)for the rhaR and rhaS genes were performed with no success. The rhamnose promoter was transformed into E. coli of which a plasmid stock was isolated by miniprep.</p><br />
<br />
<p>Finally, the team continued with constructions necessary for characterizing the magnesium riboswitch kill system. They continued with verification of the MgtA riboswithch with GFP and also GFP(+LVA tag) under a constitutive promoter.<br />
</p><br />
<br />
<br />
<br />
<h2>Week 13 (July 23 to July 27)</h2><br />
<br />
<p>During the week thirteen, the killswitch team performed plasmid switches of S7, mntP riboswitch and pRha (rhamnose inducible promoter) from the commercial IDT synthesis vector into pSB1C3.</p><br />
<br />
<p>Additionally, the team attempted to remove RhaR and RhaS from the E. coli genome via PCR. Kappa polymerase was used with a 50-65 degrees Celsius temperature gradient with no success. Given this failure, touchdown PCR from 58 to 74 degrees Celsius was performed on the RhaR and RhaS genes. These strategies failed. The team re-analyzed the primers used in these protocols; the antisense primers were erroneous and had to be redesigned.</p><br />
<br />
<p>Additionally, we tried construction of mgtAp with mgtArbsw-K082003. However no positive clones appeared in the follow up verification.</p> <br />
<br />
<p>We also worked on construction of R0040+B0034, R0040+E0240, R0040+MgtA Riboswitch, R0011+MgtA Riboswitch, MgtA Promoter+B0034, MgtA Promoter with MgtA Riboswich and GFP(+LVA tag), and B0034 with GFP(+LVA tag). These constructions are all in different phases of the verification process. The team also attempted to expedite construction of pRha (rhamnose promoter) and S7 (micrococcal nuclease) with BOO34 by building the directly from the commercial IDT synthesis vectors; however, this process failed due similar resistance genes on the IDT and BOO34 vectors.</p><br />
<br />
<br />
<br />
<br />
<h2>Week 14 (July 30 to August 3)</h2><br />
<br />
<p>This week we tried to construct R0040 and R0011 with mgtArb-K082003. This construction was done both ways, i.e both R0040 and mgtArb-K082003 were used as both vectors and insert. Out of these 2 constructions, R0040-mgtArb-K082003 gave positive clones however R0011-mgtArb-K082003 did not. A sample from a single colony with R0040-mgtArb-K082003 in pSB1C3 was sent to sequencing; the results were postively verified.</p><br />
<p>Additional constructions that were started include the following:</p><br />
<ul><br />
<li><p> R0011-mgtArbs</p></li><br />
<li><p> R0011-mgtArbs-K082003</p></li><br />
<li><p> mgtArb-S7</p></li><br />
<li><p> pRHA-B0034</p></li><br />
<li><p> B0034-S7</p></li><br />
<li><p> R0011-B0034</p></li><br />
<li><p> mntPrbs-K082003</p></li><br />
<li><p> mntPrbs-S7</p></li><br />
<li><p> B0034-S7 (ie, S7 in pSB1C3)</p></li><br />
</ul><br />
<p>Digest verification showed success with K082003+B0034, J13002+K082003, R0040+ MgtA Riboswitch, and R0040+E0240; henceforth these were submitted for sequencing.</p><br />
<br />
<br />
<br />
<h2>Week 15 (August 6 to August 10)</h2><br />
<br />
<p>Colony PCR was performed on constructions from the previous week. Positive results were obtained with the following constructions: R0011-MgtAriboswitch, MgtAriboswitch-S7, MntpRiboswithch-S7, R0011-B0034, and MntpRiboswich-K082003. Minipreps and verification digests were performed from the relevant colonies.</p><br />
<br />
<p>The commercially synthesized Mntp riboswitch and moco riboswitch were switched into PSB1C3 vectors. Colony PCR and restriction digest verification yielded positive results; these samples are destined for sequencing verification. Additionally, the team constructed tetR-RBS-GFP(+LVA. Verification procedures were performed. TetR-RBS-GFP(+LVA) is awaiting sequence verification.</p><br />
<br />
<p>Temperature gradient PCR and salt gradient PCR were used to optimize and amplify the moa operon from the E. coli genome. The rhaR gene was amplified from Top Ten E. coli colonies and and biobricked in pSB1C3 with Kapa polymerase. The rhaS gene was amplified from Top Ten E. coli on a 52 to 67 degree Celsius temperature with Kapa polymerase and DMSO.</p><br />
<p><br />
Continued working with MgtA Promoter+ B0034, R0011 +MgtA Riboswitch,B0034+K082003 and trying to get DNA of the MntP Promoter.</p><br />
<br />
<h2>Week 16 (August 13 to August 17)</h2><br />
<br />
<p>For the week of August 13th continuation of the construction of the MgtA Promoter +B0034, R0011+MgtA riboswitch and B0034+K082003 was conducted. Constructions of MgtA Promoter+B0034 and B0034+K082003 were tested with plasmid PCR several times however none of the plasmid PCR showed any bands on the gel. R0011+MgtA riboswitch restriction digest did not work therefore a reconstruction was done and will follow thought for the next week. One of the colonies from MntP Promoter IDT plate digested well and was therefore plasmid switch into pSB1C3.</p><br />
<p> We started plasmid switching parts that were not in pSB1C3 into pSB1C3. Additionally, we also started to characterize the magnesium system using mgtAp-mgtArb-K082003, mgtAp-mgtArb, R0040-mgtArb-K082003. We also tried to construct R0011-mgtArb, mntPrb-S7, mntPrb-S7J13002-K082003, R0011-mgtArb-K082003, B0034-S7. At the end of the week we were able to sequence verify B0034-S7 and mntPrb-K082003. </p><br />
<br />
<p>Finally, the rhamnose promoter system has been reoriented:</p><br />
</html>[[File:PrhaFinal.png|thumb|700px|center]]<html><br />
<br />
<p>In this finalized version of the construct, the RhaR gene has been left out from the system. Given that RhaR activates RhaS, and RhaS activates the pRha promoter, it should theoretically be sufficient to constituitively express the RhaS promoter to activate the system. Construct must continue so that it can be tested whether this new design will function and be repressible with glucose. Check out the <a href="https://2012.igem.org/Team:Calgary/Project/HumanPractices/Killswitch/Regulation#rhamnose">project page</a> for more details.<br />
</p><br />
<br />
<br />
<h2>Week 17 (August 20 to August 24)</h2><br />
<br />
<p>For the week of August 20th most of the constructions were redone while we continue with any other constructions we have already started since we noticed that we haven’t fully heat kill the enzymes. MgtA Promoter + B0034 was constructed with another B0034 that was in a kan vector while the MntP Promoter was redone from IDT as the previous MntP Promoter was not working.</p><br />
<p> This week we tried to construct mgtAp-mgtArb-S7-mgtArb so that we can construct CviAII when it would arrive. </p><br />
<br />
<p> We also attempted redoing the nuclease assay with S7 and <i>E. coli</i> genomic prep.This time the three different amounts of S7 was used. We used 200U, 50U and 10U. </p><br />
<br />
<p> The moa operon was biobricked and sequence verified. We are trying to construct the moa operon with a costitutive promoter and a ribosome binding site. </p><br />
<br />
</html>[[File:S7nuclease troubleshooting.png|thumb|500px|center|There is degredation with S7 and it looks like 10U is optimal for our purposes]]<html><br />
<br />
<p>Constructions of the rhamnose promoter (pRha) with GFP and S7 continued. These constructions have proven challenging and will have to be repeated next week.</p><br />
<br />
<br />
<h2>Week 18 (August 27 to August 31)</h2><br />
<br />
<p>For the week of August 27th constructions of MgtA Promoter +B0034, MntP Promoter +B0034 in Kan, R0010+ MgtA Riboswitch, R0010 +MntP Rbsw + S7, MntP promoter + MntP Riboswitch + S7 had to be redone as the ones done on last Friday did not grow or verification through PCR did not show positive results. After repeat trails of these construction CPCR showed that positive bands for MntP Promoter plasmid switch into kan vector, MgtA Promoter+B0034, MntP Promoter +B0034 (Kan), R0010 +MgtA Riboswitch and R0010 + MntP Riboswitch + S7. Since there was positive results was shown for these constructions, mini prep and digestion verification will be done the following week.</p><br />
<br />
<p> This week we kept reattempting our constructions however sequencing came back as things it should not have been randomly. Mostly Car genes from the denitrogenation team. Therefore we had to back to our glycerol stocks from the previously verified part and try to reconstruct our parts.</p><br />
<br />
<h2>Week 19 (September 3 to September 7)</h2><br />
<br />
<p>For the week of September 3rd constructions (MntP Promoter plasmid switch into kan vector, MgtA Promoter+B0034, MntP Promoter +B0034 (Kan), R0010 +MgtA Riboswitch and R0010 + MntP Riboswithc + S7), was verified with restriction digest and sent to sequencing. Also MntP Promoter+ MntP Riboswitch +S7 construction was reattempted after the enzyme incident where they were not fully heat killed.</p><br />
<br />
<br />
<h2>Week 20 (September 10 to September 14)</h2><br />
<br />
<p> The moco riboswitch was biobricked and sequence verified. Constructions of the moco riboswitch with different promoters (R0010, R0011, R0040) were attempted along with the moco riboswitch with the GFP LVA tag, CviaII and S7. The attempts of construction of the moa operon with the constitutive promoter and a ribosome binding site have not been successful thus far and is an ongoing project.</p><br />
<br />
<p> Some of the constructions of pRha and GFP looked promising in colony PCRs and verification digests. These samples were sent for sequencing. In the meantime, we attempted to induce the potential colonies with rhamnose to see if there was evidence of a successful construction prior to sequencing results. Results were negative compared to constituitively expressed GFP and a negative control. We awaiting sequencing results to confirm this failure.</p><br />
<br />
<br />
<h2>Week 21 (September 17 to September 21)</h2><br />
<br />
<p> The constructions with the moco riboswitch and the moa operon were not successful and were reattempted this week. </p><br />
<br />
<p> Rhamnose promoter constructions with GFP were negative as shown in sequencing results. We recommenced with this construction.</p><br />
<br />
<h2>Week 22 (September 24 to September 29)</h2><br />
<br />
<p> The constructions with the moco riboswitch and the kill genes and the GFP with LVA tag looked promising on the gels and were sent to sequencing. We tried to construct those constructs with a promoter. R0010 with the moco riboswitch and CviaII looked promising on the gels and was also sent to sequencing. </p><br />
<br />
<p> This week we reattempted the nuclease assay to compare BglII, BamHI, S7 and CviAII against each other. This time we used 10U of enzyme in each condition and tested degradation at every 45 minutes. </html>[[File:UCalgary2012 RE-S7&amp;CviaII.png|thumb|300px|center|Figure 1: This assay compares the enzymes present in the regitry i.e, BglII and BamHI to the enzymes added by us, S7 and CviAII. This shows that S7 and CviAII degrade the DNA much quicker than BglII and BamHI combined.]]<html> <br />
<br />
<h2>Week 22 (October 1 to Oct 3)</h2><br />
<br />
<p> The molybdate assay was attempted this week. mgtAp-rb-S7 construct was tested with mutated S7 and the synthesized S7. OD readings and CFU measurements were taken. </html>[[File:24 hour assay with mgtap-rb-S7 Ucalgary.png|thumb|750px|center| Figure 2: This shows the OD600 values of mgtA circuits with S7 both mutated and unmutated. The negative control consists of <i>mgtAp-mgtArb</i>.]]<html><br />
<p> Figure 2 shows that the mgtAp-mgtArb-S7 (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902018">BBa_K902018</a>) starts acting approximately 4 hours after induction. However,it also shows that 10mM MgCl<sub>2</sub> is not enough salt to inhibit the entire system because there is no difference in OD600 measurement at 4hr timepoint between 10mM and the 0mM concentrations. This test needs to be repeated with higher concentrations of Mg<sup>2+</sup> however this data suggests that the mutagenesis was successful and S7 is active and killing the cells at approximately 4hr which does not necessarily reflect upon the activity of S7 but also reflects upon the response time of the mgtA system.</p><br />
</p><br />
<br />
<h2>Week 23 (October 9 to October 12)</h2><br />
<br />
<p> The molybdate assay was not successful as the M9 media was contaminated. The assay was deemed not priority. Constructions of constitutive promoter and riboswitch were attempted with GFP (LVA tag) along with other constructions to complete the circuits shown in the regulation page. The constructs were transformed. <br />
</p><br />
<br />
<p><br />
With respect to the rhamnose expression system, our team repeated constructions of the following: Prha-B0034-GFP; and R0040-B0034-rhaS. However, given the trouble we had constructing these circuits, I decided to use gel extraction to isolate purified insert and vector following cutting with appropriate restriction enzymes. As well, I ensured that inserts were in an exact three to one ratio to their respective vectors. Finally, 1 microlitre of a 100mM solution of ATP were added to all ligation reactions since we suspected ATP degradation in our ligase buffer. The ligation reactions were carried out at room temperature overnight, and were frozen for the weekend of Regionals.<br />
</p><br />
<br />
<h2> October 12 to October 14: iGEM Regionals!</h2><br />
<br />
<h2>Week 24 (October 15 to October 19)</h2><br />
<p> With MOCO, the transformants which grew were amplified using colony PCR. When the samples were run on a gel the bands did not line up properly. Sequencing results came back and TetR promoter with Moco riboswitch was sequenced verified as well as the moco riboswitch with kill gene S7. Further constructions to complete the circuit were attempted and we ended up with 2 sequenced verified constructs of TetR promoter with moco riboswitch and S7 and GFP respectively. <br />
</p><br />
<br />
<p><br />
With the rhamnose system, the ATP spiked ligation reactions of Prha—B0034--GFP and R0040—B0034--rhaS were transformed into E. coli—a number of colonies were produced which were subsequently analyzed with PCR and digestion of isolated plasmids. There were colonies in both construction that appeared to be of appropriate size.<br />
</p><br />
<br />
<p><br />
We are hoping to complete the final rhamnose characterization circuit (Prha—B0034--GFP--R0040—B0034—rhaS) prior to finals; to this end, I designed primers for the <a href="https://2012.igem.org/Team:Calgary/Notebook/Protocols/Gibson_Assembly">Gibson assembly</a> of this circuit from plasmid stocks of pRha, B0034—GFP, B0034—rhaS, and pSB1C3.<br />
</p><br />
<br />
<h2>Week 25 (October 22 to October 26)</h2><br />
<p> The moco circuits were further constructed with a LacI promoter, a ribosome binding site, and the moaABCDE operon. This was sent to the registry. Characterization of these circuits are in progress. </p><br />
<br />
<p><br />
With the rhamnose system, sequencing results showed that we successfully constructed Prha—B0034—GFP. There was a mistake in the order so that R0040—B0034--rhaS was not send for sequencing. We will attempt to assemble the final kill switch construct using Biobrick Standard methods. Additionally, we will conduct an assay of Prha—B0034—GFP to see how rhamnose, glucose, and lack of these sugars might affect its fluorescence. The protocol can be seen <a href="https://2012.igem.org/Team:Calgary/Notebook/Protocols/Prha_Characterization">here</a>. We successfully show induction of this promoter with rhamnose and repression with glucose. See the <a href="https://2012.igem.org/Team:Calgary/Project/HumanPractices/Killswitch/Regulation">results</a> on our kill switch page.<br />
</p><br />
<br />
<p><br />
Also with rhamnose, we attempted to use Pfu to PCR out four elements for the Gibson assembly of the final rhamnose construct. The reactions were conducted on a 50 degree Celsius to 64 degree Celsius temperature gradient. Two of the PCR components were successfully amplified (B0034—GFP and pSB1C3); the other two elements require further optimization (B0034-RhaS and Prha).<br />
</p><br />
<br />
</html><br />
}}</div>Kevinm.huiehttp://2012.igem.org/Team:Calgary/Notebook/KillswitchTeam:Calgary/Notebook/Killswitch2012-10-27T02:38:43Z<p>Kevinm.huie: </p>
<hr />
<div>{{Team:Calgary/TemplateNotebookOrange|<br />
TITLE=Team Killswitch|<br />
CONTENT =<br />
<html><br />
<!--<br />
NOTE: This is a template for entering things for the time being. All dates should be enclosed in <h2> tags and all paragraphs should be enclosed in <p> tags. For bulleted lists, <ul> tags will create the list and <li> tags will surround each list item. If there are any questions, please let me know.<br />
<br />
Patrick.<br />
--><br />
<br />
<h2>Week 1 (May 1-4)</h2><br />
<p>This was the first week where we met with other team members and summarized the primary subprojects the team will be tackling this coming summer.</p><br />
<br />
<h2>Week 2 (May 7-11)</h2><br />
<p>Members were assigned to the killswitch team. We spent a majority of this week performing literature searches and narrowing the killswitch to a few ideas.</p><br />
<br />
<p>The mechanism of death is still settled upon the micrococcal nuclease, but regulation of the death genes will be difficult. Existing repressible promoters in the registry still tend to be leaky in their expression, but we need to test this out. We may look into the TetR-repressible promoter (<a href="http://partsregistry.org/Part:BBa_R0040">R0040</a>) and also the cl&lambda; regulated promoter (<a href="http://partsregistry.org/Part:BBa_R0051">R0051</a>).</p><br />
<br />
<p>We also found a few riboswitches responsible to various metal ions such as Mg<sup>2+</sup> and Mn<sup>2+</sup>. The <i>mgtA</i> riboswitch activates translation of the death gene when magnesium ions are not present in the solution. The <i>mntA</i> riboswitch deactivates translation of the death gene when manganese ions are not present. Considering this, we may be able to find a method of precipitating or otherwise sequestering Mn<sup>2+</sup> ions out of the tailings water prior to entering the bioreactor. This way, our bacteria would not die when they come into contact with the manganese in the tailings water. Possible additives include carbonate (CO<sub>3</sub><sup>2-</sup>) or hydroxide (OH<sup>-</sup>), though this may alter the pH greatly.</p><br />
<br />
<p>One other proposal would be to use promoters that activate when the bacteria detect the formation of a biofilm, for example, on glass beads. Engineering a monolayer of cells on a bead means that if a cell detaches, its death genes will activate. Further research into this is needed.</p><br />
<br />
<h2>Week 3 (May 14-18)</h2><br />
<p>We are continuing to look in to various other pathways. We discussed the possibility of a NOR-gated system to add a second layer of regulation to the kill gene. It would require the production of riboswitch ligands. Possible ligands include glucose, amino acids, and molybdenum cofactor.</p><br />
<br />
<p>We also looked into a co-dependent system where we would transform <i>E. coli</i> with two different plasmids and put them in the same bioreactor such that they produce ligands for each other that would repress the expression of the restriction enzyme and the nuclease. For this we explored riboswitches further and came up with the idea of using MOCO and SAM riboswitches as SAM is soluble in water and not found in the tailings ponds.</p> <br />
</html> [[File:Ucalgary_2012_Codependence_Mechanism_V2.png|thumb|400px|center|Proposed method of codependence. Two plasmids in two separate strains will produce ligands that repress the riboswitch controlling each other's death genes.]]<html><br />
<br />
<p> We also found a glucose repressible promoter that we could have potentially used upstream of the kill switch. This promoter is found in <i>F. tularensis</i>. However we also found that this promoter is not found in <i>E. coli</i>, and <i>F. tularensis</i> has a unique polymerase which used this promoter. Hence using this promoter does not seem feasible. <br />
<br />
Next week we will be looking into further possibilities for the kill switch.<br />
<br />
<h2>Week 4 (May 21-25)</h2><br />
<br />
<p>In terms of our literature search we decided against the glucose repressible promoter from F. tularensis because it was not native to E.coli and upon contact with the authors of the paper, we found that the promoter did not work in E.coli. We also came upon two systems that we are interested in further investigating. The first one was a glucose activated promoter that was found in the registry which we are thinking of coupling to an inverter and the second one is a rhamnose-based regulatory system.</p> <br />
<br />
<p>On Tuesday, in addition to our literature research, we decided on some of the circuits that we will be building over the next couple of weeks and came up with a plan detailing what will be done each day. These are the circuits:<br />
</p><br />
<br />
</html> [[File:Ucalgary2012_Pathways.jpg|thumb|400px|center]]<html><br />
<br />
<p> On Wednesday we proceeded with the transformation of 3 parts from the iGEM kit into our E.coli: a tetR promoter, a GFP-double terminator, and a RBS-GFP-double terminator. <br />
On Thursday we verified our transformation process with a cPCR where we ran 10 colonies from each plate with our controls. We ran a gel of the PCR products and viewed it to verify the transformation and to decide which of the successful colonies to plate and grow overnight. </p><br />
<br />
</html> [[File:UCalgary_Wrong_Gel_1.jpg|thumb|400px|center]]<html><br />
</html> [[File:UCalgary2012_Wrong_Gel_2.jpg|thumb|400px|center]]<html><br />
<br />
<p> On Friday we isolated the plasmids through a mini prep. <br />
The plan for next week is to do a restriction digest and run it on a gel to confirm that the plasmids have the part. We also want to start more transformation of our parts into E.coli such as the riboswitches and the promoters. We want to verify the transformation, isolate the plasmids and verify, and start the DNA construction digest to start building our circuit.</p><br />
<br />
<br />
<br />
<h2><br />
Week 5 (May 28-June 1)<br />
</h2><br />
<br />
<p><br />
During the week of May 28th, the killswitch team made progress toward transforming/verifying nine different parts in <i>E. coli</i>. Work began with continuation of the previous week's transformation of R0040 (TetR promoter), I13401 (GFP terminator), and I13504 (RBS GFP terminator). Note that these three parts will be necessary for characterization of the four different kill system triggers being explored by the killswitch team. Verification procedures (ie, colony PCR) showed successful transformation of I13401. Results for the other two parts were inconclusive and cloning of R0040 and I13504 will continue next week. <br />
</p><br />
<br />
<br />
<p><br />
The commercially synthesized mntA promoter, mgtA promoter, and mgtA riboswitch for the magnesium and manganese riboswitches were also transformed into <i>E. coli</i>. While colonies were successfully isolated, colony PCR was inconclusive because incorrect primers were used for the commercial plasmids. The team proceeded to isolate the plasmids from <i>E. coli</i>, perform a restriction digest of the parts, and ligation of these components into biobrick vectors. These products were transformed into other <i>E. coli</i> and the team is ready to verify presence of the cloned digest products.<br />
</p><br />
<br />
<p><br />
In continuation with magnesium and manganese riboswitches, the team attempted to biobrick mntR (a repressor of a manganese transporter activated by manganese), PhoP (a transcriptional regulator of mgtA), and PhoQ (a signal transducer which activated PhoP in the presence of divalent cations). The below PCR indicates that while PhoQ and mntR were successfully isolated, PhoP was not. The former two were transformed into <i>E. coli</i>; the transformed samples grew into a lawn and colony PCR will thus be performed next with re-streaked plates. Finally, gradient PCR was used in an attempt to biobrick PhoP.<br />
</p><br />
<br />
</html>[[File:HimikaGelGradient.jpg|thumb|400px|center]]<html><br />
<br />
<p>Lanes 6-9: PhoQ (~671 bp) <br /> Lanes 10-13: mntR (~500 bp)</p><br />
<br />
<p><br />
Primers for the MOCO and rhamnose killswitch actuators were also designed. With respect to the MOCO synthesis operon and MOCO riboswitch, primers were finalized and sent to senior members of the team. While primers for isolation of rhaSR and the rhaT promoter from <i>E. coli</i> were given in the paper which inspired the rhamnose promoter idea, the team was resistant to using the sequences since they did not seem to correlate with genes of interest in a BLAST search. Closer inspection revealed that the forward primer listed in the paper added a number of bases (>50) which were not native to the <i>E. coli</i> genome. Only 18 base pairs of the primer were complementary to <i>E. coli</i>—this discrepancy was responsible for the negative results of the BLAST alignment. Work will continue next week to optimize the rhamnose primers. They hope to order both the MOCO and rhamnose primers next week so that they may proceed with construction of the kill switch. <br />
</p><br />
<br />
<h2> Week 6 (June 4th-8th)</h2><br />
<br />
<p>This week we continued our attempt to biobrick PhoP, PhoQ and mntR. A gradient PCR was run with temperature and salt gradient (0.5mM-3.0mM). however this PCR showed no success whatsoever. We discovered that the primers designed for these parts were faulty and were binding in several places in the gene and thereby favouring products that are smaller in size. </p><br />
<p><br />
<br />
phoP-S GTTTCTTCGAATTCGCGGCCGCTTCTAGatgCGCGTACTGGTTGTTG</p><br />
<p><br />
phoP-AS GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTAtcaGCGCAATTCGAACAGATAG</p><br />
<p><br />
phoQ-S GTTTCTTCGAATTCGCGGCCGCTTCTAGatgaaaaaattactgcgtc</p><br />
<p><br />
phoQ-AS GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTAttattcatctttcggcgcag</p><br />
<p><br />
mntR-S GTTTCTTCGAATTCGCGGCCGCTTCTAGatgagtcgtcgcgcaggtac</p><br />
<p><br />
mntR-AS GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTAtcatttggcaccgtgtttc<br />
</p><br />
<br />
<p>Hence new primers were designed. </p><br />
<br />
<p> PhoPNEW-AS CTGCAGCGGCCGCTACTAGTAGCAGTAATTTTTTCATCAGCGCAATTCG</p><br />
<p> PhoQNEW-AS CTGCAGCGGCCGCTACTAGTAGCATATTTATTCATCTTTCGG </p><br />
<p> mntRNEW-S gaattcgcggccgcttctagGAGGAAGCACAATGAGTC </p><br />
<p> mntRNEW-AS CTGCAGCGGCCGCTACTAGTAGCGTGCGTAAAAAAGG</p><br />
<br />
<p>The killswitch team also focused on verification of both the magnesium/manganese (MgtA promoter, MgtA riboswitch and MntP promoter) and registry parts (R0040, I13401 and I13504).</p><br />
<br />
<p>For the magnesium/manganese parts this week we insert them in biobrick vectors in order to carry out colony PRR. Colony PCR of the magnesium/manganese parts could not have been done first since we did not have the right primer , therefore by doing a construction digest we could use the standard biobrick primers. From the gel, the results were inconclusive as the ladder was not clear and the parts were too small to tell the difference between them and primer dimers, therefore next week goal is to perform another CPCR of the parts. As well as doing colony PCR of the MgtA promoter, a restriction digest of this part was done. The gel showed good results as the bands were bright and the right size.</p><br />
<br />
</html>[[File:U.calgary.2012_06.08.2012_MgtA_Promoter_Restriction_Digest_2.jpg|thumb|400px|center|Restriction Digest of MgtA Promoter]]<html><br />
