http://2012.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=20&target=Emmyft2012.igem.org - User contributions [en]2024-03-29T08:50:20ZFrom 2012.igem.orgMediaWiki 1.16.0http://2012.igem.org/Team:Cambridge/HumanPractices/MarketResearchTeam:Cambridge/HumanPractices/MarketResearch2012-10-27T03:36:25Z<p>Emmyft: /* Human Practices – Groundwater contamination in rural India */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//down<br />
if (keyCode == 40)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/DesignProcess");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/HumanPractices/OutreachCollaboration");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/HumanPractices/Overview");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/MarketResearch"><br />
<div id="vert_HP_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/DesignProcess"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="vert_RS" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/DesignProcess"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/DesignProcess"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/DesignProcess"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
=Human Practices – Groundwater contamination in rural India=<br />
<br />
As part of our market research we interviewed Dr. Konrad Siegfried from the ARSOlux Team. Check out the interview [https://2012.igem.org/Team:Cambridge/HumanPractices/Interview HERE!]<br />
<br />
Below is a summary of our research into the suitability of our system for use in the field. <br />
<br />
===Finding a Market===<br />
<br />
The potential use of our system in this context first came to light when we became aware of WaterLifeIndia Ltd who won an award for inclusive business models at the G20 conference earlier this year for their work in providing clean, safe water in response to groundwater contamination for B.O.P. (economic base of the pyramid) customers in India.<br />
<br />
We then contacted the British Red Cross, often the first on the ground when disaster strikes, to ask about the human impact of water contamination. When first arriving, all water must be treated as contaminated until it has been tested and shown not to be. For people living in areas with chronic contamination problems, finding clean water is an incredibly time consuming process which can take many hours out of peoples (predominantly women’s) days. <br />
<br />
Further research showed that the problem is extensive and as of April 2011, Arsenic, Fluoride, Iron, Salinity and Nitrate groundwater contamination continued to be a problem in many states – especially in rural areas. Before these problems can be tackled, the scope of the problem must first be determined, requiring sensitive detection apparatus.<br />
<br />
[[File:FluorosisTeeth.jpg|250px|right|thumb|The consequences of fluoride contamination of ground water. Fluoride has been shown to damage the enamel of teeth in children between the ages of 0-8. This dental fluorosis is often accompanied by skeletal fluorosis, associated with skeletal pain and problems with movement. Excessive fluoride ingestion has also been linked to neurological damage in young children.]]<br />
<br />
<br />
<span style="color:green">'''Who is our market?'''</span><br />
<br />
Groundwater contamination can be caused by a variety of factors ranging from natural disasters to improper disposal of industrial waste. Within the topic of groundwater contamination therefore, there is still substantial variety among potential customers. We anticipate that these customers will be looking at levels of a variety of contaminants in different areas though we anticipate that they will need their testing system to provide reliable, accurate quantitative data about more than one contaminant and that testing will probably involve multiple tests over a prolonged time span. Customers may include researchers, charity workers, public health workers or heavy industries aiming to reduce their environmental impact.<br />
<br />
<br />
<span style="color:green">'''What are the current options available?'''</span><br />
<br />
Because of the rural nature of many of the presumed testing sites, standard laboratory equipment is impractical. A portable system is therefore a necessity.<br />
<br />
Currently, two main types of sensing system are readily available for purchase.<br />
<br />
The first is a strip test system. The great advantages of this system is that it is far cheaper than the alternative and highly portable – the strips are extremely light and can easily be carried in pockets if more than one site within a location is to be tested. It is also quick and easy to acquire. Searching the internet for ‘groundwater testing kit’ brings up dozens of websites from which these systems can be purchased instantly and in the possession of the customer within days.<br />
<br />
The downsides to this system are that:<br />
<br />
# the tests are disposable and suitable for a single use only meaning that many have to be used and the product continuously repurchased if long term testing is going to be considered.<br />
# each strip will only test for one contaminant. Where a groundwater source is contaminated, it is unlikely that only a single potential contaminant will be of interest. For highly focussed research this may be acceptable, but in the case of broader research more than one kind of test strip will almost certainly be needed, and as with the problem of disposability, this will push up the costs.<br />
# These tests are often not highly quantitative – quantitative to the extent of orders of magnitude but without providing precise information about contamination levels which makes them unsuitable for detailed examination of contamination levels at a source, especially if the study involves taking multiple readings over a period of time, when the change could be small.<br />
<br />
[[File:TestkitComparison.jpeg|250px|left|thumb|A comparison of the <html><u><a href="https://2012.igem.org/Team:Cambridge/HumanPractices/Interview" style="color:#000066">ARSOlux kit</a></u></html> (160 assays) (left) - a bioreporter kit - and the Arsonator kit (60 assays) (right) - an electronic water testing system. From Siegfried et al. Environ. Sci. Technol. 2012]]<br />
<br />
The other major option is an electronic water testing system. These have the advantages of being far more quantitative, largely reusable and often considering more than one contaminant within the same system. As with the strip tests however, there are major disadvantages. <br />
<br />
# acquiring these systems is not as easy. Often, instead of prices being offered, a quote must be obtained. A level of customisation is sometimes possible with the technology but it is invariably by far the more expensive of the two options.<br />
# electronic systems tend to be bigger and heavier, with complete systems often coming in bulky cases that would be difficult to transport without a vehicle. These systems act more as a field lab, and as such portability is vastly reduced.<br />
<br />
The major disadvantages to these systems are on one side a lack of quantitative results and reusability and on the other high, often prohibitive, costs.<br />
<br />
<br />
<span style="color:green">'''How our system is different'''</span><br />
<br />
Our system has been designed to be relatively low cost and the prices we have paid in producing the project, while not high, would be dramatically reduced by mass production. The system is light and portable but, between the output system and the implementation system, provides highly quantitative data. While the cuvettes and bacteria are single use, the implementation system is reusable. <br />
<br />
We consider there to be a potential market for a reliable, accurate, precise, quantitative measuring system that without the price tag of current electronic systems. We also feel that our system could fill this niche.<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
<br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="hor_overview" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/HumanPractices/MarketResearch"><br />
<div id="hor_marketresearch_on" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/HumanPractices/OutreachCollaboration"><br />
<div id="hor_outreach" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/HumanPractices/FutureDirections"><br />
<div id="hor_futuredirections" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/HumanPractices/OutreachCollaboration"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Emmyfthttp://2012.igem.org/Team:Cambridge/HumanPractices/MarketResearchTeam:Cambridge/HumanPractices/MarketResearch2012-10-27T03:36:12Z<p>Emmyft: /* Human Practices – Groundwater contamination in rural India */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//down<br />
if (keyCode == 40)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/DesignProcess");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/HumanPractices/OutreachCollaboration");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/HumanPractices/Overview");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/MarketResearch"><br />
<div id="vert_HP_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/DesignProcess"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="vert_RS" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/DesignProcess"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/DesignProcess"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/DesignProcess"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
=Human Practices – Groundwater contamination in rural India=<br />
<br />
As part of our market research we interviewed Dr. Konrad Siegfried from the ARSOlux Team. Check out the interview [[https://2012.igem.org/Team:Cambridge/HumanPractices/Interview HERE!]]<br />
<br />
Below is a summary of our research into the suitability of our system for use in the field. <br />
<br />
===Finding a Market===<br />
<br />
The potential use of our system in this context first came to light when we became aware of WaterLifeIndia Ltd who won an award for inclusive business models at the G20 conference earlier this year for their work in providing clean, safe water in response to groundwater contamination for B.O.P. (economic base of the pyramid) customers in India.<br />
<br />
We then contacted the British Red Cross, often the first on the ground when disaster strikes, to ask about the human impact of water contamination. When first arriving, all water must be treated as contaminated until it has been tested and shown not to be. For people living in areas with chronic contamination problems, finding clean water is an incredibly time consuming process which can take many hours out of peoples (predominantly women’s) days. <br />
<br />
Further research showed that the problem is extensive and as of April 2011, Arsenic, Fluoride, Iron, Salinity and Nitrate groundwater contamination continued to be a problem in many states – especially in rural areas. Before these problems can be tackled, the scope of the problem must first be determined, requiring sensitive detection apparatus.<br />
<br />
[[File:FluorosisTeeth.jpg|250px|right|thumb|The consequences of fluoride contamination of ground water. Fluoride has been shown to damage the enamel of teeth in children between the ages of 0-8. This dental fluorosis is often accompanied by skeletal fluorosis, associated with skeletal pain and problems with movement. Excessive fluoride ingestion has also been linked to neurological damage in young children.]]<br />
<br />
<br />
<span style="color:green">'''Who is our market?'''</span><br />
<br />
Groundwater contamination can be caused by a variety of factors ranging from natural disasters to improper disposal of industrial waste. Within the topic of groundwater contamination therefore, there is still substantial variety among potential customers. We anticipate that these customers will be looking at levels of a variety of contaminants in different areas though we anticipate that they will need their testing system to provide reliable, accurate quantitative data about more than one contaminant and that testing will probably involve multiple tests over a prolonged time span. Customers may include researchers, charity workers, public health workers or heavy industries aiming to reduce their environmental impact.<br />
<br />
<br />
<span style="color:green">'''What are the current options available?'''</span><br />
<br />
Because of the rural nature of many of the presumed testing sites, standard laboratory equipment is impractical. A portable system is therefore a necessity.<br />
<br />
Currently, two main types of sensing system are readily available for purchase.<br />
<br />
The first is a strip test system. The great advantages of this system is that it is far cheaper than the alternative and highly portable – the strips are extremely light and can easily be carried in pockets if more than one site within a location is to be tested. It is also quick and easy to acquire. Searching the internet for ‘groundwater testing kit’ brings up dozens of websites from which these systems can be purchased instantly and in the possession of the customer within days.<br />
<br />
The downsides to this system are that:<br />
<br />
# the tests are disposable and suitable for a single use only meaning that many have to be used and the product continuously repurchased if long term testing is going to be considered.<br />
# each strip will only test for one contaminant. Where a groundwater source is contaminated, it is unlikely that only a single potential contaminant will be of interest. For highly focussed research this may be acceptable, but in the case of broader research more than one kind of test strip will almost certainly be needed, and as with the problem of disposability, this will push up the costs.<br />
# These tests are often not highly quantitative – quantitative to the extent of orders of magnitude but without providing precise information about contamination levels which makes them unsuitable for detailed examination of contamination levels at a source, especially if the study involves taking multiple readings over a period of time, when the change could be small.<br />
<br />
[[File:TestkitComparison.jpeg|250px|left|thumb|A comparison of the <html><u><a href="https://2012.igem.org/Team:Cambridge/HumanPractices/Interview" style="color:#000066">ARSOlux kit</a></u></html> (160 assays) (left) - a bioreporter kit - and the Arsonator kit (60 assays) (right) - an electronic water testing system. From Siegfried et al. Environ. Sci. Technol. 2012]]<br />
<br />
The other major option is an electronic water testing system. These have the advantages of being far more quantitative, largely reusable and often considering more than one contaminant within the same system. As with the strip tests however, there are major disadvantages. <br />
<br />
# acquiring these systems is not as easy. Often, instead of prices being offered, a quote must be obtained. A level of customisation is sometimes possible with the technology but it is invariably by far the more expensive of the two options.<br />
# electronic systems tend to be bigger and heavier, with complete systems often coming in bulky cases that would be difficult to transport without a vehicle. These systems act more as a field lab, and as such portability is vastly reduced.<br />
<br />
The major disadvantages to these systems are on one side a lack of quantitative results and reusability and on the other high, often prohibitive, costs.<br />
<br />
<br />
<span style="color:green">'''How our system is different'''</span><br />
<br />
Our system has been designed to be relatively low cost and the prices we have paid in producing the project, while not high, would be dramatically reduced by mass production. The system is light and portable but, between the output system and the implementation system, provides highly quantitative data. While the cuvettes and bacteria are single use, the implementation system is reusable. <br />
<br />
We consider there to be a potential market for a reliable, accurate, precise, quantitative measuring system that without the price tag of current electronic systems. We also feel that our system could fill this niche.<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
<br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="hor_overview" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/HumanPractices/MarketResearch"><br />
<div id="hor_marketresearch_on" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/HumanPractices/OutreachCollaboration"><br />
<div id="hor_outreach" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/HumanPractices/FutureDirections"><br />
<div id="hor_futuredirections" style="height:36px; width:240px; float:left;"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/HumanPractices/OutreachCollaboration"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Emmyfthttp://2012.igem.org/Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEWTemplate:Team:Cambridge/CAM 2012 TEMPLATE HEADNEW2012-10-27T03:30:38Z<p>Emmyft: </p>
<hr />
<div><html><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.8.2/jquery.min.js"></script><br />
<br />
<style type ='text/css'><br />
/* Wiki Hacks - START */<br />
/* Author: Pieter van Boheemen */<br />
/* Team: TU Delft */<br />
#globalWrapper { background-color: transparent; border: none; margin: 0; padding: 0; width: 100%; height:100%;}<br />
#content { background-color: transparent; border: none; padding: 0; margin: 0; width: 100%; overflow: scroll; height:100%;}<br />
#bodyContent { border: none; padding:0; margin:0; width:100%; height:100%;}<br />
#top-section { height: 15px; margin: 0px; margin-left: auto; margin-right: auto; margin-bottom: 0 !important;<br />
padding:0; border: none; font-size: 10px;}<br />
#p-logo { height:1px; overflow:scroll; display: none;}<br />
#search-controls { overflow:hidden; display:block; background: none; position: absolute; top: 100px; right: 40px;}<br />
#footer-box { width: 100%; margin: -10px auto 0 auto; padding: 20px 0;}<br />
.visualClear { display: none; }<br />
#footer { border: none; width: 965px; margin: 0 auto; padding: 0;}<br />
.firstHeading { display: none;}<br />
#f-list a { color: #333; font-size: 10px;}<br />
#f-list a:hover { color: #666;}<br />
.printfooter { display: none; }<br />
#footer ul { margin: 0; padding: 0;}<br />
#footer ul li { margin-top: 0; margin-bottom: 0; margin-left: 10px; margin-right: 10px; padding: 0;}<br />
#search-controls { display:none; }<br />
h3#siteSub { display: none;}<br />
#contentSub {display: none;}<br />
p:first-child { display: none;}<br />
/* Wiki Hacks - END */<br />
</style><br />
<br />
<link rel='stylesheet' type='text/css' href='/Team:Cambridge/static/wiki_splash.css?action=raw&ctype=text/css'/> <br />
<br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
<br />
$('#abstract').css("display","none");<br />
<br />
$('#abstract_button').click(function() {<br />
$('#abstract').fadeIn(100);<br />
});<br />
<br />
$('#abstractclose').click(function() {<br />
$('#abstract').fadeOut(100);<br />
});<br />
<br />
$('#judgingform').css("display","none");<br />
<br />
$('#judging_button').click(function() {<br />
$('#judgingform').fadeIn(100);<br />
});<br />
<br />
$('#judgingclose').click(function() {<br />
$('#judgingform').fadeOut(100);<br />
});<br />
<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id='cam_page'><br />
<div id='wrapper_template'><br />
<div id='top'><br />
<a href="/Team:Cambridge"><br />
<div id='homepage'><br />
</div><br />
</a><br />
<br />
<div id='abstract_button'><br />
</div><br />
<br />
<div id='judging_button'><br />
</div><br />
<br />
</div><br />
<br />
<div id='main'><br />
<br />
<div id='abstract' style='padding:10px;'><br />
<h8 style="color:black; background-color:white;">Parts for a reliable and field ready biosensing platform</h8><br />
<p><h9 style="color:black; background-color:white;">Implementation of biosensors in real world situations has been made difficult by the unpredictable and non-quantified outputs of existing solutions, as well as a lack of appropriate storage, distribution and utilization systems. This leaves a large gap between a simple, functional sensing mechanism and a fully realised product that can be used in the field. We aim to bridge this gap at all points by developing a standardised ratiometric luciferase output in a Bacillus chassis. This output can be linked up with prototyped instrumentation and software for obtaining reliable quantified results. Additionally, we have reduced the specialized requirements for the storage and distribution of our bacteria by using Bacillus' sporulation system. To improve the performance of our biosensing platform we have genetically modified Bacillus’ germination speed. Lastly, we demonstrated the robustness of our system by testing it with a new fluoride riboswitch, providing the opportunity to tackle real life problems.<br />
<p><h9 style="color:black; background-color:white;"> <a href = "http://prezi.com/tganfyuhurpi/igem-splash/"> One minute tour! :) </a></h9><br />
<div id='abstractclose' style='position: absolute; top: 300px; left: 10px;'> <h9 style="color:black; background-color:white;"> >> Return to page </h9></div><br />
</div><br />
<br />
<div id='judgingform' style='padding:10px;'><br />
<br />
<div id='judgingclose'> <h9 style="color:black; background-color:white;"> >> Return to page </h9></div><br />
<br />
<div id='judgingtext'><br />
</html><br />
<br />
<br />
=Judging Form=<br />
<br />
*Please help the judges by filling out this form. Tell them what medal you think you deserve and why. Tell them which special prizes you should win. Help them find your best parts. Show them how you thought about the safety of your project. Helping the judges will help you too.<br />
<br />
----<br />
<br />
*Team: Cambridge<br />
*Region: Europe<br />
*iGEM Year:2012<br />
*Track:Foundational Advance<br />
*Project Name:Parts for a reliable and field ready biosensing platform<br />
*Project Abstract: Implementation of biosensors in real world situations has been made difficult by the unpredictable and non-quantified outputs of existing solutions, as well as a lack of appropriate storage, distribution and utilization systems. This leaves a large gap between a simple, functional sensing mechanism and a fully realised product that can be used in the field.<br /><br /> We aim to bridge this gap at all points by developing a standardised ratiometric luciferase output in a Bacillus chassis. This output can be linked up with prototyped instrumentation and software for obtaining reliable quantified results. Additionally, we have reduced the specialized requirements for the storage and distribution of our bacteria by using Bacillus' sporulation system. To improve the performance of our biosensing platform we have genetically modified Bacillus’ germination speed. Lastly, we demonstrated the robustness of our system by testing it with a new fluoride riboswitch, providing the opportunity to tackle real life problems. <br />
<br />
[https://2012.igem.org/Team:Cambridge Back to wiki]<br />
<br />
<br />
== iGEM Medals for non-software teams==<br />
<br />
*We believe our team deserves the following medal:<br />
** Bronze<br />
** Silver<br />
** &radic;Gold<br />
Because we met the following criteria (check all that apply and provide details where needed)<br />
<br />
===Requirements for a Bronze Medal===<br />
*&radic;Register the team, have a great summer, and plan to have fun at the Regional Jamboree.<br />
*&radic;Successfully complete and submit this iGEM 2012 Judging form.<br />
*&radic;Create and share a Description of the team's project using the iGEM wiki and the team's parts using the Registry of Standard Biological Parts.<br />
*&radic;Plan to present a Poster and Talk at the iGEM Jamboree.<br />
*&radic;Enter information detailing at least one new standard BioBrick Part or Device in the Registry of Standard Biological Parts. Including:<br />
**&radic;Primary nucleaic acid sequence<br />
**&radic;Description of function<br />
**&radic;Authorship<br />
**Safety notes, if relevant.<br />
**&radic;Acknowedgment of sources and references<br />
*&radic;Submit DNA for at least one new BioBrick Part or Device to the Registry.<br />
<br />
===Additional Requirements for a Silver Medal===<br />
*&radic;Demonstrate that at least one new BioBrick Part or Device of your own design and construction works as expected; characterize the operation of your new part/device.<br />
*&radic;Enter this information and other documentation on the part's 'Main Page' section of the Registry <br />Part Number(s): [http://partsregistry.org/Part:BBa_K911004 BBa_K911004]<br />
<br />
===Additional Requirements for a Gold Medal: (one OR more)===<br />
*Improve an existing BioBrick Part or Device and enter this information back on the Experience Page of the Registry.<br />Part Number(s): None<br />
*&radic;Help another iGEM team by, for example, characterizing a part, debugging a construct, or modeling or simulating their system.<br />Link to this information on your wiki. Page name: [https://2012.igem.org/Team:Cambridge/Outreach/Collaboration Team:Cambridge/Outreach/Collaboration]<br />
*&radic;Outline and detail a new approach to an issue of Human Practice in synthetic biology as it relates to your project, such as safety, security, ethics, or ownership, sharing, and innovation.<br />Link to this information on your wiki. <br />Page name: [https://2012.igem.org/Team:Cambridge/HumanPractices/Overview Team:Cambridge/HumanPractices/Overview],[https://2012.igem.org/Team:Cambridge/HumanPractices/MarketResearch Team:Cambridge/HumanPractices/MarketResearch],[https://2012.igem.org/Team:Cambridge/HumanPractices/FutureDirections Team:Cambridge/HumanPractices/FutureDirections]<br />
<br />
[https://2012.igem.org/Team:Cambridge Back to wiki]<br />
<br />
==iGEM Prizes==<br />
All teams are eligible for special prizes at the Jamborees. [https://2012.igem.org/Judging' more...] To help the judges, please indicate if you feel you should be evaluated for any of the following special prizes:<br />
*&radic;Best Human Practice Advance<br />
*&radic;Best Experimental Measurement<br />
*Best Model<br />
<br />
===Please explain briefly why you should receive any of these special prizes:===<br />
<br />
'''Best Human Practice Advance:'''<br />
<br />
We feel that we deserve this prize for three reasons: <br />
# We explored the impacts, *both positive and negative*, of synthetic biology as a solution to real world problems, through interviewing professionals working in a relevant field, namely the impact of arsenic water contamination in Bangladesh. <br />
# We recognized existing problems with the way the current direction of synthetic. On going through the registry we found that most of the characterization data for biosensing parts is often neither comparable nor replicable. We have worked to solve this issue, for example with our ratiometric dual channel output. <br />
# *Our project doesn’t stop here*, in Chanel number 6 ([https://2012.igem.org/Team:Cambridge/HumanPractices/FutureDirections Team:Cambridge/HumanPractices/FutureDirections]) we considered the future implications and technological applications of our project, as well as the means by which it could be improved by subsequent users. We feel that the end to an iGEM project should not be the conclusion of an idea, but the start of it.<br />
<br />
'''Best BioBrick Measurement Approach:'''<br />
<br />
It is absolutely vital that a quantitative, numerical, robust, and flexible measurement approach exists to relay information to a user that is an accurate representation of the input processed by a biological device. Working from these principles, the following was done:<br />
# We designed and built Biologger, a *cheap, arduino-based, fully functional automatic rotary device* that has an incorporated ratiolumnometer<br />
# Our project is entirely open-sourced and open-platform. We have published source code for the two applications which serve to operate the device, one for PCs and the other for Android devices, as well as the open source circuit design that provides this ratiometric reading. Furthermore, the Android app is able to receive its data wirelessly, which we feel is a great advance in BioBrick measurement. <br />
# Our dual-channel luciferase reporter was successfully tested with a dilution series of E.coli transformed with the Lux Operon (under pBAD) biobrick (Part BBa_K325909) of the Cambridge iGEM 2010 team. It can detect, with good accuracy, both different light intensities, as well as the percentages of blue or orange frequencies in a sample. <br />
# Our device was successfully tested using artificial light to detect different frequencies (colours) as well.<br />
Having done all the above, we believe that this fully open-sourced instrumentation kit (mechanical) chassis, electronics, software code), estimated at *$35.00* (or $85.00 if a Bluetooth modem is required), is a complete BioBrick measurement solution for any and all BioBricks with a light output.<br />
<br />
[https://2012.igem.org/Team:Cambridge Back to wiki]<br />
<br />
==Team_Parts==<br />
To help the judges evaluate your parts, please identify 3 of your parts that you feel are best documented and are of the highest quality. <br />
*;Best new BioBrick part (natural): [http://partsregistry.org/Part:BBa_K911003 BBa_K911003]<br />
*;Best new BioBrick part (engineered): [http://partsregistry.org/Part:BBa_K911004 BBa_K911004]<br />
*Best improved part(s): None<br />
<br />
List any other parts you would like the judges to examine:[http://partsregistry.org/Part:BBa_K911001 BBa_K911001], [http://partsregistry.org/Part:BBa_K911008 BBa_K911009], [http://partsregistry.org/Part:BBa_K911008 BBa_K911008]<br />
<br />
Please explain briefly why the judges should examine these other parts:<br />
* '''Magnesium Sensitive Riboswitch [http://partsregistry.org/Part:BBa_K911001 BBa_K911001]'''<br />As a riboswitch sensing construct, this part is an entirely new type of biosensor (along with the fluoride construct) that could potentially change the way we think about designing input genetic circuits. Unlike the fluoride riboswitch, it is a derepression system and therefore serves to demonstrate the principle that riboswitches can be used regardless of whether they turn on or off their reporter.<br />
* '''Fluorescent ratiometric construct for standardizing promoter output [http://partsregistry.org/Part:BBa_K911009 BBa_K911009]''' <br />Fluorescence is a major cornerstone for biosensors in the registry, however, most parts do not involve the use of a ratiometric output, which has been shown in the literature to provide much more reliable and meaningful data. This part not only furthers the development of ratiometric measurements in molecular biology but due to the choice of promoters and terminators it can be used to characterize the difference in activity between E. coli and B. Subtilis<br />
* '''Fast Germination (B. subtilis) [http://partsregistry.org/Part:BBa_K911008 BBa_K911008]'''<br />This part is entirely novel for the registry and fully utilizes the recombination machinery inherent in the Bacillus chassis. Have spores that can germinate at a faster rate is certainly a worthy achievement and could help with experiments with B. Subtilis that any future iGEM teams may wish to perform.<br />
<br />
[https://2012.igem.org/Team:Cambridge Back to wiki]<br />
<br />
==iGEM Safety==<br />
For iGEM 2012 teams are asked to detail how they approached any issues of biological safety associated with their projects.<br />
<br />
The iGEM judges expect that you have answered the four safety questions [https://2012.igem.org/Safety Safety page] on your iGEM 2012 wiki.<br />
<br />
Please provide the link to that page:<br />
Page name: [https://2012.igem.org/Team:Cambridge/Safety Team:Cambridge/Safety]<br />
<br />
==Attribution and Contributions==<br />
For iGEM 2012 the description of each project must clearly attribute work done by the team and distinguish it from work done by others, including the host labs, advisors, and instructors.<br />
<br />
Please provide the link to that page, or comments in the box below:<br />
Page name: [https://2012.igem.org/Team:Cambridge/Attributions Team:Cambridge/Attributions]<br />
<br />
==Comments==<br />
If there is any other information about your project you would like to highlight for the judges, please provide a link to your wiki page here: [https://2012.igem.org/Team:Cambridge/Overview/DesignProcess Team:Cambridge/Overview/DesignProcess]<br />
<br />
<html><br />
</div><br />
</div><br />
<br />
<br />
</html></div>Emmyfthttp://2012.igem.org/Team:CambridgeTeam:Cambridge2012-10-27T03:29:50Z<p>Emmyft: </p>
<hr />
<div><html><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<style type ='text/css'><br />
/* Wiki Hacks - START */<br />
/* Author: Pieter van Boheemen */<br />
/* Team: TU Delft */<br />
#globalWrapper { background-color: transparent; border: none; margin: 0; padding: 0; width: 100%; height:100%;}<br />
#content { background-color: transparent; border: none; padding: 0; margin: 0; width: 100%; overflow: scroll; height:100%;}<br />
#bodyContent { border: none; padding:0; margin:0; width:100%; height:100%;}<br />
#top-section { height: 15px; margin: 0px; margin-left: auto; margin-right: auto; margin-bottom: 0 !important;<br />
padding:0; border: none; font-size: 10px;}<br />
#p-logo { height:1px; overflow:scroll; display: none;}<br />
#search-controls { overflow:hidden; display:block; background: none; position: absolute; top: 100px; right: 40px;}<br />
#footer-box { width: 100%; margin: -10px auto 0 auto; padding: 20px 0;}<br />
.visualClear { display: none; }<br />
#footer { border: none; width: 965px; margin: 0 auto; padding: 0;}<br />
.firstHeading { display: none;}<br />
#f-list a { color: #333; font-size: 10px;}<br />
#f-list a:hover { color: #666;}<br />
.printfooter { display: none; }<br />
#footer ul { margin: 0; padding: 0;}<br />
#footer ul li { margin-top: 0; margin-bottom: 0; margin-left: 10px; margin-right: 10px; padding: 0;}<br />
#search-controls { display:none; }<br />
h3#siteSub { display: none;}<br />
#contentSub {display: none;}<br />
p:first-child { display: none;}<br />
/* Wiki Hacks - END */<br />
</style><br />
<br />
<link rel='stylesheet' type='text/css' href='/Team:Cambridge/static/wiki_splash.css?action=raw&ctype=text/css'/> <br />
<br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
<br />
$('.splash_over').css("display","none");<br />
<br />
$('#HP').mouseover(function() {<br />
$('#HP').css("background", "url('https://static.igem.org/mediawiki/2012/c/ce/CAMV2_HP.jpg') no-repeat");<br />
$('#HP h8').css("background-color","white");<br />
$('#HP h9').css("background-color","white");<br />
$('#HP h9').css("color","black");<br />
});<br />
<br />
$('#HP').mouseleave(function() {<br />
$('#HP').css("background-image", "none");<br />
$('#HP h8').css("background-color","black");<br />
$('#HP h9').css("background-color","black");<br />
$('#HP h9').css("color","white");<br />
});<br />
<br />
$('#OV').mouseover(function() {<br />
$('#OV').css("background", "white no-repeat");<br />
$('#OV h8').css("background-color","white");<br />
$('#OV h8').css("color","black");<br />
$('#OV h9').css("background-color","white");<br />
$('#OV h9').css("color","black");<br />
});<br />
<br />
$('#OV').mouseleave(function() {<br />
$('#OV').css("background", "none");<br />
$('#OV h8').css("background-color","black");<br />
$('#OV h8').css("color","white");<br />