<br />
<p>For the registry parts R0040 no results were shown in the initial colony PCR, however another gel was done with R0040 from the 2010 and 2011 registry plate. The colony PCR of R0040 from 2011 showed the rights bands, however the results are inconclusive as the negative was contaminated, therefore most likely another colony PCR needs to be done.</p><br />
<br />
<p>The registry part I13401 had a successful week as both the colony PCR and the restriction digest verified our parts. Since the result was successful we performed glycerol stocks of the plasmid and prepared it for sequencing the following week.</p><br />
<br />
</html>[[File:U.calgary_2012.06.04.2012-CPCR_Registry_Parts.jpg|thumb|400px|center|Colony PCR of Registry Part I13401]]<html><br />
<br />
</html>[[File:U.Calgary.2012_06.05.2012-Emily_gelb_Registriction_Digest_I13401.jpg|thumb|400px|center|Restriction Digest of Registry Part I13401]]<html><br />
<br />
<p>The part I13504 showed no results this week therefore the goal next week is to find another part that is similar to I13504 and test its verification.</p><br />
<br />
<h2>Week 7 (June 11-14)</h2><br />
<br />
<p><br />
<br />
This week we continued the insertion of magnesium promoter (MgtA) into biobrick plasmid (PSB1C3) to carry out the colony PCR to confirm the presence of the Mgta part in the plasmid using Bbk_CP_F and Bbk_CP_R primers. We are currently in the process of further verification by using a mini prep.<br />
We also transformed four registry parts (J06702 [RBS-mCherry-dTerm], I13507 [RBS-RFP-dTerm], E0840 [RBS-GFP-dTerm] and E0240 [RBS-GFP-dTerm]) directly from the kit plates and verified the parts using colony PCR the following day. The primers used to verify these parts were Bbk_CP_F and Bbk_CP_R. These parts were successfully transformed but we still saw some contaminant bands in the gels (see below). <br />
</p><br />
<p><br />
<br />
</html>[[File:CPCRmntPpromoterUCALGARY.jpeg|thumb|400px|center]]<html>]</p><br />
<br />
<p><br />
<br />
Transformation of MntP in PSB1C3 vector was verified using colony PCR. However, the results indicated that the presence of MntP as well as a contaminant band around 3000 bp.</p><br />
<br />
<p></html>[[File:FourGlowingReportersUCLAGARY.jpeg|thumb|400px|center|Colony PCR of Registry Parts where J04650 was successful]]<html>]</p><br />
</p><br />
<br />
<p><br />
Transformation of registry parts I13521 [TetR-B0034-RFP-dTerm], I13507 and J04650 [RFP-dTerm] were performed and colony PCR was carried out to verify the presence of the parts in the cells. J04650 was the only part that was successfully transformed. Though the other parts were not successfully transformed, we can still see non-specific bands in the gel (see below). We are currently doing mini prep to additionally verify the success of transformation.</p><br />
<br />
</html>[[File:06.13.2012-transformedpartsHGD.jpg|thumb|400px|center|Colony PCR of Registry Parts where J04650 was successful]]<html><br />
<br />
<h2>Week 8 (June 18-June 22)</h2><br />
<br />
<p> This week we did a restriction digest of all the plasmids that were isolated. We confirmed that we had J04650, I13507, E0240 and mgtA riboswitch. Hence these were sent to sequencing. We got sequencing results back and confirmed that we have J04650, I13507, J06702, R0040, E0240 and mgtA riboswitch. Henceforth, we started constructing the mgtA riboswitch with J04650. </p> <br />
<br />
</html>[[File:06.21.12 Mgta Construct Digest Himika(1).jpg|thumb|400px|center|Restriction digest of mgtA riboswitch and J04650 construction]]<html><br />
<p> The mgtA riboswitch with J04650 was confirmed using PCR as well as restriction digest. We plan on sequencing it when we are able to construct it with a promoter. </p><br />
<br />
<br />
<h2>Week 9 (June 25-June 29)</h2><br />
<br />
<p> This week we attempted to construct the mgtA riboswith and J04650 construct with promoters such as MgtA and TetR. We also tried to plasmid switch I13507 such that we can put mgtA promoter on to that composite part. So far we have verified through colony PCR that the<br />
<br />
<h2>Week 10 (July 3-July 6)</h2><br />
<br />
<p> This week, we attempted to religate our constructions from the previous week as they were not verified as positive in our colony PCR. We had run a gel to see if the inserts and vectors were digested properly and they were. Following transformation, we verified it through cPCR. The two gels show the results of construction involving two promoters (Mgta Promoter and a constitutive tetR promoter, R0040) and the mgta rbsw with different reporter gene constructs from the previous week. There are also some plasmid switches and constructions of the promoters and just the riboswitch. Based on these results, we isolated plasmids of R0040 + (Mgta RBSW and I13401) from L6 and L7 as well as I13507 from L8 from the first gel and R0040 + (Mgta RBSW and J04650) from the second gel (circled in red). We also transformed B0034, a ribosome binding site and constructed Mgta rbsw with a reporter construct with fast degrading GFP. </p><br />
<br />
</html>[[File:iGEMCalgary2012.07.04.2012 Construction cPCR.jpg|thumb|400px|center|Gel 1: Colony PCR of Constructions]]<html><br />
</html>[[File:iGEMCalgary2012.07.04.2012 Construction cPCR 2 (1) with label.jpg|thumb|400px|center|Gel 2: Colony PCR of Constructions]]<html><br />
<br />
<p> We verified these constructions with a digest. The third gel shows the digest and the lanes circled are the ones that look good and were sent to sequencing. </p><br />
<br />
</html>[[File:iGEMCalgary2012.07.06.2012 verification of overnight digest with labels.jpg|thumb|400px|center|Verification digest of constructions]]<html><br />
<br />
<h2>Week 11 (July 9-July 13)</h2><br />
<br />
<p> During the week of July 9th, construction was done on R0040 with J04650 and K082003 constructs as well as E0240 and B0034. Similarly the MgtA promoter was constructed with either J04650 construct, K082003 construct, E0240 or B0034. Furthermore a gel was run on the J04650 and K082003 constructs to check for genomic contamination which showed positive results for sequencing. </p><br />
<br />
</html>[[File:Uofcalgary_07.11.2012_MINI_PREP_RESULTS_2.jpg|thumb|400px|center|Gel of the Mini Prep to check for genomic contamination]]<html><br />
<br />
<p> From the restriction digest of the construction R0040 or MgtA promoter with the J04650 or K082003 constructs little results was shown, however some of the sequencing presented varying results. Sequencing of the R0040 with MgtA riboswitch and J04650 worked beside for weird sequencing around the scar site while both registry part E0240 and B0034 were good. The construct with MgtA promoter did not work as sequencing showed that the promoter was not part of the construct therefore the construction of these parts will have to continue another week. </p><br />
<br />
<p> Results from colony PCR showed positive bands for R0040 (vector) with B0034 (insert), R0040 (vector) with E0240 (insert) and B0034 (vector) with R0040 (insert). </p><br />
<br />
</html>[[File:U.Calgary.2012.07.12.2012_kevin_%26_rai_%27s_july10_constructs_CPCR_2.jpg|thumb|400px|center|Colony PCR of R0040 constructions]]<html><br />
<br />
<p> Construction of these constructs will be done another week as the restriction digest did not look good at the same time the ladder was not readable. </p><br />
<br />
</html>[[File:U.Calgary.2012.07.13.2012_CPCR_overnight_digest_and_RD_2.jpg|thumb|400px|center|Unreadable gel due to the ladder smearing]]<html><br />
<br />
<br />
<br />
<h2>Week 12 (July 16 to July 20)</h2><br />
<br />
<p>During week twelve (July 16th to July 20th), the kill switch team worked on three different projects: first, transformation/verification of kill genes; second, transformation and PCR of parts for the rhamnose inducible kill system; and third, construction of parts for characterization of the magnesium riboswitch kill system.</p><br />
<br />
<p>The commercially synthesized kill genes K131009 (colicin E2 operon w/o SOS promoter) and S7 nuclease (micrococal nuclease gene) were transformed into E. coli. Colonies transformed with these genes, along with the previously transformed K117000 (for colicin activation), K112808 (holin-antiholin lysis system), and endolysin, were subjected to verification procedures including colony PCR and verification digests. Successful transformants were sent off for commercial sequencing.</p><br />
<br />
<p>The team also began work on the the rhamnose inducible kill system since primers for rhaR and rhaS genes were received along with the synthesized rhamnose promoter. Temperature gradient PCRs (54C-59C; also 54C-65C with phusion)for the rhaR and rhaS genes were performed with no success. The rhamnose promoter was transformed into E. coli of which a plasmid stock was isolated by miniprep.</p><br />
<br />
<p>Finally, the team continued with constructions necessary for characterizing the magnesium riboswitch kill system. They continued with verification of the MgtA riboswithch with GFP and also GFP(+LVA tag) under a constitutive promoter.<br />
</p><br />
<br />
<br />
<br />
<h2>Week 13 (July 23 to July 27)</h2><br />
<br />
<p>During the week thirteen, the killswitch team performed plasmid switches of S7, mntP riboswitch and pRha (rhamnose inducible promoter) from the commercial IDT synthesis vector into pSB1C3.</p><br />
<br />
<p>Additionally, the team attempted to remove RhaR and RhaS from the E. coli genome via PCR. Kappa polymerase was used with a 50-65 degrees Celsius temperature gradient with no success. Given this failure, touchdown PCR from 58 to 74 degrees Celsius was performed on the RhaR and RhaS genes. These strategies failed. The team re-analyzed the primers used in these protocols; the antisense primers were erroneous and had to be redesigned.</p><br />
<br />
<p>Additionally, we tried construction of mgtAp with mgtArbsw-K082003. However no positive clones appeared in the follow up verification.</p> <br />
<br />
<p>We also worked on construction of R0040+B0034, R0040+E0240, R0040+MgtA Riboswitch, R0011+MgtA Riboswitch, MgtA Promoter+B0034, MgtA Promoter with MgtA Riboswich and GFP(+LVA tag), and B0034 with GFP(+LVA tag). These constructions are all in different phases of the verification process. The team also attempted to expedite construction of pRha (rhamnose promoter) and S7 (micrococcal nuclease) with BOO34 by building the directly from the commercial IDT synthesis vectors; however, this process failed due similar resistance genes on the IDT and BOO34 vectors.</p><br />
<br />
<br />
<br />
<br />
<h2>Week 14 (July 30 to August 3)</h2><br />
<br />
<p>This week we tried to construct R0040 and R0011 with mgtArb-K082003. This construction was done both ways, i.e both R0040 and mgtArb-K082003 were used as both vectors and insert. Out of these 2 constructions, R0040-mgtArb-K082003 gave positive clones however R0011-mgtArb-K082003 did not. A sample from a single colony with R0040-mgtArb-K082003 in pSB1C3 was sent to sequencing; the results were postively verified.</p><br />
<p>Additional constructions that were started include the following:</p><br />
<ul><br />
<li><p> R0011-mgtArbs</p></li><br />
<li><p> R0011-mgtArbs-K082003</p></li><br />
<li><p> mgtArb-S7</p></li><br />
<li><p> pRHA-B0034</p></li><br />
<li><p> B0034-S7</p></li><br />
<li><p> R0011-B0034</p></li><br />
<li><p> mntPrbs-K082003</p></li><br />
<li><p> mntPrbs-S7</p></li><br />
<li><p> B0034-S7 (ie, S7 in pSB1C3)</p></li><br />
</ul><br />
<p>Digest verification showed success with K082003+B0034, J13002+K082003, R0040+ MgtA Riboswitch, and R0040+E0240; henceforth these were submitted for sequencing.</p><br />
<br />
<br />
<br />
<h2>Week 15 (August 6 to August 10)</h2><br />
<br />
<p>Colony PCR was performed on constructions from the previous week. Positive results were obtained with the following constructions: R0011-MgtAriboswitch, MgtAriboswitch-S7, MntpRiboswithch-S7, R0011-B0034, and MntpRiboswich-K082003. Minipreps and verification digests were performed from the relevant colonies.</p><br />
<br />
<p>The commercially synthesized Mntp riboswitch and moco riboswitch were switched into PSB1C3 vectors. Colony PCR and restriction digest verification yielded positive results; these samples are destined for sequencing verification. Additionally, the team constructed tetR-RBS-GFP(+LVA. Verification procedures were performed. TetR-RBS-GFP(+LVA) is awaiting sequence verification.</p><br />
<br />
<p>Temperature gradient PCR and salt gradient PCR were used to optimize and amplify the moa operon from the E. coli genome. The rhaR gene was amplified from Top Ten E. coli colonies and and biobricked in pSB1C3 with Kapa polymerase. The rhaS gene was amplified from Top Ten E. coli on a 52 to 67 degree Celsius temperature with Kapa polymerase and DMSO.</p><br />
<p><br />
Continued working with MgtA Promoter+ B0034, R0011 +MgtA Riboswitch,B0034+K082003 and trying to get DNA of the MntP Promoter.</p><br />
<br />
<h2>Week 16 (August 13 to August 17)</h2><br />
<br />
<p>For the week of August 13th continuation of the construction of the MgtA Promoter +B0034, R0011+MgtA riboswitch and B0034+K082003 was conducted. Constructions of MgtA Promoter+B0034 and B0034+K082003 were tested with plasmid PCR several times however none of the plasmid PCR showed any bands on the gel. R0011+MgtA riboswitch restriction digest did not work therefore a reconstruction was done and will follow thought for the next week. One of the colonies from MntP Promoter IDT plate digested well and was therefore plasmid switch into pSB1C3.</p><br />
<p> We started plasmid switching parts that were not in pSB1C3 into pSB1C3. Additionally, we also started to characterize the magnesium system using mgtAp-mgtArb-K082003, mgtAp-mgtArb, R0040-mgtArb-K082003. We also tried to construct R0011-mgtArb, mntPrb-S7, mntPrb-S7J13002-K082003, R0011-mgtArb-K082003, B0034-S7. At the end of the week we were able to sequence verify B0034-S7 and mntPrb-K082003. </p><br />
<br />
<p>Finally, the rhamnose promoter system has been reoriented:</p><br />
</html>[[File:PrhaFinal.png|thumb|700px|center]]<html><br />
<br />
<p>In this finalized version of the construct, the RhaR gene has been left out from the system. Given that RhaR activates RhaS, and RhaS activates the pRha promoter, it should theoretically be sufficient to constituitively express the RhaS promoter to activate the system. Construct must continue so that it can be tested whether this new design will function and be repressible with glucose. Check out the <a href="https://2012.igem.org/Team:Calgary/Project/HumanPractices/Killswitch/Regulation#rhamnose">project page</a> for more details.<br />
</p><br />
<br />
<br />
<h2>Week 17 (August 20 to August 24)</h2><br />
<br />
<p>For the week of August 20th most of the constructions were redone while we continue with any other constructions we have already started since we noticed that we haven’t fully heat kill the enzymes. MgtA Promoter + B0034 was constructed with another B0034 that was in a kan vector while the MntP Promoter was redone from IDT as the previous MntP Promoter was not working.</p><br />
<p> This week we tried to construct mgtAp-mgtArb-S7-mgtArb so that we can construct CviAII when it would arrive. </p><br />
<br />
<p> We also attempted redoing the nuclease assay with S7 and <i>E. coli</i> genomic prep.This time the three different amounts of S7 was used. We used 200U, 50U and 10U. </p><br />
<br />
<p> The moa operon was biobricked and sequence verified. We are trying to construct the moa operon with a costitutive promoter and a ribosome binding site. </p><br />
<br />
</html>[[File:S7nuclease troubleshooting.png|thumb|500px|center|There is degredation with S7 and it looks like 10U is optimal for our purposes]]<html><br />
<br />
<p>Constructions of the rhamnose promoter (pRha) with GFP and S7 continued. These constructions have proven challenging and will have to be repeated next week.</p><br />
<br />
<br />
<h2>Week 18 (August 27 to August 31)</h2><br />
<br />
<p>For the week of August 27th constructions of MgtA Promoter +B0034, MntP Promoter +B0034 in Kan, R0010+ MgtA Riboswitch, R0010 +MntP Rbsw + S7, MntP promoter + MntP Riboswitch + S7 had to be redone as the ones done on last Friday did not grow or verification through PCR did not show positive results. After repeat trails of these construction CPCR showed that positive bands for MntP Promoter plasmid switch into kan vector, MgtA Promoter+B0034, MntP Promoter +B0034 (Kan), R0010 +MgtA Riboswitch and R0010 + MntP Riboswitch + S7. Since there was positive results was shown for these constructions, mini prep and digestion verification will be done the following week.</p><br />
<br />
<p> This week we kept reattempting our constructions however sequencing came back as things it should not have been randomly. Mostly Car genes from the denitrogenation team. Therefore we had to back to our glycerol stocks from the previously verified part and try to reconstruct our parts.</p><br />
<br />
<h2>Week 19 (September 3 to September 7)</h2><br />
<br />
<p>For the week of September 3rd constructions (MntP Promoter plasmid switch into kan vector, MgtA Promoter+B0034, MntP Promoter +B0034 (Kan), R0010 +MgtA Riboswitch and R0010 + MntP Riboswithc + S7), was verified with restriction digest and sent to sequencing. Also MntP Promoter+ MntP Riboswitch +S7 construction was reattempted after the enzyme incident where they were not fully heat killed.</p><br />
<br />
<br />
<h2>Week 20 (September 10 to September 14)</h2><br />
<br />
<p> The moco riboswitch was biobricked and sequence verified. Constructions of the moco riboswitch with different promoters (R0010, R0011, R0040) were attempted along with the moco riboswitch with the GFP LVA tag, CviaII and S7. The attempts of construction of the moa operon with the constitutive promoter and a ribosome binding site have not been successful thus far and is an ongoing project.</p><br />
<br />
<p> Some of the constructions of pRha and GFP looked promising in colony PCRs and verification digests. These samples were sent for sequencing. In the meantime, we attempted to induce the potential colonies with rhamnose to see if there was evidence of a successful construction prior to sequencing results. Results were negative compared to constituitively expressed GFP and a negative control. We awaiting sequencing results to confirm this failure.</p><br />
<br />
<br />
<h2>Week 21 (September 17 to September 21)</h2><br />
<br />
<p> The constructions with the moco riboswitch and the moa operon were not successful and were reattempted this week. </p><br />
<br />
<p> Rhamnose promoter constructions with GFP were negative as shown in sequencing results. We recommenced with this construction.</p><br />
<br />
<h2>Week 22 (September 24 to September 29)</h2><br />
<br />
<p> The constructions with the moco riboswitch and the kill genes and the GFP with LVA tag looked promising on the gels and were sent to sequencing. We tried to construct those constructs with a promoter. R0010 with the moco riboswitch and CviaII looked promising on the gels and was also sent to sequencing. </p><br />
<br />
<p> This week we reattempted the nuclease assay to compare BglII, BamHI, S7 and CviAII against each other. This time we used 10U of enzyme in each condition and tested degradation at every 45 minutes. </html>[[File:UCalgary2012 RE-S7&amp;CviaII.png|thumb|300px|center|Figure 2: This assay compares the enzymes present in the regitry i.e, BglII and BamHI to the enzymes added by us, S7 and CviAII. This shows that S7 and CviAII degrade the DNA much quicker than BglII and BamHI combined.]]<html> <br />
<br />
<h2>Week 22 (October 1 to Oct 3)</h2><br />
<br />
<p> The molybdate assay was attempted this week. mgtAp-rb-S7 construct was tested with mutated S7 and the synthesized S7. OD readings and CFU measurements were taken. </html>[[File:24 hour assay with mgtap-rb-S7 Ucalgary.png|thumb|750px|center| Figure 6: This shows the OD600 values of mgtA circuits with S7 both mutated and unmutated. The negative control consists of <i>mgtAp-mgtArb</i>.]]<html><br />
<p> Figure 6 shows that the mgtAp-mgtArb-S7 (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902018">BBa_K902018</a>) starts acting approximately 4 hours after induction. However,it also shows that 10mM MgCl<sub>2</sub> is not enough salt to inhibit the entire system because there is no difference in OD600 measurement at 4hr timepoint between 10mM and the 0mM concentrations. This test needs to be repeated with higher concentrations of Mg<sup>2+</sup> however this data suggests that the mutagenesis was successful and S7 is active and killing the cells at approximately 4hr which does not necessarily reflect upon the activity of S7 but also reflects upon the response time of the mgtA system.</p><br />
</p><br />
<br />
<h2>Week 23 (October 9 to October 12)</h2><br />
<br />
<p> The molybdate assay was not successful as the M9 media was contaminated. The assay was deemed not priority. Constructions of constitutive promoter and riboswitch were attempted with GFP (LVA tag) along with other constructions to complete the circuits shown in the regulation page. The constructs were transformed. <br />
<br />
</p><br />
<h2> October 12 to October 14: iGEM Regionals!</h2><br />
<h2>Week 24 (October 15 to October 19)</h2><br />
<p> The transformants which grew were amplified using colony PCR. When the samples were run on a gel the bands did not line up properly. Sequencing results came back and TetR promoter with Moco riboswitch was sequenced verified as well as the moco riboswitch with kill gene S7. Further constructions to complete the circuit were attempted and we ended up with 2 sequenced verified constructs of TetR promoter with moco riboswitch and S7 and GFP respectively. <br />
</p><br />
<h2>Week 25 (October 22 to October 26)</h2><br />
<br />
<p> The moco circuits were further constructed with a LacI promoter, a ribosome binding site, and the moaABCDE operon. This was sent to the registry. Characterization of these circuits are in progress. </p><br />
<br />
</html><br />
}}</div>Kevinm.huiehttp://2012.igem.org/Team:Calgary/Project/ReferencesTeam:Calgary/Project/References2012-10-27T02:28:26Z<p>Kevinm.huie: </p>
<hr />
<div>{{Team:Calgary/TemplateProjectOrange|<br />
TITLE=References|<br />
CONTENT={{{CONTENT|<br />
<html><br />
<br />
<br />
<ul><br />
<br />
<li>2009 iGEM Calgary. <a href="https://2009.igem.org/Team:Calgary/Notebook"> https://2009.igem.org/Team:Calgary/Notebook</a> </li><br><br />
<br />
<li>Asenjo JA. (1949). Bioreactor system design. New York (NY): Marcel Dekker Inc.</li><br><br />
<br />
<li>Baba T, Ara T, Hasegawa M, Takai Y, Okumura Y, Baba M, Datsenko KA, Tomita M, Wanner BL, and Mori H. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol 2006 Feb;1-11.</li><br><br />
<br />
<li>Becker SA, Feist AM, Mo ML, Hannum G, Palsson BØ, Herrgard MJ. Quantitative prediction of cellular metabolism with constraint-based models: the COBRA Toolbox. Nature Protocols 2 2007 Mar; 727-723.</li></br><br />
<br />
<li>Becker SA, Feist AM, Mo ML, Hannum G, Palsson BØ, Herrgard MJ. Quantitative prediction of cellular metabolism with constraint-based models: the COBRA Toolbox v2.0. Nature Protocols 6 2011 Aug; 1290-1307.</li></br><br />
<br />
<li>Behar FH, Albrecht P. Correlations between carboxylic acids and hydrocarbons in several crude oils alteration by biodegradation. Org Geochem 1984;6:597-604. </li><br><br />
<br />
<li>Bergman L. Growth and maintenance of yeast. Methods in Molecular Biology. 2001May; 177: 9-39.</li><br><br />
<br />
<li>Biran I, Levcov K, Hengge-Aronis R, Ron EZ, Rishpon J. On-line monitoring of gene expression. Microbiology.1999 April;145:2129-2133.</li><br><br />
<br />
<li>Canadian Centre for Occupational Health and Safety: Health Effects of Sulfur Dioxid. <a href="http://www.ccohs.ca/oshanswers/chemicals/chem_profiles/sulfurdi/health_sul.html">http://www.ccohs.ca/oshanswers/chemicals/chem_profiles/sulfurdi/health_sul.html</a> (Retrieved: 09/18/2012)</li><br><br />
<br />
<li>Clemente JS, Fedorak PM. A review of the occurrences, analyses, toxicity, and biodegradation of naphthenic acids. Chemosphere 2005 Feb 6;60(5):585-600.</li><br><br />
<br />
<li>Clemente JS, Prasad NGN, MacKinnon MD, Fedorak PM. A statistical comparison of naphthenic acids characterized by gas chromatography-mass spectrometry. Chemosphere 2003. 50:1265-1274.</li><br><br />
<br />
<li>Cromie MJ, Groisman EA. Promoter and riboswitch control of the Mg2+ transporter MgtA from Salmonella enterica. J Bacteriol 2010 Jan;192(2):604-607.</li><br><br />
<br />
<li>Dana G, Kuiken T, Rejeski D & Snow A (2012) Synthetic biology: Four steps to avoid a synthetic-biology disaster. Nature 483:29.</li><br><br />
<br />
<li>Daus B, Mattusch J, Paschke A, Wennrich R, and Weiss H. Kinetics of the arsenite oxidation in seepage water from a tin mill tailings pond. Talanta 2000 May 5; 51(6) 1087-95. </li></br><br />
<br />
<li>Del Rio LF, Hadwin AK, Pinto LJ, MacKinnon MD, Moore MM. Degradation of naphthenic acids by sediment micro-organisms. J Appl Microbiol 2006 Nov;101(5):1049-1061. </li><br><br />
<br />
<li>Dingwall C, Lomonossoff GP, Laskey RA. High sequence specificity of micrococcal nuclease. Nucleic Acids Res 1981 Jun 25;9(12):2659-2673. </li><br><br />
<br />
<li>Diaz E, Garcia, JL. Genetics Engineering for Removal of Sulfur and Nitrogen from Fuel Heterocycles. Handbook of Hydrocarbon and Lipid Microbiology: 2144-2157. Springer, 2010. </li><br><br />
<br />
<li>Egan SM, Schleif RF, others. A regulatory cascade in the inductionof rhaBAD. J Mol Biol 1993;234(1):87-98.</li><br><br />
<br />
<li>Environmental Protection Agency, (1995), Nitrogen oxides (NOx) Why and how they are controlled. <a href="http://www.epa.gov/ttn/catc/dir1/fnoxdoc.pdf">http://www.epa.gov/ttn/catc/dir1/fnoxdoc.pdf</a> </li><br><br />
<br />
<li>Feist AM, Henry CS, Reed JL, Krummenacker M, Joyce AR, Karp PD, Broadbelt LJ, Hatzimanikatis V, Palsson BØ. A genome-scale metabolic reconstruction for <i>Escherichia coli</i> K-12 MG1655 that accounts for 1260 ORFs and thermodynamic information. Mol Syst Biol 3 2007 Jun; 121.</li></br><br />
<br />
<li>Frank RA, Fischer K, Kavanagh R, Burnison BK, Aresenault G, Headley J, Peru KM, VanDerKraak G, Solomon K. Effect of Carboxylic Acid Content on the Acute Toxicity of Oil Sands Naphthenic Acids. Environ Sci Technol 2009 Dec 11;43(2):266–271.</li><br><br />
<br />
<li>Galán B, Díaz E, García JL. Enhancing desulfurization by engineering a flavin reductase-encoding gene cassette in recombinant biocatalysts. Environ microbiol. 2000 Dec; 2(6): 687-94 </li><br><br />
<br />
<br />
<li>German Collection of Microorganisms and Cell Cultures (DSMZ): Nocardia iowensis. <a href="https://www.dsmz.de/catalogues/details/culture/DSM-45197.html">http://www.dsmz.de/catalogues/details/culture/DSM-45197.html</a></li><br><br />
<br />
<br />
<li>Gopinath AV, Russell D. An Inexpensive Field-Portable Programmable Potentiostat. Chem. Educator.2006 July;11:23-28.</li></br><br />
<br />
<li>Harayama S, Rekik M, Wasserfallen A and Bairoch A. Evolutionary relationships between catabolic pathways for aromatics: conservation of gene order and nucleotide sequences of catechol oxidation genes of pWW0 and NAH7 plasmids. MGG Mol Gen.Genet.1987; 210(2): 241–247.</li><br><br />
<br />
<li>He A, Li T, Daniels L, Fotheringham I, Rosazza J.P.N. Nocardia sp. Carboxylic Acid Reductase: Cloning, Expression, and Characterization of a New Aldehyde Oxidoreductase Family. Applied and Environmental Microbiology 2004 Mar;70(3):1874–1881.</li><br><br />