$('#OV h9').css("background-color","black");<br />
$('#OV h9').css("color","white");<br />
});<br />
<br />
$('#RS').mouseover(function() {<br />
$('#RS').css("background", "url('https://static.igem.org/mediawiki/2012/9/9e/CAMV2_RS.jpg') no-repeat");<br />
$('#RS h8').css("background-color","white");<br />
$('#RS h9').css("background-color","white");<br />
$('#RS h9').css("color","black");<br />
});<br />
<br />
$('#RS').mouseleave(function() {<br />
$('#RS').css("background-image", "none");<br />
$('#RS h8').css("background-color","black");<br />
$('#RS h9').css("background-color","black");<br />
$('#RS h9').css("color","white");<br />
});<br />
<br />
$('#RM').mouseover(function() {<br />
$('#RM').css("background", "url('https://static.igem.org/mediawiki/2012/2/23/CAMV2_RM.JPG') no-repeat");<br />
$('#RM h8').css("background-color","white");<br />
$('#RM h9').css("background-color","white");<br />
$('#RM h9').css("color","black");<br />
});<br />
<br />
$('#RM').mouseleave(function() {<br />
$('#RM').css("background-image", "none");<br />
$('#RM h8').css("background-color","black");<br />
$('#RM h9').css("background-color","black");<br />
$('#RM h9').css("color","white");<br />
});<br />
<br />
$('#BL').mouseover(function() {<br />
$('#BL').css("background", "url('https://static.igem.org/mediawiki/2012/e/e1/CAMV2_BL.jpg') no-repeat");<br />
$('#BL h8').css("background-color","white");<br />
$('#BL h9').css("background-color","white");<br />
$('#BL h9').css("color","black");<br />
});<br />
<br />
$('#BL').mouseleave(function() {<br />
$('#BL').css("background-image", "none");<br />
$('#BL h8').css("background-color","black");<br />
$('#BL h9').css("background-color","black");<br />
$('#BL h9').css("color","white");<br />
});<br />
<br />
$('#SD').mouseover(function() {<br />
$('#SD').css("background", "url('https://static.igem.org/mediawiki/2012/8/88/CAMV2_SD.jpg') no-repeat");<br />
$('#SD h8').css("background-color","white");<br />
$('#SD h9').css("background-color","white");<br />
$('#SD h9').css("color","black");<br />
});<br />
<br />
$('#SD').mouseleave(function() {<br />
$('#SD').css("background-image", "none");<br />
$('#SD h8').css("background-color","black");<br />
$('#SD h9').css("background-color","black");<br />
$('#SD h9').css("color","white");<br />
});<br />
<br />
<br />
$('#abstract').css("display","none");<br />
<br />
$('#abstract_button').click(function() {<br />
$('#abstract').fadeIn(100);<br />
});<br />
<br />
$('#abstractclose').click(function() {<br />
$('#abstract').fadeOut(100);<br />
});<br />
<br />
$('#judgingform').css("display","none");<br />
<br />
$('#judging_button').click(function() {<br />
$('#judgingform').fadeIn(100);<br />
});<br />
<br />
$('#judgingclose').click(function() {<br />
$('#judgingform').fadeOut(100);<br />
});<br />
<br />
<br />
});<br />
<br />
</script><br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<div id='cam_page'><br />
<br />
<div id='wrapper'><br />
<div id='top'><br />
<div id='abstract_button'><br />
</div><br />
<div id='judging_button'><br />
</div><br />
</div><br />
<div id='main'><br />
<br />
<div id='abstract' style='padding:10px;'><br />
<h8 style="color:black; background-color:white;">Parts for a reliable and field ready biosensing platform</h8><br />
<p><h9 style="color:black; background-color:white;">Implementation of biosensors in real world situations has been made difficult by the unpredictable and non-quantified outputs of existing solutions, as well as a lack of appropriate storage, distribution and utilization systems. This leaves a large gap between a simple, functional sensing mechanism and a fully realised product that can be used in the field. We aim to bridge this gap at all points by developing a standardised ratiometric luciferase output in a Bacillus chassis. This output can be linked up with prototyped instrumentation and software for obtaining reliable quantified results. Additionally, we have reduced the specialized requirements for the storage and distribution of our bacteria by using Bacillus' sporulation system. To improve the performance of our biosensing platform we have genetically modified Bacillus’ germination speed. Lastly, we demonstrated the robustness of our system by testing it with a new fluoride riboswitch, providing the opportunity to tackle real life problems.<br />
<p><h9 style="color:black; background-color:white;"> <a href = "http://prezi.com/tganfyuhurpi/igem-splash/"> One minute tour! :) </a></h9><br />
<div id='abstractclose' style='position: absolute; top: 300px; left: 10px;'> <h9 style="color:black; background-color:white;"> >> Return to page </h9></div><br />
</div><br />
<br />
<div id='judgingform' style='padding:10px;'><br />
<br />
<div id='judgingclose'> <h9 style="color:black; background-color:white;"> >> Return to page </h9></div><br />
<br />
<div id='judgingtext'><br />
</html><br />
<br />
<br />
=Judging Form=<br />
<br />
*Please help the judges by filling out this form. Tell them what medal you think you deserve and why. Tell them which special prizes you should win. Help them find your best parts. Show them how you thought about the safety of your project. Helping the judges will help you too.<br />
<br />
----<br />
<br />
*Team: Cambridge<br />
*Region: Europe<br />
*iGEM Year:2012<br />
*Track:Foundational Advance<br />
*Project Name:Parts for a reliable and field ready biosensing platform<br />
*Project Abstract: Implementation of biosensors in real world situations has been made difficult by the unpredictable and non-quantified outputs of existing solutions, as well as a lack of appropriate storage, distribution and utilization systems. This leaves a large gap between a simple, functional sensing mechanism and a fully realised product that can be used in the field.<br /><br /> We aim to bridge this gap at all points by developing a standardised ratiometric luciferase output in a Bacillus chassis. This output can be linked up with prototyped instrumentation and software for obtaining reliable quantified results. Additionally, we have reduced the specialized requirements for the storage and distribution of our bacteria by using Bacillus' sporulation system. To improve the performance of our biosensing platform we have genetically modified Bacillus’ germination speed. Lastly, we demonstrated the robustness of our system by testing it with a new fluoride riboswitch, providing the opportunity to tackle real life problems. <br />
<br />
[https://2012.igem.org/Team:Cambridge Back to wiki]<br />
<br />
<br />
== iGEM Medals for non-software teams==<br />
<br />
*We believe our team deserves the following medal:<br />
** Bronze<br />
** Silver<br />
** &radic;Gold<br />
Because we met the following criteria (check all that apply and provide details where needed)<br />
<br />
===Requirements for a Bronze Medal===<br />
*&radic;Register the team, have a great summer, and plan to have fun at the Regional Jamboree.<br />
*&radic;Successfully complete and submit this iGEM 2012 Judging form.<br />
*&radic;Create and share a Description of the team's project using the iGEM wiki and the team's parts using the Registry of Standard Biological Parts.<br />
*&radic;Plan to present a Poster and Talk at the iGEM Jamboree.<br />
*&radic;Enter information detailing at least one new standard BioBrick Part or Device in the Registry of Standard Biological Parts. Including:<br />
**&radic;Primary nucleaic acid sequence<br />
**&radic;Description of function<br />
**&radic;Authorship<br />
**Safety notes, if relevant.<br />
**&radic;Acknowedgment of sources and references<br />
*&radic;Submit DNA for at least one new BioBrick Part or Device to the Registry.<br />
<br />
===Additional Requirements for a Silver Medal===<br />
*&radic;Demonstrate that at least one new BioBrick Part or Device of your own design and construction works as expected; characterize the operation of your new part/device.<br />
*&radic;Enter this information and other documentation on the part's 'Main Page' section of the Registry <br />Part Number(s): [http://partsregistry.org/Part:BBa_K911004 BBa_K911004]<br />
<br />
===Additional Requirements for a Gold Medal: (one OR more)===<br />
*Improve an existing BioBrick Part or Device and enter this information back on the Experience Page of the Registry.<br />Part Number(s): None<br />
*&radic;Help another iGEM team by, for example, characterizing a part, debugging a construct, or modeling or simulating their system.<br />Link to this information on your wiki. Page name: [https://2012.igem.org/Team:Cambridge/Outreach/Collaboration Team:Cambridge/Outreach/Collaboration]<br />
*&radic;Outline and detail a new approach to an issue of Human Practice in synthetic biology as it relates to your project, such as safety, security, ethics, or ownership, sharing, and innovation.<br />Link to this information on your wiki. <br />Page name: [https://2012.igem.org/Team:Cambridge/HumanPractices/Overview Team:Cambridge/HumanPractices/Overview],[https://2012.igem.org/Team:Cambridge/HumanPractices/MarketResearch Team:Cambridge/HumanPractices/MarketResearch],[https://2012.igem.org/Team:Cambridge/HumanPractices/FutureDirections Team:Cambridge/HumanPractices/FutureDirections]<br />
<br />
[https://2012.igem.org/Team:Cambridge Back to wiki]<br />
<br />
==iGEM Prizes==<br />
All teams are eligible for special prizes at the Jamborees. [https://2012.igem.org/Judging' more...] To help the judges, please indicate if you feel you should be evaluated for any of the following special prizes:<br />
*&radic;Best Human Practice Advance<br />
*&radic;Best Experimental Measurement<br />
*Best Model<br />
<br />
===Please explain briefly why you should receive any of these special prizes:===<br />
<br />
'''Best Human Practice Advance:'''<br />
<br />
We feel that we deserve this prize for three reasons: <br />
# We explored the impacts, *both positive and negative*, of synthetic biology as a solution to real world problems, through interviewing professionals working in a relevant field, namely the impact of arsenic water contamination in Bangladesh. <br />
# We recognized existing problems with the way the current direction of synthetic. On going through the registry we found that most of the characterization data for biosensing parts is often neither comparable nor replicable. We have worked to solve this issue, for example with our ratiometric dual channel output. <br />
# *Our project doesn’t stop here*, in Chanel number 6 ([https://2012.igem.org/Team:Cambridge/HumanPractices/FutureDirections Team:Cambridge/HumanPractices/FutureDirections]) we considered the future implications and technological applications of our project, as well as the means by which it could be improved by subsequent users. We feel that the end to an iGEM project should not be the conclusion of an idea, but the start of it.<br />
<br />
'''Best BioBrick Measurement Approach:'''<br />
<br />
It is absolutely vital that a quantitative, numerical, robust, and flexible measurement approach exists to relay information to a user that is an accurate representation of the input processed by a biological device. Working from these principles, the following was done:<br />
# We designed and built Biologger, a *cheap, arduino-based, fully functional automatic rotary device* that has an incorporated ratiolumnometer<br />
# Our project is entirely open-sourced and open-platform. We have published source code for the two applications which serve to operate the device, one for PCs and the other for Android devices, as well as the open source circuit design that provides this ratiometric reading. Furthermore, the Android app is able to receive its data wirelessly, which we feel is a great advance in BioBrick measurement. <br />
# Our dual-channel luciferase reporter was successfully tested with a dilution series of E.coli transformed with the Lux Operon (under pBAD) biobrick (Part BBa_K325909) of the Cambridge iGEM 2010 team. It can detect, with good accuracy, both different light intensities, as well as the percentages of blue or orange frequencies in a sample. <br />
# Our device was successfully tested using artificial light to detect different frequencies (colours) as well.<br />
Having done all the above, we believe that this fully open-sourced instrumentation kit (mechanical) chassis, electronics, software code), estimated at *$35.00* (or $85.00 if a Bluetooth modem is required), is a complete BioBrick measurement solution for any and all BioBricks with a light output.<br />
<br />
[https://2012.igem.org/Team:Cambridge Back to wiki]<br />
<br />
==Team_Parts==<br />
To help the judges evaluate your parts, please identify 3 of your parts that you feel are best documented and are of the highest quality. <br />
*;Best new BioBrick part (natural): [http://partsregistry.org/Part:BBa_K911003 BBa_K911003]<br />
*;Best new BioBrick part (engineered): [http://partsregistry.org/Part:BBa_K911004 BBa_K911004]<br />
*Best improved part(s): None<br />
<br />
List any other parts you would like the judges to examine:[http://partsregistry.org/Part:BBa_K911001 BBa_K911001], [http://partsregistry.org/Part:BBa_K911008 BBa_K911009], [http://partsregistry.org/Part:BBa_K911008 BBa_K911008]<br />
<br />
Please explain briefly why the judges should examine these other parts:<br />
* '''Magnesium Sensitive Riboswitch [http://partsregistry.org/Part:BBa_K911001 BBa_K911001]'''<br />As a riboswitch sensing construct, this part is an entirely new type of biosensor (along with the fluoride construct) that could potentially change the way we think about designing input genetic circuits. Unlike the fluoride riboswitch, it is a derepression system and therefore serves to demonstrate the principle that riboswitches can be used regardless of whether they turn on or off their reporter.<br />
* '''Fluorescent ratiometric construct for standardizing promoter output [http://partsregistry.org/Part:BBa_K911009 BBa_K911009]''' <br />Fluorescence is a major cornerstone for biosensors in the registry, however, most parts do not involve the use of a ratiometric output, which has been shown in the literature to provide much more reliable and meaningful data. This part not only furthers the development of ratiometric measurements in molecular biology but due to the choice of promoters and terminators it can be used to characterize the difference in activity between E. coli and B. Subtilis<br />
* '''Fast Germination (B. subtilis) [http://partsregistry.org/Part:BBa_K911008 BBa_K911008]'''<br />This part is entirely novel for the registry and fully utilizes the recombination machinery inherent in the Bacillus chassis. Have spores that can germinate at a faster rate is certainly a worthy achievement and could help with experiments with B. Subtilis that any future iGEM teams may wish to perform.<br />
<br />
[https://2012.igem.org/Team:Cambridge Back to wiki]<br />
<br />
==iGEM Safety==<br />
For iGEM 2012 teams are asked to detail how they approached any issues of biological safety associated with their projects.<br />
<br />
The iGEM judges expect that you have answered the four safety questions [https://2012.igem.org/Safety Safety page] on your iGEM 2012 wiki.<br />
<br />
Please provide the link to that page:<br />
Page name: [https://2012.igem.org/Team:Cambridge/Safety Team:Cambridge/Safety]<br />
<br />
==Attribution and Contributions==<br />
For iGEM 2012 the description of each project must clearly attribute work done by the team and distinguish it from work done by others, including the host labs, advisors, and instructors.<br />
<br />
Please provide the link to that page, or comments in the box below:<br />
Page name: [https://2012.igem.org/Team:Cambridge/Attributions Team:Cambridge/Attributions]<br />
<br />
==Comments==<br />
If there is any other information about your project you would like to highlight for the judges, please provide a link to your wiki page here: [https://2012.igem.org/Team:Cambridge/Overview/DesignProcess Team:Cambridge/Overview/DesignProcess]<br />
<br />
<html><br />
</div><br />
</div><br />
<br />
<div id='HP' class='splash'><br />
<h8 style='color:#339900;'>Human Practices</h8><br />
<p><h9>THE DRIVING FORCE</h9><br />
<p><h9>Our goal is to standardise the output of biosensors, and to develop a cheap, user-friendly kit to be used in the field</h9><br />
<p><a href="/Team:Cambridge/HumanPractices/Overview"><h9> >>Overview</h9></a><br />
<p><a href="/Team:Cambridge/HumanPractices/MarketResearch"><h9> >>Market Research</h9></a><br />
<p><a href="/Team:Cambridge/HumanPractices/OutreachCollaboration"><h9> >>Outreach & Collaborations</h9></a><br />
<p><a href="/Team:Cambridge/HumanPractices/FutureDirections"><h9> >>Future Directions </h9></a><br />
</div><br />
<br />
<div id='OV' class='splash' style='padding-top: 0px;'><br />
<h8 style='color:#FFFFFF;'>Parts for a Reliable and Field Ready Biosensing Platform</h8><br />
<p><h9>OVERVIEW</h9><br />
<p><h9>There are many biosensors available but there is no standard way to deploy them. Many are also non-quantitative and unpredictable. We have been working on a ratiometric luciferase output which can be read by an Arduino device.<br />
This output could be used with theoretically any biosensor. We investigated the potential of riboswitches as future biosensors. We use a B.subtilis chassis as these form low maintenance spores for easy, long-term storage. </h9><br />
<p><a href="/Team:Cambridge/Overview/Overview"><h9> >>Overview</h9></a><br />
<p><a href="/Team:Cambridge/Overview/DesignProcess"><h9> >>Design Process</h9></a><br />
<p><a href="/Team:Cambridge/Overview/Parts"><h9> >>Parts</h9></a><br />
<p><a href="/Team:Cambridge/Overview/Labbook"><h9> >>Lab book</h9></a><br />
<p><a href="/Team:Cambridge/Overview/Results"><h9> >>Results</h9></a><br />
</div><br />
<br />
<div id='RS' class='splash'><br />
<h8 style='color:#4682B4;'>RiboSense</h8><br />
<p><h9>A NOVEL FLUORIDE SENSOR BASED ON A RIBOSWITCH CONSTRUCT</h9><br />
<p><h9>Riboswitches may well be the biosensor of the future though they are currently under-represented in the registry.</h9><br />
<p><a href='/Team:Cambridge/Ribosense/Overview'><h9> >>Overview</h9></a><br />
<p><a href='/Team:Cambridge/Ribosense/DesignProcess'><h9> >>Design Process</h9></a><br />
<p><a href='/Team:Cambridge/Ribosense/Parts'><h9> >>Parts</h9></a><br />
<p><a href='/Team:Cambridge/Ribosense/Labbook'><h9> >>Lab book</h9></a><br />
<p><a href='/Team:Cambridge/Ribosense/Results'><h9> >>Results</h9></a><br />
</div><br />
<br />
<div id='RM' class='splash'><br />
<h8 style='color:#FF9900;'>Ratiometrica</h8><br />
<p><h9>INVESTIGATING THE POTENTIAL OF RATIOMETRIC REPORTER CONSTRUCTS FOR ACCURATE AND REPRODUCIBLE CHARACTERISATION</h9><br />
<p><h9>We designed fluorescence and luminescence-based constructs that would function in both E.coli and B.subtilis</h9><br />
<p><a href="/Team:Cambridge/Ratiometrica/Overview"><h9> >>Overview</h9></a><br />
<p><a href="/Team:Cambridge/Ratiometrica/DesignProcess"><h9> >>Design Process</h9></a><br />
<p><a href="/Team:Cambridge/Ratiometrica/Parts"><h9> >>Parts</h9></a><br />
<p><a href="/Team:Cambridge/Ratiometrica/Labbook"><h9> >>Lab book</h9></a><br />
<p><a href="/Team:Cambridge/Ratiometrica/Results"><h9> >>Results</h9></a><br />
</div><br />
<br />
<div id='BL' class='splash'><br />
<h8 style='color:#FFFF00;'>Biologger</h8><br />
<p><h9>A CHEAP, ARDUINO-BASED, AUTOMATIC ROTARY RATIOLUMINOMETER</h9><br />
<p><h9>An open-sourced, open-platform approach relaying easily interpretable information to a user that is an accurate representation of the input processed by a biological device.</h9><br />
<p><a href="/Team:Cambridge/Biologger/Overview"><h9> >>Overview</h9></a><br />
<p><a href="/Team:Cambridge/Biologger/DesignProcess"><h9> >>Design Process</h9></a><br />
<p><a href="/Team:Cambridge/Biologger/Parts"><h9> >>Parts</h9></a><br />
<p><a href="/Team:Cambridge/Biologger/Labbook"><h9> >>Lab book</h9></a><br />
<p><a href="/Team:Cambridge/Biologger/Results"><h9> >>Results</h9></a><br />
</div><br />
<br />
<div id='SD' class='splash'><br />
<h8 style='color:#FF0033;'>Sporage & Distribution</h8><br />
<p><h9>B. SUBTILIS: LONG TERM, USER-FRIENDLY STORAGE</h9><br />
<p><h9>We developed and optimised procedures for sporulation and germination.</h9><br />
<p><a href="/Team:Cambridge/SD/Overview"><h9> >>Overview</h9><br />
<p><a href="/Team:Cambridge/SD/DesignProcess"><h9> >>Design Process</h9></a><br />
<p><a href="/Team:Cambridge/SD/Parts"><h9> >>Parts</h9></a><br />
<p><a href="/Team:Cambridge/SD/Labbook"><h9> >>Lab book</h9></a><br />
<p><a href="/Team:Cambridge/SD/Results"><h9> >>Results</h9></a><br />
</div><br />
<br />
</div><br />
<div id='bottom'><br />
<a href= "/Team:Cambridge/Diary/Week_1"><br />
<div id='diary' class='bottom_nav'><br />
</div><br />
</a><br />
<a href= "/Team:Cambridge/Protocols"><br />
<div id='protocols' class='bottom_nav'><br />
</div><br />
</a><br />
<a href= "/Team:Cambridge/Team"><br />
<div id='team' class='bottom_nav'><br />
</div><br />
</a><br />
<a href= "/Team:Cambridge/Sponsors"><br />
<div id='sponsors' class='bottom_nav'><br />
</div><br />
</a><br />
<a href= "/Team:Cambridge/Safety"><br />
<div id='safety' class='bottom_nav'><br />
</div><br />
</a><br />
<a href= "http://www.facebook.com/CambridgeIgem2012" class="cam-external"><br />
<div id='facebook' class='bottom_social'><br />
</div><br />
</a><br />
<a href= "http://www.flickr.com/photos/cambridgeigem2012/" class="cam-external"><br />
<div id='flickr' class='bottom_social'><br />
</div><br />
</a><br />
<a href= "http://twitter.com/cambridgeigem12" class="cam-external"><br />
<div id='twitter' class='bottom_social'><br />
</div><br />
</a><br />
<a href= "http://www.youtube.com/watch?v=lO6ajD0KfVI&feature=youtu.be" class="cam-external"><br />
<div id='youtube' class='bottom_social'><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<br />
<br />
<br />
</div><br />
<br />
<br />
</html></div>Emmyfthttp://2012.igem.org/Team:CambridgeTeam:Cambridge2012-10-27T03:29:20Z<p>Emmyft: </p>
<hr />
<div><html><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<style type ='text/css'><br />
/* Wiki Hacks - START */<br />
/* Author: Pieter van Boheemen */<br />
/* Team: TU Delft */<br />
#globalWrapper { background-color: transparent; border: none; margin: 0; padding: 0; width: 100%; height:100%;}<br />
#content { background-color: transparent; border: none; padding: 0; margin: 0; width: 100%; overflow: scroll; height:100%;}<br />
#bodyContent { border: none; padding:0; margin:0; width:100%; height:100%;}<br />
#top-section { height: 15px; margin: 0px; margin-left: auto; margin-right: auto; margin-bottom: 0 !important;<br />
padding:0; border: none; font-size: 10px;}<br />
#p-logo { height:1px; overflow:scroll; display: none;}<br />
#search-controls { overflow:hidden; display:block; background: none; position: absolute; top: 100px; right: 40px;}<br />
#footer-box { width: 100%; margin: -10px auto 0 auto; padding: 20px 0;}<br />
.visualClear { display: none; }<br />
#footer { border: none; width: 965px; margin: 0 auto; padding: 0;}<br />
.firstHeading { display: none;}<br />
#f-list a { color: #333; font-size: 10px;}<br />
#f-list a:hover { color: #666;}<br />
.printfooter { display: none; }<br />
#footer ul { margin: 0; padding: 0;}<br />
#footer ul li { margin-top: 0; margin-bottom: 0; margin-left: 10px; margin-right: 10px; padding: 0;}<br />
#search-controls { display:none; }<br />
h3#siteSub { display: none;}<br />
#contentSub {display: none;}<br />
p:first-child { display: none;}<br />
/* Wiki Hacks - END */<br />
</style><br />
<br />
<link rel='stylesheet' type='text/css' href='/Team:Cambridge/static/wiki_splash.css?action=raw&ctype=text/css'/> <br />
<br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
<br />
$('.splash_over').css("display","none");<br />
<br />
$('#HP').mouseover(function() {<br />
$('#HP').css("background", "url('https://static.igem.org/mediawiki/2012/c/ce/CAMV2_HP.jpg') no-repeat");<br />
$('#HP h8').css("background-color","white");<br />
$('#HP h9').css("background-color","white");<br />
$('#HP h9').css("color","black");<br />
});<br />
<br />
$('#HP').mouseleave(function() {<br />
$('#HP').css("background-image", "none");<br />
$('#HP h8').css("background-color","black");<br />
$('#HP h9').css("background-color","black");<br />
$('#HP h9').css("color","white");<br />
});<br />
<br />
$('#OV').mouseover(function() {<br />
$('#OV').css("background", "white no-repeat");<br />
$('#OV h8').css("background-color","white");<br />
$('#OV h8').css("color","black");<br />
$('#OV h9').css("background-color","white");<br />
$('#OV h9').css("color","black");<br />
});<br />
<br />
$('#OV').mouseleave(function() {<br />
$('#OV').css("background", "none");<br />
$('#OV h8').css("background-color","black");<br />
$('#OV h8').css("color","white");<br />
$('#OV h9').css("background-color","black");<br />
$('#OV h9').css("color","white");<br />
});<br />
<br />
$('#RS').mouseover(function() {<br />
$('#RS').css("background", "url('https://static.igem.org/mediawiki/2012/9/9e/CAMV2_RS.jpg') no-repeat");<br />
$('#RS h8').css("background-color","white");<br />
$('#RS h9').css("background-color","white");<br />
$('#RS h9').css("color","black");<br />
});<br />
<br />
$('#RS').mouseleave(function() {<br />
$('#RS').css("background-image", "none");<br />
$('#RS h8').css("background-color","black");<br />
$('#RS h9').css("background-color","black");<br />
$('#RS h9').css("color","white");<br />
});<br />
<br />
$('#RM').mouseover(function() {<br />
$('#RM').css("background", "url('https://static.igem.org/mediawiki/2012/2/23/CAMV2_RM.JPG') no-repeat");<br />
$('#RM h8').css("background-color","white");<br />
$('#RM h9').css("background-color","white");<br />
$('#RM h9').css("color","black");<br />
});<br />
<br />
$('#RM').mouseleave(function() {<br />
$('#RM').css("background-image", "none");<br />
$('#RM h8').css("background-color","black");<br />
$('#RM h9').css("background-color","black");<br />
$('#RM h9').css("color","white");<br />
});<br />
<br />
$('#BL').mouseover(function() {<br />
$('#BL').css("background", "url('https://static.igem.org/mediawiki/2012/e/e1/CAMV2_BL.jpg') no-repeat");<br />
$('#BL h8').css("background-color","white");<br />
$('#BL h9').css("background-color","white");<br />
$('#BL h9').css("color","black");<br />
});<br />
<br />
$('#BL').mouseleave(function() {<br />
$('#BL').css("background-image", "none");<br />
$('#BL h8').css("background-color","black");<br />
$('#BL h9').css("background-color","black");<br />
$('#BL h9').css("color","white");<br />
});<br />
<br />
$('#SD').mouseover(function() {<br />
$('#SD').css("background", "url('https://static.igem.org/mediawiki/2012/8/88/CAMV2_SD.jpg') no-repeat");<br />
$('#SD h8').css("background-color","white");<br />
$('#SD h9').css("background-color","white");<br />
$('#SD h9').css("color","black");<br />
});<br />
<br />
$('#SD').mouseleave(function() {<br />
$('#SD').css("background-image", "none");<br />
$('#SD h8').css("background-color","black");<br />
$('#SD h9').css("background-color","black");<br />
$('#SD h9').css("color","white");<br />
});<br />
<br />
<br />
$('#abstract').css("display","none");<br />
<br />
$('#abstract_button').click(function() {<br />
$('#abstract').fadeIn(100);<br />
});<br />
<br />
$('#abstractclose').click(function() {<br />
$('#abstract').fadeOut(100);<br />
});<br />
<br />
$('#judgingform').css("display","none");<br />
<br />
$('#judging_button').click(function() {<br />
$('#judgingform').fadeIn(100);<br />
});<br />
<br />
$('#judgingclose').click(function() {<br />
$('#judgingform').fadeOut(100);<br />
});<br />
<br />
<br />
});<br />
<br />
</script><br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<div id='cam_page'><br />
<br />
<div id='wrapper'><br />
<div id='top'><br />
<div id='abstract_button'><br />
</div><br />
<div id='judging_button'><br />
</div><br />
</div><br />
<div id='main'><br />
<br />
<div id='abstract' style='padding:10px;'><br />
<h8 style="color:black; background-color:white;">Parts for a reliable and field ready biosensing platform</h8><br />
<p><h9 style="color:black; background-color:white;">Implementation of biosensors in real world situations has been made difficult by the unpredictable and non-quantified outputs of existing solutions, as well as a lack of appropriate storage, distribution and utilization systems. This leaves a large gap between a simple, functional sensing mechanism and a fully realised product that can be used in the field. We aim to bridge this gap at all points by developing a standardised ratiometric luciferase output in a Bacillus chassis. This output can be linked up with prototyped instrumentation and software for obtaining reliable quantified results. Additionally, we have reduced the specialized requirements for the storage and distribution of our bacteria by using Bacillus' sporulation system. To improve the performance of our biosensing platform we have genetically modified Bacillus’ germination speed. Lastly, we demonstrated the robustness of our system by testing it with a new fluoride riboswitch, providing the opportunity to tackle real life problems.<br />
<p><h9 style="color:black; background-color:white;"> <a href = "http://prezi.com/tganfyuhurpi/igem-splash/> One minute tour! :) </a></h9><br />
<div id='abstractclose' style='position: absolute; top: 300px; left: 10px;'> <h9 style="color:black; background-color:white;"> >> Return to page </h9></div><br />
</div><br />
<br />
<div id='judgingform' style='padding:10px;'><br />
<br />
<div id='judgingclose'> <h9 style="color:black; background-color:white;"> >> Return to page </h9></div><br />
<br />
<div id='judgingtext'><br />
</html><br />
<br />
<br />
=Judging Form=<br />
<br />
*Please help the judges by filling out this form. Tell them what medal you think you deserve and why. Tell them which special prizes you should win. Help them find your best parts. Show them how you thought about the safety of your project. Helping the judges will help you too.<br />
<br />
----<br />
<br />
*Team: Cambridge<br />
*Region: Europe<br />
*iGEM Year:2012<br />
*Track:Foundational Advance<br />
*Project Name:Parts for a reliable and field ready biosensing platform<br />
*Project Abstract: Implementation of biosensors in real world situations has been made difficult by the unpredictable and non-quantified outputs of existing solutions, as well as a lack of appropriate storage, distribution and utilization systems. This leaves a large gap between a simple, functional sensing mechanism and a fully realised product that can be used in the field.<br /><br /> We aim to bridge this gap at all points by developing a standardised ratiometric luciferase output in a Bacillus chassis. This output can be linked up with prototyped instrumentation and software for obtaining reliable quantified results. Additionally, we have reduced the specialized requirements for the storage and distribution of our bacteria by using Bacillus' sporulation system. To improve the performance of our biosensing platform we have genetically modified Bacillus’ germination speed. Lastly, we demonstrated the robustness of our system by testing it with a new fluoride riboswitch, providing the opportunity to tackle real life problems. <br />
<br />
[https://2012.igem.org/Team:Cambridge Back to wiki]<br />
<br />
<br />
== iGEM Medals for non-software teams==<br />
<br />
*We believe our team deserves the following medal:<br />
** Bronze<br />
** Silver<br />
** &radic;Gold<br />
Because we met the following criteria (check all that apply and provide details where needed)<br />
<br />
===Requirements for a Bronze Medal===<br />
*&radic;Register the team, have a great summer, and plan to have fun at the Regional Jamboree.<br />
*&radic;Successfully complete and submit this iGEM 2012 Judging form.<br />
*&radic;Create and share a Description of the team's project using the iGEM wiki and the team's parts using the Registry of Standard Biological Parts.<br />
*&radic;Plan to present a Poster and Talk at the iGEM Jamboree.<br />
*&radic;Enter information detailing at least one new standard BioBrick Part or Device in the Registry of Standard Biological Parts. Including:<br />
**&radic;Primary nucleaic acid sequence<br />
**&radic;Description of function<br />
**&radic;Authorship<br />
**Safety notes, if relevant.<br />
**&radic;Acknowedgment of sources and references<br />
*&radic;Submit DNA for at least one new BioBrick Part or Device to the Registry.<br />
<br />
===Additional Requirements for a Silver Medal===<br />
*&radic;Demonstrate that at least one new BioBrick Part or Device of your own design and construction works as expected; characterize the operation of your new part/device.<br />
*&radic;Enter this information and other documentation on the part's 'Main Page' section of the Registry <br />Part Number(s): [http://partsregistry.org/Part:BBa_K911004 BBa_K911004]<br />
<br />
===Additional Requirements for a Gold Medal: (one OR more)===<br />
*Improve an existing BioBrick Part or Device and enter this information back on the Experience Page of the Registry.<br />Part Number(s): None<br />
*&radic;Help another iGEM team by, for example, characterizing a part, debugging a construct, or modeling or simulating their system.<br />Link to this information on your wiki. Page name: [https://2012.igem.org/Team:Cambridge/Outreach/Collaboration Team:Cambridge/Outreach/Collaboration]<br />
*&radic;Outline and detail a new approach to an issue of Human Practice in synthetic biology as it relates to your project, such as safety, security, ethics, or ownership, sharing, and innovation.<br />Link to this information on your wiki. <br />Page name: [https://2012.igem.org/Team:Cambridge/HumanPractices/Overview Team:Cambridge/HumanPractices/Overview],[https://2012.igem.org/Team:Cambridge/HumanPractices/MarketResearch Team:Cambridge/HumanPractices/MarketResearch],[https://2012.igem.org/Team:Cambridge/HumanPractices/FutureDirections Team:Cambridge/HumanPractices/FutureDirections]<br />
<br />
[https://2012.igem.org/Team:Cambridge Back to wiki]<br />
<br />
==iGEM Prizes==<br />
All teams are eligible for special prizes at the Jamborees. [https://2012.igem.org/Judging' more...] To help the judges, please indicate if you feel you should be evaluated for any of the following special prizes:<br />
*&radic;Best Human Practice Advance<br />
*&radic;Best Experimental Measurement<br />
*Best Model<br />
<br />
===Please explain briefly why you should receive any of these special prizes:===<br />
<br />
'''Best Human Practice Advance:'''<br />
<br />
We feel that we deserve this prize for three reasons: <br />
# We explored the impacts, *both positive and negative*, of synthetic biology as a solution to real world problems, through interviewing professionals working in a relevant field, namely the impact of arsenic water contamination in Bangladesh. <br />
# We recognized existing problems with the way the current direction of synthetic. On going through the registry we found that most of the characterization data for biosensing parts is often neither comparable nor replicable. We have worked to solve this issue, for example with our ratiometric dual channel output. <br />
# *Our project doesn’t stop here*, in Chanel number 6 ([https://2012.igem.org/Team:Cambridge/HumanPractices/FutureDirections Team:Cambridge/HumanPractices/FutureDirections]) we considered the future implications and technological applications of our project, as well as the means by which it could be improved by subsequent users. We feel that the end to an iGEM project should not be the conclusion of an idea, but the start of it.<br />
<br />