<br />
<li>Heckman KL, Pease LR. Gene splicing and mutagenesis by PCR-driven overlap extension. Nature Protocols 2007 2;4 924-932.</li><br> <br />
<br />
<li>Helmann J. Measuring metals with RNA. J Mol Cell 2007 Sept 21; 27(6) 859-860. </li></br><br />
<br />
<li>Herman DC, Fedorak PM, MacKinnon MD, Costerton JW. Biodegradation of naphthenic acids by microbial populations indigenous to oil sands tailings. Can J Microbiol 1994 Jun;40(6):467-477.</li><br><br />
<br />
<li>Hirrlinger B, Stolz A, Knackmuss HJ. Purification and properties of an amidase from Rhodococcus erythropolis MP50 which enantioselectively hydrolyzes 2-arylpropionamides. J Bacteriology 1996; 178(12) 3501-3507.</li><br><br />
<br />
<li>Holowenko FM, Mackinnon MD, Fedorak PM. Naphthenic acids and surrogate naphthenic acids in methanogenic microcosms. Water Res 2001 Aug;35(11):2595-2606. </li><br><br />
<br />
<li>Jeske M, Altenbuchner J. The Escherichia coli rhamnose promoterrhaP BAD is in Pseudomonas putida KT2440 independent of Crp--cAMPactivation. Appl Microbiol Biotechnol 2010;85(6):1923-1933.</li><br><br />
<br />
<li>Kamali N, Tavallaie M, Bambai B, Karkhane AA, Miri M. Site-directed mutagenesis enhances the activity of NADH-FMN oxidoreductase (DszD) activity of <i>Rhodococcus erythropolis</i>. Biotechnol Lett. 2010; 32: 921-927</li><br><br />
<br />
<li>Kanehisa Laboratories. KEGG pathway: Benzoic acid family-reference pathway. 2010. http://www.genome.jp/kegg/pathway/map/map07110.html </li><br><br />
<br />
<li>Katzer JR, Sivasubramanian R. Process and Catalyst Needs for Hydrodenitrogenation. Catalysis Reviews: Science and Engineering 1979; 20(2):155-208. </li><br><br />
<br />
<li>Kayser KJ, Kilbane JJ. II Gas Technology Institute. Method for metabolizing carbazole in petroleum, US Patent No. 6,943,006 B2. Sep 13, 2005. </li><br><br />
<br />
<li>Kilbane JJ. Microbial biocatalyst developments to upgrade fossil fuels. Current Opinion in Biotechnology 2006; 17(3):305-314.</li><br><br />
<br />
<li>Knudsen S, Saadbye P, Hansen LH, Collier A, Jacobsen BL, Schlundt J, Karlstrom OH. Development and testing of improved suicide functions for biological containment of bacteria. Appl Environ Microbiol 1995 Mar; 61(3):985-991.</li><br><br />
<br />
<li>Lewenza S, Falsafi RK, Winsor G, Gooderham WJ, McPhee JB, Brinkman FS, et al. Construction of a mini-Tn5-luxCDABE mutant library in <i>Pseudomonas aeruginosa</i> PAO1: a tool for identifying differentially regulated genes. Genome Res 2005 Apr;15(4):583-589. </li><br><br />
<br />
<li>Li GQ, Li SS, Zhang ML, Wang J, Zhu L, Liang FL, Liu RL, Ma T. Genetic rearrangement strategy for optimizing the dibenzothiophene biodesulfurization pathway in <i>Rhodococcus erythropolis</i>. Appl Environ Microbiol. 2008 Feb; 74(4): 971-6 </li><br><br />
<br />
<li>Li MZ, Squires CH, Monticello DJ, Childs JD. Genetic analysis of the dsz promoter and associated regulatory regions of <i>Rhodococcus erythropolis</i> IGTS8. J Bacteriol. 1996 Nov; 178(22): 6409-18</li><br><br />
<br />
<li>Lim HN, Lee Y, Hussein R. Fundamental relationship between operon organization and gene expression. Proc Natl Acad Sci U S A. 2011 Jun 28;108(26):10626-31. </li><br><br />
<br />
<li>Ma T. The Desulfurization Pathway in <i>Rhodococcus</i>. Microbiology Monographs 2010; 16: 207-230.</li><br><br />
<br />
<li>Mayaux JF, Cerbelaud E, Soubrier F, Yeh P, Blanche F, Petre D. Purification, Cloning, and Primary Structure of a New Enantiomer-Selective Amidase from a Rhodococcus Strain: Structural Evidence for a Conserved Genetic Coupling with Nitrile Hydratase. J Bacteriology Nov. 1991; 173(21): 6694-6704. </li><br><br />
<br />
<li>Morales M, Le Borgne S. Microorganisms Utilizing Nitrogen-Containing Heterocyclic Hydrocarbons. Handbook of Hydrocarbon and Lipid Microbiology: 2144-2157. Springer, 2010.</li><br><br />
<br />
<li>Nakai C, Kagamiyama H, Nozaki M. Complete nucleotide sequence of the metapyrocatechase gene on the TOL plasmid of <i>Pseudomonas putida </i> mt-2. J Biol Chem. 1983 Mar; 258(5):2923-2928.</li><br><br />
<br />
<li>Oshiro T, Ohkita R, Takikawa T, Manabe M, Lee WC, Tanokura M, Izumi Y. Improvement of 2'-hydroxybiphenyl-2-sulfinate desulfinase, an enzyme involved in the dibenzothiophene desulfurization pathway, from <i>Rhodococcus erythropolis</i> KA2-5-1 by site-directed mutagenesis. Biosci Biotechnol Biochem. 2007 Nov.; 71(11):2815-21</li><br><br />
<br />
<li>Parts Registry: The PetroBrick – Strong Constitutive Expression of ADC and AAR in pSB1C3 <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K590025 (Retrieved 8/28/2012">http://partsregistry.org/wiki/index.php?title=Part:BBa_K590025 (Retrieved 8/28/2012</a> </li><br><br />
<br />
<li>Paulsen IT, Press CM, Ravel J, Kobayashi DY, Myers GSA, Mavrodi DV, DeBoy RT, Seshadri R, Ren Q, Madupu R, Dodson RJ, Durkin AS, Brinkac LM, Daughtery SC, Sullivan SA, Rosovitz MJ, Gwinn ML, Zhou L, Schneider DJ, Cartinhour SW, Nelson WC, Weidman, Watkin K, Tran K, Khouri H, Pierson EA, Pierson III LS, Thomashow LS, Loper JE. Complete genome sequence of the plant commensal <i>Pseudomonas fluorescens</i> Pf-5. Nature Biotech. July 2003. 23(7):873-878. </li><br><br />
<br />
<li>Phillips R, Kondev J, Theriot J. Physical Biology of the Cell. 1st ed. Garland Science. 2008. </li><br><br />
<br />
<li>Ramesh A, Wakeman CA, and Winkler WC. Insights into metalloregulation by M-box riboswitch RNAs via structural analysis of manganese-bound complexes. J Mol Biol 2011 Apr 8; 407(4) 556-70. </li></br><br />
<br />
<li>Ramos-Padron E, Bordenave S, Lin S, Bhaskar IM, Dong X, Sensen CW, et al. Carbon and sulfur cycling by microbial communities in a gypsum-treated oil sands tailings pond. Environ Sci Technol 2011 Jan 15;45(2):439-446.</li><br><br />
<br />
<li>Reit K., & Tramper J. (1991). Basic bioreactor design. New York (NY):Marcel Dekker Inc.</li><br><br />
<br />
<li>Regulski EE, Moy RH, Weinberg Z, Barrick JE, Yao Z, Ruzzo WL, Breaker RR. A widespread riboswitch candidate that controls bacterial genes involved in molybdenum cofactor and tungsten cofactor metabolism.Mol Microbiol. 2008 May; 68(4): 918–932</li><br> <br />
<br />
<li>Reznikoff WS. Transposon Tn5. Annu Rev Genet 2008;42:269-286. </li><br><br />
<br />
<li>Rude MA, Baron TS, Brubaker S, Alibhai M, Del Cardayre SB, and Schirmer A. Terminal olefin (1-alkene) biosynthesis by a novel p450 fatty acid decarboxylase from Jeotgalicoccus species. Applied and Environmental Microbiology 2011 Mar;77(5):1718–1727.</li><br><br />
<br />
<li>Schweigert N, Zehnder AJ, Eggen RI. Chemical properties of catechols and their molecular modes of toxic action in cells, from microorganisms to mammals. Environ Microbiol 2001 Feb; 3(2):81-91</li><br><br />
<br />
<li>Scott, A., Mackinnon, M.D., Fedorak, P.M. (2005). Naphthenic acids in tailings ponds are more difficult to degrade than commercial naphthenic acids. Environ Sci Tech, 39, 8388-8394.</li><br><br />
<br />
<br />
<li>Sheridan DL, Hughes TE. A faster way to make GFP-based biosensors: two new transposons for creating multicolored libraries of fluorescent fusion proteins. BMC Biotechnol 2004 Aug 18;4:17. </li><br><br />
<br />
<li>Shu L, Chiou Y, Orville AM, Miller MA, Lipscomb JD, Que L. X-ray absorption spectroscopic studies of the Fe(II) active site of catechol 2,3-dioxygenase. Implications for the extradiol cleavage mechanism. Biochem 1995; 34:6649-6659.</li><br><br />
<br />
<li>Slavcheva E, Shone B, Turnbull A. Review of napthenic acid corrosion in oilrefining. British Corrosion Journal 1999 Feb;34(2):125-131. </li><br><br />
<br />
<li>So J. Mini-transposon Tn5gfp constructs for differential tagging of microorganisms. Biotech and Bioprocess Eng 1999;4(2):154-156. </li><br><br />
<br />
<li>Soleimani M, Bassi A, Margaritis A. Biodesulfurization of refractory organic sulfur compounds in fossil fuels. Biotechnol Adv. 2007 Nov-Dec;25(6):570-96 </li><br><br />
<br />
<li>Sukovich DJ. Hydrocarbon Biosynthesis by Bacteria: Genes and Hydrocarbon Products. PhD Dissertation, Microbiology, Immunology, and Cancer Biology Graduate Program, University of Minnesota. 2010; 1 – 208.</li><br><br />
<br />
<li>Syncrude, (2012), Tailings Management. <a href="http://www.syncrude.ca/users/folder.asp?FolderID=5913 <br />
">http://www.syncrude.ca/users/folder.asp?FolderID=5913 <br />
</a> </li><br><br />
<br />
<br />
<li>Timms-Wilson TM, Bailey MJ. Reliable use of green fluorescent protein in fluorescent pseudomonads. J Microbiol Methods 2001 Jul 30;46(1):77-80. </li><br><br />
<br />
<li>TOMLAB Optimization, MatLab Optimization. <a href="http://tomopt.com/tomlab/">http://tomopt.com/tomlab/</a> </li><br><br />
<br />
<li>United Nations Environment Programme: Sulfur Air Pollution. <a href="http://www.unep.org/transport/pcfv/pdf/Ethiopia-AirPollutionsulphur.pdf">http://www.unep.org/transport/pcfv/pdf/Ethiopia-AirPollutionsulphur.pdf </a> </li><br><br />
<br />
<br />
<br />
<li>United States Environmental Protection Agency: Sulfur Dioxide. <a href="http://www.epa.gov/air/sulfurdioxide/">http://www.epa.gov/air/sulfurdioxide/</a> </li><br><br />
<br />
<br />
<li>UW iGEM: Diesel Production Background. <a href="https://2011.igem.org/Team:Washington/Alkanes/Background">https://2011.igem.org/Team:Washington/Alkanes/Background</a> </li><br><br />
<br />
<br />
<br />
<li>Vaillancourt FH, Bolin JT, Eltis LD. The ins and outs of ring-cleaving dioxygenases. Crit Rev Biochem Mol. 2006; 41:241-267. </li><br><br />
<br />
<li>Venkitasubramanian P, Daniels L, Rosazza JPN. Reduction of Carboxylic Acids by Nocardia Aldehyde Oxidoreductase Requires a Phosphopantetheinylated Enzyme. Journal of Biological Chemistry 2007 Nov 13;282(1):478-485. </li><br><br />
<br />
<li>Vitreschak AG, Rodionov DA, Mironov AA, Gelfand MS. Riboswitches: the oldest mechanism for the regulation of gene expression? Trends Genet 2004 Jan;20(1):44-50.</li></br><br />
<br />
<li>Vogel U, Jensen KF. The RNA chain elongation rate in <i>Escherichia coli</i> depends on the growth rate. J Bacteriol. 1994 May;176(10):2807-13. </li><br><br />
<br />
<li>Waters LS, Sandoval M, and Storz G. The<i> Escherichia coli</i> MntR miniregulon includes genes encoding a small protein and an efflux pump required for manganese homeostasis. J Bacteriol 2011 Nov; 193(21) 5887-97.</li></br><br />
<br />
<br />
<li>Wright JK, Overath P. Purification of the lactose:H+ carrier of <i>Escherichia coli</i> and characterization of galactoside binding and transport. Eur J Biochem.1984 Feb 1;138(3):497-508.</li><br><br />
<br />
<li>Xiong AS, Peng RH, Cheng ZM, Li Y, Liu JG, Zhuang J, Gao F, Xu F, Qiao YS, Zhang Z, Chen JM, Yao QH. Concurrent mutations in six amino acids in beta-glucuronidase improve its thermostability. Protein Eng Des Sel. 2007 Jul;20(7):319-25. Epub 2007 Jun 8. </li><br><br />
<br />
<li>Xu P, Yu P, Li FP, Cai XF, Ma CQ. Microbial degradation of sulfur, nitrogen and oxygen heterocycles. Trends in Microbiology 2006; 14(9):398-405.</li><br><br />
<br />
<li>Yoshimura F, Nikaido H. Permeability of Pseudomonas aeruginosa outer membrane to hydrophilic solutes. J Bacteriol. 1982 Nov;152(2):636-42. </li><br><br />
<br />
<li>Young R, Bremer H. Polypeptide-chain-elongation rate in <i>Escherichia coli</i> B/r as a function of growth rate. Biochem J. 1976 Nov 15;160(2):185-94. </li><br><br />
<br />
<li>Zeuthen P, Knudsen KG, Whitehurst DD.Organic nitrogen compounds in gas oil blends, their hydrotreated products and the importance to hydrotreatment. Catalysis Today Feb 2001; 65(2-4):307-314.</li><br><br />
<br />
<li>Zhang X, Wiseman S, Yu H, Liu H, Giesy JP, Hecker M. Assessing the toxicity of naphthenic acids using a microbial genome wide live cell reporter array system. Environ Sci Technol 2011 Mar 1;45(5):1984-1991.</li><br><br />
<br />
<li>Zhang Y, Nelson M, Nietfeldt JW, Burbank DE, Van Etten JL.Characterization of Chlorella virus PBCV-1 CviAII restriction andmodification system. Nucleic Acids Res 1992;20(20):5351-5356.</li><br><br />
<br />
<li>Zhu G, Pang K, Parkin G. New Modes for Coordination of Aromatic Heterocyclic Nitrogen Compounds to Molybdenum: Catalytic Hydrogenation of Quinoline, Isoquinoline, and Quinoxaline by Mo(PMe<sub>3</sub>)<sub>4</sub>H<sub>4</sub>. Journal of the American Chemical Society 2008; 130(5):1564-1565. </li><br><br />
<br />
<br />
<br />
<br />
<br />
<br />
</ul><br />
<br />
<br />
</html>}}}<br />
}}</div>Kevinm.huiehttp://2012.igem.org/Team:Calgary/Project/ReferencesTeam:Calgary/Project/References2012-10-27T02:18:19Z<p>Kevinm.huie: </p>
<hr />
<div>{{Team:Calgary/TemplateProjectOrange|<br />
TITLE=References|<br />
CONTENT={{{CONTENT|<br />
<html><br />
<br />
<br />
<ul><br />
<br />
<li>2009 iGEM Calgary. <a href="https://2009.igem.org/Team:Calgary/Notebook"> https://2009.igem.org/Team:Calgary/Notebook</a> </li><br><br />
<br />
<li>Asenjo JA. (1949). Bioreactor system design. New York (NY): Marcel Dekker Inc.</li><br><br />
<br />
<li>Baba T, Ara T, Hasegawa M, Takai Y, Okumura Y, Baba M, Datsenko KA, Tomita M, Wanner BL, and Mori H. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol 2006 Feb;1-11.</li><br><br />
<br />
<li>Becker SA, Feist AM, Mo ML, Hannum G, Palsson BØ, Herrgard MJ. Quantitative prediction of cellular metabolism with constraint-based models: the COBRA Toolbox. Nature Protocols 2 2007 Mar; 727-723.</li></br><br />
<br />
<li>Becker SA, Feist AM, Mo ML, Hannum G, Palsson BØ, Herrgard MJ. Quantitative prediction of cellular metabolism with constraint-based models: the COBRA Toolbox v2.0. Nature Protocols 6 2011 Aug; 1290-1307.</li></br><br />
<br />
<li>Behar FH, Albrecht P. Correlations between carboxylic acids and hydrocarbons in several crude oils alteration by biodegradation. Org Geochem 1984;6:597-604. </li><br><br />
<br />
<li>Biran I, Levcov K, Hengge-Aronis R, Ron EZ, Rishpon J. On-line monitoring of gene expression. Microbiology.1999 April;145:2129-2133.</li><br><br />
<br />
<li>Canadian Centre for Occupational Health and Safety: Health Effects of Sulfur Dioxid. <a href="http://www.ccohs.ca/oshanswers/chemicals/chem_profiles/sulfurdi/health_sul.html">http://www.ccohs.ca/oshanswers/chemicals/chem_profiles/sulfurdi/health_sul.html</a> (Retrieved: 09/18/2012)</li><br><br />
<br />
<li>Clemente JS, Fedorak PM. A review of the occurrences, analyses, toxicity, and biodegradation of naphthenic acids. Chemosphere 2005 Feb 6;60(5):585-600.</li><br><br />
<br />
<li>Clemente JS, Prasad NGN, MacKinnon MD, Fedorak PM. A statistical comparison of naphthenic acids characterized by gas chromatography-mass spectrometry. Chemosphere 2003. 50:1265-1274.</li><br><br />
<br />
<li>Cromie MJ, Groisman EA. Promoter and riboswitch control of the Mg2+ transporter MgtA from Salmonella enterica. J Bacteriol 2010 Jan;192(2):604-607.</li><br><br />
<br />
<li>Dana G, Kuiken T, Rejeski D & Snow A (2012) Synthetic biology: Four steps to avoid a synthetic-biology disaster. Nature 483:29.</li><br><br />
<br />
<li>Daus B, Mattusch J, Paschke A, Wennrich R, and Weiss H. Kinetics of the arsenite oxidation in seepage water from a tin mill tailings pond. Talanta 2000 May 5; 51(6) 1087-95. </li></br><br />
<br />
<li>Del Rio LF, Hadwin AK, Pinto LJ, MacKinnon MD, Moore MM. Degradation of naphthenic acids by sediment micro-organisms. J Appl Microbiol 2006 Nov;101(5):1049-1061. </li><br><br />
<br />
<li>Dingwall C, Lomonossoff GP, Laskey RA. High sequence specificity of micrococcal nuclease. Nucleic Acids Res 1981 Jun 25;9(12):2659-2673. </li><br><br />
<br />
<li>Diaz E, Garcia, JL. Genetics Engineering for Removal of Sulfur and Nitrogen from Fuel Heterocycles. Handbook of Hydrocarbon and Lipid Microbiology: 2144-2157. Springer, 2010. </li><br><br />
<br />
<li>Egan SM, Schleif RF, others. A regulatory cascade in the inductionof rhaBAD. J Mol Biol 1993;234(1):87-98.</li><br><br />
<br />
<li>Environmental Protection Agency, (1995), Nitrogen oxides (NOx) Why and how they are controlled. <a href="http://www.epa.gov/ttn/catc/dir1/fnoxdoc.pdf">http://www.epa.gov/ttn/catc/dir1/fnoxdoc.pdf</a> </li><br><br />
<br />
<li>Feist AM, Henry CS, Reed JL, Krummenacker M, Joyce AR, Karp PD, Broadbelt LJ, Hatzimanikatis V, Palsson BØ. A genome-scale metabolic reconstruction for <i>Escherichia coli</i> K-12 MG1655 that accounts for 1260 ORFs and thermodynamic information. Mol Syst Biol 3 2007 Jun; 121.</li></br><br />
<br />
<li>Frank RA, Fischer K, Kavanagh R, Burnison BK, Aresenault G, Headley J, Peru KM, VanDerKraak G, Solomon K. Effect of Carboxylic Acid Content on the Acute Toxicity of Oil Sands Naphthenic Acids. Environ Sci Technol 2009 Dec 11;43(2):266–271.</li><br><br />
<br />
<li>Galán B, Díaz E, García JL. Enhancing desulfurization by engineering a flavin reductase-encoding gene cassette in recombinant biocatalysts. Environ microbiol. 2000 Dec; 2(6): 687-94 </li><br><br />
<br />
<br />
<li>German Collection of Microorganisms and Cell Cultures (DSMZ): Nocardia iowensis. <a href="https://www.dsmz.de/catalogues/details/culture/DSM-45197.html">http://www.dsmz.de/catalogues/details/culture/DSM-45197.html</a></li><br><br />
<br />
<br />
<li>Gopinath AV, Russell D. An Inexpensive Field-Portable Programmable Potentiostat. Chem. Educator.2006 July;11:23-28.</li></br><br />
<br />
<li>Harayama S, Rekik M, Wasserfallen A and Bairoch A. Evolutionary relationships between catabolic pathways for aromatics: conservation of gene order and nucleotide sequences of catechol oxidation genes of pWW0 and NAH7 plasmids. MGG Mol Gen.Genet.1987; 210(2): 241–247.</li><br><br />
<br />
<li>He A, Li T, Daniels L, Fotheringham I, Rosazza J.P.N. Nocardia sp. Carboxylic Acid Reductase: Cloning, Expression, and Characterization of a New Aldehyde Oxidoreductase Family. Applied and Environmental Microbiology 2004 Mar;70(3):1874–1881.</li><br><br />
<br />
<li>Heckman KL, Pease LR. Gene splicing and mutagenesis by PCR-driven overlap extension. Nature Protocols 2007 2;4 924-932.</li><br> <br />
<br />
<li>Helmann J. Measuring metals with RNA. J Mol Cell 2007 Sept 21; 27(6) 859-860. </li></br><br />
<br />
<li>Herman DC, Fedorak PM, MacKinnon MD, Costerton JW. Biodegradation of naphthenic acids by microbial populations indigenous to oil sands tailings. Can J Microbiol 1994 Jun;40(6):467-477.</li><br><br />
<br />
<li>Hirrlinger B, Stolz A, Knackmuss HJ. Purification and properties of an amidase from Rhodococcus erythropolis MP50 which enantioselectively hydrolyzes 2-arylpropionamides. J Bacteriology 1996; 178(12) 3501-3507.</li><br><br />
<br />
<li>Holowenko FM, Mackinnon MD, Fedorak PM. Naphthenic acids and surrogate naphthenic acids in methanogenic microcosms. Water Res 2001 Aug;35(11):2595-2606. </li><br><br />
<br />
<li>Jeske M, Altenbuchner J. The Escherichia coli rhamnose promoterrhaP BAD is in Pseudomonas putida KT2440 independent of Crp--cAMPactivation. Appl Microbiol Biotechnol 2010;85(6):1923-1933.</li><br><br />
<br />
<li>Kamali N, Tavallaie M, Bambai B, Karkhane AA, Miri M. Site-directed mutagenesis enhances the activity of NADH-FMN oxidoreductase (DszD) activity of <i>Rhodococcus erythropolis</i>. Biotechnol Lett. 2010; 32: 921-927</li><br><br />
<br />
<li>Kanehisa Laboratories. KEGG pathway: Benzoic acid family-reference pathway. 2010. http://www.genome.jp/kegg/pathway/map/map07110.html </li><br><br />
<br />
<li>Katzer JR, Sivasubramanian R. Process and Catalyst Needs for Hydrodenitrogenation. Catalysis Reviews: Science and Engineering 1979; 20(2):155-208. </li><br><br />
<br />
<li>Kayser KJ, Kilbane JJ. II Gas Technology Institute. Method for metabolizing carbazole in petroleum, US Patent No. 6,943,006 B2. Sep 13, 2005. </li><br><br />
<br />
<li>Kilbane JJ. Microbial biocatalyst developments to upgrade fossil fuels. Current Opinion in Biotechnology 2006; 17(3):305-314.</li><br><br />
<br />
<li>Knudsen S, Saadbye P, Hansen LH, Collier A, Jacobsen BL, Schlundt J, Karlstrom OH. Development and testing of improved suicide functions for biological containment of bacteria. Appl Environ Microbiol 1995 Mar; 61(3):985-991.</li><br><br />
<br />
<li>Lewenza S, Falsafi RK, Winsor G, Gooderham WJ, McPhee JB, Brinkman FS, et al. Construction of a mini-Tn5-luxCDABE mutant library in <i>Pseudomonas aeruginosa</i> PAO1: a tool for identifying differentially regulated genes. Genome Res 2005 Apr;15(4):583-589. </li><br><br />
<br />
<li>Li GQ, Li SS, Zhang ML, Wang J, Zhu L, Liang FL, Liu RL, Ma T. Genetic rearrangement strategy for optimizing the dibenzothiophene biodesulfurization pathway in <i>Rhodococcus erythropolis</i>. Appl Environ Microbiol. 2008 Feb; 74(4): 971-6 </li><br><br />
<br />
<li>Li MZ, Squires CH, Monticello DJ, Childs JD. Genetic analysis of the dsz promoter and associated regulatory regions of <i>Rhodococcus erythropolis</i> IGTS8. J Bacteriol. 1996 Nov; 178(22): 6409-18</li><br><br />
<br />
<li>Lim HN, Lee Y, Hussein R. Fundamental relationship between operon organization and gene expression. Proc Natl Acad Sci U S A. 2011 Jun 28;108(26):10626-31. </li><br><br />
<br />
<li>Ma T. The Desulfurization Pathway in <i>Rhodococcus</i>. Microbiology Monographs 2010; 16: 207-230.</li><br><br />
<br />
<li>Mayaux JF, Cerbelaud E, Soubrier F, Yeh P, Blanche F, Petre D. Purification, Cloning, and Primary Structure of a New Enantiomer-Selective Amidase from a Rhodococcus Strain: Structural Evidence for a Conserved Genetic Coupling with Nitrile Hydratase. J Bacteriology Nov. 1991; 173(21): 6694-6704. </li><br><br />
<br />
<li>Morales M, Le Borgne S. Microorganisms Utilizing Nitrogen-Containing Heterocyclic Hydrocarbons. Handbook of Hydrocarbon and Lipid Microbiology: 2144-2157. Springer, 2010.</li><br><br />
<br />
<li>Nakai C, Kagamiyama H, Nozaki M. Complete nucleotide sequence of the metapyrocatechase gene on the TOL plasmid of <i>Pseudomonas putida </i> mt-2. J Biol Chem. 1983 Mar; 258(5):2923-2928.</li><br><br />
<br />
<li>Oshiro T, Ohkita R, Takikawa T, Manabe M, Lee WC, Tanokura M, Izumi Y. Improvement of 2'-hydroxybiphenyl-2-sulfinate desulfinase, an enzyme involved in the dibenzothiophene desulfurization pathway, from <i>Rhodococcus erythropolis</i> KA2-5-1 by site-directed mutagenesis. Biosci Biotechnol Biochem. 2007 Nov.; 71(11):2815-21</li><br><br />
<br />
<li>Parts Registry: The PetroBrick – Strong Constitutive Expression of ADC and AAR in pSB1C3 <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K590025 (Retrieved 8/28/2012">http://partsregistry.org/wiki/index.php?title=Part:BBa_K590025 (Retrieved 8/28/2012</a> </li><br><br />
<br />
<li>Paulsen IT, Press CM, Ravel J, Kobayashi DY, Myers GSA, Mavrodi DV, DeBoy RT, Seshadri R, Ren Q, Madupu R, Dodson RJ, Durkin AS, Brinkac LM, Daughtery SC, Sullivan SA, Rosovitz MJ, Gwinn ML, Zhou L, Schneider DJ, Cartinhour SW, Nelson WC, Weidman, Watkin K, Tran K, Khouri H, Pierson EA, Pierson III LS, Thomashow LS, Loper JE. Complete genome sequence of the plant commensal <i>Pseudomonas fluorescens</i> Pf-5. Nature Biotech. July 2003. 23(7):873-878. </li><br><br />
<br />
<li>Phillips R, Kondev J, Theriot J. Physical Biology of the Cell. 1st ed. Garland Science. 2008. </li><br><br />
<br />
<li>Ramesh A, Wakeman CA, and Winkler WC. Insights into metalloregulation by M-box riboswitch RNAs via structural analysis of manganese-bound complexes. J Mol Biol 2011 Apr 8; 407(4) 556-70. </li></br><br />
<br />
<li>Ramos-Padron E, Bordenave S, Lin S, Bhaskar IM, Dong X, Sensen CW, et al. Carbon and sulfur cycling by microbial communities in a gypsum-treated oil sands tailings pond. Environ Sci Technol 2011 Jan 15;45(2):439-446.</li><br><br />
<br />
<li>Reit K., & Tramper J. (1991). Basic bioreactor design. New York (NY):Marcel Dekker Inc.</li><br><br />
<br />
<li>Regulski EE, Moy RH, Weinberg Z, Barrick JE, Yao Z, Ruzzo WL, Breaker RR. A widespread riboswitch candidate that controls bacterial genes involved in molybdenum cofactor and tungsten cofactor metabolism.Mol Microbiol. 2008 May; 68(4): 918–932</li><br> <br />
<br />
<li>Reznikoff WS. Transposon Tn5. Annu Rev Genet 2008;42:269-286. </li><br><br />
<br />
<li>Rude MA, Baron TS, Brubaker S, Alibhai M, Del Cardayre SB, and Schirmer A. Terminal olefin (1-alkene) biosynthesis by a novel p450 fatty acid decarboxylase from Jeotgalicoccus species. Applied and Environmental Microbiology 2011 Mar;77(5):1718–1727.</li><br><br />
<br />
<li>Schweigert N, Zehnder AJ, Eggen RI. Chemical properties of catechols and their molecular modes of toxic action in cells, from microorganisms to mammals. Environ Microbiol 2001 Feb; 3(2):81-91</li><br><br />
<br />
<li>Scott, A., Mackinnon, M.D., Fedorak, P.M. (2005). Naphthenic acids in tailings ponds are more difficult to degrade than commercial naphthenic acids. Environ Sci Tech, 39, 8388-8394.</li><br><br />
<br />
<br />
<li>Sheridan DL, Hughes TE. A faster way to make GFP-based biosensors: two new transposons for creating multicolored libraries of fluorescent fusion proteins. BMC Biotechnol 2004 Aug 18;4:17. </li><br><br />
<br />
<li>Shu L, Chiou Y, Orville AM, Miller MA, Lipscomb JD, Que L. X-ray absorption spectroscopic studies of the Fe(II) active site of catechol 2,3-dioxygenase. Implications for the extradiol cleavage mechanism. Biochem 1995; 34:6649-6659.</li><br><br />
<br />
<li>Slavcheva E, Shone B, Turnbull A. Review of napthenic acid corrosion in oilrefining. British Corrosion Journal 1999 Feb;34(2):125-131. </li><br><br />
<br />
<li>So J. Mini-transposon Tn5gfp constructs for differential tagging of microorganisms. Biotech and Bioprocess Eng 1999;4(2):154-156. </li><br><br />
<br />
<li>Soleimani M, Bassi A, Margaritis A. Biodesulfurization of refractory organic sulfur compounds in fossil fuels. Biotechnol Adv. 2007 Nov-Dec;25(6):570-96 </li><br><br />
<br />
<li>Sukovich DJ. Hydrocarbon Biosynthesis by Bacteria: Genes and Hydrocarbon Products. PhD Dissertation, Microbiology, Immunology, and Cancer Biology Graduate Program, University of Minnesota. 2010; 1 – 208.</li><br><br />
<br />
<li>Syncrude, (2012), Tailings Management. <a href="http://www.syncrude.ca/users/folder.asp?FolderID=5913 <br />
">http://www.syncrude.ca/users/folder.asp?FolderID=5913 <br />
</a> </li><br><br />
<br />
<br />
<li>Timms-Wilson TM, Bailey MJ. Reliable use of green fluorescent protein in fluorescent pseudomonads. J Microbiol Methods 2001 Jul 30;46(1):77-80. </li><br><br />
<br />
<li>TOMLAB Optimization, MatLab Optimization. <a href="http://tomopt.com/tomlab/">http://tomopt.com/tomlab/</a> </li><br><br />
<br />
<li>United Nations Environment Programme: Sulfur Air Pollution. <a href="http://www.unep.org/transport/pcfv/pdf/Ethiopia-AirPollutionsulphur.pdf">http://www.unep.org/transport/pcfv/pdf/Ethiopia-AirPollutionsulphur.pdf </a> </li><br><br />
<br />
<br />
<br />
<li>United States Environmental Protection Agency: Sulfur Dioxide. <a href="http://www.epa.gov/air/sulfurdioxide/">http://www.epa.gov/air/sulfurdioxide/</a> </li><br><br />
<br />
<br />
<li>UW iGEM: Diesel Production Background. <a href="https://2011.igem.org/Team:Washington/Alkanes/Background">https://2011.igem.org/Team:Washington/Alkanes/Background</a> </li><br><br />
<br />
<br />
<br />
<li>Vaillancourt FH, Bolin JT, Eltis LD. The ins and outs of ring-cleaving dioxygenases. Crit Rev Biochem Mol. 2006; 41:241-267. </li><br><br />
<br />
<li>Venkitasubramanian P, Daniels L, Rosazza JPN. Reduction of Carboxylic Acids by Nocardia Aldehyde Oxidoreductase Requires a Phosphopantetheinylated Enzyme. Journal of Biological Chemistry 2007 Nov 13;282(1):478-485. </li><br><br />
<br />
<li>Vitreschak AG, Rodionov DA, Mironov AA, Gelfand MS. Riboswitches: the oldest mechanism for the regulation of gene expression? Trends Genet 2004 Jan;20(1):44-50.</li></br><br />
<br />
<li>Vogel U, Jensen KF. The RNA chain elongation rate in <i>Escherichia coli</i> depends on the growth rate. J Bacteriol. 1994 May;176(10):2807-13. </li><br><br />