'''Best BioBrick Measurement Approach:'''<br />
<br />
It is absolutely vital that a quantitative, numerical, robust, and flexible measurement approach exists to relay information to a user that is an accurate representation of the input processed by a biological device. Working from these principles, the following was done:<br />
# We designed and built Biologger, a *cheap, arduino-based, fully functional automatic rotary device* that has an incorporated ratiolumnometer<br />
# Our project is entirely open-sourced and open-platform. We have published source code for the two applications which serve to operate the device, one for PCs and the other for Android devices, as well as the open source circuit design that provides this ratiometric reading. Furthermore, the Android app is able to receive its data wirelessly, which we feel is a great advance in BioBrick measurement. <br />
# Our dual-channel luciferase reporter was successfully tested with a dilution series of E.coli transformed with the Lux Operon (under pBAD) biobrick (Part BBa_K325909) of the Cambridge iGEM 2010 team. It can detect, with good accuracy, both different light intensities, as well as the percentages of blue or orange frequencies in a sample. <br />
# Our device was successfully tested using artificial light to detect different frequencies (colours) as well.<br />
Having done all the above, we believe that this fully open-sourced instrumentation kit (mechanical) chassis, electronics, software code), estimated at *$35.00* (or $85.00 if a Bluetooth modem is required), is a complete BioBrick measurement solution for any and all BioBricks with a light output.<br />
<br />
[https://2012.igem.org/Team:Cambridge Back to wiki]<br />
<br />
==Team_Parts==<br />
To help the judges evaluate your parts, please identify 3 of your parts that you feel are best documented and are of the highest quality. <br />
*;Best new BioBrick part (natural): [http://partsregistry.org/Part:BBa_K911003 BBa_K911003]<br />
*;Best new BioBrick part (engineered): [http://partsregistry.org/Part:BBa_K911004 BBa_K911004]<br />
*Best improved part(s): None<br />
<br />
List any other parts you would like the judges to examine:[http://partsregistry.org/Part:BBa_K911001 BBa_K911001], [http://partsregistry.org/Part:BBa_K911008 BBa_K911009], [http://partsregistry.org/Part:BBa_K911008 BBa_K911008]<br />
<br />
Please explain briefly why the judges should examine these other parts:<br />
* '''Magnesium Sensitive Riboswitch [http://partsregistry.org/Part:BBa_K911001 BBa_K911001]'''<br />As a riboswitch sensing construct, this part is an entirely new type of biosensor (along with the fluoride construct) that could potentially change the way we think about designing input genetic circuits. Unlike the fluoride riboswitch, it is a derepression system and therefore serves to demonstrate the principle that riboswitches can be used regardless of whether they turn on or off their reporter.<br />
* '''Fluorescent ratiometric construct for standardizing promoter output [http://partsregistry.org/Part:BBa_K911009 BBa_K911009]''' <br />Fluorescence is a major cornerstone for biosensors in the registry, however, most parts do not involve the use of a ratiometric output, which has been shown in the literature to provide much more reliable and meaningful data. This part not only furthers the development of ratiometric measurements in molecular biology but due to the choice of promoters and terminators it can be used to characterize the difference in activity between E. coli and B. Subtilis<br />
* '''Fast Germination (B. subtilis) [http://partsregistry.org/Part:BBa_K911008 BBa_K911008]'''<br />This part is entirely novel for the registry and fully utilizes the recombination machinery inherent in the Bacillus chassis. Have spores that can germinate at a faster rate is certainly a worthy achievement and could help with experiments with B. Subtilis that any future iGEM teams may wish to perform.<br />
<br />
[https://2012.igem.org/Team:Cambridge Back to wiki]<br />
<br />
==iGEM Safety==<br />
For iGEM 2012 teams are asked to detail how they approached any issues of biological safety associated with their projects.<br />
<br />
The iGEM judges expect that you have answered the four safety questions [https://2012.igem.org/Safety Safety page] on your iGEM 2012 wiki.<br />
<br />
Please provide the link to that page:<br />
Page name: [https://2012.igem.org/Team:Cambridge/Safety Team:Cambridge/Safety]<br />
<br />
==Attribution and Contributions==<br />
For iGEM 2012 the description of each project must clearly attribute work done by the team and distinguish it from work done by others, including the host labs, advisors, and instructors.<br />
<br />
Please provide the link to that page, or comments in the box below:<br />
Page name: [https://2012.igem.org/Team:Cambridge/Attributions Team:Cambridge/Attributions]<br />
<br />
==Comments==<br />
If there is any other information about your project you would like to highlight for the judges, please provide a link to your wiki page here: [https://2012.igem.org/Team:Cambridge/Overview/DesignProcess Team:Cambridge/Overview/DesignProcess]<br />
<br />
<html><br />
</div><br />
</div><br />
<br />
<div id='HP' class='splash'><br />
<h8 style='color:#339900;'>Human Practices</h8><br />
<p><h9>THE DRIVING FORCE</h9><br />
<p><h9>Our goal is to standardise the output of biosensors, and to develop a cheap, user-friendly kit to be used in the field</h9><br />
<p><a href="/Team:Cambridge/HumanPractices/Overview"><h9> >>Overview</h9></a><br />
<p><a href="/Team:Cambridge/HumanPractices/MarketResearch"><h9> >>Market Research</h9></a><br />
<p><a href="/Team:Cambridge/HumanPractices/OutreachCollaboration"><h9> >>Outreach & Collaborations</h9></a><br />
<p><a href="/Team:Cambridge/HumanPractices/FutureDirections"><h9> >>Future Directions </h9></a><br />
</div><br />
<br />
<div id='OV' class='splash' style='padding-top: 0px;'><br />
<h8 style='color:#FFFFFF;'>Parts for a Reliable and Field Ready Biosensing Platform</h8><br />
<p><h9>OVERVIEW</h9><br />
<p><h9>There are many biosensors available but there is no standard way to deploy them. Many are also non-quantitative and unpredictable. We have been working on a ratiometric luciferase output which can be read by an Arduino device.<br />
This output could be used with theoretically any biosensor. We investigated the potential of riboswitches as future biosensors. We use a B.subtilis chassis as these form low maintenance spores for easy, long-term storage. </h9><br />
<p><a href="/Team:Cambridge/Overview/Overview"><h9> >>Overview</h9></a><br />
<p><a href="/Team:Cambridge/Overview/DesignProcess"><h9> >>Design Process</h9></a><br />
<p><a href="/Team:Cambridge/Overview/Parts"><h9> >>Parts</h9></a><br />
<p><a href="/Team:Cambridge/Overview/Labbook"><h9> >>Lab book</h9></a><br />
<p><a href="/Team:Cambridge/Overview/Results"><h9> >>Results</h9></a><br />
</div><br />
<br />
<div id='RS' class='splash'><br />
<h8 style='color:#4682B4;'>RiboSense</h8><br />
<p><h9>A NOVEL FLUORIDE SENSOR BASED ON A RIBOSWITCH CONSTRUCT</h9><br />
<p><h9>Riboswitches may well be the biosensor of the future though they are currently under-represented in the registry.</h9><br />
<p><a href='/Team:Cambridge/Ribosense/Overview'><h9> >>Overview</h9></a><br />
<p><a href='/Team:Cambridge/Ribosense/DesignProcess'><h9> >>Design Process</h9></a><br />
<p><a href='/Team:Cambridge/Ribosense/Parts'><h9> >>Parts</h9></a><br />
<p><a href='/Team:Cambridge/Ribosense/Labbook'><h9> >>Lab book</h9></a><br />
<p><a href='/Team:Cambridge/Ribosense/Results'><h9> >>Results</h9></a><br />
</div><br />
<br />
<div id='RM' class='splash'><br />
<h8 style='color:#FF9900;'>Ratiometrica</h8><br />
<p><h9>INVESTIGATING THE POTENTIAL OF RATIOMETRIC REPORTER CONSTRUCTS FOR ACCURATE AND REPRODUCIBLE CHARACTERISATION</h9><br />
<p><h9>We designed fluorescence and luminescence-based constructs that would function in both E.coli and B.subtilis</h9><br />
<p><a href="/Team:Cambridge/Ratiometrica/Overview"><h9> >>Overview</h9></a><br />
<p><a href="/Team:Cambridge/Ratiometrica/DesignProcess"><h9> >>Design Process</h9></a><br />
<p><a href="/Team:Cambridge/Ratiometrica/Parts"><h9> >>Parts</h9></a><br />
<p><a href="/Team:Cambridge/Ratiometrica/Labbook"><h9> >>Lab book</h9></a><br />
<p><a href="/Team:Cambridge/Ratiometrica/Results"><h9> >>Results</h9></a><br />
</div><br />
<br />
<div id='BL' class='splash'><br />
<h8 style='color:#FFFF00;'>Biologger</h8><br />
<p><h9>A CHEAP, ARDUINO-BASED, AUTOMATIC ROTARY RATIOLUMINOMETER</h9><br />
<p><h9>An open-sourced, open-platform approach relaying easily interpretable information to a user that is an accurate representation of the input processed by a biological device.</h9><br />
<p><a href="/Team:Cambridge/Biologger/Overview"><h9> >>Overview</h9></a><br />
<p><a href="/Team:Cambridge/Biologger/DesignProcess"><h9> >>Design Process</h9></a><br />
<p><a href="/Team:Cambridge/Biologger/Parts"><h9> >>Parts</h9></a><br />
<p><a href="/Team:Cambridge/Biologger/Labbook"><h9> >>Lab book</h9></a><br />
<p><a href="/Team:Cambridge/Biologger/Results"><h9> >>Results</h9></a><br />
</div><br />
<br />
<div id='SD' class='splash'><br />
<h8 style='color:#FF0033;'>Sporage & Distribution</h8><br />
<p><h9>B. SUBTILIS: LONG TERM, USER-FRIENDLY STORAGE</h9><br />
<p><h9>We developed and optimised procedures for sporulation and germination.</h9><br />
<p><a href="/Team:Cambridge/SD/Overview"><h9> >>Overview</h9><br />
<p><a href="/Team:Cambridge/SD/DesignProcess"><h9> >>Design Process</h9></a><br />
<p><a href="/Team:Cambridge/SD/Parts"><h9> >>Parts</h9></a><br />
<p><a href="/Team:Cambridge/SD/Labbook"><h9> >>Lab book</h9></a><br />
<p><a href="/Team:Cambridge/SD/Results"><h9> >>Results</h9></a><br />
</div><br />
<br />
</div><br />
<div id='bottom'><br />
<a href= "/Team:Cambridge/Diary/Week_1"><br />
<div id='diary' class='bottom_nav'><br />
</div><br />
</a><br />
<a href= "/Team:Cambridge/Protocols"><br />
<div id='protocols' class='bottom_nav'><br />
</div><br />
</a><br />
<a href= "/Team:Cambridge/Team"><br />
<div id='team' class='bottom_nav'><br />
</div><br />
</a><br />
<a href= "/Team:Cambridge/Sponsors"><br />
<div id='sponsors' class='bottom_nav'><br />
</div><br />
</a><br />
<a href= "/Team:Cambridge/Safety"><br />
<div id='safety' class='bottom_nav'><br />
</div><br />
</a><br />
<a href= "http://www.facebook.com/CambridgeIgem2012" class="cam-external"><br />
<div id='facebook' class='bottom_social'><br />
</div><br />
</a><br />
<a href= "http://www.flickr.com/photos/cambridgeigem2012/" class="cam-external"><br />
<div id='flickr' class='bottom_social'><br />
</div><br />
</a><br />
<a href= "http://twitter.com/cambridgeigem12" class="cam-external"><br />
<div id='twitter' class='bottom_social'><br />
</div><br />
</a><br />
<a href= "http://www.youtube.com/watch?v=lO6ajD0KfVI&feature=youtu.be" class="cam-external"><br />
<div id='youtube' class='bottom_social'><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<br />
<br />
<br />
</div><br />
<br />
<br />
</html></div>Emmyfthttp://2012.igem.org/Team:CambridgeTeam:Cambridge2012-10-27T03:28:23Z<p>Emmyft: </p>
<hr />
<div><html><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<style type ='text/css'><br />
/* Wiki Hacks - START */<br />
/* Author: Pieter van Boheemen */<br />
/* Team: TU Delft */<br />
#globalWrapper { background-color: transparent; border: none; margin: 0; padding: 0; width: 100%; height:100%;}<br />
#content { background-color: transparent; border: none; padding: 0; margin: 0; width: 100%; overflow: scroll; height:100%;}<br />
#bodyContent { border: none; padding:0; margin:0; width:100%; height:100%;}<br />
#top-section { height: 15px; margin: 0px; margin-left: auto; margin-right: auto; margin-bottom: 0 !important;<br />
padding:0; border: none; font-size: 10px;}<br />
#p-logo { height:1px; overflow:scroll; display: none;}<br />
#search-controls { overflow:hidden; display:block; background: none; position: absolute; top: 100px; right: 40px;}<br />
#footer-box { width: 100%; margin: -10px auto 0 auto; padding: 20px 0;}<br />
.visualClear { display: none; }<br />
#footer { border: none; width: 965px; margin: 0 auto; padding: 0;}<br />
.firstHeading { display: none;}<br />
#f-list a { color: #333; font-size: 10px;}<br />
#f-list a:hover { color: #666;}<br />
.printfooter { display: none; }<br />
#footer ul { margin: 0; padding: 0;}<br />
#footer ul li { margin-top: 0; margin-bottom: 0; margin-left: 10px; margin-right: 10px; padding: 0;}<br />
#search-controls { display:none; }<br />
h3#siteSub { display: none;}<br />
#contentSub {display: none;}<br />
p:first-child { display: none;}<br />
/* Wiki Hacks - END */<br />
</style><br />
<br />
<link rel='stylesheet' type='text/css' href='/Team:Cambridge/static/wiki_splash.css?action=raw&ctype=text/css'/> <br />
<br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
<br />
$('.splash_over').css("display","none");<br />
<br />
$('#HP').mouseover(function() {<br />
$('#HP').css("background", "url('https://static.igem.org/mediawiki/2012/c/ce/CAMV2_HP.jpg') no-repeat");<br />
$('#HP h8').css("background-color","white");<br />
$('#HP h9').css("background-color","white");<br />
$('#HP h9').css("color","black");<br />
});<br />
<br />
$('#HP').mouseleave(function() {<br />
$('#HP').css("background-image", "none");<br />
$('#HP h8').css("background-color","black");<br />
$('#HP h9').css("background-color","black");<br />
$('#HP h9').css("color","white");<br />
});<br />
<br />
$('#OV').mouseover(function() {<br />
$('#OV').css("background", "white no-repeat");<br />
$('#OV h8').css("background-color","white");<br />
$('#OV h8').css("color","black");<br />
$('#OV h9').css("background-color","white");<br />
$('#OV h9').css("color","black");<br />
});<br />
<br />
$('#OV').mouseleave(function() {<br />
$('#OV').css("background", "none");<br />
$('#OV h8').css("background-color","black");<br />
$('#OV h8').css("color","white");<br />
$('#OV h9').css("background-color","black");<br />
$('#OV h9').css("color","white");<br />
});<br />
<br />
$('#RS').mouseover(function() {<br />
$('#RS').css("background", "url('https://static.igem.org/mediawiki/2012/9/9e/CAMV2_RS.jpg') no-repeat");<br />
$('#RS h8').css("background-color","white");<br />
$('#RS h9').css("background-color","white");<br />
$('#RS h9').css("color","black");<br />
});<br />
<br />
$('#RS').mouseleave(function() {<br />
$('#RS').css("background-image", "none");<br />
$('#RS h8').css("background-color","black");<br />
$('#RS h9').css("background-color","black");<br />
$('#RS h9').css("color","white");<br />
});<br />
<br />
$('#RM').mouseover(function() {<br />
$('#RM').css("background", "url('https://static.igem.org/mediawiki/2012/2/23/CAMV2_RM.JPG') no-repeat");<br />
$('#RM h8').css("background-color","white");<br />
$('#RM h9').css("background-color","white");<br />
$('#RM h9').css("color","black");<br />
});<br />
<br />
$('#RM').mouseleave(function() {<br />
$('#RM').css("background-image", "none");<br />
$('#RM h8').css("background-color","black");<br />
$('#RM h9').css("background-color","black");<br />
$('#RM h9').css("color","white");<br />
});<br />
<br />
$('#BL').mouseover(function() {<br />
$('#BL').css("background", "url('https://static.igem.org/mediawiki/2012/e/e1/CAMV2_BL.jpg') no-repeat");<br />
$('#BL h8').css("background-color","white");<br />
$('#BL h9').css("background-color","white");<br />
$('#BL h9').css("color","black");<br />
});<br />
<br />
$('#BL').mouseleave(function() {<br />
$('#BL').css("background-image", "none");<br />
$('#BL h8').css("background-color","black");<br />
$('#BL h9').css("background-color","black");<br />
$('#BL h9').css("color","white");<br />
});<br />
<br />
$('#SD').mouseover(function() {<br />
$('#SD').css("background", "url('https://static.igem.org/mediawiki/2012/8/88/CAMV2_SD.jpg') no-repeat");<br />
$('#SD h8').css("background-color","white");<br />
$('#SD h9').css("background-color","white");<br />
$('#SD h9').css("color","black");<br />
});<br />
<br />
$('#SD').mouseleave(function() {<br />
$('#SD').css("background-image", "none");<br />
$('#SD h8').css("background-color","black");<br />
$('#SD h9').css("background-color","black");<br />
$('#SD h9').css("color","white");<br />
});<br />
<br />
<br />
$('#abstract').css("display","none");<br />
<br />
$('#abstract_button').click(function() {<br />
$('#abstract').fadeIn(100);<br />
});<br />
<br />
$('#abstractclose').click(function() {<br />
$('#abstract').fadeOut(100);<br />
});<br />
<br />
$('#judgingform').css("display","none");<br />
<br />
$('#judging_button').click(function() {<br />
$('#judgingform').fadeIn(100);<br />
});<br />
<br />
$('#judgingclose').click(function() {<br />
$('#judgingform').fadeOut(100);<br />
});<br />
<br />
<br />
});<br />
<br />
</script><br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<div id='cam_page'><br />
<br />
<div id='wrapper'><br />
<div id='top'><br />
<div id='abstract_button'><br />
</div><br />
<div id='judging_button'><br />
</div><br />
</div><br />
<div id='main'><br />
<br />
<div id='abstract' style='padding:10px;'><br />
<h8 style="color:black; background-color:white;">Parts for a reliable and field ready biosensing platform</h8><br />
<p><h9 style="color:black; background-color:white;">Implementation of biosensors in real world situations has been made difficult by the unpredictable and non-quantified outputs of existing solutions, as well as a lack of appropriate storage, distribution and utilization systems. This leaves a large gap between a simple, functional sensing mechanism and a fully realised product that can be used in the field. We aim to bridge this gap at all points by developing a standardised ratiometric luciferase output in a Bacillus chassis. This output can be linked up with prototyped instrumentation and software for obtaining reliable quantified results. Additionally, we have reduced the specialized requirements for the storage and distribution of our bacteria by using Bacillus' sporulation system. To improve the performance of our biosensing platform we have genetically modified Bacillus’ germination speed. Lastly, we demonstrated the robustness of our system by testing it with a new fluoride riboswitch, providing the opportunity to tackle real life problems.<br />