<br />
<li>Waters LS, Sandoval M, and Storz G. The<i> Escherichia coli</i> MntR miniregulon includes genes encoding a small protein and an efflux pump required for manganese homeostasis. J Bacteriol 2011 Nov; 193(21) 5887-97.</li></br><br />
<br />
<br />
<li>Wright JK, Overath P. Purification of the lactose:H+ carrier of <i>Escherichia coli</i> and characterization of galactoside binding and transport. Eur J Biochem.1984 Feb 1;138(3):497-508.</li><br><br />
<br />
<li>Xiong AS, Peng RH, Cheng ZM, Li Y, Liu JG, Zhuang J, Gao F, Xu F, Qiao YS, Zhang Z, Chen JM, Yao QH. Concurrent mutations in six amino acids in beta-glucuronidase improve its thermostability. Protein Eng Des Sel. 2007 Jul;20(7):319-25. Epub 2007 Jun 8. </li><br><br />
<br />
<li>Xu P, Yu P, Li FP, Cai XF, Ma CQ. Microbial degradation of sulfur, nitrogen and oxygen heterocycles. Trends in Microbiology 2006; 14(9):398-405.</li><br><br />
<br />
<li>Yoshimura F, Nikaido H. Permeability of Pseudomonas aeruginosa outer membrane to hydrophilic solutes. J Bacteriol. 1982 Nov;152(2):636-42. </li><br><br />
<br />
<li>Young R, Bremer H. Polypeptide-chain-elongation rate in <i>Escherichia coli</i> B/r as a function of growth rate. Biochem J. 1976 Nov 15;160(2):185-94. </li><br><br />
<br />
<li>Zeuthen P, Knudsen KG, Whitehurst DD.Organic nitrogen compounds in gas oil blends, their hydrotreated products and the importance to hydrotreatment. Catalysis Today Feb 2001; 65(2-4):307-314.</li><br><br />
<br />
<li>Zhang X, Wiseman S, Yu H, Liu H, Giesy JP, Hecker M. Assessing the toxicity of naphthenic acids using a microbial genome wide live cell reporter array system. Environ Sci Technol 2011 Mar 1;45(5):1984-1991.</li><br><br />
<br />
<li>Zhang Y, Nelson M, Nietfeldt JW, Burbank DE, Van Etten JL.Characterization of Chlorella virus PBCV-1 CviAII restriction andmodification system. Nucleic Acids Res 1992;20(20):5351-5356.</li><br><br />
<br />
<li>Zhu G, Pang K, Parkin G. New Modes for Coordination of Aromatic Heterocyclic Nitrogen Compounds to Molybdenum: Catalytic Hydrogenation of Quinoline, Isoquinoline, and Quinoxaline by Mo(PMe<sub>3</sub>)<sub>4</sub>H<sub>4</sub>. Journal of the American Chemical Society 2008; 130(5):1564-1565. </li><br><br />
<br />
<br />
<br />
<br />
<br />
<br />
</ul><br />
<br />
<br />
</html>}}}<br />
}}</div>Kevinm.huiehttp://2012.igem.org/Team:Calgary/Project/HumanPractices/Killswitch/RegulationTeam:Calgary/Project/HumanPractices/Killswitch/Regulation2012-10-27T01:58:50Z<p>Kevinm.huie: </p>
<hr />
<div>{{Team:Calgary/TemplateProjectOrange|<br />
TITLE=Regulation/Expression Platform|<br />
CONTENT=<br />
<html><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/8c/UCalgary2012_FRED_Killswitch_Regulation_Low-Res.png" style="float: right; padding: 10px; height: 200px;"></img><br />
<div align="justify"><br />
<br />
<h2> Tight Regulation </h2><br />
<p>Inducible kill systems are not new to iGEM. Looking through the registry, there are several constructs such as the inducible BamHI system contributed by Berkley in 2007 (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_I716462">BBa_I716462</a>) and <a href="http://partsregistry.org/Image:UoflBamHIdatasheet.png">tested by Lethbridge in 2011</a>. This uses a <i>BamHI</i> gene downsteam of an arabinose-inducible promoter. Another example is an IPTG inducible Colicin construct (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K117009">BBa_K117009</a>) submitted by NTU-Singapore in 2008. One major problem with these systems however is a lack of tight control. As was demonstrated by the Lethbridge 2011 team, this part has leaky expression when inducer compound is not present. The frequently used lacI promoter has similar problems when not used in conjunction with strong plasmid-mediated expression of lacI. This can be seen in our electrochemical characterization of the UidA hydrolase enzyme (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902002">BBa_K902002</a>) shown here. Tight control is not only a problem for kill switch application, but for any application requiring strict regulation. As such, we decided that expanding the registry repertoire of control elements would be useful for our system as well as a variety of other applications. Therefore we added a new level of regulation in addition to the promoter, a riboswitch</p><br />
<h2> Introducing the Riboswitch </h2><br />
<p>Riboswitches are small pieces of mRNA which bind ligands to modify translation of downstream genes. These sites are engineered into circuits by replacing traditional ribosome binding sites with riboswitches. The riboswitch is able to bind its respective ligand to inhibit or promote binding of translational machinery (Vitreschak <i>et al</i>, 2004). Riboswitches can be used in tandem with an appropriate promoter to enable tighter control of gene expression. Given this opportunity for control, and that ligands for riboswitches are often inexpensive small ions, these methods might be a feasible solution for controlling the kill switch in our industrial bioreactor.</p><br />
<br />
</html> [[File:UofC_RIBOSWITCH.png|thumb|350px|centre|Figure 1: A simply diagram illustrating the riboswitch and the three metabolite, magnesium, manganese and molybdenum, we have tested.]] <html><br />
<br />
<p>We explored 3 different riboswitches, each responsive to a different metabolite (magnesium, manganese or molybdate co-factor) that would be inexpensive to implement into a bioreactor environment. Additionally, we also investigated a repressible and inducible promoter, responsive to glucose and rhamnose respectively.</p><br />
<p>The general approach taken to build the system was constructing the promoter with the respective riboswitch followed by the kill genes. </p><br />
<h2>Magnesium riboswitch</h2><br />
<p>The magnesium riboswitch that we looked at is repressed in the presence of magnesium ions. This system has two control components – a promoter and a riboswitch. Normally the magnesium (mgtA) promoter (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902009">BBa_K902009</a>) and the magnesium (mgtA) riboswitch (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902008">BBa_K902009</a>) are activated if there is a deficiency of magnesium in the cell (Winnie and Groisman, 2010). The sequence of the <i>mgtA</i> promoter and riboswitch was obtained from Winnie and Groisman. A lack of magnesium activates other genes in <i>E. coli </i>to allow influx of magnesium into the cell. The two proteins in the cascade that activate the system are <i>PhoP</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902010">BBa_K902010</a>) and <i>PhoQ</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902011">BBa_K902011</a>). <i>PhoQ</i> is the trans-membrane protein which gets activated in the absence of magnesium and phosphorylates <i>PhoP</i>. <i>PhoP</i> in turn binds to the mgtA promoter and transcribes genes downstream (Winnie and Groisman, 2010).</p><br />
<br />
<h2>Manganese riboswitch</h2><br />
<p> Manganese is an essential micronutrient. It is an important co-factor for enzymes and it also reduces oxidative stress in the cell (Waters <i>et al</i>. 2011). Despite being an important micronutrient, it is toxic to cells at high levels. MntR protein detects the level of manganese in the cell and acts as a transcription factor to control the expression of manganese transporter such as MntH, MntP and MntABCDE. In order to regulate these genes <i>mntR</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902030">BBa_K902030</a>) binds to the mntP promoter (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902073">BBa_K902073</a>). The manganese homeostasis is also controlled by the manganese riboswitch <i>mntPrb</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902074">BBa_K90274</a>). The sequences of the <i>mntP</i> promoter and the <i>mntP</i> riboswitch was obtained from the Waters et al, 2011.</p><br />
<br />
</html><br />
[[File:Ucalgary2012 KillswitchstuffsystemsAandB.png|thumb|800px|left|Figure 2: '''A)''' MgtA pathway in <i>E. coli</i>. <i>PhoQ</i> is the transmembrane receptor which, upon detecting low magnesium concentrations, phosphorylates <i>PhoP</i> which acts as a transcription factor, transcribing genes downstream of the MgtA promoter necessary for bringing magnesium into the cell. There is a second level of control with the magnesium riboswitch. In the presence of high magnesium the riboswitch forms a secondary structure which does not allow the ribosome to bind to the transcript, thus inhibiting translation. '''B)''' In the presence of manganese, the <i>MntR</i> protein represses the <i>mntH</i> transporter, preventing the movement of manganese and also upregulating the putative efflux pump. Genes downstream of the mntP promoter are thus transcribed in the presence of manganese. The addition of the <i>MntR</i> protein in this system allows for tighter regulation of the system.]]<html><br />
<br />
<h2> The Moco Riboswitch </h2><br />
<br />
<p>The molybdenum cofactor riboswitch (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902023">BBa_K902023</a>) is an RNA element which responds to the presence of the metabolite molybdenum cofactor (MOCO) (Regulski et al, 2008). This RNA element is located in the <i>E.coli</i> genome just upstream of the <i>moaABCDE</i> operon (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902024">BBa_K902024</a>), containing the moco synthesis genes. Moco is an important co-factor in many different enzymes. The moco riboswitch has 2 regions: an aptamer domain and the expression platform. When moco is present in the cell it will bind to the aptamer region in the riboswitch causing an allosteric change. This allosteric change affects the expression platform by physically hiding the ribosome binding site which prevents translation.</p><br />
<br />
<br />
<br />
</html><br />
[[File:Moco_riboswitchCalgary2012.jpg|thumb|750px|center|Figure 3: This picture depicts the Moco RNA motif which is upstream of the <i>moaABCDE</i> operon. ]]<html> <br />
<br />
<h2> Building the Systems </h2><br />
<br />
<p> Using these riboswitches, we wanted to design a system where we would place our kill genes downstream, and then supplement our bioreactor with the appropriate ions to keep the systems turned off. We biobricked and submitted DNA for the the <i>mgtaP</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902009">BBa_K902009</a>) and mntP promoter (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902073">BBa_K902073</a>) as well as their respective riboswitches (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902008">BBa_K902008</a>) (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902074">BBa_K902074</a>) and the moco riboswitch (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902023">BBa_K902023</a>). In addition, we also biobricked some of the regulatory proteins: <i>PhoP</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902010">BBa_K902010</a>), <i>PhoQ</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902011">BBa_K902011</a>), <i>mntR</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902030">BBa_K902030</a>) and the Moa Operon (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902024">BBa_K902024</a>) . Our final system would inovolve constitutive expression of these necessary regulatory elements upstream of our riboswitches and kill genes. An example of the manganese system is shown in figure 4. </p><br />
<br />
</html>[[File:U.Calgary.2012_10.02.2012_Final_Construct_1.png|thumb|600px|center|Figure 4: Final construct for the manganese system. The circuit includes a TetR promoter, RBS, mntR, double terminator, mntP promoter, mntP riboswitch, <i>S7</i>, mntP riboswitch and <i>CViAII</i>.]]<html><br />
<br />
<br />
<a name="killswitch"></a><h2> Characterizing the riboswitches </h2><br />
<br />
<h3> GFP testing</h3><br />
<br />
</html>[[File:MgtA circuits Ucalgary1.png|thumb|150px|right|Figure 5: In these set of circuits, <i>TetR</i>-RBS-K082003 serves as a positive control and the <i>mgtAp-mgtArb</i> serves as a negative control.]]<html><br />
<br />
<p> In order to test the control of these promoters and riboswitches, we constructed them independently and together upstream of GFP (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K082003">BBa_K082003</a>) with an LVA tag. Figure 5 shows these circuits for the mgtA system. Identical circuits were designed for all three systems, however only the top two were needed for the mocoriboswitch system.</p><br />
<br />
<p>We then tested the aforementioned circuits by growing cells containing our circuits with varying concentrations of their respective ions. Our detailed protocols can be found <a href="https://2012.igem.org/Team:Calgary/Notebook/Protocols/mgcircuit">here</a>. We then measured fluorescent output, normalizing to a negative control not expressing GFP.</p><br />
<br />
<h3> Results </h3><br />
<br />
<p>So far, we have been able to obtain results for our magnesium system, as can be seen in figure 6. </html><br />
[[File:Magmesium graph ucalgary2.png|thumb|500px|left|Figure 6: This graph represents the relative fluorescence units from the mgtA promoter riboswitch construct as well as the riboswitch construct under the TetR promoter (BBa_R0040). We can see a decrease in the level of GFP output with increasing concentrations of magnesium. There is much steeper decrease in the GFP output in the construct with the magnesium promoter and riboswitch compared to the construct with just the riboswitch alone.]]<html></p><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br />
<br />
<br />
<p>As the graph shows, there is a much larger decrease in the GFP output when the mgtA promoter and riboswitch are working together as compared to the <i>mgtA</i> riboswitch alone under the control of TetR promoter (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_J13002">BBa_J13002</a>). This suggests that having both the promoter and the riboswitch together provides a tighter control over the genes expressed downstream. This also suggests that the magnesium riboswitch alone is sufficient in reducing gene expression downstream of a constitutive promoter.</p><br />
<br />
<p> It is important to consider however that the control elements of the system, <a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902010"><i>PhoP</i> </a> and <a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902011"> <i>PhoQ</i></a>, that were described above were not present in the circuits tested and therefore there is GFP expression in at the inhibitory concentration (10mM MgCl<sub>2</sub>). We believe that having the regulatory elements would give us better control and limit the leakiness.</p><br />
<br />
<p>Although the magnesium system is highly regulated, it is not a suitable system for the purposes of our bioreactor. The tailings are composed of very high concentration of magnesium, as high as 120mM (Kim <i>et al</i>. 2011). As can be seen, this would inhibit the system. Therefore, if our bacteria were to escape into the tailings, the kill genes would not be activated and the bacteria would be able to survive. However, we feel that this could still be an incredibly useful system for other teams for both killswtitch and non-killswitch-related applications, making it still a valuable contribution to the registry. </p><br />
<br />
<h3> Kill Gene Testing </h3><br />
<br />
<p> While building our systems with GFP in order to test their control, we also constructed them with our kill genes. This was delayed substantially however due to problems in their synthesis. Specifically, the micrococcal nuclease that arrived from IDT had a 1bp point mutation which changed an isoleucine residue into a lysine. Initially, our systems resulted in no killing of cells. Therefore we had to mutate this residue using <a href="https://2012.igem.org/Team:Calgary/Notebook/Protocols/mutagenesis"> site-directed mutagenesis</a>. Once completed, we were able to begin testing. With our GFP data collected, we moved on to characterizing the mgtA control system upstream of our <i>S7</i> kill gene (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902019">BBa_K902019</a>). To test the circuits, we incubated cells expressing our construct with varying concentrations of magnesium. We then measured both Colony Forming Units (CFU) and OD 600. For a deatiled protocol, see <a href="https://2012.igem.org/Team:Calgary/Notebook/Protocols/mgtacircuit">here</a>.</p><br />
<br />
<h3> Results </h3><br />
<br />
</html>[[File:24 hour assay with mgtap-rb-S7 Ucalgary.png|thumb|750px|center| Figure 7: This shows the OD600 values of mgtA circuits with S7 both mutated and unmutated. The negative control consists of <i>mgtAp-mgtArb</i>.]]<html><br />
<p> Figure 7 shows that the mgtAp-mgtArb-S7 (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902018">BBa_K902018</a>) starts acting approximately 4 hours after induction. However, it also shows that 10mM MgCl<sub>2</sub> is not enough salt to inhibit the entire system because there is no difference in OD600 measurement at 4hr time point between 10mM and the 0mM concentrations. This test needs to be repeated with higher concentrations of Mg<sup>2+</sup> however this data suggests that the mutagenesis was successful and <i>S7</i> is active and killing the cells at approximately 4hr which does not necessarily reflect solely upon the activity of <i>S7</i> but also on the response time of the mgtA system.</p><br />
<br />
<br />
<h2>An alternative: a glucose repressible system</h2><br />
<br />
<p>Based on the problem with the magnesium system in relation to tailings pond conditions, we wanted to find an alternative. We found a promoter that was induced by rhamnose and repressed by glucose. This seemed to be a very suitable candidate for controlling the kill switch in the bioreactor since the promoter was shown to be tightly repressed by glucose. We could supplement the bioreactor with glucose to inhibit expression of the kill genes in the bioreactor. Escape of bacteria into the tailings ponds would cause expression of the kill genes due to lack of glucose in the surrounding environment.<br />
</p> <br />
<p>This promoter, known as <i>pRha</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902065">BBa_K902065</a>), is responsible for regulating genes related to rhamnose metabolism and contains a separate promoter on its leading and reverse strands (see figure 8). <i>RhaR</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902069">BBa_K902069</a>) and <i>RhaS</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902068">BBa_K902068</a>) serve to regulate expression of the rhamnose metabolism operon <i>rhaBAD</i>. The <i>RhaR</i> transcription factor is activated by L-rhamnose to up-regulate expression <i>rhaSR</i> operon. In turn, the resulting <i>RhaS</i> activates the <i>rhaBAD</i> operon to generate the rhamnose metabolism genes (Egan & Schleif, 1993).</p><br />
<br />
</html>[[File:NativeRhamnosePromoter_Calgary2012.jpg|thumb|750px|center|Figure 8: The rhamnose metabolism genes as they exist in Top Ten <i>E. coli</i>]]<br />
<html><br />
<br />
</html>[[File:PrhaFinal.png|thumb|750px|center|Figure 9: The rhamnose metabolism genes native to <i>E. coli</i>]]<br />
<html><br />
<p>Our kill system is different from the native rhamnose system with the <i>rhaR</i> and <i>rhaS</i> control genes. We have constitutively expressed <i>RhaS</i> to overcome dependency on rhamnose to cause activation of the kill switch. While <i>RhaS</i> is continuously present, the system is shut off in the presence of glucose. However, in the outside environment glucose levels are lower such that <i>RhaS</i> is able to activate the kill genes.</p><br />
<h3>Building the system</h3><br />
<p>Our team had <i>pRha</i> promoter (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902065">BBa_K902065</a>) commercially synthesized as per the sequence given by Jeske and Altenbuchner (2010). The <i>rhaS</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902068">BBa_K902068</a>) and <i>rhaR</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902069">BBa_K902069</a>) genes were amplified via PCR from Top 10 <i>E. coli</i> using Kapa HiFi polymerase. </p><br />
<p>We tested the unoptimized rhamnose system using a fluorescent output. INSERT FIGURE </p><br />
<p>Additionally, we also tested the rhamnose system with micrococcal nuclease in the presence of glucose and rhamnose in both Top10 cells as well as glyA knockout from the Keio knockout collection. INSERT FIGURE AND DESCRIBE STUFF</p><br />
<p><br />
<h2> The Glycine Auxotroph </h2><br />
<p> The idea of using an auxotropic system was initially considered, however due to the pricing of this system we felt it to be inappropriate for a large scale bioreactor. Auxotrophic systems that we had looked into included the 5-fluoro-orotic acid and histidine, which were both found to be expensive. This idea was reconsidered when our <a href="https://2012.igem.org/Team:Calgary/Project/OSCAR/FluxAnalysis">Flux Variability Analysis</a> showed that the Petrobrick system can be optimized with glycine added to the media. The production of hydrocarbons increased by a factor of 3 with our glycine media when compared to Washington’s production media. This finding justified our introduction of a glycine auxotrophic system as the increased efficiency of the Petrobrick in addition to another safety feature far outweighed the cost of implementing the system. This is feasible because glycine is not readily found in the environment and is relatively inexpensive to supplement on a large scale. </p> <p> We used a knockout strain JW2535-1 from the Keio collection in which the gene responsible for the synthesis of glycine was knocked out. The bacteria become dependent on glycine in the environment. The JW2535-1 knockout strain used works directly on glyA which is a component of the glycine hydroxymethyltransferase by mutating the glyA into Kan which overall prevents the bacteria’s growth. A glycine assay was set up to determine concentrations of glycine needed for the survival of the bacteria. The bacteria were grown on plate with glycine concentrations ranging from 1nM to 100mM. When zero glycine was added to the media there was some bacterial growth over time. This system will therefore need to work in conjunction with the kill switch system as another layer of security to reduce possibility of escapers. Please see our <a href="https://2012.igem.org/Team:Calgary/Project/Synergy">Synergy Page</a> for more information. </p><br />
</html><br />
}}</div>Kevinm.huiehttp://2012.igem.org/Team:Calgary/Project/HumanPractices/Killswitch/RegulationTeam:Calgary/Project/HumanPractices/Killswitch/Regulation2012-10-27T01:55:47Z<p>Kevinm.huie: </p>
<hr />
<div>{{Team:Calgary/TemplateProjectOrange|<br />
TITLE=Regulation/Expression Platform|<br />
CONTENT=<br />
<html><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/8c/UCalgary2012_FRED_Killswitch_Regulation_Low-Res.png" style="float: right; padding: 10px; height: 200px;"></img><br />
<div align="justify"><br />
<br />
<h2> Tight Regulation </h2><br />
<p>Inducible kill systems are not new to iGEM. Looking through the registry, there are several constructs such as the inducible BamHI system contributed by Berkley in 2007 (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_I716462">BBa_I716462</a>) and <a href="http://partsregistry.org/Image:UoflBamHIdatasheet.png">tested by Lethbridge in 2011</a>. This uses a <i>BamHI</i> gene downsteam of an arabinose-inducible promoter. Another example is an IPTG inducible Colicin construct (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K117009">BBa_K117009</a>) submitted by NTU-Singapore in 2008. One major problem with these systems however is a lack of tight control. As was demonstrated by the Lethbridge 2011 team, this part has leaky expression when inducer compound is not present. The frequently used lacI promoter has similar problems when not used in conjunction with strong plasmid-mediated expression of lacI. This can be seen in our electrochemical characterization of the UidA hydrolase enzyme (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902002">BBa_K902002</a>) shown here. Tight control is not only a problem for kill switch application, but for any application requiring strict regulation. As such, we decided that expanding the registry repertoire of control elements would be useful for our system as well as a variety of other applications. Therefore we added a new level of regulation in addition to the promoter, a riboswitch</p><br />
<h2> Introducing the Riboswitch </h2><br />
<p>Riboswitches are small pieces of mRNA which bind ligands to modify translation of downstream genes. These sites are engineered into circuits by replacing traditional ribosome binding sites with riboswitches. The riboswitch is able to bind its respective ligand to inhibit or promote binding of translational machinery (Vitreschak <i>et al</i>, 2004). Riboswitches can be used in tandem with an appropriate promoter to enable tighter control of gene expression. Given this opportunity for control, and that ligands for riboswitches are often inexpensive small ions, these methods might be a feasible solution for controlling the kill switch in our industrial bioreactor.</p><br />
<br />
</html> [[File:UofC_RIBOSWITCH.png|centre|350px|center|Figure 1: A simply diagram illustrating the riboswitch and the three metabolite, magnesium, manganese and molybdenum, we have tested.]] <html><br />
<br />
<p>We explored 3 different riboswitches, each responsive to a different metabolite (magnesium, manganese or molybdate co-factor) that would be inexpensive to implement into a bioreactor environment. Additionally, we also investigated a repressible and inducible promoter, responsive to glucose and rhamnose respectively.</p><br />
<p>The general approach taken to build the system was constructing the promoter with the respective riboswitch followed by the kill genes. </p><br />
<h2>Magnesium riboswitch</h2><br />
<p>The magnesium riboswitch that we looked at is repressed in the presence of magnesium ions. This system has two control components – a promoter and a riboswitch. Normally the magnesium (mgtA) promoter (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902009">BBa_K902009</a>) and the magnesium (mgtA) riboswitch (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902008">BBa_K902009</a>) are activated if there is a deficiency of magnesium in the cell (Winnie and Groisman, 2010). The sequence of the <i>mgtA</i> promoter and riboswitch was obtained from Winnie and Groisman. A lack of magnesium activates other genes in <i>E. coli </i>to allow influx of magnesium into the cell. The two proteins in the cascade that activate the system are <i>PhoP</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902010">BBa_K902010</a>) and <i>PhoQ</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902011">BBa_K902011</a>). <i>PhoQ</i> is the trans-membrane protein which gets activated in the absence of magnesium and phosphorylates <i>PhoP</i>. <i>PhoP</i> in turn binds to the mgtA promoter and transcribes genes downstream (Winnie and Groisman, 2010).</p><br />
<br />
<h2>Manganese riboswitch</h2><br />