<p><a href = "http://prezi.com/tganfyuhurpi/igem-splash/> <h9 style="color:black; background-color:white;">One minute tour! :) </h9></a><br />
<div id='abstractclose' style='position: absolute; top: 300px; left: 10px;'> <h9 style="color:black; background-color:white;"> >> Return to page </h9></div><br />
</div><br />
<br />
<div id='judgingform' style='padding:10px;'><br />
<br />
<div id='judgingclose'> <h9 style="color:black; background-color:white;"> >> Return to page </h9></div><br />
<br />
<div id='judgingtext'><br />
</html><br />
<br />
<br />
=Judging Form=<br />
<br />
*Please help the judges by filling out this form. Tell them what medal you think you deserve and why. Tell them which special prizes you should win. Help them find your best parts. Show them how you thought about the safety of your project. Helping the judges will help you too.<br />
<br />
----<br />
<br />
*Team: Cambridge<br />
*Region: Europe<br />
*iGEM Year:2012<br />
*Track:Foundational Advance<br />
*Project Name:Parts for a reliable and field ready biosensing platform<br />
*Project Abstract: Implementation of biosensors in real world situations has been made difficult by the unpredictable and non-quantified outputs of existing solutions, as well as a lack of appropriate storage, distribution and utilization systems. This leaves a large gap between a simple, functional sensing mechanism and a fully realised product that can be used in the field.<br /><br /> We aim to bridge this gap at all points by developing a standardised ratiometric luciferase output in a Bacillus chassis. This output can be linked up with prototyped instrumentation and software for obtaining reliable quantified results. Additionally, we have reduced the specialized requirements for the storage and distribution of our bacteria by using Bacillus' sporulation system. To improve the performance of our biosensing platform we have genetically modified Bacillus’ germination speed. Lastly, we demonstrated the robustness of our system by testing it with a new fluoride riboswitch, providing the opportunity to tackle real life problems. <br />
<br />
[https://2012.igem.org/Team:Cambridge Back to wiki]<br />
<br />
<br />
== iGEM Medals for non-software teams==<br />
<br />
*We believe our team deserves the following medal:<br />
** Bronze<br />
** Silver<br />
** &radic;Gold<br />
Because we met the following criteria (check all that apply and provide details where needed)<br />
<br />
===Requirements for a Bronze Medal===<br />
*&radic;Register the team, have a great summer, and plan to have fun at the Regional Jamboree.<br />
*&radic;Successfully complete and submit this iGEM 2012 Judging form.<br />
*&radic;Create and share a Description of the team's project using the iGEM wiki and the team's parts using the Registry of Standard Biological Parts.<br />
*&radic;Plan to present a Poster and Talk at the iGEM Jamboree.<br />
*&radic;Enter information detailing at least one new standard BioBrick Part or Device in the Registry of Standard Biological Parts. Including:<br />
**&radic;Primary nucleaic acid sequence<br />
**&radic;Description of function<br />
**&radic;Authorship<br />
**Safety notes, if relevant.<br />
**&radic;Acknowedgment of sources and references<br />
*&radic;Submit DNA for at least one new BioBrick Part or Device to the Registry.<br />
<br />
===Additional Requirements for a Silver Medal===<br />
*&radic;Demonstrate that at least one new BioBrick Part or Device of your own design and construction works as expected; characterize the operation of your new part/device.<br />
*&radic;Enter this information and other documentation on the part's 'Main Page' section of the Registry <br />Part Number(s): [http://partsregistry.org/Part:BBa_K911004 BBa_K911004]<br />
<br />
===Additional Requirements for a Gold Medal: (one OR more)===<br />
*Improve an existing BioBrick Part or Device and enter this information back on the Experience Page of the Registry.<br />Part Number(s): None<br />
*&radic;Help another iGEM team by, for example, characterizing a part, debugging a construct, or modeling or simulating their system.<br />Link to this information on your wiki. Page name: [https://2012.igem.org/Team:Cambridge/Outreach/Collaboration Team:Cambridge/Outreach/Collaboration]<br />
*&radic;Outline and detail a new approach to an issue of Human Practice in synthetic biology as it relates to your project, such as safety, security, ethics, or ownership, sharing, and innovation.<br />Link to this information on your wiki. <br />Page name: [https://2012.igem.org/Team:Cambridge/HumanPractices/Overview Team:Cambridge/HumanPractices/Overview],[https://2012.igem.org/Team:Cambridge/HumanPractices/MarketResearch Team:Cambridge/HumanPractices/MarketResearch],[https://2012.igem.org/Team:Cambridge/HumanPractices/FutureDirections Team:Cambridge/HumanPractices/FutureDirections]<br />
<br />
[https://2012.igem.org/Team:Cambridge Back to wiki]<br />
<br />
==iGEM Prizes==<br />
All teams are eligible for special prizes at the Jamborees. [https://2012.igem.org/Judging' more...] To help the judges, please indicate if you feel you should be evaluated for any of the following special prizes:<br />
*&radic;Best Human Practice Advance<br />
*&radic;Best Experimental Measurement<br />
*Best Model<br />
<br />
===Please explain briefly why you should receive any of these special prizes:===<br />
<br />
'''Best Human Practice Advance:'''<br />
<br />
We feel that we deserve this prize for three reasons: <br />
# We explored the impacts, *both positive and negative*, of synthetic biology as a solution to real world problems, through interviewing professionals working in a relevant field, namely the impact of arsenic water contamination in Bangladesh. <br />
# We recognized existing problems with the way the current direction of synthetic. On going through the registry we found that most of the characterization data for biosensing parts is often neither comparable nor replicable. We have worked to solve this issue, for example with our ratiometric dual channel output. <br />
# *Our project doesn’t stop here*, in Chanel number 6 ([https://2012.igem.org/Team:Cambridge/HumanPractices/FutureDirections Team:Cambridge/HumanPractices/FutureDirections]) we considered the future implications and technological applications of our project, as well as the means by which it could be improved by subsequent users. We feel that the end to an iGEM project should not be the conclusion of an idea, but the start of it.<br />
<br />
'''Best BioBrick Measurement Approach:'''<br />
<br />
It is absolutely vital that a quantitative, numerical, robust, and flexible measurement approach exists to relay information to a user that is an accurate representation of the input processed by a biological device. Working from these principles, the following was done:<br />
# We designed and built Biologger, a *cheap, arduino-based, fully functional automatic rotary device* that has an incorporated ratiolumnometer<br />
# Our project is entirely open-sourced and open-platform. We have published source code for the two applications which serve to operate the device, one for PCs and the other for Android devices, as well as the open source circuit design that provides this ratiometric reading. Furthermore, the Android app is able to receive its data wirelessly, which we feel is a great advance in BioBrick measurement. <br />
# Our dual-channel luciferase reporter was successfully tested with a dilution series of E.coli transformed with the Lux Operon (under pBAD) biobrick (Part BBa_K325909) of the Cambridge iGEM 2010 team. It can detect, with good accuracy, both different light intensities, as well as the percentages of blue or orange frequencies in a sample. <br />
# Our device was successfully tested using artificial light to detect different frequencies (colours) as well.<br />
Having done all the above, we believe that this fully open-sourced instrumentation kit (mechanical) chassis, electronics, software code), estimated at *$35.00* (or $85.00 if a Bluetooth modem is required), is a complete BioBrick measurement solution for any and all BioBricks with a light output.<br />
<br />
[https://2012.igem.org/Team:Cambridge Back to wiki]<br />
<br />
==Team_Parts==<br />
To help the judges evaluate your parts, please identify 3 of your parts that you feel are best documented and are of the highest quality. <br />
*;Best new BioBrick part (natural): [http://partsregistry.org/Part:BBa_K911003 BBa_K911003]<br />
*;Best new BioBrick part (engineered): [http://partsregistry.org/Part:BBa_K911004 BBa_K911004]<br />
*Best improved part(s): None<br />
<br />
List any other parts you would like the judges to examine:[http://partsregistry.org/Part:BBa_K911001 BBa_K911001], [http://partsregistry.org/Part:BBa_K911008 BBa_K911009], [http://partsregistry.org/Part:BBa_K911008 BBa_K911008]<br />
<br />
Please explain briefly why the judges should examine these other parts:<br />
* '''Magnesium Sensitive Riboswitch [http://partsregistry.org/Part:BBa_K911001 BBa_K911001]'''<br />As a riboswitch sensing construct, this part is an entirely new type of biosensor (along with the fluoride construct) that could potentially change the way we think about designing input genetic circuits. Unlike the fluoride riboswitch, it is a derepression system and therefore serves to demonstrate the principle that riboswitches can be used regardless of whether they turn on or off their reporter.<br />
* '''Fluorescent ratiometric construct for standardizing promoter output [http://partsregistry.org/Part:BBa_K911009 BBa_K911009]''' <br />Fluorescence is a major cornerstone for biosensors in the registry, however, most parts do not involve the use of a ratiometric output, which has been shown in the literature to provide much more reliable and meaningful data. This part not only furthers the development of ratiometric measurements in molecular biology but due to the choice of promoters and terminators it can be used to characterize the difference in activity between E. coli and B. Subtilis<br />
* '''Fast Germination (B. subtilis) [http://partsregistry.org/Part:BBa_K911008 BBa_K911008]'''<br />This part is entirely novel for the registry and fully utilizes the recombination machinery inherent in the Bacillus chassis. Have spores that can germinate at a faster rate is certainly a worthy achievement and could help with experiments with B. Subtilis that any future iGEM teams may wish to perform.<br />
<br />
[https://2012.igem.org/Team:Cambridge Back to wiki]<br />
<br />
==iGEM Safety==<br />
For iGEM 2012 teams are asked to detail how they approached any issues of biological safety associated with their projects.<br />
<br />
The iGEM judges expect that you have answered the four safety questions [https://2012.igem.org/Safety Safety page] on your iGEM 2012 wiki.<br />
<br />
Please provide the link to that page:<br />
Page name: [https://2012.igem.org/Team:Cambridge/Safety Team:Cambridge/Safety]<br />
<br />
==Attribution and Contributions==<br />
For iGEM 2012 the description of each project must clearly attribute work done by the team and distinguish it from work done by others, including the host labs, advisors, and instructors.<br />
<br />
Please provide the link to that page, or comments in the box below:<br />
Page name: [https://2012.igem.org/Team:Cambridge/Attributions Team:Cambridge/Attributions]<br />
<br />
==Comments==<br />
If there is any other information about your project you would like to highlight for the judges, please provide a link to your wiki page here: [https://2012.igem.org/Team:Cambridge/Overview/DesignProcess Team:Cambridge/Overview/DesignProcess]<br />
<br />
<html><br />
</div><br />
</div><br />
<br />
<div id='HP' class='splash'><br />
<h8 style='color:#339900;'>Human Practices</h8><br />
<p><h9>THE DRIVING FORCE</h9><br />
<p><h9>Our goal is to standardise the output of biosensors, and to develop a cheap, user-friendly kit to be used in the field</h9><br />
<p><a href="/Team:Cambridge/HumanPractices/Overview"><h9> >>Overview</h9></a><br />
<p><a href="/Team:Cambridge/HumanPractices/MarketResearch"><h9> >>Market Research</h9></a><br />
<p><a href="/Team:Cambridge/HumanPractices/OutreachCollaboration"><h9> >>Outreach & Collaborations</h9></a><br />
<p><a href="/Team:Cambridge/HumanPractices/FutureDirections"><h9> >>Future Directions </h9></a><br />
</div><br />
<br />
<div id='OV' class='splash' style='padding-top: 0px;'><br />
<h8 style='color:#FFFFFF;'>Parts for a Reliable and Field Ready Biosensing Platform</h8><br />
<p><h9>OVERVIEW</h9><br />
<p><h9>There are many biosensors available but there is no standard way to deploy them. Many are also non-quantitative and unpredictable. We have been working on a ratiometric luciferase output which can be read by an Arduino device.<br />
This output could be used with theoretically any biosensor. We investigated the potential of riboswitches as future biosensors. We use a B.subtilis chassis as these form low maintenance spores for easy, long-term storage. </h9><br />
<p><a href="/Team:Cambridge/Overview/Overview"><h9> >>Overview</h9></a><br />
<p><a href="/Team:Cambridge/Overview/DesignProcess"><h9> >>Design Process</h9></a><br />
<p><a href="/Team:Cambridge/Overview/Parts"><h9> >>Parts</h9></a><br />
<p><a href="/Team:Cambridge/Overview/Labbook"><h9> >>Lab book</h9></a><br />
<p><a href="/Team:Cambridge/Overview/Results"><h9> >>Results</h9></a><br />
</div><br />
<br />
<div id='RS' class='splash'><br />
<h8 style='color:#4682B4;'>RiboSense</h8><br />
<p><h9>A NOVEL FLUORIDE SENSOR BASED ON A RIBOSWITCH CONSTRUCT</h9><br />
<p><h9>Riboswitches may well be the biosensor of the future though they are currently under-represented in the registry.</h9><br />
<p><a href='/Team:Cambridge/Ribosense/Overview'><h9> >>Overview</h9></a><br />
<p><a href='/Team:Cambridge/Ribosense/DesignProcess'><h9> >>Design Process</h9></a><br />
<p><a href='/Team:Cambridge/Ribosense/Parts'><h9> >>Parts</h9></a><br />
<p><a href='/Team:Cambridge/Ribosense/Labbook'><h9> >>Lab book</h9></a><br />
<p><a href='/Team:Cambridge/Ribosense/Results'><h9> >>Results</h9></a><br />
</div><br />
<br />
<div id='RM' class='splash'><br />
<h8 style='color:#FF9900;'>Ratiometrica</h8><br />
<p><h9>INVESTIGATING THE POTENTIAL OF RATIOMETRIC REPORTER CONSTRUCTS FOR ACCURATE AND REPRODUCIBLE CHARACTERISATION</h9><br />
<p><h9>We designed fluorescence and luminescence-based constructs that would function in both E.coli and B.subtilis</h9><br />
<p><a href="/Team:Cambridge/Ratiometrica/Overview"><h9> >>Overview</h9></a><br />
<p><a href="/Team:Cambridge/Ratiometrica/DesignProcess"><h9> >>Design Process</h9></a><br />
<p><a href="/Team:Cambridge/Ratiometrica/Parts"><h9> >>Parts</h9></a><br />
<p><a href="/Team:Cambridge/Ratiometrica/Labbook"><h9> >>Lab book</h9></a><br />
<p><a href="/Team:Cambridge/Ratiometrica/Results"><h9> >>Results</h9></a><br />
</div><br />
<br />
<div id='BL' class='splash'><br />
<h8 style='color:#FFFF00;'>Biologger</h8><br />
<p><h9>A CHEAP, ARDUINO-BASED, AUTOMATIC ROTARY RATIOLUMINOMETER</h9><br />
<p><h9>An open-sourced, open-platform approach relaying easily interpretable information to a user that is an accurate representation of the input processed by a biological device.</h9><br />
<p><a href="/Team:Cambridge/Biologger/Overview"><h9> >>Overview</h9></a><br />
<p><a href="/Team:Cambridge/Biologger/DesignProcess"><h9> >>Design Process</h9></a><br />
<p><a href="/Team:Cambridge/Biologger/Parts"><h9> >>Parts</h9></a><br />
<p><a href="/Team:Cambridge/Biologger/Labbook"><h9> >>Lab book</h9></a><br />
<p><a href="/Team:Cambridge/Biologger/Results"><h9> >>Results</h9></a><br />
</div><br />
<br />
<div id='SD' class='splash'><br />
<h8 style='color:#FF0033;'>Sporage & Distribution</h8><br />
<p><h9>B. SUBTILIS: LONG TERM, USER-FRIENDLY STORAGE</h9><br />
<p><h9>We developed and optimised procedures for sporulation and germination.</h9><br />
<p><a href="/Team:Cambridge/SD/Overview"><h9> >>Overview</h9><br />
<p><a href="/Team:Cambridge/SD/DesignProcess"><h9> >>Design Process</h9></a><br />
<p><a href="/Team:Cambridge/SD/Parts"><h9> >>Parts</h9></a><br />
<p><a href="/Team:Cambridge/SD/Labbook"><h9> >>Lab book</h9></a><br />
<p><a href="/Team:Cambridge/SD/Results"><h9> >>Results</h9></a><br />
</div><br />
<br />
</div><br />
<div id='bottom'><br />
<a href= "/Team:Cambridge/Diary/Week_1"><br />
<div id='diary' class='bottom_nav'><br />
</div><br />
</a><br />
<a href= "/Team:Cambridge/Protocols"><br />
<div id='protocols' class='bottom_nav'><br />
</div><br />
</a><br />
<a href= "/Team:Cambridge/Team"><br />
<div id='team' class='bottom_nav'><br />
</div><br />
</a><br />
<a href= "/Team:Cambridge/Sponsors"><br />
<div id='sponsors' class='bottom_nav'><br />
</div><br />
</a><br />
<a href= "/Team:Cambridge/Safety"><br />
<div id='safety' class='bottom_nav'><br />
</div><br />
</a><br />
<a href= "http://www.facebook.com/CambridgeIgem2012" class="cam-external"><br />
<div id='facebook' class='bottom_social'><br />
</div><br />
</a><br />
<a href= "http://www.flickr.com/photos/cambridgeigem2012/" class="cam-external"><br />
<div id='flickr' class='bottom_social'><br />
</div><br />
</a><br />
<a href= "http://twitter.com/cambridgeigem12" class="cam-external"><br />
<div id='twitter' class='bottom_social'><br />
</div><br />
</a><br />