<p> Manganese is an essential micronutrient. It is an important co-factor for enzymes and it also reduces oxidative stress in the cell (Waters <i>et al</i>. 2011). Despite being an important micronutrient, it is toxic to cells at high levels. MntR protein detects the level of manganese in the cell and acts as a transcription factor to control the expression of manganese transporter such as MntH, MntP and MntABCDE. In order to regulate these genes <i>mntR</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902030">BBa_K902030</a>) binds to the mntP promoter (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902073">BBa_K902073</a>). The manganese homeostasis is also controlled by the manganese riboswitch <i>mntPrb</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902074">BBa_K90274</a>). The sequences of the <i>mntP</i> promoter and the <i>mntP</i> riboswitch was obtained from the Waters et al, 2011.</p><br />
<br />
</html><br />
[[File:Ucalgary2012 KillswitchstuffsystemsAandB.png|thumb|800px|left|Figure 2: '''A)''' MgtA pathway in <i>E. coli</i>. <i>PhoQ</i> is the transmembrane receptor which, upon detecting low magnesium concentrations, phosphorylates <i>PhoP</i> which acts as a transcription factor, transcribing genes downstream of the MgtA promoter necessary for bringing magnesium into the cell. There is a second level of control with the magnesium riboswitch. In the presence of high magnesium the riboswitch forms a secondary structure which does not allow the ribosome to bind to the transcript, thus inhibiting translation. '''B)''' In the presence of manganese, the <i>MntR</i> protein represses the <i>mntH</i> transporter, preventing the movement of manganese and also upregulating the putative efflux pump. Genes downstream of the mntP promoter are thus transcribed in the presence of manganese. The addition of the <i>MntR</i> protein in this system allows for tighter regulation of the system.]]<html><br />
<br />
<h2> The Moco Riboswitch </h2><br />
<br />
<p>The molybdenum cofactor riboswitch (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902023">BBa_K902023</a>) is an RNA element which responds to the presence of the metabolite molybdenum cofactor (MOCO) (Regulski et al, 2008). This RNA element is located in the <i>E.coli</i> genome just upstream of the <i>moaABCDE</i> operon (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902024">BBa_K902024</a>), containing the moco synthesis genes. Moco is an important co-factor in many different enzymes. The moco riboswitch has 2 regions: an aptamer domain and the expression platform. When moco is present in the cell it will bind to the aptamer region in the riboswitch causing an allosteric change. This allosteric change affects the expression platform by physically hiding the ribosome binding site which prevents translation.</p><br />
<br />
<br />
<br />
</html><br />
[[File:Moco_riboswitchCalgary2012.jpg|thumb|750px|center|Figure 3: This picture depicts the Moco RNA motif which is upstream of the <i>moaABCDE</i> operon. ]]<html> <br />
<br />
<h2> Building the Systems </h2><br />
<br />
<p> Using these riboswitches, we wanted to design a system where we would place our kill genes downstream, and then supplement our bioreactor with the appropriate ions to keep the systems turned off. We biobricked and submitted DNA for the the <i>mgtaP</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902009">BBa_K902009</a>) and mntP promoter (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902073">BBa_K902073</a>) as well as their respective riboswitches (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902008">BBa_K902008</a>) (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902074">BBa_K902074</a>) and the moco riboswitch (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902023">BBa_K902023</a>). In addition, we also biobricked some of the regulatory proteins: <i>PhoP</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902010">BBa_K902010</a>), <i>PhoQ</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902011">BBa_K902011</a>), <i>mntR</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902030">BBa_K902030</a>) and the Moa Operon (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902024">BBa_K902024</a>) . Our final system would inovolve constitutive expression of these necessary regulatory elements upstream of our riboswitches and kill genes. An example of the manganese system is shown in figure 4. </p><br />
<br />
</html>[[File:U.Calgary.2012_10.02.2012_Final_Construct_1.png|thumb|600px|center|Figure 4: Final construct for the manganese system. The circuit includes a TetR promoter, RBS, mntR, double terminator, mntP promoter, mntP riboswitch, <i>S7</i>, mntP riboswitch and <i>CViAII</i>.]]<html><br />
<br />
<br />
<a name="killswitch"></a><h2> Characterizing the riboswitches </h2><br />
<br />
<h3> GFP testing</h3><br />
<br />
</html>[[File:MgtA circuits Ucalgary1.png|thumb|150px|right|Figure 5: In these set of circuits, <i>TetR</i>-RBS-K082003 serves as a positive control and the <i>mgtAp-mgtArb</i> serves as a negative control.]]<html><br />
<br />
<p> In order to test the control of these promoters and riboswitches, we constructed them independently and together upstream of GFP (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K082003">BBa_K082003</a>) with an LVA tag. Figure 5 shows these circuits for the mgtA system. Identical circuits were designed for all three systems, however only the top two were needed for the mocoriboswitch system.</p><br />
<br />
<p>We then tested the aforementioned circuits by growing cells containing our circuits with varying concentrations of their respective ions. Our detailed protocols can be found <a href="https://2012.igem.org/Team:Calgary/Notebook/Protocols/mgcircuit">here</a>. We then measured fluorescent output, normalizing to a negative control not expressing GFP.</p><br />
<br />
<h3> Results </h3><br />
<br />
<p>So far, we have been able to obtain results for our magnesium system, as can be seen in figure 6. </html><br />
[[File:Magmesium graph ucalgary2.png|thumb|500px|left|Figure 6: This graph represents the relative fluorescence units from the mgtA promoter riboswitch construct as well as the riboswitch construct under the TetR promoter (BBa_R0040). We can see a decrease in the level of GFP output with increasing concentrations of magnesium. There is much steeper decrease in the GFP output in the construct with the magnesium promoter and riboswitch compared to the construct with just the riboswitch alone.]]<html></p><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br />
<br />
<br />
<p>As the graph shows, there is a much larger decrease in the GFP output when the mgtA promoter and riboswitch are working together as compared to the <i>mgtA</i> riboswitch alone under the control of TetR promoter (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_J13002">BBa_J13002</a>). This suggests that having both the promoter and the riboswitch together provides a tighter control over the genes expressed downstream. This also suggests that the magnesium riboswitch alone is sufficient in reducing gene expression downstream of a constitutive promoter.</p><br />
<br />
<p> It is important to consider however that the control elements of the system, <a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902010"><i>PhoP</i> </a> and <a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902011"> <i>PhoQ</i></a>, that were described above were not present in the circuits tested and therefore there is GFP expression in at the inhibitory concentration (10mM MgCl<sub>2</sub>). We believe that having the regulatory elements would give us better control and limit the leakiness.</p><br />
<br />
<p>Although the magnesium system is highly regulated, it is not a suitable system for the purposes of our bioreactor. The tailings are composed of very high concentration of magnesium, as high as 120mM (Kim <i>et al</i>. 2011). As can be seen, this would inhibit the system. Therefore, if our bacteria were to escape into the tailings, the kill genes would not be activated and the bacteria would be able to survive. However, we feel that this could still be an incredibly useful system for other teams for both killswtitch and non-killswitch-related applications, making it still a valuable contribution to the registry. </p><br />
<br />
<h3> Kill Gene Testing </h3><br />
<br />
<p> While building our systems with GFP in order to test their control, we also constructed them with our kill genes. This was delayed substantially however due to problems in their synthesis. Specifically, the micrococcal nuclease that arrived from IDT had a 1bp point mutation which changed an isoleucine residue into a lysine. Initially, our systems resulted in no killing of cells. Therefore we had to mutate this residue using <a href="https://2012.igem.org/Team:Calgary/Notebook/Protocols/mutagenesis"> site-directed mutagenesis</a>. Once completed, we were able to begin testing. With our GFP data collected, we moved on to characterizing the mgtA control system upstream of our <i>S7</i> kill gene (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902019">BBa_K902019</a>). To test the circuits, we incubated cells expressing our construct with varying concentrations of magnesium. We then measured both Colony Forming Units (CFU) and OD 600. For a deatiled protocol, see <a href="https://2012.igem.org/Team:Calgary/Notebook/Protocols/mgtacircuit">here</a>.</p><br />
<br />
<h3> Results </h3><br />
<br />
</html>[[File:24 hour assay with mgtap-rb-S7 Ucalgary.png|thumb|750px|center| Figure 7: This shows the OD600 values of mgtA circuits with S7 both mutated and unmutated. The negative control consists of <i>mgtAp-mgtArb</i>.]]<html><br />
<p> Figure 7 shows that the mgtAp-mgtArb-S7 (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902018">BBa_K902018</a>) starts acting approximately 4 hours after induction. However, it also shows that 10mM MgCl<sub>2</sub> is not enough salt to inhibit the entire system because there is no difference in OD600 measurement at 4hr time point between 10mM and the 0mM concentrations. This test needs to be repeated with higher concentrations of Mg<sup>2+</sup> however this data suggests that the mutagenesis was successful and <i>S7</i> is active and killing the cells at approximately 4hr which does not necessarily reflect solely upon the activity of <i>S7</i> but also on the response time of the mgtA system.</p><br />
<br />
<br />
<h2>An alternative: a glucose repressible system</h2><br />
<br />
<p>Based on the problem with the magnesium system in relation to tailings pond conditions, we wanted to find an alternative. We found a promoter that was induced by rhamnose and repressed by glucose. This seemed to be a very suitable candidate for controlling the kill switch in the bioreactor since the promoter was shown to be tightly repressed by glucose. We could supplement the bioreactor with glucose to inhibit expression of the kill genes in the bioreactor. Escape of bacteria into the tailings ponds would cause expression of the kill genes due to lack of glucose in the surrounding environment.<br />
</p> <br />
<p>This promoter, known as <i>pRha</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902065">BBa_K902065</a>), is responsible for regulating genes related to rhamnose metabolism and contains a separate promoter on its leading and reverse strands (see figure 8). <i>RhaR</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902069">BBa_K902069</a>) and <i>RhaS</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902068">BBa_K902068</a>) serve to regulate expression of the rhamnose metabolism operon <i>rhaBAD</i>. The <i>RhaR</i> transcription factor is activated by L-rhamnose to up-regulate expression <i>rhaSR</i> operon. In turn, the resulting <i>RhaS</i> activates the <i>rhaBAD</i> operon to generate the rhamnose metabolism genes (Egan & Schleif, 1993).</p><br />
<br />
</html>[[File:NativeRhamnosePromoter_Calgary2012.jpg|thumb|750px|center|Figure 8: The rhamnose metabolism genes as they exist in Top Ten <i>E. coli</i>]]<br />
<html><br />
<br />
</html>[[File:PrhaFinal.png|thumb|750px|center|Figure 9: The rhamnose metabolism genes native to <i>E. coli</i>]]<br />
<html><br />
<p>Our kill system is different from the native rhamnose system with the <i>rhaR</i> and <i>rhaS</i> control genes. We have constitutively expressed <i>RhaS</i> to overcome dependency on rhamnose to cause activation of the kill switch. While <i>RhaS</i> is continuously present, the system is shut off in the presence of glucose. However, in the outside environment glucose levels are lower such that <i>RhaS</i> is able to activate the kill genes.</p><br />
<h3>Building the system</h3><br />
<p>Our team had <i>pRha</i> promoter (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902065">BBa_K902065</a>) commercially synthesized as per the sequence given by Jeske and Altenbuchner (2010). The <i>rhaS</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902068">BBa_K902068</a>) and <i>rhaR</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902069">BBa_K902069</a>) genes were amplified via PCR from Top 10 <i>E. coli</i> using Kapa HiFi polymerase. </p><br />
<p>We tested the unoptimized rhamnose system using a fluorescent output. INSERT FIGURE </p><br />
<p>Additionally, we also tested the rhamnose system with micrococcal nuclease in the presence of glucose and rhamnose in both Top10 cells as well as glyA knockout from the Keio knockout collection. INSERT FIGURE AND DESCRIBE STUFF</p><br />
<p><br />
<h2> The Glycine Auxotroph </h2><br />
<p> The idea of using an auxotropic system was initially considered, however due to the pricing of this system we felt it to be inappropriate for a large scale bioreactor. Auxotrophic systems that we had looked into included the 5-fluoro-orotic acid and histidine, which were both found to be expensive. This idea was reconsidered when our <a href="https://2012.igem.org/Team:Calgary/Project/OSCAR/FluxAnalysis">Flux Variability Analysis</a> showed that the Petrobrick system can be optimized with glycine added to the media. The production of hydrocarbons increased by a factor of 3 with our glycine media when compared to Washington’s production media. This finding justified our introduction of a glycine auxotrophic system as the increased efficiency of the Petrobrick in addition to another safety feature far outweighed the cost of implementing the system. This is feasible because glycine is not readily found in the environment and is relatively inexpensive to supplement on a large scale. </p> <p> We used a knockout strain JW2535-1 from the Keio collection in which the gene responsible for the synthesis of glycine was knocked out. The bacteria become dependent on glycine in the environment. The JW2535-1 knockout strain used works directly on glyA which is a component of the glycine hydroxymethyltransferase by mutating the glyA into Kan which overall prevents the bacteria’s growth. A glycine assay was set up to determine concentrations of glycine needed for the survival of the bacteria. The bacteria were grown on plate with glycine concentrations ranging from 1nM to 100mM. When zero glycine was added to the media there was some bacterial growth over time. This system will therefore need to work in conjunction with the kill switch system as another layer of security to reduce possibility of escapers. Please see our <a href="https://2012.igem.org/Team:Calgary/Project/Synergy">Synergy Page</a> for more information. </p><br />
</html><br />
}}</div>Kevinm.huiehttp://2012.igem.org/Team:Calgary/Notebook/Protocols/constructionTeam:Calgary/Notebook/Protocols/construction2012-10-04T03:45:29Z<p>Kevinm.huie: </p>
<hr />
<div>{{Team:Calgary/TemplateNotebookOrange|<br />
TITLE=Restriction Digest, Antarctic Phosphotase, and Ligation|<br />
CONTENT=<html><br />
<br />
<p> Determine the order of the two parts you will be putting together; the one in front will be referred to as the insert, while the one behind will be referred to as the vector. Both the vector and the insert need to have their own separate tube, at least in the beginning. </p><br />
<p><em> Restriction Digest Protocol</em></p><br />
<p> In the Insert Tube...<br />
<ul><br />
<li>600 ng of DNA (To figure out the volume, the calculation is 600 / concentration of plasmid. This gives you volume in μL).</li><br />
<li>Water, so that the volume of both DNA and water in the tube is 35 μL total</li><br />
<li>4 μL of React 1 Buffer </li><br />
<li>0.5 μL of EcoRI </li><br />
<li>0.5 μL of SpeI</li><br />
</ul><br />
</p><br />
<p> In the vector Tube...<br />
<ul><br />
<li>200 ng of DNA (To figure out the volume, the calculation is 250 / concentration of plasmid. This gives you volume in μL).</li><br />
<li>Add water, so that the volume of both DNA and water in the tube is 35 μL total</li><br />
<li>4 μL of React 2 Buffer</li><br />
<li>0.5 μL of EcoRI</li><br />
<li>0.5 μL of XbaI</li><br />
</ul><br />
</p><br />
<p> Put both tubes into the 37°C water bath for one hour. After, place them into the 82°C heating block for 20 minutes. This deactivates any enzymes in the tube (which is ok, because by now they’ve done all they need to).<br />
Take the insert out, and put it in a -20°C freezer. </p><br />
<p><em> Antarctic Phosphatase Protocol</em></p><br />
<p> To the vector tube, add 5 μL of 10x Antarctic Phosphatase Buffer, 4 μL of water, and 1 μL of Antarctic Phosphatase. We do this to prevent the vector from closing up again without any insert.<br />
Put the tube into the 37°C water bath for 30 mins. After, place it in the 82°C heating block for 10 minutes. </p><br />
<p><em> Ligation Protocol </em></p><br />
<p>Take the insert out of the freezer, and add 5 μL of insert and 5 μL of vector to a new tube. Label the rest of each tube as Unligated, put the date on the tube, and stick it in the -20°C freezer incase your ligation/transformation doesn’t work. To the single tube of 10 μL mix, add 4 μL of 5X T4 Ligase Buffer, 0.5 μL of T4 Ligase and 6 μL of double distilled water. Let this sit at room temperature for at least 60 minutes. </p><br />
<p> You are now done. If you are going to transform this construction product, add all 21μL to a tube of whichever competent bacteria you're using. </p><br />
<br />
</html>}}</div>Kevinm.huiehttp://2012.igem.org/Team:Calgary/Notebook/Protocols/compcellsTeam:Calgary/Notebook/Protocols/compcells2012-10-04T03:37:54Z<p>Kevinm.huie: </p>
<hr />
<div>{{Team:Calgary/TemplateNotebookOrange|<br />
TITLE=Making Chemically Competent <i>E. coli</i> Cells|<br />
CONTENT=<html><br />
<br />
<br />
<br />
<p>This procedure was done using Top10 cells ordered from Invitrogen. 50 mL Falcon tubes were used for this protocol.</p><br />
<br />
<ol><br />
<li> Innoculate 5-10 mL LB at 37&deg;C while shaking </li><br />
<li> Subculture 1 mL of bacteria solution into 50 mL LB broth at 37&deg; while shaking<br />
until OD600 is 0.4-0.6 (This step should require approximately 2.5 hours) </li><br />
<li> Centrifuge the subculture at 10 000 rpm at 4&deg;C for 2 minutes </li><br />
<li> Resuspend pellet in 12.5 mL of cold CaCl<sub>2</sub> (50 mM) and leave on ice for 10 minutes </li><br />
<li> Centrifuge at 10 000 rpm at 4&deg;C for 2 minutes and resuspend in 2 mL of cold CaCl<sub>2</sub> (50 mM, 15% glycerol solution) </li><br />
<li> Leave on ice for at least 30 minutes and then aliquot 200 μL and freeze at -80&deg;C </li><br />
</ol><br />
<br><br><br><br><br><br><br><br><br><br><br />
</html>}}</div>Kevinm.huiehttp://2012.igem.org/Team:Calgary/Notebook/Protocols/oncultureTeam:Calgary/Notebook/Protocols/onculture2012-10-04T03:31:53Z<p>Kevinm.huie: </p>
<hr />
<div>{{Team:Calgary/TemplateNotebookOrange|<br />
TITLE=Overnight Cultures|<br />
CONTENT=<html><br />
<br />
<p> Reagents and Materials (per culture prepared):<br />
<ul><br />
<li> 10mL culture tube. Use 16mm x 160mm or 16mm x 125mm</li><br />
<li> 5 mL LB</li><br />
<li> 5 μL 1000X antibiotics</li><br />
<li> Single colonies on a plate (best not to start an over night from a glycerol stock)</li><br />
</ul><br />
</p><br />
<p> Protocol </p><br />
<ol><br />
<br />
<li> Add 5mL sterile/autoclaved LB in a 10mL culture tube. </li><br />
<li> Pipet 5μL of 1000X antibiotic into the LB.</li><br />
<li> Select a single colony using a sterile toothpick or pipette tip. </li><br />
<li> Place toothpick or pipette tip in the culture tube and stir. </li><br />
<li> Remove toothpick, or in the case of a pipette tip, leave in the tube. </li><br />
<li>Place culture tube in incubator at 37°C overnight shaking vigorously (250 RPM)</li><br />
</ol><br />
<br></br><br></br><br></br><br />
</html>}}</div>Kevinm.huiehttp://2012.igem.org/Team:Calgary/Notebook/Protocols/transformationTeam:Calgary/Notebook/Protocols/transformation2012-10-04T03:29:35Z<p>Kevinm.huie: </p>
<hr />
<div>{{Team:Calgary/TemplateNotebookOrange|<br />
<br />
TITLE= Bacterial Transformation|<br />
CONTENT = <html><br />
<br />
<ol><br />
<li> Thaw 100 μL of competent cells (per transformation) on ice just before they are needed</li><br />
<li> Add DNA (max 20μl) thawed cells and mix by flicking the side of the tube. Leave on ice for 30 minutes</li><br />
<li> Heat shock 5 minutes at 37 degrees Celsius</li><br />
<li> Place on ice for 5 minutes </li><br />
<li> Add 250ul SOC medium to each tube</li><br />
<li> Incubate for 30 to 60 minutes with shaking at 37&deg;C. (Note that for Kanamycin containing plasmids always use one hour)</li><br />
<li> Spin down to remove all supernatant except approximately 100 μL</li><br />
<li> Plate approximately 50 μL on each of two antibiotic plates </li><br />
<li> <a href="https://2012.igem.org/Team:Calgary/Notebook/Protocols/onculture">Grow overnight</a> at 37&deg;C </li><br />
</ol><br />
<p> For this protocol we used a couple of controls<br />
<ul><br />
<li> <b> Positive Control </b> - pBluescript in TOP10 cells on ampicillin plates </li><br />
<li> <b> Negative Control </b> - TOP10 cells grown on ampcillin plates </li><br />
</ul><br />
</p><br />
<br />
<br></br><br></br><br></br><br />
<br />
</html>}}</div>Kevinm.huiehttp://2012.igem.org/Team:Calgary/Notebook/Protocols/constructionTeam:Calgary/Notebook/Protocols/construction2012-10-04T03:28:37Z<p>Kevinm.huie: </p>
<hr />
<div>{{Team:Calgary/TemplateNotebookOrange|<br />
TITLE=Restriction Digest, Antarctic Phosphotase, and Ligation|<br />
CONTENT=<html><br />
<br />
<p> Determine the order of the two parts you will be putting together; the one in front will be referred to as the insert, while the one behind will be referred to as the vector. Both the vector and the insert need to have their own separate tube, at least in the beginning. </p><br />
<p><em> Restriction Digest Protocol</em></p><br />
<p> In the Insert Tube...<br />
<ul><br />
<li>600 ng of DNA (To figure out the volume, the calculation is 600 / concentration of plasmid. This gives you volume in μL).</li><br />
<li>Water, so that the volume of both DNA and water in the tube is 35 μL total</li><br />
<li>4 μL of React 1 Buffer </li><br />
<li>0.5 μL of EcoRI </li><br />
<li>0.5 μL of SpeI</li><br />
</ul><br />
</p><br />
<p> In the vector Tube...<br />
<ul><br />
<li>200 ng of DNA (To figure out the volume, the calculation is 250 / concentration of plasmid. This gives you volume in μL).</li><br />
<li>Add water, so that the volume of both DNA and water in the tube is 35 μL total</li><br />
<li>4 μL of React 2 Buffer</li><br />
<li>0.5 μL of EcoRI</li><br />
<li>0.5 μL of XbaI</li><br />
</ul><br />
</p><br />
<p> Put both tubes into the 37°C water bath for one hour. After, place them into the 82°C heating block for 20 minutes. This deactivates any enzymes in the tube (which is ok, because by now they’ve done all they need to).<br />
Take the insert out, and put it in a -20°C freezer. </p><br />
<p><em> Antarctic Phosphatase Protocol</em></p><br />
<p> To the vector tube, add 5 μL of 10x Antarctic Phosphatase Buffer, 4 μL of water, and 1 μL of Antarctic Phosphatase. We do this to prevent the vector from closing up again without any insert.<br />
Put the tube into the 37°C water bath for 30 mins. After, place it in the 82°C heating block for 10 minutes. </p><br />
<p><em> Ligation Protocol </em></p><br />
<p>Take the insert out of the freezer, and add 5 μL of insert and 5 μL of vector to a new tube. Label the rest of each tube as Unligated, put the date on the tube, and stick it in the -20°C freezer incase your ligation/transformation doesn’t work. To the single tube of 10 μL mix, add 4 μL of T4 Ligase Buffer, 0.5 μL of T4 Ligase and 6 μL of double distilled water. Let this sit at room temperature for at least 60 minutes. </p><br />
<p> You are now done. If you are going to transform this construction product, add all 21μL to a tube of whichever competent bacteria you're using. </p><br />
<br />
</html>}}</div>Kevinm.huiehttp://2012.igem.org/Team:Calgary/Project/ReferencesTeam:Calgary/Project/References2012-10-04T02:31:39Z<p>Kevinm.huie: </p>
<hr />
<div>{{Team:Calgary/TemplateProjectOrange|<br />
TITLE=References|<br />
CONTENT={{{CONTENT|<br />
<html><br />
<br />
<br />
<ul><br />
<br />
<li>2009 iGEM Calgary. <a href="https://2009.igem.org/Team:Calgary/Notebook"> https://2009.igem.org/Team:Calgary/Notebook</a> </li><br><br />
<br />
<li>Asenjo J.A. (1949). Bioreactor system design. New York (NY): Marcel Dekker Inc.</li><br><br />
<br />
<li>Becker SA, Feist AM, Mo ML, Hannum G, Palsson BØ, Herrgard MJ. Quantitative prediction of cellular metabolism with constraint-based models: the COBRA Toolbox. Nature Protocols 2 2007 Mar; 727-723.</li></br><br />
<br />
<li>Becker SA, Feist AM, Mo ML, Hannum G, Palsson BØ, Herrgard MJ. Quantitative prediction of cellular metabolism with constraint-based models: the COBRA Toolbox v2.0. Nature Protocols 6 2011 Aug; 1290-1307.</li></br><br />
<br />
<li>Behar F.H, Albrecht P. Correlations between carboxylic acids and hydrocarbons in several crude oils alteration by biodegradation. Organic Geochemistry 1984;6:597-604. </li><br><br />
<br />
<li>Biran I, Levcov K, Hengge-Aronis R, Ron EZ, Rishpon J. On-line monitoring of gene expression. Microbiology.1999 April;145:2129-2133.</li></br><br />
<br />
<li>Canadian Centre for Occupational Health and Safety: Health Effects of Sulfur Dioxid. <a href="http://www.ccohs.ca/oshanswers/chemicals/chem_profiles/sulfurdi/health_sul.html">http://www.ccohs.ca/oshanswers/chemicals/chem_profiles/sulfurdi/health_sul.html</a> (Retrieved: 09/18/2012)</li><br><br />
<br />
<li>Clemente J.S, Fedorak P.M. A review of the occurrences, analyses, toxicity, and biodegradation of naphthenic acids. Chemosphere 2005 Feb 6;60(5):585-600.</li><br><br />
<br />
<li>Cromie MJ, Groisman EA. Promoter and riboswitch control of the Mg2+ transporter MgtA from Salmonella enterica. <J Bacteriol 2010 Jan;192(2):604-607.</li><br><br />
<br />
<li>Dana G, Kuiken T, Rejeski D & Snow A (2012) Synthetic biology: Four steps to avoid a synthetic-biology disaster. Nature 483:29.</li><br><br />
<br />
<li>Daus B, Mattusch J, Paschke A, Wennrich R, and Weiss H. Kinetics of the arsenite oxidation in seepage water from a tin mill tailings pond. Talanta 2000 May 5; 51(6) 1087-95. </li></br><br />
<br />
<li>Del Rio LF, Hadwin AK, Pinto LJ, MacKinnon MD, Moore MM. Degradation of naphthenic acids by sediment micro-organisms. J Appl Microbiol 2006 Nov;101(5):1049-1061. </li><br><br />
<br />
<li>Diaz, E. & Garcia, J.L. Genetics Engineering for Removal of Sulfur and Nitrogen from Fuel Heterocycles. Handbook of Hydrocarbon and Lipid Microbiology: 2144-2157. Springer, 2010. </li><br><br />
<br />
<li>Environmental Protection Agency, (1995), Nitrogen oxides (NOx) Why and how they are controlled. <a href="http://www.epa.gov/ttn/catc/dir1/fnoxdoc.pdf">http://www.epa.gov/ttn/catc/dir1/fnoxdoc.pdf</a> </li><br><br />
<br />
<li>Feist AM, Henry CS, Reed JL, Krummenacker M, Joyce AR, Karp PD, Broadbelt LJ, Hatzimanikatis V, Palsson BØ. A genome-scale metabolic reconstruction for <i>Escherichia coli</i> K-12 MG1655 that accounts for 1260 ORFs and thermodynamic information. Molecular Systems Biology 3 2007 Jun; 121.</li></br><br />
<br />
<li>Frank R.A, Fischer K, Kavanagh R, Burnison B.K, Aresenault G, Headley J, Peru K.M, VanDerKraak G, Solomon K. Effect of Carboxylic Acid Content on the Acute Toxicity of Oil Sands Naphthenic Acids. EnvironSciTechnol 2009 Dec 11;43(2):266–271.</li><br><br />
<br />
<li>Galán B, Díaz E, García JL. Enhancing desulfurization by engineering a flavin reductase-encoding gene cassette in recombinant biocatalysts. Environmental microbiology. 2000 Dec; 2(6): 687-94 </li><br><br />
<br />
<br />
<li>German Collection of Microorganisms and Cell Cultures (DSMZ): Nocardia iowensis. <a href="https://www.dsmz.de/catalogues/details/culture/DSM-45197.html">https://www.dsmz.de/catalogues/details/culture/DSM-45197.html</a></li><br><br />
<br />
<br />
<li>Gopinath AV, Russell D. An Inexpensive Field-Portable Programmable Potentiostat. Chem.Educator.2006 July;11:23-28.</li></br><br />
<br />
<li>Harayama S, Rekik M, Wasserfallen A and Bairoch A. Evolutionary relationships between catabolic pathways for aromatics: conservation of gene order and nucleotide sequences of catechol oxidation genes of pWW0 and NAH7 plasmids. MGG Mol Gen.Genet.1987; 210(2): 241–247.</li><br><br />
<br />
<li>He A, Li T, Daniels L, Fotheringham I, Rosazza J.P.N. Nocardia sp. Carboxylic Acid Reductase: Cloning, Expression, and Characterization of a New Aldehyde Oxidoreductase Family. Applied and Environmental Microbiology 2004 Mar;70(3):1874–1881.</li><br><br />
<br />
<li>Helmann J. Measuring metals with RNA. J Mol Cell 2007 Sept 21; 27(6) 859-860. </li></br><br />
<br />
<li>Herman DC, Fedorak PM, MacKinnon MD, Costerton JW. Biodegradation of naphthenic acids by microbial populations indigenous to oil sands tailings. Can J Microbiol 1994 Jun;40(6):467-477.</li><br><br />
<br />
<li>Holowenko FM, Mackinnon MD, Fedorak PM. Naphthenic acids and surrogate naphthenic acids in methanogenic microcosms. Water Res 2001 Aug;35(11):2595-2606. </li><br><br />
<br />
<li>Kamali N, Tavallaie M, Bambai B, Karkhane AA, Miri M. Site-directed mutagenesis enhances the activity of NADH-FMN oxidoreductase (DszD) activity of <i>Rhodococcus erythropolis</i>. Biotechnol Lett. 2010; 32: 921-927</li><br><br />
<br />
<li>Katzer JR, Sivasubramanian R. Process and Catalyst Needs for Hydrodenitrogenation. Catalysis Reviews: Science and Engineering 1979; 20(2):155-208. </li><br><br />
<br />
<li>Kayser, K.J. & Kilbane, J.J., II Gas Technology Institute. Method for metabolizing carbazole in petroleum, US Patent No. 6,943,006 B2. Sep 13, 2005. </li><br><br />
<br />
<li>Kilbane JJ. Microbial biocatalyst developments to upgrade fossil fuels. Current Opinion in Biotechnology 2006; 17(3):305-314.</li><br><br />
<br />
<li>Lewenza S, Falsafi RK, Winsor G, Gooderham WJ, McPhee JB, Brinkman FS, et al. Construction of a mini-Tn5-luxCDABE mutant library in Pseudomonas aeruginosa PAO1: a tool for identifying differentially regulated genes. Genome Res 2005 Apr;15(4):583-589. </li><br><br />
<br />
<li>Li GQ, Li SS, Zhang ML, Wang J, Zhu L, Liang FL, Liu RL, Ma T. Genetic rearrangement strategy for optimizing the dibenzothiophene biodesulfurization pathway in <i>Rhodococcus erythropolis</i>. Appl Environ Microbiol. 2008 Feb; 74(4): 971-6 </li><br><br />
<br />
<li>Li MZ, Squires CH, Monticello DJ, Childs JD. Genetic analysis of the dsz promoter and associated regulatory regions of <i>Rhodococcus erythropolis</i> IGTS8. J Bacteriol. 1996 Nov; 178(22): 6409-18</li><br><br />
<br />
<li>Lim HN, Lee Y, Hussein R. Fundamental relationship between operon organization and gene expression. Proc Natl Acad Sci U S A. 2011 Jun 28;108(26):10626-31. </li><br><br />
<br />
<li>Ma T. The Desulfurization Pathway in <i>Rhodococcus</i>. Microbiology Monographs 2010; 16: 207-230.</li><br><br />
<br />
<li>Morales M, Le Borgne S. Microorganisms Utilizing Nitrogen-Containing Heterocyclic Hydrocarbons. Handbook of Hydrocarbon and Lipid Microbiology: 2144-2157. Springer, 2010.</li><br><br />
<br />
<li>Nakai C, Kagamiyama H, Nozaki M. Complete nucleotide sequence of the metapyrocatechase gene on the TOL plasmid of <i>Pseudomonas putida </i> mt-2. J Biol Chem. 1983 Mar; 258(5):2923-2928.</li><br><br />
<br />
<li>Oshiro T, Ohkita R, Takikawa T, Manabe M, Lee WC, Tanokura M, Izumi Y. Improvement of 2'-hydroxybiphenyl-2-sulfinate desulfinase, an enzyme involved in the dibenzothiophene desulfurization pathway, from <i>Rhodococcus erythropolis</i> KA2-5-1 by site-directed mutagenesis. Biosci Biotechnol Biochem. 2007 Nov.; 71(11):2815-21</li><br><br />
<br />
<li>Parts Registry: The PetroBrick – Strong Constitutive Expression of ADC and AAR in pSB1C3 <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K590025 (Retrieved 8/28/2012">http://partsregistry.org/wiki/index.php?title=Part:BBa_K590025 (Retrieved 8/28/2012</a> </li><br><br />
<br />
<li>Phillips R, Kondev J, Theriot J. Physical Biology of the Cell. 1st ed. Garland Science. 2008. </li><br><br />
<br />
<li>Ramesh A, Wakeman CA, and Winkler WC. Insights into metalloregulation by M-box riboswitch RNAs via structural analysis of manganese-bound complexes. J Mol Biol 2011 Apr 8; 407(4) 556-70. </li></br><br />
<br />
<li>Ramos-Padron E, Bordenave S, Lin S, Bhaskar IM, Dong X, Sensen CW, et al. Carbon and sulfur cycling by microbial communities in a gypsum-treated oil sands tailings pond. Environ Sci Technol 2011 Jan 15;45(2):439-446.</li><br><br />
<br />
<li>Reit K., & Tramper J. (1991). Basic bioreactor design. New York (NY):Marcel Dekker Inc.</li><br><br />
<br />
<li>Regulski EE, Moy RH, Weinberg Z, Barrick JE, Yao Z, Ruzzo WL, Breaker RR. A widespread riboswitch candidate that controls bacterial genes involved in molybdenum cofactor and tungsten cofactor metabolism.Mol Microbiol. 2008 May; 68(4): 918–932</li><br> <br />
<br />
<li>Reznikoff WS. Transposon Tn5. Annu Rev Genet 2008;42:269-286. </li><br><br />
<br />
<li>Rude M.A, Baron T.S, Brubaker S, Alibhai M, Del Cardayre S.B, and Schirmer A. Terminal olefin (1-alkene) biosynthesis by a novel p450 fatty acid decarboxylase from Jeotgalicoccus species. Applied and Environmental Microbiology 2011 Mar;77(5):1718–1727.</li><br><br />
<br />
<li>Schweigert N, Zehnder AJ, Eggen RI. Chemical properties of catechols and their molecular modes of toxic action in cells, from microorganisms to mammals. Environ Microbiol 2001 Feb; 3(2):81-91</li><br><br />
<br />
<li>Scott, A., Mackinnon, M.D., Fedorak, P.M. (2005). Naphthenic acids in tailings ponds are more difficult to degrade than commercial naphthenic acids. Environmental Science and Technology, 39, 8388-8394.</li><br><br />
<br />
<br />
<br />
<li>Sheridan DL, Hughes TE. A faster way to make GFP-based biosensors: two new transposons for creating multicolored libraries of fluorescent fusion proteins. BMC Biotechnol 2004 Aug 18;4:17. </li><br><br />
<br />
<li>Shu L, Chiou Y, Orville AM, Miller MA, Lipscomb JD, Que L. X-ray absorption spectroscopic studies of the Fe(II) active site of catechol 2,3-dioxygenase. Implications for the extradiol cleavage mechanism. Biochem 1995; 34:6649-6659.</li><br><br />
<br />
<li>Slavcheva E, Shone B, Turnbull A. Review of napthenic acid corrosion in oilrefining. British Corrosion Journal 1999 Feb;34(2):125-131. </li><br><br />
<br />
<li>So J. Mini-transposon Tn5gfp constructs for differential tagging of microorganisms. Biotechnology and Bioprocess Engineering 1999;4(2):154-156. </li><br><br />
<br />
<li>Soleimani M, Bassi A, Margaritis A. Biodesulfurization of refractory organic sulfur compounds in fossil fuels. Biotechnol Adv. 2007 Nov-Dec;25(6):570-96 </li><br><br />
<br />
<li>Sukovich DJ. Hydrocarbon Biosynthesis by Bacteria: Genes and Hydrocarbon Products. PhD Dissertation, Microbiology, Immunology, and Cancer Biology Graduate Program, University of Minnesota. 2010; 1 – 208.</li><br><br />
<br />
<li>Syncrude, (2012), Tailings Management. <a href="http://www.syncrude.ca/users/folder.asp?FolderID=5913 <br />
">http://www.syncrude.ca/users/folder.asp?FolderID=5913 <br />
</a> </li><br><br />
<br />
<br />
<li>Timms-Wilson TM, Bailey MJ. Reliable use of green fluorescent protein in fluorescent pseudomonads. J Microbiol Methods 2001 Jul 30;46(1):77-80. </li><br><br />
<br />
<li>TOMLAB Optimization, MatLab Optimization. <a href="http://tomopt.com/tomlab/">http://tomopt.com/tomlab/</a> </li><br><br />
<br />
<li>United Nations Environment Programme: Sulfur Air Pollution. <a href="http://www.unep.org/transport/pcfv/pdf/Ethiopia-AirPollutionsulphur.pdf">http://www.unep.org/transport/pcfv/pdf/Ethiopia-AirPollutionsulphur.pdf </a> </li><br><br />
<br />
<br />
<br />
<li>United States Environmental Protection Agency: Sulfur Dioxide. <a href="http://www.epa.gov/air/sulfurdioxide/">http://www.epa.gov/air/sulfurdioxide/</a> </li><br><br />
<br />
<br />
<li>UW iGEM: Diesel Production Background. <a href="https://2011.igem.org/Team:Washington/Alkanes/Background">https://2011.igem.org/Team:Washington/Alkanes/Background</a> </li><br><br />
<br />
<br />
<br />
<li>Vaillancourt FH, Bolin JT, Eltis LD. The ins and outs of ring-cleaving dioxygenases. Crit Rev Biochem Mol. 2006; 41:241-267. </li><br><br />
<br />
<li>Venkitasubramanian P, Daniels L, Rosazza J.P.N. Reduction of Carboxylic Acids by Nocardia Aldehyde Oxidoreductase Requires a Phosphopantetheinylated Enzyme. Journal of Biological Chemistry 2007 Nov 13;282(1):478-485. </li><br><br />
<br />
<li>Vitreschak AG, Rodionov DA, Mironov AA, Gelfand MS. Riboswitches: the oldest mechanism for the regulation of gene expression? Trends Genet 2004 Jan;20(1):44-50.</li></br><br />
<br />
<li>Vogel U, Jensen KF. The RNA chain elongation rate in <i>Escherichia coli</i> depends on the growth rate. J Bacteriol. 1994 May;176(10):2807-13. </li><br><br />
<br />
<li>Waters LS, Sandoval M, and Storz G. <i>The Escherichia coli</i> MntR miniregulon includes genes encoding a small protein and an efflux pump required for manganese homeostasis. J Bacteriol 2011 Nov; 193(21) 5887-97.</li></br><br />
<br />
<br />
<li>Wright JK, Overath P. Purification of the lactose:H+ carrier of <i>Escherichia coli</i> and characterization of galactoside binding and transport. Eur J Biochem.1984 Feb 1;138(3):497-508.</li><br><br />
<br />
<li>Xiong AS, Peng RH, Cheng ZM, Li Y, Liu JG, Zhuang J, Gao F, Xu F, Qiao YS, Zhang Z, Chen JM, Yao QH. Concurrent mutations in six amino acids in beta-glucuronidase improve its thermostability. Protein Eng Des Sel. 2007 Jul;20(7):319-25. Epub 2007 Jun 8. </li><br><br />
<br />
<li>Xu P, Yu P, Li FP, Cai XF, Ma CQ. Microbial degradation of sulfur, nitrogen and oxygen heterocycles. Trends in Microbiology 2006; 14(9):398-405.</li><br><br />
<br />
<li>Yoshimura F, Nikaido H. Permeability of Pseudomonas aeruginosa outer membrane to hydrophilic solutes. J Bacteriol. 1982 Nov;152(2):636-42. </li><br><br />
<br />
<li>Young R, Bremer H. Polypeptide-chain-elongation rate in <i>Escherichia coli</i> B/r as a function of growth rate. Biochem J. 1976 Nov 15;160(2):185-94. </li><br><br />
<br />
<li>Zeuthen P, Knudsen KG, Whitehurst DD.Organic nitrogen compounds in gas oil blends, their hydrotreated products and the importance to hydrotreatment. Catalysis Today Feb 2001; 65(2-4):307-314.</li><br><br />
<br />
<li>Zhang X, Wiseman S, Yu H, Liu H, Giesy JP, Hecker M. Assessing the toxicity of naphthenic acids using a microbial genome wide live cell reporter array system. Environ Sci Technol 2011 Mar 1;45(5):1984-1991.</li><br><br />
<br />
<li>Zhu G, Pang K, Parkin G. New Modes for Coordination of Aromatic Heterocyclic Nitrogen Compounds to Molybdenum: Catalytic Hydrogenation of Quinoline, Isoquinoline, and Quinoxaline by Mo(PMe<sub>3</sub>)<sub>4</sub>H<sub>4</sub>. Journal of the American Chemical Society 2008; 130(5):1564-1565. </li><br><br />
<br />
<br />
<br />
<br />
<br />
<br />
</ul><br />
<br />
<br />
</html>}}}<br />
}}</div>Kevinm.huiehttp://2012.igem.org/Team:Calgary/Notebook/Protocols/plasmidminiprepTeam:Calgary/Notebook/Protocols/plasmidminiprep2012-10-04T02:21:19Z<p>Kevinm.huie: </p>
<hr />
<div>{{Team:Calgary/TemplateNotebookOrange|<br />
<br />
TITLE= Plasmid Purification from <i>E. coli</i>|<br />
CONTENT = <html><br />
<br />
<p>We used two plasmid miniprep protocols. The first protocol is taken from the GenElute Miniprep Plasmid Preparation Kits distributed by Sigma Aldrich. We modified the elution portion of the procedure by using double distilled water to elute rather than using TE buffer. We also skipped the step with the optional wash solution. Instead, the step with the addition of Wash Solution in the Column Tube was done twice.</p><br />
<br />
<br />
<ol><br />
<li> Make overnight cultures from LB agar plate growth (The protocol for the making of overnight cultures can be found as a separate protocol).</li><br />
<li> After allowing approximately 16 hours of growth, pellet the cells using a centrifuge for 20 minutes at a speed of 4000 rpm at 4°C.</li><br />
<li> Discard the supernatant, while being careful not to discard any of the pellet.</li><br />
<li> Resuspend the pellet in 200 µL of Resuspension Solution (with RNase A added) provided from the kit. In case of <i>Rhodococcus</i> plasmid purification, 20 &micro;L of lysozyme with a concentration of 20mg/mL was added and the tube was incubated at 37&deg;C for 30 minutes.</li><br />
<li> Transfer the solution from a Falcon tube to a 1.5 µL microcentrifuge tube.</li><br />
<li> Add 200 & µL of Lysis Solution and invert gently to mix. Allow the mixture to clear for less than 5 minutes.</li><br />
<li> Add 350 & µL of Neutralization Solution and invert the tube 4-6 times to mix.</li><br />
<li> Pellet the microcentrifuge tubes at 14000 rpm using a microcentrifuge for 10 minutes. The resulting solution is the lysate.</li><br />
<li> Add 500 µL of the Column Preparation Solution to a binding column inside a collection tube. Centrifuge this tube for 1 minute at 14 000 rpm and discard the liquid underneath the binding tube.</li><br />
<li> Transfer the lysate into the binding column, being careful not to transfer any solid. Discard the microcentrifuge tube with the solid.</li><br />
<li> Centrifuge the collection tube at 14 000 rpm for 1 minute. Discard whatever liquid flowed through the binding column into the collection tube.</li><br />
<li> Add 750 µL of Wash Solution with concentrated ethanol added to the column and spin at 14 000 rpm for 1 minute. Discard the liquid that flowed through into the collection tube.</li><br />
<li> Repeat Step 12 a second time with the same quantity of Wash Solution.</li><br />
<li> Centrifuge the tube for 1 minute at 14 000 rpm to dry the column.</li><br />
<li> Transfer the column to a new 1.5 mL microcentrifuge tube.</li><br />
<li> Add 50 µL of double distilled water to the column and spin for 1 minute at 14 000 rpm.</li><br />
<li> Use a spectrophotometer to measure the concentration and the purity of your plasmid.</li><br />
<br />
</ol><br />
<br><br><br />
<br />
<p>The second protocol uses in-house reagents and ethanol precipitation of plasmid DNA. The required buffer solutions are:</p><br />
<ul><li> P1 : 50 mM TrisHCl (pH 8.0), 10 mM EDTA, 100 µg/ml RNAse A (store at 4°C)</li><br />
<li> P2 : 200 mM NaOH, 1% SDS</li><br />
<li> P3 : 3 M KAc (pH 5.5) (store at 4°C)</li><br />
</ul><br />
<ol><br />
<li> Grow 2.5 mL O/N culture and use 2 mL for below, keeping 0.5 mL for glycerol stock.</li><br />
<li> Pellet culture into 2 mL microfuge tube.</li><br />
<li> Aspire supernatant; Repeat if necessary.</li><br />
<li> Resuspend pellet in 300 µL P1 (Keep on ice).</li><br />
<li> *Perform next quickly (<1 min). * Add 300 µL P2 → Invert → Add 300 µL P3 (Keep on ice).</li><br />
<li> Centrifuge 14000 rpm for 10 min @ RT.</li><br />
<li> Aliquot the supernatant into 1.5 mL microfuge tube (~600-800 µL).</li><br />
<li> Add 650 µL isopropanol (RT) → Invert → Incubate for 10 min at room temperature.</li><br />
<li> Centrifuge 14000 rpm for 10 min @ 4°C → Aspirate.</li><br />
<li> Wash pellet with 70% cold EtOH (~500 µL).</li><br />
<li> Centrifuge 14000 rpm for 5 min @ 4°C → Aspirate.</li><br />
<li> Air-dry pellet (place tubes upside down or SpeedVac for 10 min).</li><br />
<li> Resuspend (by flicking) in double distilled water (30 µL).</li><br />
<li>Can be left at RT to facilitate dissolving of plasmid in double distilled water.</li><br />
<li>Run 3-4 µL on gel to check quality AND/OR Measure concentration (A260/A280).</li><br />
</ol><br />
<br />
<br />
<br />
<br />
</html><br />
}}</div>Kevinm.huiehttp://2012.igem.org/Team:Calgary/Project/HumanPractices/Killswitch/RegulationTeam:Calgary/Project/HumanPractices/Killswitch/Regulation2012-10-04T01:23:01Z<p>Kevinm.huie: </p>
<hr />
<div>{{Team:Calgary/TemplateProjectOrange|<br />
TITLE=Regulation/Expression Platform|<br />
CONTENT=<br />
<html><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/8c/UCalgary2012_FRED_Killswitch_Regulation_Low-Res.png" style="float: right; padding: 10px; height: 200px;"></img><br />
<div align="justify"><br />
<br />
<h2> Tight Regulation </h2><br />
<br />
<p>Inducible kill systems are not new to iGEM. Looking through the registry, there are several constructs such as the inducible BamHI system contributed by Berkley in 2007 (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_I716462">BBa_I716462</a>) and <a href="http://partsregistry.org/Image:UoflBamHIdatasheet.png">tested by Lethbridge in 2011</a>. This uses a <i>BamHI</i> gene downsteam of an arabinose-inducible promoter. Another example is an IPTG inducible Colicin construct (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K117009">BBa_K117009</a>) submitted by NTU-Singapore in 2008. One major problem with these systems however is a lack of tight control. As was demonstrated by the Lethbridge team, this part has leaky expression when inducer compound is not present. The frequently used lacI promoter has similar problems when not used in conjunction with strong plasmid-mediated expression of lacI. This can be seen in our electrochemical characterization of the uidA hydrolase enzyme (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902002">BBa_K902002</a>) shown here. Tight control is not only a problem for kill switch application, but for any application requiring strict regulation. As such, we decided that expanding the registry repertoire of control elements would be useful for our system as well as a variety of other applications. </p><br />
<br />
<h2> Introducing the Riboswitch </h2><br />
<br />
<p>Riboswitches are small pieces of mRNA which bind small molecules to modify translation of downstream genes. These sites are engineered into circuits by replacing traditional ribosome binding sites with riboswitches. The riboswitch is able to bind its respective ligand to inhibit or promote binding of translational machinery(Vitreschak <i>et al</i>, 2004). Riboswitches can be used in tandem with an appropriate promoter to enable tighter control of gene expression. Given this opportunity for control, and that ligands for riboswitches are often inexpensive small ions, these methods might be a feasible solution for controlling the kill switch in our industrial bioreactor.</p><br />
<br />
</html> [[File:UofC_RIBOSWITCH.png|centre|350px]] <html><br />
<br />
<p>We explored 3 different riboswitches, each responsive to a different metabolite (magnesium, manganese or molybdate) that would be cheap to implement into a bioreactor environment. Additionally, we also investigated a repressible and inducible promoter responsive to glucose and rhamnose respectively.</p><br />
<br />
<h2>Magnesium riboswitch</h2><br />
<br />
<p>The magnesium riboswitch that we looked at is repressed in the presence of magnesium ions. This system has two control components – a promoter and a riboswitch. Normally the magnesium (mgtA) promoter (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902009">BBa_K902009</a>) and the magnesium (mgtA) riboswitch (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902008">BBa_K902009</a>) are activated if there is a deficiency of magnesium in the cell (Winnie and Groisman, 2010). The lack of magnesium activates other genes in <i>E. coli </i>to allow influx of magnesium into the cell. The two proteins in the cascade that activate the system are <i>PhoP</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902010">BBa_K902010</a>) and <i>PhoQ</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902011">BBa_K902011</a>). <i>PhoQ</i> is the trans-membrane protein which gets activated in the absence of magnesium and phosphorylates <i>PhoP</i>. <i>PhoP</i> in turn binds to the mgtA promoter and transcribes genes downstream(Winnie and Groisman, 2010).</p><br />
<br />
<br />
<br />
<h2>Manganese riboswitch</h2><br />
<br />
<p> Manganese is an essential micronutrient. It is an important co-factor for enzymes and it also reduces oxidative stress in the cell (Waters et al, 2011). Despite being an important micronutrient, it is toxic to cells at high levels. <i>MntRI</i> detects the level of manganese in the cell and acts as a transcription factor to control the expression of manganese transporter such as mntH, mntP and mntABCDE. In order to regulate these genes <i>mntR</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902030">BBa_K902030</a>) binds to the mntP promoter (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902073">BBa_K902073</a>). The manganese homeostasis is also controlled by the manganese riboswitch <i>mntPrb</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902074">BBa_K90274</a>)</p><br />
<br />
</html><br />
[[File:Ucalgary2012 KillswitchstuffsystemsAandB.png|thumb|800px|left|Figure 1: '''A)''' MgtA pathway in <i>E. coli</i>. <i>PhoQ</i> is the transmembrane receptor which, upon detecting low magnesium concentrations, phosphorylates <i>PhoP</i> which acts as a transcription factor, transcribing genes downstream of the MgtA promoter necessary for bringing magnesium into the cell. There is a second level of control with the magnesium riboswitch. In the presence of high magnesium the riboswitch forms a secondary structure which does not allow the ribosome to bind to the transcript, thus inhibiting translation. '''B)''' In the presence of manganese, the <i>MntR</i> protein represses the <i>mntH</i> transporter, preventing the movement of manganese and also upregulating the putative efflux pump. Genes downstream of the mntP promoter are thus transcribed in the presence of manganese. The addition of the <i>MntR</i> protein in this system allows for tighter regulation of the system.]]<html><br />
<br />
<h2> The Moco Riboswitch </h2><br />
<br />
<p>The molybdenum cofactor (moco) riboswitch (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902023">BBa_K902023</a>) is an RNA element which responds to the presence of the metabolite molybdenum cofactor(MOCO) (Regulski et al, 2008). This RNA element is located in the <i>E.coli</i> genome just upstream of the <i>moaABCDE</i> operon (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902024">BBa_K902024</a>), which contain the important moco synthesis genes. Moco is an important co-factor in many different enzymes. The moco riboswitch has 2 regions: an aptamer domain and the expression platform. When moco is present in the cell it will bind to the aptamer region in the riboswitch causing an allosteric change. This allosteric change affects the expression platform by physically hiding the ribosome binding site which prevents translation.</p><br />
<br />
</html><br />
[[File:Moco_riboswitchCalgary2012.jpg|thumb|750px|center|Figure 2: This picture depicts the Moco RNA motif which is upstream of the <i>moaABCDE</i> operon. ]]<html> <br />
<br />
<h2> Building the Systems </h2><br />
<br />
<p> Using these riboswitches, we wanted to design a system where we would place our kill genes downstream, and then supplement our bioreactor with the appropriate ions to keep the systems turned off. We biobricked and submitted DNA for the the <i>mgtaP</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902009">BBa_K902009</a>) and mntP promoter (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902073">BBa_K902073</a>) as well as their respective riboswitches (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902008">BBa_K902008</a>) (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902074">BBa_K902074</a>) and the moco riboswitch (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902023">BBa_K902023</a>). In addition, we also biobricked some of the regulatory proteins: <i>PhoP</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902010">BBa_K902010</a>), <i>PhoQ</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902011">BBa_K902011</a>), <i>mntR</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902030">BBa_K902030</a>) and the Moa Operon (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902024">BBa_K902024</a>) . Our final system would inovolve constitutive expression of these necessary regulatory elements upstream of our riboswitches and kill genes. An example of the manganese system is shown in figure 3. </p><br />
<br />
</html>[[File:U.Calgary.2012_10.02.2012_Final_Construct_1.png|thumb|600px|center|Figure 3: Final construct for the manganese system. The circuit includes a TetR promoter, RBS, mntR, double terminator, mntP promoter, mntP riboswitch, <i>S7</i>, mntP riboswitch and <i>CViAII</i>.]]<html><br />
<br />
<br />
<h2> Characterizing the riboswitches </h2><br />
<br />
<h3> GFP testing</h3><br />
<br />
</html>[[File:MgtA circuits Ucalgary1.png|thumb|150px|right|Figure 4: In these set of circuits, <i>TetR</i>-RBS-K082003 serves as a positive control and the <i>mgtAp-mgtArb</i> serves as a negative control.]]<html><br />
<br />
<p> In order to test the control of these promoters and riboswitches, we constructed them independently and together upstream of GFP (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K082003">BBa_K082003</a>) with an LVA tag. Figure 4 shows these circuits for the mgtA system. Identical circuits were designed for all three systems, however only the top two were needed for the mocoriboswitch system.</p><br />
<br />
<p><br />
We then tested the aforementioned circuits by growing cells containing our circuits with varying concentrations of their respective ions. Our detailed protocols can be found <a href="https://2012.igem.org/Team:Calgary/Notebook/Protocols/mgcircuit">here</a>. We then measured fluorescent output, normalizing to a negative control not expressing GFP.</p><br />
<br />
<h3> Results </h3><br />
<br />
<p>So far, we have been able to obtain results for our magnesium system, as can be seen in figure 5. </html><br />
[[File:Magmesium graph ucalgary2.png|thumb|500px|left|Figure 5: This graph represents the relative fluorescence units from the mgtA promoter riboswitch construct as well as the riboswitch construct under the TetR promoter (BBa_R0040). We can see a decrease in the level of GFP output with increasing concentrations of magnesium. There is much steeper decrease in the GFP output in the construct with the magnesium promoter and riboswitch compared to the construct with just the riboswitch alone.]]<html></p><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br />
<p>As the graph shows, there is a much larger decrease in the GFP output when the mgtA promoter and riboswitch are working together as compared to the <i>mgtA</i> riboswitch alone under the control of TetR promoter (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_J13002">BBa_J13002</a>). This suggests that having both the promoter and the riboswitch together provides a tighter control over the genes expressed downstream. This also suggests that the magnesium riboswitch alone is sufficient in reducing gene expression downstream of a constitutive promoter.</p><br />