<a href= "http://www.youtube.com/watch?v=lO6ajD0KfVI&feature=youtu.be" class="cam-external"><br />
<div id='youtube' class='bottom_social'><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<br />
<br />
<br />
</div><br />
<br />
<br />
</html></div>Emmyfthttp://2012.igem.org/Team:Cambridge/AttributionsTeam:Cambridge/Attributions2012-10-27T03:23:29Z<p>Emmyft: /* Wiki */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
//down<br />
if (keyCode == 38)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/OfficialTeamProfile");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/Team"><br />
<div id="vert_TeamMembers" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/OfficialTeamProfile"><br />
<div id="vert_OfficialTeam" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Attributions"><br />
<div id="vert_Attributions_on" class="vert_nav"><br />
</div><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<html><br />
<br />
</html><br />
<br />
=='''Attributions'''==<br />
<br />
<br />
Please see below for the attributions of work carried out as part of our project.<br />
<br />
===Sporage and Distribution===<br />
<br />
The fast promoter swap over strains we used in sporage and distribution were developed based on work by Peter Setlow from the Setlow lab at the University of Connecticut (see references in the project section). Furthermore Barbara and Peter Setlow sent us the two E. coli plasmids used for transformation of B. Subtilis as well as the finalised spores we used in testing the construct. They also provided us with information on sporulation and germination protocols and help with designing primers for biobricking the part.<br />
<br />
Paul Mallaband and Stuart Bell from the team made up sporulation and germination medium and carried out imaging of the spores. They also carried out all relevant pcr, gibson and restriction ligation reactions to make a biobrick of the part.<br />
<br />
Paul Grant from the Haseloff lab was instrumental in helping with imaging spores and gave advice on staining, slide preparation and microscopy.<br />
<br />
===Instrumentation===<br />
<br />
Andreas Petrides from the team led the development of the instrumentation kit along with Paul Mallaband. Electronics and Arduino code was tackled by Andreas, python code by Paul whilst both took part in the mechanical design and sourcing of materials. The testing of the instrumentation was done by Andreas with the aid of Thomas Whittaker who prepared the biological samples.<br />
<br />
The python code was based on that submitted at http://www.blendedtechnologies.com/realtime-plot-of-arduino-serial-data-using-python/231. All arduino code was developed by Andreas and Paul. The android application was implemented by Andreas, based on [http://www.amarino-toolkit.net/index.php/home.html<u><span style="color:#000066">Amarino</span></u>]<br />
projects' open-source code (General Public License). <br />
<br />
Mr. Tim Love from the engineering department gave advice on software design and the Engineering department helped with supplying some of the materials required. The actual assembly of the kit was done entirely by Andreas and Paul.<br />
<br />
===Ribosense===<br />
The fluoride riboswitch, with &beta;-galactosidase reporter, was generously supplied, both in plasmid form, and as transformed cells, by the Breaker laboratory (See references in the project page as well as the special thanks page) at the University of Yale.<br />
<br />
The plasmid supplied was then transformed into 168 strain ''B. subtilis'', and Top10 ''E. coli'', by Jolyon Martin from the team. He also carried out the &beta;-galactosidase and Miller Assays.<br />
<br />
The magnesium riboswitch was amplified up, using primers of our own design, from a prepared ''B. subtilis'' genome sample. This sample was provided by PJ Steiner of the Haseloff lab. Oliver Meacock, from the team, then pieced this amplified DNA into pJS130, a shuttle vector also provided by PJ Steiner. Oliver Meacock also carried out the characterisation assay for the magnesium riboswitch.<br />
<br />
All relevant primers for each riboswitch were designed by Jolyon Martin and Oliver Meacock in parallel. All PCR reactions, restriction digests, and other experiments using these parts were carried our by the pair.<br />
<br />
===Ratiometrica===<br />
<br />
James Brown from the Haseloff Lab, Cambridge has offered us invaluable advice in collecting and analysing data from our ratiometric fluorescent construct.<br />
<br />
PJ Steiner from the Haseloff Lab has provided the original E. coli and B. subtilis shuttle vector pJS130 on which we worked.<br />
<br />
Paul Mallaband, Emmy Tsang and Thomas Whittaker from the team designed and assembled the final ratiometric fluorescent construct using PCR and Gibson assembly. The component biobricks (other than the backbone) came from the Registry's Spring Distribution Kit. We designed the original primers for Gibson and ligation, optimised the PCR, gel and PCR extraction, and Gibson assembly protocols, and tested the construct.<br />
<br />
Fernan Federici from the Haseloff Lab provided the original mOrange DNA template, while the fischeri LuxBrick (K325909) is from the Parts Registry. Tom and Emmy from the team have assembled the construct using Gibson assembly and PCR.<br />
<br />
Tom from the team has designed the harveii Lux-mOrange2 construct, which was then synthesised and codon optimised by DNA 2.0. <br />
<br />
===Wiki===<br />
<br />
The javascript and css style sheets used in this wiki are based on those made by Haydn King from the Cambridge 2011 team.<br />
<br />
Emmy from the team designed the graphics while Paul and Andreas tweaked the javascripts and css. <br />
<br />
Background image for Human Practices on Homepage from here: http://www.flickr.com/photos/foshydog/3590414135/ (under the CCC-BY 2.0 license)<br />
<br />
Social media icons from "Infocus Simple White Sidebar Social Media Icons": http://webtreats.mysitemyway.com/1540-infocus-simple-white-sidebar-social-media-icons/<br />
<br />
Interface and graphics are designed using Adobe CS5 Photoshop, Illustrator and Dreamweaver. Some of the PS brushes used in both V1.0 and V2.0 of the wiki: <br />
*http://www.brusheezy.com/brushes/27476-dbd---swooshpack-lite<br />
*http://differentxdreamz.deviantart.com/art/Delicate-Praise-Brushes-134841016<br />
*http://www.brusheezy.com/brushes/18307-pretty-designs<br />
<br />
===Human Practices===<br />
<br />
Charlotte Bransfield-Garth from the team corresponded with international NGOs, conducting market research and reporting on the real world situation.<br />
<br />
Oli from the team interviewed Dr. Konrad Siegfried, a member of the ARSOlux team testing for water contamination in Bangladesh, and also explored the future directions of the our project.<br />
<br />
<html><br />
</div><br />
</html><br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Emmyfthttp://2012.igem.org/Team:Cambridge/Overview/ResultsTeam:Cambridge/Overview/Results2012-10-27T03:19:13Z<p>Emmyft: /* Overview of Results */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/HumanPractices/FutureDirections");<br />
}<br />
<br />
//down<br />
if (keyCode == 40)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Results");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Labbook");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/FutureDirections"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="vert_OV_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Results"><br />
<div id="vert_RS" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Results"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Results"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Results"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= Overview of Results =<br />
<br />
Here's a summary of our results within 12 weeks (plus 3 weeks after the Regional Jamboree):<br />
* Designed a total of 6 biobricks<br />
* Constructed and assembled 5 biobricks using PCR and Gibson Assembly (only the ratiometric luciferase biobrick is synthesized)<br />
* 5 of the 6 they have been put into standard backbone, sequenced and sent to the registry<br />
* 5 of the 6 are optimised to work in both E. coli and B. subtilis; the remaining one is a fast germination biobrick for B. subtilis<br />
* Attempted to characterise all 6 biobricks as fully as possible<br />
* created an open-source, open-platform arduino-based device to measure ratiometric luciferase output; the design won best experimental measurement approach at the European Jamboree<br />
<br />
Press the down arrow key to see the details of our results and characterisation data.<br />
<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Overview/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="hor_labbook" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="hor_results_on" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Emmyfthttp://2012.igem.org/Team:Cambridge/Biologger/LabbookTeam:Cambridge/Biologger/Labbook2012-10-27T03:10:33Z<p>Emmyft: </p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Labbook");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/SD/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Biologger/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Biologger/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= Biologger Labbook =<br />
<br />
==Week 3==<br />
<br />
===Wednesday (11/07/12)===<br />
<br />
'''Arduino circuitry'''<br />
<br />
----<br />
<br />
*Real-Time image captured by our freshly made primitive software, monitoring a light sensor on an arduino board. C++ was used to communicate with the Arduino and Python was used for data logging.<br />
<br />
===Friday (13/07/12)===<br />
<br />
'''Testing of the spectral properties of filters'''<br />
<br />
----<br />
<br />
*Blue , Green and Red filters were tested in different wavelengths (400 nm - 600 nm) in a spectrophotometer.<br />
<br />
*Excellent absorbance/emmitance results given by the blue and red filters near 580nm and 490nm respectively. 580nm is the wavelength where intensity of light is to be measured to identify the presence of mOrange. 490nm is the wavelength where maximum light intensity is expected with or without the presence of mOrange.<br />
<br />
[[File:MOrange_expected_graphs.jpg|250px|The expected output spectrum of our MOrange/luciferase fusion|thumb|left]]<br />
[[File:Filter_spectrum.png|250px|The spectral properties of our filters. The different colours represent the different colours of filter.|thumb|left]]<br />
<br />
==Week 4==<br />
<br />
===Friday (20/07/12)===<br />
<br />
'''Ratiometrica-Lux: Transformation of e.coli with lux genes from 2010'''<br />
<br />
----<br />
<br />
*Arabinose induction: Using the same 3mM arabinose prepared earlier in the week, the E. coli were spun down and the arabinose was added. After 5 hours, light is observed.<br />
*Testing the Arduino kit: the testing took place in the dark room, and the cell culture (in 1.5mL Eppendorf tubes) was held close to the photosensor and then taken away repeatedly. The data recorded was plotted with Matlab, as shown:<br />
[[File:CAM_Sensor_darkroom_glowingbacteria.jpg|thumb|700px|Light level against time]]<br />
<br />
*It should be noted that the background light levels were falling linearly, possibly due to negative feedback on the photosensor, but there is a consistent 5-6% increase of the original base reading upon placing the cells close the the photosensor.<br />
<br />
==Week 5==<br />
<br />
===Thursday (26/07/12)===<br />
<br />
'''Instrumentation: Hardware implementation'''<br />
<br />
----<br />
<br />
[[File:deviceprototype.jpg|thumb|500px|Our device, reaching perfection!]]<br />
<br />
<br />
<br />
Our device is close to being implemented. The filtered photoresistors are placed now in the right position, the motory circuit is also functioning, the main chassis of the device is constructed and painted. However, the mirrors which will be used to surround the cuvettes are still missing and so is the mechanical coupler designed by us and being constructed at the Instrument shop of the Engineering Department. The device is also powered by a 9V battery, without the need to be connected to the computer.<br />
<br />
==Week 14==<br />
<br />
===Monday (24/09/12)===<br />
'''Instrumentation'''<br />
<br />
The sensitivity of the sensor concerning light intensities was tested using a dilution series of luciferase-producing bacteria. 20ml Cultures were grown overnight from single colonies. The cultures were induced with 40ul of 1.5M arabinose (for a final concentration of 3mM). Cultures were left for 2 1/2 hours for full induction. Subsequently, a culture was pelleted and resuspended in 4ml LB. Doubling dilutions, of volume 2ml, were made from this concentrate, down to 1/8th concentration.<br />
1ml of each 2ml dilution was analysed in each cuvette, which was placed in the cuvette holder we made ourselves. <br />
<br />
[[File:Dilutiontest.jpg|thumb|400px|Raw sensor values(V) vs Concentration of bioluminescent E.coli- Concentrations on the x-axis are relative therefore an OD 600 value was also taken|center]]<br />
<br />
[[File:Norm_light.png|thumb|400px|Normalised sensor data using a dilution series of bioluminescent E.coli- Concentrations on the x-axis are relative therefore an OD 600 value was also taken|center]]<br />
<br />
[[File:Norm_blue.jpg|thumb|400px|Normalised percentage of blue frequencies using the same dilution series of E.coli|center]]<br />
<br />
[[File:Dilution_series.jpg|thumb|400px|Dilution series of E.coli from most concentrated to least|center]]<br />
<br />
===Tuesday (25/09/12)===<br />
<br />
'''Instrumentation'''<br />
<br />
The sensitivity of the sensor concerning different frequencies (colours) of light was tested as well. As can be seen below, measurements taken from orange and blue light yield values respectively above and below those from white light (our reference point). The data was taken using a constant intensity of light for each case (V.High and V.Low brightness). This was done with the aid of an Android phone and a specialised software application, called Color Flashlight, downloaded from the official Market. <br />
[[File:Sensor_colour.jpg|400px|Sensor data for different colours at different intensities|thumb|center]]<br />
<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Biologger/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Biologger/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Emmyfthttp://2012.igem.org/Team:Cambridge/Biologger/LabbookTeam:Cambridge/Biologger/Labbook2012-10-27T03:09:42Z<p>Emmyft: Created page with "{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}} <html> <script type="text/javascript"> $(document).keydown(function(e){ //e.which is set by jQuery for those browsers t..."</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Overview");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/SD/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Biologger/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Biologger/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= Biologger Labbook =<br />
<br />
==Week 3==<br />
<br />
===Wednesday (11/07/12)===<br />
<br />
'''Arduino circuitry'''<br />
<br />
----<br />
<br />
*Real-Time image captured by our freshly made primitive software, monitoring a light sensor on an arduino board. C++ was used to communicate with the Arduino and Python was used for data logging.<br />
<br />
===Friday (13/07/12)===<br />
<br />
'''Testing of the spectral properties of filters'''<br />
<br />
----<br />
<br />
*Blue , Green and Red filters were tested in different wavelengths (400 nm - 600 nm) in a spectrophotometer.<br />
<br />
*Excellent absorbance/emmitance results given by the blue and red filters near 580nm and 490nm respectively. 580nm is the wavelength where intensity of light is to be measured to identify the presence of mOrange. 490nm is the wavelength where maximum light intensity is expected with or without the presence of mOrange.<br />
<br />
[[File:MOrange_expected_graphs.jpg|250px|The expected output spectrum of our MOrange/luciferase fusion|thumb|left]]<br />
[[File:Filter_spectrum.png|250px|The spectral properties of our filters. The different colours represent the different colours of filter.|thumb|left]]<br />
<br />
==Week 4==<br />
<br />
===Friday (20/07/12)===<br />
<br />
'''Ratiometrica-Lux: Transformation of e.coli with lux genes from 2010'''<br />
<br />
----<br />
<br />
*Arabinose induction: Using the same 3mM arabinose prepared earlier in the week, the E. coli were spun down and the arabinose was added. After 5 hours, light is observed.<br />
*Testing the Arduino kit: the testing took place in the dark room, and the cell culture (in 1.5mL Eppendorf tubes) was held close to the photosensor and then taken away repeatedly. The data recorded was plotted with Matlab, as shown:<br />
[[File:CAM_Sensor_darkroom_glowingbacteria.jpg|thumb|700px|Light level against time]]<br />
<br />
*It should be noted that the background light levels were falling linearly, possibly due to negative feedback on the photosensor, but there is a consistent 5-6% increase of the original base reading upon placing the cells close the the photosensor.<br />
<br />
==Week 5==<br />
<br />
===Thursday (26/07/12)===<br />
<br />
'''Instrumentation: Hardware implementation'''<br />
<br />
----<br />
<br />
[[File:deviceprototype.jpg|thumb|500px|Our device, reaching perfection!]]<br />
<br />
<br />
<br />
Our device is close to being implemented. The filtered photoresistors are placed now in the right position, the motory circuit is also functioning, the main chassis of the device is constructed and painted. However, the mirrors which will be used to surround the cuvettes are still missing and so is the mechanical coupler designed by us and being constructed at the Instrument shop of the Engineering Department. The device is also powered by a 9V battery, without the need to be connected to the computer.<br />