<br />
<p> It is important to consider however that the control elements of the system, <a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902010"><i>PhoP</i> </a> and <a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902011"> <i>PhoQ</i></a>, that were described above were not present in the circuits tested and therefore there is GFP expression in at the inhibitory concentration (10mM MgCl<sub>2</sub>). We believe that having the regulatory elements would give us better control and limit the leakiness.</p><br />
<br />
<p>Although the magnesium system is highly regulated, it is not a suitable system for the purposes of our bioreactor. The tailings are composed of very high concentration of magnesium, as high as 120mM (Kim et al, 2011). As can be seen, this would inhibit the system. Therefore, if our bacteria were to escape into the tailings, the kill genes would not be activated and the bacteria would be able to survive. However, we feel that this could still be an incredibly useful system for other teams for both killswtitch and non-killswitch-related applications, making it still a valuable contribution to the registry. </p><br />
<br />
<h3> Kill Gene Testing </h3><br />
<br />
<p> While building our systems with GFP in order to test their control, we also constructed them with our kill genes. This was delayed substantially however due to problems in their synthesis. Specifically, the micrococcal nuclease that arrived from IDT had a 1bp point mutation which changed a isoleucine residue into a lysine. Initially, our systems resulted in no killing of cells. Therefore we had to mutate this residue using <a href="https://2012.igem.org/Team:Calgary/Notebook/Protocols/mutagenesis"> site-directed mutagenesis</a>. Once completed, we were able to begin testing. With our GFP data collected, we moved on to characterizing the mgtA control system upstream of our <i>S7</i> kill gene (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902019">BBa_K902019</a>). To test the circuits, we incubated cells expressing our construct with varying concentrations of magnesium. We then measured both Colony Forming Units (CFU) and OD 600. For a deatiled protocol, see <a href="https://2012.igem.org/Team:Calgary/Notebook/Protocols/mgtacircuit">here</a>.</p><br />
<br />
<h3> Results </h3><br />
<br />
</html>[[File:24 hour assay with mgtap-rb-S7 Ucalgary.png|thumb|750px|center| Figure 6: This shows the OD600 values of mgtA circuits with S7 both mutated and unmutated. The negative control consists of <i>mgtAp-mgtArb</i>.]]<html><br />
<p> Figure 6 shows that the mgtAp-mgtArb-S7 (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902018">BBa_K902018</a>) starts acting approximately 4 hours after induction. However, it also shows that 10mM MgCl<sub>2</sub> is not enough salt to inhibit the entire system because there is no difference in OD600 measurement at 4hr time point between 10mM and the 0mM concentrations. This test needs to be repeated with higher concentrations of Mg<sup>2+</sup> however this data suggests that the mutagenesis was successful and <i>S7</i> is active and killing the cells at approximately 4hr which does not necessarily reflect solely upon the activity of <i>S7</i> but also on the response time of the mgtA system.</p><br />
<br />
<br />
<h2>An alternative: a glucose repressible system</h2><br />
<br />
<p>Based on the problem with the magnesium system in relation to tailings pond conditions, we wanted to find an alternative (other than the manganese and moco systems, which require further testing). We found a promoter in the literature that was induced by rhamnose and repressed by glucose. This seemed to be a very suitable candidate for controlling the kill switch in the bioreactor since the promoter was shown to be tightly repressed by glucose and rhamnose is fairly inexpensive and not found in high concentrations in tailings ponds. We could supplement the bioreactor with glucose to inhibit expression of the kill genes in the bioreactor. Escape of bacteria into the tailings ponds would cause expression of the kill genes since glucose levels in the surrounding environment would be insufficient for deactivate the promoter.<br />
</p> <br />
<br />
<p>This promoter, known as <i>pRha</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902065">BBa_K902065</a>), is responsible for regulating six genes related to rhamnose metabolism and contains a separate promoter on its leading and reverse strands (see figure 7). <i>RhaR</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902069">BBa_K902069</a>) and <i>RhaS</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902068">BBa_K902068</a>) serve to regulate expression of the rhamnose metabolism genes <i>rhaB</i>, <i>rhaA</i>, and <i>rhaD</i> on the opposite side of the promoter. The <i>RhaR</i> transcription factor is activated by L-rhamnose to up-regulate expression <i>rhaSR</i> operon. In turn, the resulting <i>RhaS</i> activates the <i>rhaBAD</i> operon to generate the rhamnose metabolism genes (Egan & Schleif, 1993).</p><br />
<br />
</html>[[File:NativeRhamnosePromoter_Calgary2012.jpg|thumb|750px|center|Figure 7: The rhamnose metabolism genes as they exist in Top Ten <i>E. coli</i>]]<br />
<html><br />
<br />
<p>As a kill switch regulator, our team has harnessed global catabolite repression of the rhamnose promoter. Expression of the <i>rhaBAD</i> operon with <i>RhaS</i> requires the binding of catabolite receptor protein (CRP) cAMP complex to the promoter. When glucose is present, cAMP levels are low, such that CRP is unable to activate the promoter (Egan & Schleif, 1993). With this mechanism, our team set out to control our kill genes with glucose via the following rhamnose promoter construct:</p><br />
<br />
<p>Our kill system is different from the native rhamnose system with the <i>rhaR</i> and <i>rhaS</i> control genes. We have constituitively expressed <i>RhaS</i> to overcome dependency on rhamnose to cause activation of the kill switch. While <i>RhaS</i> is continuously present, global catabolite repression prevents activation of the kill genes in the bioreactor, however in the outside environment glucose levels are lower such that <i>RhaS</i> is able to activate the kill genes.</p><br />
<br />
<h3>Building the system</h3><br />
<p>Our team had <i>pRha</i> promoter (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902065">BBa_K902065</a>) commercially synthesized as per the sequence given by Jeske and Altenbuchner (2010). The <i>rhaS</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902068">BBa_K902068</a>) and <i>rhaR</i> (<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K902069">BBa_K902069</a>) genes were amplified via PCR from Top Ten <i>E. coli</i> using Kapa HiFi polymerase. </p><br />
<br />
<p>Given the control gene modifications which we have engineered into our system to optimize it for the tailings ponds, we are working to determine whether glucose repression of our modified system can match patterns shown by Giacalone et al. (2006) and Jeske and Altenbuchner (2010). To this end, we have constructed the rhamnose promoter with GFP (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K902066">BBa_K902066</a>) and are finalizing construction with constituitively expressed <i>RhaS</i>, so that we can characterize this promoter and test it in combination with our kill genes.</p><br />
<br />
</html><br />
}}</div>Kevinm.huiehttp://2012.igem.org/Team:Calgary/Project/ReferencesTeam:Calgary/Project/References2012-10-03T06:55:24Z<p>Kevinm.huie: </p>
<hr />
<div>{{Team:Calgary/TemplateProjectOrange|<br />
TITLE=References|<br />
CONTENT={{{CONTENT|<br />
<html><br />
<br />
<br />
<ul><br />
<li>Asenjo J.A. (1949).Bioreactor system design. New York (NY): Marcel Dekker Inc. <br />
</p><br />
<p><br />
<li>Reit K., & Tramper J. (1991). Basic bioreactor design. New York (NY):Marcel Dekker Inc.<br />
</p><br />
<p><br />
<li>Canadian Centre for Occupational Health and Safety: Health Effects of Sulfur Dioxide, http://www.ccohs.ca/oshanswers/chemicals/chem_profiles/sulfurdi/health_sul.html (Retrieved: 09/18/2012)</li><br><br />
<br />
<li>Dana G, Kuiken T, Rejeski D & Snow A (2012) Synthetic biology: Four steps to avoid a synthetic-biology disaster. Nature 483:29.</li><br><br />
<br />
<li>Del Rio LF, Hadwin AK, Pinto LJ, MacKinnon MD, Moore MM. Degradation of naphthenic acids by sediment micro-organisms. J Appl Microbiol 2006 Nov;101(5):1049-1061. </li><br><br />
<br />
<li>Galán B, Díaz E, García JL. Enhancing desulphurization by engineering a flavin reductase-encoding gene cassette in recombinant biocatalysts. Environmental microbiology. 2000 Dec; 2(6): 687-94 </li><br><br />
<br />
<li>Herman DC, Fedorak PM, MacKinnon MD, Costerton JW. Biodegradation of naphthenic acids by microbial populations indigenous to oil sands tailings. Can J Microbiol 1994 Jun;40(6):467-477.</li><br><br />
<br />
<li>Holowenko FM, Mackinnon MD, Fedorak PM. Naphthenic acids and surrogate naphthenic acids in methanogenic microcosms. Water Res 2001 Aug;35(11):2595-2606. </li><br><br />
<br />
<li>Kamali N, Tavallaie M, Bambai B, Karkhane AA, Miri M. Site-directed mutagenesis enhances the activity of NADH-FMN oxidoreductase (DszD) activity of <i>Rhodococcus erythropolis</i>. Biotechnol Lett. 2010; 32: 921-927</li><br><br />
<br />
<li>Lewenza S, Falsafi RK, Winsor G, Gooderham WJ, McPhee JB, Brinkman FS, et al. Construction of a mini-Tn5-luxCDABE mutant library in Pseudomonas aeruginosa PAO1: a tool for identifying differentially regulated genes. Genome Res 2005 Apr;15(4):583-589. </li><br><br />
<br />
<li>Li GQ, Li SS, Zhang ML, Wang J, Zhu L, Liang FL, Liu RL, Ma T. Genetic rearrangement strategy for optimizing the dibenzothiophene biodesulfurization pathway in <i>Rhodococcus erythropolis</i>. Appl Environ Microbiol. 2008 Feb; 74(4): 971-6 </li><br><br />
<br />
<li>Li MZ, Squires CH, Monticello DJ, Childs JD. Genetic analysis of the dsz promoter and associated regulatory regions of <i>Rhodococcus erythropolis</i> IGTS8. J Bacteriol. 1996 Nov; 178(22): 6409-18</li><br><br />
<br />
<li>Lim HN, Lee Y, Hussein R. Fundamental relationship between operon organization and gene expression. Proc Natl Acad Sci U S A. 2011 Jun 28;108(26):10626-31. </li><br><br />
<br />
<li>Ma T. The Desulfurization Pathway in <i>Rhodococcus</i>. Microbiology Monographs 2010; 16: 207-230.</li><br><br />
<br />
<li> Nakai C, Kagamiyama H, Nozaki M. Complete nucleotide sequence of the metapyrocatechase gene on the TOL plasmid of <i>Pseudomonas putida </i> mt-2. J Biol Chem. 1983 Mar; 258(5):2923-2928.</li><br><br />
<br />
<li>Oshiro T, Ohkita R, Takikawa T, Manabe M, Lee WC, Tanokura M, Izumi Y. Improvement of 2'-hydroxybiphenyl-2-sulfinate desulfinase, an enzyme involved in the dibenzothiophene desulfurization pathway, from <i>Rhodococcus erythropolis</i> KA2-5-1 by site-directed mutagenesis. Biosci Biotechnol Biochem. 2007 Nov.; 71(11):2815-21</li><br><br />
<br />
<br />
<li>Phillips R, Kondev J, Theriot J. Physical Biology of the Cell. 1st ed. Garland Science. 2008. </li><br><br />
<br />
<li>Ramos-Padron E, Bordenave S, Lin S, Bhaskar IM, Dong X, Sensen CW, et al. Carbon and sulfur cycling by microbial communities in a gypsum-treated oil sands tailings pond. Environ Sci Technol 2011 Jan 15;45(2):439-446.</li><br><br />
<br />
<li>Reznikoff WS. Transposon Tn5. Annu Rev Genet 2008;42:269-286. </li><br><br />
<br />
<li>Schweigert N, Zehnder AJ, Eggen RI. Chemical properties of catechols and their molecular modes of toxic action in cells, from microorganisms to mammals. Environ Microbiol 2001 Feb; 3(2):81-91</li><br><br />
<br />
<li>Sheridan DL, Hughes TE. A faster way to make GFP-based biosensors: two new transposons for creating multicolored libraries of fluorescent fusion proteins. BMC Biotechnol 2004 Aug 18;4:17. </li><br><br />
<br />
<li>Shu L, Chiou Y, Orville AM, Miller MA, Lipscomb JD, Que L. X-ray absorption spectroscopic studies of the Fe(II) active site of catechol 2,3-dioxygenase. Implications for the extradiol cleavage mechanism. Biochem 1995; 34:6649-6659.</li><br><br />
<br />
<li>So J. Mini-transposon Tn5gfp constructs for differential tagging of microorganisms. Biotechnology and Bioprocess Engineering 1999;4(2):154-156. </li><br><br />
<br />
<li>Timms-Wilson TM, Bailey MJ. Reliable use of green fluorescent protein in fluorescent pseudomonads. J Microbiol Methods 2001 Jul 30;46(1):77-80. </li><br><br />
<br />
<br />
<li>United Nations Environment Programme: Sulfur Air Pollution, http://www.unep.org/transport/pcfv/pdf/Ethiopia-AirPollutionsulphur.pdf (Retrieved: 09/18/2012)</li><br><br />
<br />
<li>United States Environmental Protection Agency: Sulfur Dioxide, http://www.epa.gov/air/sulfurdioxide/ (Retrieved: 09/18/2012)</li><br><br />
<br />
<br />
<li>Vogel U, Jensen KF. The RNA chain elongation rate in Escherichia coli depends on the growth rate. J Bacteriol. 1994 May;176(10):2807-13. </li><br><br />
<br />
<li>Wright JK, Overath P. Purification of the lactose:H+ carrier of Escherichia coli and characterization of galactoside binding and transport. Eur J Biochem.1984 Feb 1;138(3):497-508.</li><br><br />
<br />
<li>Xiong AS, Peng RH, Cheng ZM, Li Y, Liu JG, Zhuang J, Gao F, Xu F, Qiao YS, Zhang Z, Chen JM, Yao QH. Concurrent mutations in six amino acids in beta-glucuronidase improve its thermostability. Protein Eng Des Sel. 2007 Jul;20(7):319-25. Epub 2007 Jun 8. </li><br><br />
<br />
<li>Yoshimura F, Nikaido H. Permeability of Pseudomonas aeruginosa outer membrane to hydrophilic solutes. J Bacteriol. 1982 Nov;152(2):636-42. </li><br><br />
<br />
<li>Young R, Bremer H. Polypeptide-chain-elongation rate in Escherichia coli B/r as a function of growth rate. Biochem J. 1976 Nov 15;160(2):185-94. </li><br><br />
<br />
<li>Zhang X, Wiseman S, Yu H, Liu H, Giesy JP, Hecker M. Assessing the toxicity of naphthenic acids using a microbial genome wide live cell reporter array system. Environ Sci Technol 2011 Mar 1;45(5):1984-1991.</li><br><br />
<br />
<li>2009 iGEM Calgary, 2009.igem.org/Team:Calgary/Notebook </li><br><br />
<br />
<li> He A, Li T, Daniels L, Fotheringham I, Rosazza J.P.N. Nocardia sp. Carboxylic Acid Reductase: Cloning, Expression, and Characterization of a New Aldehyde Oxidoreductase Family. Applied and Environmental Microbiology 2004 Mar;70(3):1874–1881.</li><br><br />
<br />
<li> Venkitasubramanian P, Daniels L, Rosazza J.P.N. Reduction of Carboxylic Acids by Nocardia Aldehyde Oxidoreductase Requires a Phosphopantetheinylated Enzyme. Journal of Biological Chemistry 2007 Nov 13;282(1):478-485. </li><br><br />
<br />
<li> Rude M.A, Baron T.S, Brubaker S, Alibhai M, Del Cardayre S.B, and Schirmer A. Terminal olefin (1-alkene) biosynthesis by a novel p450 fatty acid decarboxylase from Jeotgalicoccus species. Applied and Environmental Microbiology 2011 Mar;77(5):1718–1727.</li><br><br />
<br />
<li> Clemente J.S, Fedorak P.M. A review of the occurrences, analyses, toxicity, and biodegradation of naphthenic acids. Chemosphere 2005 Feb 6;60(5):585-600.</li><br><br />
<br />
<li> Frank R.A, Fischer K, Kavanagh R, Burnison B.K, Aresenault G, Headley J, Peru K.M, VanDerKraak G, Solomon K. Effect of Carboxylic Acid Content on the Acute Toxicity of Oil Sands Naphthenic Acids. EnvironSciTechnol 2009 Dec 11;43(2):266–271.</li><br><br />
<br />
<li> Slavcheva E, Shone B, Turnbull A. Review of napthenic acid corrosion in oilrefining. British Corrosion Journal 1999 Feb;34(2):125-131. </li><br><br />
<br />
<li> Behar F.H, Albrecht P. Correlations between carboxylic acids and hydrocarbons in several crude oils alteration by biodegradation. Organic Geochemistry 1984;6:597-604. </li><br><br />
<br />
<li>German Collection of Microorganisms and Cell Cultures (DSMZ): Nocardia iowensis. https://www.dsmz.de/catalogues/details/culture/DSM-45197.html (retrieved 8/28/2012)</li><br><br />
<br />
<li>UW iGEM: Diesel Production Background. https://2011.igem.org/Team:Washington/Alkanes/Background (retrieved 8/28/2012)</li><br><br />
<br />
<li>Parts Registry: The PetroBrick – Strong Constitutive Expression of ADC and AAR in pSB1C3. http://partsregistry.org/wiki/index.php?title=Part:BBa_K590025 (retrieved 8/28/2012)</li><br><br />
<br />
<li>Asenjo J.A. (1949).Bioreactor system design. New York (NY): Marcel Dekker Inc.</li></br><br />
<br />
<li>Reit K., & Tramper J. (1991). Basic bioreactor design. New York (NY):Marcel Dekker Inc.</li></br><br />
<br />
<li>Becker SA, Feist AM, Mo ML, Hannum G, Palsson BØ, Herrgard MJ. Quantitative prediction of cellular metabolism with constraint-based models: the COBRA Toolbox. Nature Protocols 2 2007 Mar; 727-723.</li></br><br />
<br />
<li>Becker SA, Feist AM, Mo ML, Hannum G, Palsson BØ, Herrgard MJ. Quantitative prediction of cellular metabolism with constraint-based models: the COBRA Toolbox v2.0. Nature Protocols 6 2011 Aug; 1290-1307.</li></br><br />
<br />
<li>Feist AM, Henry CS, Reed JL, Krummenacker M, Joyce AR, Karp PD, Broadbelt LJ, Hatzimanikatis V, Palsson BØ. A genome-scale metabolic reconstruction for Escherichia coli K-12 MG1655 that accounts for 1260 ORFs and thermodynamic information. Molecular Systems Biology 3 2007 Jun; 121.</li></br><br />
<br />
<li>TOMLAB Optimization, MatLab Optimization, http://tomopt.com/tomlab/</li></br><br />
<br />
<li>Gopinath AV, Russell D. An Inexpensive Field-Portable Programmable Potentiostat. Chem.Educator.2006 July;11:23-28.</li></br><br />
<br />
<li>Biran I, Levcov K, Hengge-Aronis R, Ron EZ, Rishpon J. On-line monitoring of gene expression. Microbiology.1999 April;145:2129-2133.</li></br><br />
<br />
<li>Waters LS, Sandoval M, and Storz G. <i>The Escherichia coli MntR miniregulon includes genes encoding a small protein and an efflux pump required for manganese homeostasis.</i> J Bacteriol 2011 Nov; 193(21) 5887-97.</li></br><br />
<br />
<li>Ramesh A, Wakeman CA, and Winkler WC. <i>Insights into metalloregulation by M-box riboswitch RNAs via structural analysis of manganese-bound complexes.</i> J Mol Biol 2011 Apr 8; 407(4) 556-70. </li></br><br />
<br />
<li>Helmann J. <i>Measuring metals with RNA.</i> J Mol Cell 2007 Sept 21; 27(6) 859-860. </li></br><br />
<br />
<li>Daus B, Mattusch J, Paschke A, Wennrich R, and Weiss H. <i>Kinetics of the arsenite oxidation in seepage water from a tin mill tailings pond.</i> Talanta 2000 May 5; 51(6) 1087-95. </li></br><br />
<br />
</ul><br />
<br />
<br />
</html>}}}<br />
}}</div>Kevinm.huiehttp://2012.igem.org/Team:Calgary/Project/HumanPractices/Killswitch/RegulationTeam:Calgary/Project/HumanPractices/Killswitch/Regulation2012-10-03T06:28:04Z<p>Kevinm.huie: </p>
<hr />
<div>{{Team:Calgary/TemplateProjectOrange|<br />
TITLE=Regulation/Expression Platform|<br />
CONTENT=<br />
<html><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/8c/UCalgary2012_FRED_Killswitch_Regulation_Low-Res.png" style="float: right; padding: 10px; height: 200px;"></img><br />
<div align="justify"><br />
<h2>Magnesium repressible system</h2><br />
<br />
<p>This system is repressed in the presence of magnesium. This system has two control components – a promoter and a riboswitch. Normally the magnesium promoter (mgtA promoter) and the magnesium riboswitch (mgtArb) are activated if there is a deficiency of magnesium in the cell. The lack of magnesium activates other genes in <i>E. coli </i>to allow influx of magnesium into the cell. There are two proteins in the cascade that activate the system namely PhoP and PhoQ. PhoQ is the trans-membrane protein which gets activated in the absence of magnesium and phosphorylates PhoP. PhoP in turn binds to the mgtA promoter and transcribes genes downstream.</p><br />
<br />
</html><br />
[[File:Magnesium pathway Ucalgary.png|thumb|500px|center|Figure 1: MgtA pathway in <i>E. coli</i>. The phoQ protein is the transmembrane receptor which detects low magnesium concentration. PhoQ then phosphorylates PhoP which acts as a transcription factor on mgtA promoter and transcribes genes downstream necessary for bringing magnesium into the cell. There is a second level of control with the magnesium riboswitch. In the presence of high magnesium the riboswitch forms a secondary structure which does not allow the ribosome to bind to the transcript inhibiting translation. In the case of low magnesium however, the transcript is expressed and this allows influx of magnesium.]]<html><br />
<br />
</html>[[File:MgtA circuits Ucalgary1.png|thumb|150px|right|Figure 2: In these set of circuits, <i>TetR</i>-RBS-K082003 serves as a positive control and the <i>mgtAp-mgtArb</i> serves as a negative control.]]<html><h3><i>Test circuits for the magnesium system</i></h3><br />
<br />
<p>To test the magnesium regulatory elements we built each of the elements with a reporter gene. We chose Bba_K082003 which is GFP with an LVA tag as our choice of reporter. We did not choose BBa_E0040, the stable GFP, because we wanted a real time indication of the system's control. Stable GFP has a half life of 8 hours and would still fluoresce when the system is shut off.</p><br />
<br />
<p> We build these circuits to test the control elements of the system, namely the <i>mgtA</i> promoter and the <i>mgtA</i> riboswitch.</p><br />
<br />
<br />
<h3><i>Characterization of these circuits</i></h3><br />
<p><br />
We tested the aforementioned circuits in different concentrations of magnesium. For detailed protocol see INSERT LINK HERE. The values were normalized to the negative control which is the magnesium promoter and riboswitch alone.</p><br />
<br />
<p>There is a much larger decrease in the GFP output when the <i>mgtA</i> promoter and riboswitch are working together compared to the <i>mgtA</i> riboswitch alone under the control of TetR promoter. This suggests that having both the promoter and the riboswitch together provides a tighter control over the genes expressed downstream. This also suggests that magnesium riboswitch alone is sufficient in reducing gene expression downstream of a constitutive promoter.</p><br />
<br />
<p> It is important to consider however that the control elements of the system namely<i> PhoP</i> and<i> PhoQ</i> were not present in the circuits tested and therefore there is some GFP expression in even at the inhibitory concentration (10mM MgCl<sub>2</sub>). We believe that having the regulatory elements would give us better control and get rid of the leakiness.</p><br />
<br />
<p> Although the magnesium system is highly regulated, it is not a suitable system for the purposes of our bioreactor. The tailings are composed of very high concentration of magnesium- upto 30mM(REFERENCE). As can be seen from figure 3, this would inhibit the system. Therefore, if our bacteria escapes into the tailings, the kill genes would not be activated and the bacteria would be able to survive. </p><br />
<br />
<p> In contrast, it is important to note that this system adds important regulatory elements to the registry such as an inducible promoter and a riboswitch which can be used by other teams to control both killswitches as well as other regulatory pathways which do not pertain using tailings. </p><br />
</html><br />
[[File:Magmesium graph ucalgary2.png|thumb|500px|center|Figure 3: This graph represents the relative flourescence units from the mgtA promoter riboswitch construct as well as the riboswitch construct under the TetR promoter (BBa_R0040). We can see a decrease in the level of GFP output with increasing concentrations of magnesium. There is much steeper decrease in the GFP output in the construct with the magnesium promoter and riboswitch compared to the construct with just the riboswitch alone.]]<html><br />
<br />
<p> We also wanted to test the magnesium system with our kill genes. The micrococcal nuclease that arrived from IDT had 1bp mutation which changed a isoleucine residue into a lysine. Therefore we had to mutate it. To test the circuits we measured both CFU and OD 600.</p><br />
</html>[[File:24 hour assay with mgtap-rb-S7 Ucalgary.png|thumb|750px|center| Figure 4: This shows the OD600 values of mgtA circuits with S7 both mutated and unmutated. The negative control consists of <i>mgtAp-mgtArb</i>.]]<html><br />
<br />
<h1>Manganese regulation</h1><br />
<br />
<p> Manganese is an essential micronutrient. It is an important co-factor for enzymes and it also reduces oxidative stress in the cell(Waters et al, 2011). Despite being an important micronutrient it is toxic to cells at high levels. MntR detects the level of manganese in the cell and binds acts as a transcription factor to control the expression of manganese transportes such as mntH, mntP and mntABCDE. In order to regulate these genes mntR binds to the mntP promoter. The manganese homeostatsis is also controlled by the manganese riboswitch <i>mntPrb</i></p><br />
<br />
</html>[[File:U.Calgary.2012_10.02.2012_Membrane_Final_2.png|thumb|500px|center|Figure 4: The manganese system in the presence of manganese found in the tailing ponds will initially trigger the mntR regulator. As one of its function, the regulator will repress the mntH transporter preventing the movement of manganese. As a second function, the mntR will upregulate the putative efflux pump. The manganese system itself responds to the manganese metal allowing the transcription of the gene downstream. The addition of the mntR in this system is generally used to better regulate the manganese system.]]<html><br />
<br />
<h3><i>Our manganese system</i></h3><br />
<br />
<p>For our system we use the mntR,<i>mntP</i> promoter and <i>mntP</i> riboswitch. At high levels of manganese the mntP promoter <i>mntPp</i> and riboswitch <i>mntPrb</i> is activated producing the genes downstream. For our purposes we will be constructing <i>mntPp</i> and <i>mntPrb</i> with S7 and CviAII. </p><br />
<br />
</html>[[File:U.Calgary.2012_10.02.2012_Final_Construct_1.png|thumb|600px|center|Figure 5: Final construct for the manganese system. The circuit includes a TetR promoter, RBS, mntR, double terminator, <i>mntP promoter</i>, <i>mntP riboswitch</i>, S7, <i>mntP riboswitch</i> and CViAII.]]<html><br />
<br />
</html>[[File:U.Calgary.2012_10.02.2012_Construct_3.png|thumb|200px|right|Figure 6: These set of circuits are used to characterise both the mntP promoter and the mntP riboswitch. The negative control composes of mntP promoter-mntP riboswitch while the positive control is the circuit TetR-RBS-K082003.]]<html><br />
<br />
<h3><i>Test circuits for the manganese system</i></h3><br />
<br />
<p>The manganese system was constructed with GFP-LVA for characterization purposes. The following are the control circuits built in order to characterise the MntP promoter and the MntP riboswitch.</p><br />
<br />
<br />
<h3><i>Future Use</i></h3><br />
<br />
<p>Even though this system is a relatively good way to regulate our kill genes, there is some limitation to this system. The main problem why this circuit will not work for our system is because when tailing pond water is added to the bioreactor there is fairly high concentration of Mn2+ in the contaminated water ~48mg/L or ~170µM/L. This concentration is 17 times the amount of Mn2+ needed to trigger the system (10 µM) therefore an additional chemical such as EDTA (a chelator) will have to be added to lower the manganese levels in the bioreactor. This however brings up another situation since EDTA is fairly expensive and will have to be constantly supplied to the bioreactor. Although this system may not be feasible for our system, this regulator system may be used in another pathway.</p><br />
<br />
<br />
<br />
<h1>Glucose repressible system</h1><br />
<br />
<h2>Purpose</h2><br />
<p>The rhamnose inducible promoter is suitable for controlling the kill switch in the the bioreactor since the promoter is shown to be tightly repressed with glucose. We aim to supplement the bioreactor with glucose to inhibit<br />
expression of the kill genes in the bioreactor. Escape of bacteria into the tailings ponds will cause expression of the kill genes since glucose levels in the surrounding environment would be insufficient for deactivate the promoter. We selected this system for two reasons. Firstly, the promoter exhibits tight repression with glucose and could thus limit inadvertent expression of the kill genes; and secondly, glucose is a common monosacharide which is economically feasible to continuously supplement into the bioreactor.<br />
</p> <br />
<br />
<h2>Application of the rhamnose promoter</h2><br />
<p>The rhamnose promoter (pRha) is responsible for regulating six genes related to rhamnose metabolism and contains a separate promoter on its leading and reverse strands (see Figure one). RhaR and RhaS serve to regulate expression of the rhamnose metabolism genes rhaB, rhaA, and rhaD on the opposite side of the promoter. The RhaR transcription factor is activated by L-rhamnose to up-regulate expression rhaSR operon. In turn, the resulting RhaS activates the rhaBAD operon to generate the rhamnose metabolism genes (Egan & Schleif, 1993).</p><br />
<br />
</html>[[File:NativeRhamnosePromoter_Calgary2012.jpg|thumb|500px|center|Figure one: The rhamnose metabolism genes as they exist in Top Ten E. coli]]<br />
<html><br />
<br />
<p>As a kill switch regulator, our team has harnessed global catabolite repression of the rhamnose promoter. Expression of the rhaBAD operon with RhaS requires the binding of catabolite receptor protein (CRP) cAMP complex to the promoter. When glucose is present, cAMP levels are low, such that CRP is unable to activate the promoter (Egan & Schleif, 1993). With this mechanism, our team set out to control our kill genes with glucose with the following rhamnose promoter construct:</p><br />
<br />
</html>[[File:RhamnoseConstruct_Calgary2012.png|thumb|500px|center|Figure two: Our design for the glucose repressible, rhamnose based promoter for our kill system.]]<html><br />
<br />
<p>Our kill system is different from the native rhamnose system with the rhaR and rhaS control genes. We have constituitively expressed rhaS to overcome dependency on rhamnose to cause activation of the kill switch. While RhaS is continuously present, global catabolite repression prevents its activation the kill genes in the bioreactor; in the outside environment, glucose levels are lower such that RhaS is able to activate the kill genes.</p><br />
<br />
<h2>Components and characterization</h2><br />
<p>Our team had pRha promoter commercially synthesized as per the sequence given by Jeske and Altenbuchner (2010). The rhaS and rhaR genes were amplified via PCR from Top Ten E. coli using Kapa Hi-Fi polymerase. </p><br />
<br />
<p>Given the control gene modifications which we have engineered into our system to optimize it for the tailings ponds, we are working to determine whether glucose repression of our modified system match patterns shown by Giacalone et al. (2006) and Jeske and Altenbuchner (2010). To this end, we have constructed the rhamnose promoter with GFP and are finalizing construction with constituitively expressed RhaS, so that we can characterize (LINK) this promoter and test it with our kill genes.</p><br />
<br />
<br />
<br />
<h1>The Moco Riboswitch - In progess</h1><br />
<h2>Background</h2><br />
<p><br />
The molybdenum cofactor (moco) riboswitch is an RNA element which responds to the presence of the metabolite molybdenum cofactor. This RNA element is located in the E.coli genome just upstream of the moaABCDE operon, which contain the important moco synthesis genes. Moco is an important cofactor in many different enzymes ranging from to this. The moco riboswitch has 2 regions: an aptamer domain and the expression platform. When moco is present in the cell it will bind to the aptamer region in the riboswitch which will cause an allosteric change. This allosteric change affects the expression platform by physically hiding the ribosome binding site thus preventing translation from occurring and hence adding a translational level of gene expression regulation. Therefore, the moco riboswitch, when activated by moco, inhibits gene expression.<br />
<br />
</p><br />
</html><br />
[[File:Moco_riboswitchCalgary2012.jpg|thumb|500px|center|Figure (#): This picture depicts the Moco RNA motif upstream of the moaABCDE operon ]]<html> <br />
<h2>Molybdate in TPW</h2><br />
<br />
<h2>The Killswitch Design</h2><br />
<br />
<p><br />
This riboswitch system can be used to design a killswitch mechanism to regulate the expression of our kill genes, CviAII and S7. The basic design of this system includes the kill genes downstream of the riboswitch all of which is under the control of a constitutive promoter. Downstream of this construct is the moa operon constitutively expressed. This entire construct will be present in a low copy plasmid in our bacteria. While moco synthesis is a normal process in the bacteria we wanted to constitutively express the moa operon for two reasons. First, we wanted to up regulate the expression of moco to ensure high enough concentrations of moco capable of inactivating the kill switch when the bacteria are in the bioreactor. Second, the moa operon in the genome is under regulation by the bacteria to maintain equilibrium and therefore we think it might not be reliable in producing the required concentration. The two moa operons will express our metabolite moco, which will activate the riboswitch and represses the kill genes. <br />
<br />
</p><br />
</html><br />
[[File:RaioperonCalgary2012.png|thumb|500px|center|Figure #: Moa Operon]]<html><br />
<br />
<p><br />
<br />
Molybdenum, Mo, is a trace element that is required by the bacteria for moco synthesis. Bacteria cannot uptake molybdenum in the elemental form and so uptakes molybdenum in its oxyanion form molybdate, MoO4, using the molybdate transport system. We wanted a system where molybdate is present in the bioreactor permitting moco synthesis (inactivate killswitch) and absent in the tailings pond water (TPW) preventing moco synthesis (activate killswitch). We discovered that molybdenum is indeed present in the TPW. </p><br />
<p><br />
Concentrations of Mo in the TPW:<br />
• [Mo] in the Syncrude and Suncor TPW in 1990: <br />
– 0.183 mg/L in the surface region (1m-10m)<br />
– 0.045 mg/L in the sludge region (11m-20m)<br />
<br />
</p><br />
<br />
<p><br />
Molybdate forms when molybdenum is in contact with both water and oxygen. If the bacteria escape they will first enter the surface region where it is possible for the bacteria to encounter molybdate. If molybdate is present in the TPW, then there is a possibility that moco can be synthesized in the escaped bacteria inactivating the kill switch. This dilemma would defeat the purpose of this killswitch mechanism. </p><br />
<br />
<h2>The Solution </h2><br />
<p><br />
Upon further literature research we found that molybdate is transported using a molybdate transport system which is coded by the modABCD operon. It has been shown that knocking out mod C, a gene encoding the ATPase of the transporter, enables the transport system dysfunctional and prevents moco synthesis. However, if molybdate is supplemented in high enough concentrations to the bacteria, the bacteria are able to use its sulphate transport system to transport molybdate. This gave rise to the idea of having a mod C knock out strain of bacteria in our system and supplementing it with molybdate allowing moco synthesis (inactivate killswitch) inside the bioreactor. The paper tried 10mM sodium molybdate supplementation in the media whereas that the litreture level states less than 1 uM. Therefore, in the tailings ponds, the concentration is not high enough and molybdate is transported into the cell preventing moco synthesis. This activates the kill switch. Sodium molybdate is expensive and it can be said that on a large bioreactor scale it is impractical to provide. However, there are inexpensive and effective filtration mechanisms available to filter most of it out and reuse it. The filtration also prevents dumping a load of molybdate ions in the TPW. </p><br />
<br />
<h2>Characterization</h2><br />
<br />
<p>There are two experiments that we want to run with this system. Firstly, the paper did not characterize the concentration of molybdate needed to enter through the sulphate system. So we want to supply e.coli and mod c knockout strain with various concentations of molybdate and measure the optical density and do a cfu assay. Secondly we want to characterize the following system. Flourescence assay for K08 and od and cfyu for kill genes. At the moment the system is still being built. </p><br />
<br />
<p> Biobricks being built: </p><br />
<br />
<br />
</html><br />
[[File:Raisstuff1Calgary2012.png|thumb|500px|center]]<html><br />
<br />
</html><br />
[[File:Raiconstructs2Calgary2012.png|thumb|500px|center]]<html><br />
<br />
<br />
<br />
</html><br />
}}</div>Kevinm.huiehttp://2012.igem.org/Team:Calgary/Project/HumanPractices/Killswitch/RegulationTeam:Calgary/Project/HumanPractices/Killswitch/Regulation2012-10-03T06:26:52Z<p>Kevinm.huie: </p>
<hr />
<div>{{Team:Calgary/TemplateProjectOrange|<br />
TITLE=Regulation/Expression Platform|<br />
CONTENT=<br />
<html><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/8c/UCalgary2012_FRED_Killswitch_Regulation_Low-Res.png" style="float: right; padding: 10px; height: 200px;"></img><br />
<div align="justify"><br />
<h2>Magnesium repressible system</h2><br />
<br />
<p>This system is repressed in the presence of magnesium. This system has two control components – a promoter and a riboswitch. Normally the magnesium promoter (mgtA promoter) and the magnesium riboswitch (mgtArb) are activated if there is a deficiency of magnesium in the cell. The lack of magnesium activates other genes in <i>E. coli </i>to allow influx of magnesium into the cell. There are two proteins in the cascade that activate the system namely PhoP and PhoQ. PhoQ is the trans-membrane protein which gets activated in the absence of magnesium and phosphorylates PhoP. PhoP in turn binds to the mgtA promoter and transcribes genes downstream.</p><br />
<br />
</html><br />
[[File:Magnesium pathway Ucalgary.png|thumb|500px|center|Figure 1: MgtA pathway in <i>E. coli</i>. The phoQ protein is the transmembrane receptor which detects low magnesium concentration. PhoQ then phosphorylates PhoP which acts as a transcription factor on mgtA promoter and transcribes genes downstream necessary for bringing magnesium into the cell. There is a second level of control with the magnesium riboswitch. In the presence of high magnesium the riboswitch forms a secondary structure which does not allow the ribosome to bind to the transcript inhibiting translation. In the case of low magnesium however, the transcript is expressed and this allows influx of magnesium.]]<html><br />
<br />
</html>[[File:MgtA circuits Ucalgary1.png|thumb|150px|right|Figure 2: In these set of circuits, <i>TetR</i>-RBS-K082003 serves as a positive control and the <i>mgtAp-mgtArb</i> serves as a negative control.]]<html><h3><i>Test circuits for the magnesium system</i></h3><br />
<br />
<p>To test the magnesium regulatory elements we built each of the elements with a reporter gene. We chose Bba_K082003 which is GFP with an LVA tag as our choice of reporter. We did not choose BBa_E0040, the stable GFP, because we wanted a real time indication of the system's control. Stable GFP has a half life of 8 hours and would still fluoresce when the system is shut off.</p><br />
<br />
<p> We build these circuits to test the control elements of the system, namely the <i>mgtA</i> promoter and the <i>mgtA</i> riboswitch.</p><br />
<br />
<br />
<h3><i>Characterization of these circuits</i></h3><br />
<p><br />
We tested the aforementioned circuits in different concentrations of magnesium. For detailed protocol see INSERT LINK HERE. The values were normalized to the negative control which is the magnesium promoter and riboswitch alone.</p><br />
<br />
<p>There is a much larger decrease in the GFP output when the <i>mgtA</i> promoter and riboswitch are working together compared to the <i>mgtA</i> riboswitch alone under the control of TetR promoter. This suggests that having both the promoter and the riboswitch together provides a tighter control over the genes expressed downstream. This also suggests that magnesium riboswitch alone is sufficient in reducing gene expression downstream of a constitutive promoter.</p><br />
<br />
<p> It is important to consider however that the control elements of the system namely<i> PhoP</i> and<i> PhoQ</i> were not present in the circuits tested and therefore there is some GFP expression in even at the inhibitory concentration (10mM MgCl<sub>2</sub>). We believe that having the regulatory elements would give us better control and get rid of the leakiness.</p><br />
<br />
<p> Although the magnesium system is highly regulated, it is not a suitable system for the purposes of our bioreactor. The tailings are composed of very high concentration of magnesium- upto 30mM(REFERENCE). As can be seen from figure 3, this would inhibit the system. Therefore, if our bacteria escapes into the tailings, the kill genes would not be activated and the bacteria would be able to survive. </p><br />
<br />
<p> In contrast, it is important to note that this system adds important regulatory elements to the registry such as an inducible promoter and a riboswitch which can be used by other teams to control both killswitches as well as other regulatory pathways which do not pertain using tailings. </p><br />
</html><br />
[[File:Magmesium graph ucalgary2.png|thumb|500px|center|Figure 3: This graph represents the relative flourescence units from the mgtA promoter riboswitch construct as well as the riboswitch construct under the TetR promoter (BBa_R0040). We can see a decrease in the level of GFP output with increasing concentrations of magnesium. There is much steeper decrease in the GFP output in the construct with the magnesium promoter and riboswitch compared to the construct with just the riboswitch alone.]]<html><br />
<br />
<p> We also wanted to test the magnesium system with our kill genes. The micrococcal nuclease that arrived from IDT had 1bp mutation which changed a isoleucine residue into a lysine. Therefore we had to mutate it. To test the circuits we measured both CFU and OD 600.</p><br />
</html>[[File:24 hour assay with mgtap-rb-S7 Ucalgary.png|thumb|750px|center| Figure 4: This shows the OD600 values of mgtA circuits with S7 both mutated and unmutated. The negative control consists of <i>mgtAp-mgtArb</i>.]]<html><br />
<br />
<h1>Manganese regulation</h1><br />
<br />
<p> Manganese is an essential micronutrient. It is an important co-factor for enzymes and it also reduces oxidative stress in the cell(Waters et al, 2011). Despite being an important micronutrient it is toxic to cells at high levels. MntR detects the level of manganese in the cell and binds acts as a transcription factor to control the expression of manganese transportes such as mntH, mntP and mntABCDE. In order to regulate these genes mntR binds to the mntP promoter. The manganese homeostatsis is also controlled by the manganese riboswitch <i>mntPrb</i></p><br />
<br />
</html>[[File:U.Calgary.2012_10.02.2012_Membrane_Final_2.png|thumb|500px|center|Figure 4: The manganese system in the presence of manganese found in the tailing ponds will initially trigger the mntR regulator. As one of its function, the regulator will repress the mntH transporter preventing the movement of manganese. As a second function, the mntR will upregulate the putative efflux pump. The manganese system itself responds to the manganese metal allowing the transcription of the gene downstream. The addition of the mntR in this system is generally used to better regulate the manganese system.]]<html><br />
<br />
<h3><i>Our manganese system</i></h3><br />
<br />
<p>For our system we use the mntR,<i>mntP</i> promoter and <i>mntP</i> riboswitch. At high levels of manganese the mntP promoter <i>mntPp</i> and riboswitch <i>mntPrb</i> is activated producing the genes downstream. For our purposes we will be constructing <i>mntPp</i> and <i>mntPrb</i> with S7 and CviAII. </p><br />
<br />
</html>[[File:U.Calgary.2012_10.02.2012_Final_Construct_1.png|thumb|600px|center|Figure 5: Final construct for the manganese system. The circuit includes a TetR promoter, RBS, mntR, double terminator, <i>mntP promoter</i>, <i>mntP riboswitch</i>, S7, <i>mntP riboswitch</i> and CViAII]]<html><br />
<br />
</html>[[File:U.Calgary.2012_10.02.2012_Construct_3.png|thumb|200px|right|Figure 6: These set of circuits are used to characterise both the mntP promoter and the mntP riboswitch. The negative control composes of mntP promoter-mntP riboswitch while the positive control is the circuit TetR-RBS-K082003.]]<html><br />
<br />
<h3><i>Test circuits for the manganese system</i></h3><br />
<br />
<p>The manganese system was constructed with GFP-LVA for characterization purposes. The following are the control circuits built in order to characterise the MntP promoter and the MntP riboswitch.</p><br />
<br />
<br />
<h3><i>Future Use</i></h3><br />
<br />
<p>Even though this system is a relatively good way to regulate our kill genes, there is some limitation to this system. The main problem why this circuit will not work for our system is because when tailing pond water is added to the bioreactor there is fairly high concentration of Mn2+ in the contaminated water ~48mg/L or ~170µM/L. This concentration is 17 times the amount of Mn2+ needed to trigger the system (10 µM) therefore an additional chemical such as EDTA (a chelator) will have to be added to lower the manganese levels in the bioreactor. This however brings up another situation since EDTA is fairly expensive and will have to be constantly supplied to the bioreactor. Although this system may not be feasible for our system, this regulator system may be used in another pathway.</p><br />
<br />
<br />
<br />
<h1>Glucose repressible system</h1><br />
<br />
<h2>Purpose</h2><br />
<p>The rhamnose inducible promoter is suitable for controlling the kill switch in the the bioreactor since the promoter is shown to be tightly repressed with glucose. We aim to supplement the bioreactor with glucose to inhibit<br />
expression of the kill genes in the bioreactor. Escape of bacteria into the tailings ponds will cause expression of the kill genes since glucose levels in the surrounding environment would be insufficient for deactivate the promoter. We selected this system for two reasons. Firstly, the promoter exhibits tight repression with glucose and could thus limit inadvertent expression of the kill genes; and secondly, glucose is a common monosacharide which is economically feasible to continuously supplement into the bioreactor.<br />
</p> <br />
<br />
<h2>Application of the rhamnose promoter</h2><br />
<p>The rhamnose promoter (pRha) is responsible for regulating six genes related to rhamnose metabolism and contains a separate promoter on its leading and reverse strands (see Figure one). RhaR and RhaS serve to regulate expression of the rhamnose metabolism genes rhaB, rhaA, and rhaD on the opposite side of the promoter. The RhaR transcription factor is activated by L-rhamnose to up-regulate expression rhaSR operon. In turn, the resulting RhaS activates the rhaBAD operon to generate the rhamnose metabolism genes (Egan & Schleif, 1993).</p><br />
<br />
</html>[[File:NativeRhamnosePromoter_Calgary2012.jpg|thumb|500px|center|Figure one: The rhamnose metabolism genes as they exist in Top Ten E. coli]]<br />
<html><br />
<br />
<p>As a kill switch regulator, our team has harnessed global catabolite repression of the rhamnose promoter. Expression of the rhaBAD operon with RhaS requires the binding of catabolite receptor protein (CRP) cAMP complex to the promoter. When glucose is present, cAMP levels are low, such that CRP is unable to activate the promoter (Egan & Schleif, 1993). With this mechanism, our team set out to control our kill genes with glucose with the following rhamnose promoter construct:</p><br />
<br />
</html>[[File:RhamnoseConstruct_Calgary2012.png|thumb|500px|center|Figure two: Our design for the glucose repressible, rhamnose based promoter for our kill system.]]<html><br />
<br />
<p>Our kill system is different from the native rhamnose system with the rhaR and rhaS control genes. We have constituitively expressed rhaS to overcome dependency on rhamnose to cause activation of the kill switch. While RhaS is continuously present, global catabolite repression prevents its activation the kill genes in the bioreactor; in the outside environment, glucose levels are lower such that RhaS is able to activate the kill genes.</p><br />
<br />
<h2>Components and characterization</h2><br />
<p>Our team had pRha promoter commercially synthesized as per the sequence given by Jeske and Altenbuchner (2010). The rhaS and rhaR genes were amplified via PCR from Top Ten E. coli using Kapa Hi-Fi polymerase. </p><br />
<br />
<p>Given the control gene modifications which we have engineered into our system to optimize it for the tailings ponds, we are working to determine whether glucose repression of our modified system match patterns shown by Giacalone et al. (2006) and Jeske and Altenbuchner (2010). To this end, we have constructed the rhamnose promoter with GFP and are finalizing construction with constituitively expressed RhaS, so that we can characterize (LINK) this promoter and test it with our kill genes.</p><br />
<br />
<br />
<br />
<h1>The Moco Riboswitch - In progess</h1><br />
<h2>Background</h2><br />
<p><br />
The molybdenum cofactor (moco) riboswitch is an RNA element which responds to the presence of the metabolite molybdenum cofactor. This RNA element is located in the E.coli genome just upstream of the moaABCDE operon, which contain the important moco synthesis genes. Moco is an important cofactor in many different enzymes ranging from to this. The moco riboswitch has 2 regions: an aptamer domain and the expression platform. When moco is present in the cell it will bind to the aptamer region in the riboswitch which will cause an allosteric change. This allosteric change affects the expression platform by physically hiding the ribosome binding site thus preventing translation from occurring and hence adding a translational level of gene expression regulation. Therefore, the moco riboswitch, when activated by moco, inhibits gene expression.<br />
<br />
</p><br />
</html><br />
[[File:Moco_riboswitchCalgary2012.jpg|thumb|500px|center|Figure (#): This picture depicts the Moco RNA motif upstream of the moaABCDE operon ]]<html> <br />
<h2>Molybdate in TPW</h2><br />
<br />
<h2>The Killswitch Design</h2><br />
<br />
<p><br />
This riboswitch system can be used to design a killswitch mechanism to regulate the expression of our kill genes, CviAII and S7. The basic design of this system includes the kill genes downstream of the riboswitch all of which is under the control of a constitutive promoter. Downstream of this construct is the moa operon constitutively expressed. This entire construct will be present in a low copy plasmid in our bacteria. While moco synthesis is a normal process in the bacteria we wanted to constitutively express the moa operon for two reasons. First, we wanted to up regulate the expression of moco to ensure high enough concentrations of moco capable of inactivating the kill switch when the bacteria are in the bioreactor. Second, the moa operon in the genome is under regulation by the bacteria to maintain equilibrium and therefore we think it might not be reliable in producing the required concentration. The two moa operons will express our metabolite moco, which will activate the riboswitch and represses the kill genes. <br />
<br />
</p><br />
</html><br />
[[File:RaioperonCalgary2012.png|thumb|500px|center|Figure #: Moa Operon]]<html><br />
<br />
<p><br />
<br />
Molybdenum, Mo, is a trace element that is required by the bacteria for moco synthesis. Bacteria cannot uptake molybdenum in the elemental form and so uptakes molybdenum in its oxyanion form molybdate, MoO4, using the molybdate transport system. We wanted a system where molybdate is present in the bioreactor permitting moco synthesis (inactivate killswitch) and absent in the tailings pond water (TPW) preventing moco synthesis (activate killswitch). We discovered that molybdenum is indeed present in the TPW. </p><br />
<p><br />
Concentrations of Mo in the TPW:<br />
• [Mo] in the Syncrude and Suncor TPW in 1990: <br />
– 0.183 mg/L in the surface region (1m-10m)<br />
– 0.045 mg/L in the sludge region (11m-20m)<br />
<br />
</p><br />
<br />
<p><br />
Molybdate forms when molybdenum is in contact with both water and oxygen. If the bacteria escape they will first enter the surface region where it is possible for the bacteria to encounter molybdate. If molybdate is present in the TPW, then there is a possibility that moco can be synthesized in the escaped bacteria inactivating the kill switch. This dilemma would defeat the purpose of this killswitch mechanism. </p><br />
<br />
<h2>The Solution </h2><br />
<p><br />
Upon further literature research we found that molybdate is transported using a molybdate transport system which is coded by the modABCD operon. It has been shown that knocking out mod C, a gene encoding the ATPase of the transporter, enables the transport system dysfunctional and prevents moco synthesis. However, if molybdate is supplemented in high enough concentrations to the bacteria, the bacteria are able to use its sulphate transport system to transport molybdate. This gave rise to the idea of having a mod C knock out strain of bacteria in our system and supplementing it with molybdate allowing moco synthesis (inactivate killswitch) inside the bioreactor. The paper tried 10mM sodium molybdate supplementation in the media whereas that the litreture level states less than 1 uM. Therefore, in the tailings ponds, the concentration is not high enough and molybdate is transported into the cell preventing moco synthesis. This activates the kill switch. Sodium molybdate is expensive and it can be said that on a large bioreactor scale it is impractical to provide. However, there are inexpensive and effective filtration mechanisms available to filter most of it out and reuse it. The filtration also prevents dumping a load of molybdate ions in the TPW. </p><br />
<br />
<h2>Characterization</h2><br />
<br />
<p>There are two experiments that we want to run with this system. Firstly, the paper did not characterize the concentration of molybdate needed to enter through the sulphate system. So we want to supply e.coli and mod c knockout strain with various concentations of molybdate and measure the optical density and do a cfu assay. Secondly we want to characterize the following system. Flourescence assay for K08 and od and cfyu for kill genes. At the moment the system is still being built. </p><br />
<br />
<p> Biobricks being built: </p><br />
<br />
<br />
</html><br />
[[File:Raisstuff1Calgary2012.png|thumb|500px|center]]<html><br />
<br />
</html><br />
[[File:Raiconstructs2Calgary2012.png|thumb|500px|center]]<html><br />
<br />
<br />
<br />
</html><br />
}}</div>Kevinm.huie