<br />
==Week 14==<br />
<br />
===Monday (24/09/12)===<br />
'''Instrumentation'''<br />
<br />
The sensitivity of the sensor concerning light intensities was tested using a dilution series of luciferase-producing bacteria. 20ml Cultures were grown overnight from single colonies. The cultures were induced with 40ul of 1.5M arabinose (for a final concentration of 3mM). Cultures were left for 2 1/2 hours for full induction. Subsequently, a culture was pelleted and resuspended in 4ml LB. Doubling dilutions, of volume 2ml, were made from this concentrate, down to 1/8th concentration.<br />
1ml of each 2ml dilution was analysed in each cuvette, which was placed in the cuvette holder we made ourselves. <br />
<br />
[[File:Dilutiontest.jpg|thumb|400px|Raw sensor values(V) vs Concentration of bioluminescent E.coli- Concentrations on the x-axis are relative therefore an OD 600 value was also taken|center]]<br />
<br />
[[File:Norm_light.png|thumb|400px|Normalised sensor data using a dilution series of bioluminescent E.coli- Concentrations on the x-axis are relative therefore an OD 600 value was also taken|center]]<br />
<br />
[[File:Norm_blue.jpg|thumb|400px|Normalised percentage of blue frequencies using the same dilution series of E.coli|center]]<br />
<br />
[[File:Dilution_series.jpg|thumb|400px|Dilution series of E.coli from most concentrated to least|center]]<br />
<br />
===Tuesday (25/09/12)===<br />
<br />
'''Instrumentation'''<br />
<br />
The sensitivity of the sensor concerning different frequencies (colours) of light was tested as well. As can be seen below, measurements taken from orange and blue light yield values respectively above and below those from white light (our reference point). The data was taken using a constant intensity of light for each case (V.High and V.Low brightness). This was done with the aid of an Android phone and a specialised software application, called Color Flashlight, downloaded from the official Market. <br />
[[File:Sensor_colour.jpg|400px|Sensor data for different colours at different intensities|thumb|center]]<br />
<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Biologger/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Biologger/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Emmyfthttp://2012.igem.org/Team:Cambridge/Ratiometrica/LabbookTeam:Cambridge/Ratiometrica/Labbook2012-10-27T03:02:35Z<p>Emmyft: /* General Labbook */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Labbook");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Biologger/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= Ratiometrica Labbook =<br />
<br />
==Week 4 ==<br />
<br />
===Monday (16/07/12)===<br />
<br />
'''Ratiometrica- Lux: Transformation of bacillus and e.coli with lux genes from 2010'''<br />
<br />
----<br />
<br />
*Arabinose induction: from [https://2010.igem.org/Team:Cambridge Cambridge 2010 iGEM Team's] data, the arabinose concentration which will give the optimum amount of light is around 3mM. We hence added 0.45mg arabinose to each mL of LB.<br />
*Light is detected after around 5 hours in the transformed E. coli<br />
*B. subtilis plates have no growth, very possibly due to plasmid backbone pSB1C3 not being compatible in B. subtilis<br />
<br />
<br />
===Wednesday (18/07/12)===<br />
'''Ratiometrica-Lux: Transformation of e.coli with lux genes from 2010'''<br />
<br />
----<br />
<br />
*Progress: (1) Streaked 8 25ug/ml Chloramphenicol plates with transformed e.coli and incubate overnight; (2) inoculate individual colonies from the plates in liquid medium; (3) Incubate overnight at 37 degrees<br />
<br />
===Friday (20/07/12)===<br />
<br />
'''Ratiometrica-Lux: Transformation of e.coli with lux genes from 2010'''<br />
<br />
----<br />
<br />
*Arabinose induction: Using the same 3mM arabinose prepared earlier in the week, the E. coli were spun down and the arabinose was added. After 5 hours, light is observed.<br />
*Testing the Arduino kit: the testing took place in the dark room, and the cell culture (in 1.5mL Eppendorf tubes) was held close to the photosensor and then taken away repeatedly. The data recorded was plotted with Matlab, as shown:<br />
[[File:CAM_Sensor_darkroom_glowingbacteria.jpg|thumb|700px|Light level against time]]<br />
<br />
*It should be noted that the background light levels were falling linearly, possibly due to negative feedback on the photosensor, but there is a consistent 5-6% increase of the original base reading upon placing the cells close the the photosensor.<br />
<br />
<br />
==Week 5==<br />
===Thursday (26/07/12)===<br />
'''Ratiometrica: [[Team:Cambridge/Protocols/PCRProtocol|PCR of vectors, CFP, YFP, Promotor, Terminator and mOrange]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch and constructing the fluorescent ratiometric plasmid. <br />
<br />
*Parts from registry amplified: E0020 (CFP), B0015 (Terminator), K143083 (Pveg) and E0030 (YFP).<br />
<br />
*mOrange from lab also used<br />
<br />
*Primers:<br />
<br />
:*E0020<br />
<br />
::*Forward: cacaattaaaggaggaattcaaa|ATGGTGAGCAAGGGC<br />
<br />
::*Reverse: tcgttttatttgatgcctgg|TTATTACTTGTACAGCTCGTCCA<br />
<br />
:*B0015<br />
<br />
::*Forward: acgagctgtacaagtaataa|CCAGGCATCAAATAAAACGA<br />
<br />
::*Reverse: aaaattattttgacaaaatt|TATAAACGCAGAAAGGCCC<br />
<br />
:*K143083<br />
<br />
::*Forward: tgggcctttctgcgtttata|AATTTTGTCAAAATAATTTTATTG<br />
<br />
::*Reverse: tcctcgcccttgctcaccat|ctagta|TTCACCACCTTTCTCTAGTAACA<br />
<br />
:*E0030<br />
<br />
::*Forward: tgttactagagaaaggtggtgaa|tactag|ATGGTGAGCAAGGGCG<br />
<br />
::*Reverse: gatgcctggctctagtatca|TTATTACTTGTACAGCTCGTCCA<br />
<br />
:*mOrange<br />
<br />
::*Forward: accaaaaaggaatagagt|ATGGTGAGCAAGGGCG<br />
<br />
::*Reverse: caaacttcat|ACTTCCTCCTCCTCCACTTCCTCCTCCTCC|cttgtaagctcgtccatgc<br />
<br />
:*pJS130 Mg2+<br />
<br />
::*Forward: tagaggaggtacgagtcccg|ATGAAACCAGTAACGTTATACGA<br />
<br />
::*Reverse: tacatcacaattacggaaca|CAAAATCGTCTCCCTCC<br />
<br />
:*pJS130 Fluorescent<br />
<br />
::*Forward: acgagctgtacaagtaataa|TGATACTAGAGCCAGGCATC<br />
<br />
::*Reverse: tcctcgcccttgctcaccat|TTTGAATTCCTCCTTTAATT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 58 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 180secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
===Friday (27/07/12)===<br />
<br />
'''Ribosense & Ratiometrica: [[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
{|cellspacing="20"<br />
|[[File:CAM_120727_1_edited.jpg|200px|left|thumb|Vector amplification gel. Lanes 2-4 Lux containing vector. Lanes 5-7 Fluorescent construct vector. No products from this gel were amplified.]]<br />
|[[File:CAM_120727_2_edited.jpg|200px|left|thumb|Various. Lanes 3-5 mOrange amplification. Lanes 6-8 eCFP (E0020) amplification. mOrange amplification did not work.]]<br />
|[[File:CAM_120727_3_edited.jpg|200px|left|thumb|Small products for fluorescent construct. Lanes 1-3 Terminator (B0015). Lanes 4-6 Promotor pVEG + SpoVG (K143053).]]<br />
|-<br />
|[[File:CAM_120727_4_edited.jpg|200px|left|thumb|Various. Lanes 2-4 eYFP (E0030) amplification. Lanes 5-7 Mg2+ vector +8 codons. Lane 8 Mg2+ vector -8 codons. Lane 8 amplification did not work.]]<br />
|[[File:CAM_120727_5_edited.jpg|200px|left|thumb|Mg2+ riboswitch gel. Lanes 6+7 positive and negative controls respectively for entire run. Lanes 3-5 genomic riboswitch amplification -8 codons. Lanes 2+3 vector -8 codons.]]<br />
|}<br />
<br />
*PCR fragments for Mg2+ riboswitch, luxA/mOrange fusion and fluorescent construct from yesterday separated on gels. 90mins at 100V.<br />
<br />
*Mostly successful, but will need to repeat four runs: Three vectors (fluorescent, fusion (lux) and Mg2+ riboswitch (-8 codons) and mOrange gene.<br />
<br />
<br />
<br />
'''Ribosense & Ratiometrica: [[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of successfully amplified DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful CFP, YFP, B0015, Pveg + SpoVG (K143053), riboswitch and vector DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
==Week 6==<br />
===Monday (30/07/12)===<br />
<br />
'''Ratiometrica & Ribosense: [[Team:Cambridge/Protocols/PCRProtocol|PCR of vectors and mOrange]]'''<br />
<br />
----<br />
<br />
[[File:mOrangegel.jpg|250px|thumb|mOrange PCR run at multiple temperatures, every two lanes increacing the temperature of the annealing step by 2 &deg;C. No lanes worked.]]<br />
<br />
[[File:vectorgel1.jpg|250px|thumb|Top: Fusion, lux containing vector gel. Lanes 2-4, Vector DNA. Lane 5, +ve control. Lane 6, -ve control. Bottom: Vector gel. Lanes 1-3, Fluorescent contruct vector DNA. Lanes 4-6, Riboswitch construct vector DNA.]]<br />
<br />
*Not all products were obtained during Friday's PCR. Most of these missing products were large vector backbones. They are being run again, with a much longer extension time of 300s. If that fails, primers will be ordered to split the vectors into manageable chunks, and the PCR reattempted when they arrive.<br />
<br />
*PCR cycle x35: <br />
<br />
:* 15s Denaturing at 95 C<br />
:* 45s Annealing at 60 C<br />
:* 300s Extension at 72 C<br />
<br />
*Remaining stray product had a slightly tricky secondary structure at the 3' end. It will be run at a series of annealing temperatures in a PCR machine capable of a temperature gradient.<br />
<br />
*mOrange PCR run at many different temperatures, from 62 &deg;C to 76 &deg;C. However this doesn't seem to solve our problem (refer to Gel photos). It seems likely that it is a primer design problem.<br />
<br />
'''Ratiometrica: [[Team:Cambridge/Protocols/GelElectrophoresis|Separation of vector and mOrange DNA]]'''<br />
<br />
----<br />
<br />
*Positive control produced no band. No primer smear - primers may not be in mix for some reason.<br />
<br />
*Realized correct lux vector template was not added during PCR preparation, consequently no amplification occured. Still appears to be a primer smear.<br />
<br />
*Fluorescent vector backbone produced several bands. Appears to be due to mis-priming during PCR. Either changing the primers or raising the annealing temperature should solve this problem, but may mean that we have to do this PCR separately.<br />
<br />
*Riboswitch vector also failed. However, the extraction from the previous PCR run may have worked. We will try producing a functional plasmid with this extraction before running this PCR again. <br />
<br />
===Tuesday (31/07/12)===<br />
'''Ratiometrica-Flu: [[Team:Cambridge/Protocols/PCRProtocol|PCR of split fluorescent construct]]'''<br />
<br />
----<br />
<br />
[[File:Flu split vector.jpg|250px|right|thumb|Fluorescent construct gels. Top: Lanes 2-4: Fragment A - expected size 4500bp. Bottom: Lanes 2-4: Fragment B - expected size 3000bp. Lane 5: negative control. All lanes worked well.]]<br />
<br />
*Our present theory is that the vectors that we are trying to amplify is too large for the PCR to effectively take place. Given this, we are using split primers to try to reduce the size of the fragments (kindly provided by [[Team:Cambridge/Special_thanks|P.J.Steiner]]).<br />
<br />
*New primer sequences:<br />
<br />
:*Forward: tgaagtgttcgacaatataaatgtg|CGAAACGATCCTCATCCTGT<br />
<br />
:*Reverse: ACAGGATGAGGATCGTTTCG|cacatttatattgtcgaacacttca<br />
<br />
*PCR Programme<br />
<br />
*After gel electrophorsis, it was found that the PCR had worked perfectly. Given we now have all the fragments for the fluorescent construct, we will try to make it with Gibson ASAP.<br />
<br />
===Friday (03/08/12)===<br />
<br />
'''Ratiometrica-Flu: [[Team:Cambridge/Protocols/Gibsonassembly|Construction of fluorescent plasmid with Gibson Assembly]]'''<br />
<br />
----<br />
<br />
*'''Isothermal reaction buffer''' *5 remade with correct composition. Needed to order NAD+, so used some master mix from Haseloff lab.<br />
<br />
*Various Gibson tail tagged DNA fragments produced over last few weeks assembled together using Gibson protocol:<br />
<br />
:*pJS130 plasmid fragment A<br />
<br />
:*pJS130 plasmid fragment B<br />
<br />
:*CFP (E0020)<br />
<br />
:*Terminator (B0015)<br />
<br />
:*pVEG + RBS (K143053)<br />
<br />
:*YFP (E0030)<br />
<br />
'''Ratiometrica-Flu: [[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of TOP10 e.coli with Gibson products]]'''<br />
<br />
----<br />
<br />
*3 tubes of TOP10 transformed with Gibson products. Cells plated out on 100&mu;g/ml ampicillin plates.<br />
<br />
*No positive control added. If no cells grow, will add positive control to all future experiments.<br />
<br />
*Results: no growth (04/08/12)<br />
<br />
'''Ribosense: [[Team:Cambridge/Protocols/PCRProtocol|PCR of split Mg2+ vector]]'''<br />
<br />
----<br />
<br />
[[File:split Mg2+ 1.jpg|right|250px|thumb|results of split magnesium vector PCR. None of the products worked]]<br />
<br />
*PCR of magnesium riboswitch vector repeated with primers to split plasmid.<br />
<br />
*Lanes 2 + 3: Fragment A (center - cut site (promotor side))<br />
<br />
*Lanes 4 + 5: Fragment B (without 8 codon substitution) (cut site (lac I side) - center)<br />
<br />
*Lanes 6 + 7: Fragment B (with 8 codon substitution) (cut stie (lac I side) - center)<br />
<br />
*Gels run, found PCR was unsuccessful.<br />
<br />
'''Ratiometrica-Lux: [[Team:Cambridge/Protocols/PCRProtocol|PCR of mOrange]]'''<br />
<br />
----<br />
<br />
*with the forward primer correctly labelled and the single-base deletion in the reversed primer fixed, we were able to obtain the mOrange fragment<br />
<br />
*PCR Programme: <br />
<br />
*Result: bands of the correct size (Lanes 7-8)<br />
<br />
==Week 7==<br />
===Monday (06/08/12)===<br />
'''Ratiometrica-Lux: [[Team:Cambridge/Protocols/PCRProtocol|Split PCR of Lux vector]]'''<br />
<br />
----<br />
<br />
*Primers for spliting pSB1C3 arrived and were used to PCR the Ratiometrica-Lux vector<br />
<br />
:*Fragment A: Vec FWD and Vec split RVS (expected size: 5kb)<br />
<br />
:*Fragment b: Vec split FWD and Vec RVS (expected size: 4.6kb)<br />
<br />
*PCR Programme:<br />
<br />
*Results: other than one very ambiguous band (lane 6) which might be of the right size, the others did not work.<br />
<br />
===Tuesday (07/08/12)===<br />
'''Ratiometrica-Flu: [[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of Fluorescent construct]]'''<br />
<br />
----<br />
<br />
*6-piece Gibson assembly done in triplicate<br />
<br />
:* Reaction 1: Tube 1 (Fragment A), Tube 4 (Fragment B), Tube 10 (CFP), Tube 13 (B0015), Tube 16 (K143053), Tube 19 (YFP)<br />
<br />
:* Reaction 2: Tube 2 (Fragment A), Tube 5 (Fragment B), Tube 11 (CFP), Tube 14 (B0015), Tube 17 (K143053), Tube 20 (YFP)<br />
<br />
:* Reaction 3: Tube 3 (Fragment A), Tube 6 (Fragment B), Tube 12 (CFP), Tube 15 (B0015), Tube 18 (K143053), Tube 21 (YFP)<br />
<br />
'''Ratiometrica-Lux: [[Team:Cambridge/Protocols/PCRcolony|colony PCR of Lux vector]]'''<br />
<br />
----<br />
<br />
*2nd attempt at amplifying the Lux vector in two fragments, similar to one attempted yesterday<br />
<br />
*Results: no bands of the correct size. There seems to be DNA in the well which indicates presence of very large pieces of DNA.<br />
<br />
===Wednesday (08/08/12)===<br />
<br />
'''Ratiometrica & Ribosense: [[Team:Cambridge/Protocols/ElectricalTransformation|Electrical transformation of competent e.coli with Gibson products]]'''<br />
<br />
----<br />
<br />
*Gibson constructs from yesterday (fluorescent and magnesium riboswitch) transformed into e.coli produced yesterday.<br />
<br />
*Cells plated out onto 50 &mu;g/ml ampicillin plates. Put in incubator overnight.<br />
<br />
'''Ratiometrica-Flu: [[Team:Cambridge/Protocols/RestrictionDigest|Restriction Digest of Gibson products]]'''<br />
<br />
----<br />
<br />
*A restriction digest was performed to investigate if the plasmid was actually successfully constructed in the 6-piece Gibson reaction<br />
<br />
:*Restrictrion Enzymes: SalI (site at 5619), XhoI (site at 8040)<br />
<br />
:*Restriction Enzyme buffer: NEBuffer 3<br />
<br />
*Results: No bands at all; probably because there was too little DNA.<br />
<br />
==Week 8==<br />
===Monday (13/08/12)===<br />
<br />
'''Ratiometrica-Lux: [[Team:Cambridge/Protocols/MiniPrep|Miniprep of LuxBrick plasmid]]'''<br />
<br />
----<br />
<br />
*Miniprepped is done using miniprep kit supplied by Cambio<br />
*Plasmids are miniprepped from 3 cultures<br />
<br />
<br />
'''Ratiometrica-Lux: [[Team:Cambridge/Protocols/PCRProtocol| PCR of lux vector]]'''<br />
<br />
----<br />
<br />
*With split primers, similar conditions to last week (except no longer using E. coli colonies), each half in triplicates<br />
*Results: Half of the vector (Fragment B) came out (gel 1), positive control worked (gel 2 lane 5)<br />
<br />
<br />
'''Ratiometrica-Lux: [[Team:Cambridge/Protocols/ArabinoseInduction| Arabinose induction of Lux E. coli]]'''<br />
<br />
----<br />
<br />
*E. coli with the lux plasmid (K325909) O/N liquid cultures are induced with 3mM arabinose<br />
*They did not produce visible bioluminescence after 7 hours. We suspect it to be a problem associated either with the concentration of cells in the culture or the amount of arabinose we added.<br />
<br />
===Tuesday (14/08/12)===<br />
'''Ratiometrica-Lux: [[Team:Cambridge/Protocols/ArabinoseInduction|Arabinose Induction of Lux E. coli]]'''<br />
<br />
----<br />
<br />
*After our failed liquid culture induction, we made LB agar plates with 3mM arabinose and the appropriate antibiotics.<br />
*Cells are plated out on the arabinose plates and incubated at 37&deg;C overnight.<br />
*Colonies on plates show bioluminescence after overnight incubation<br />
<br />
===Thursday (16/08/12)===<br />
<br />
'''Ratiometrica-Lux: [[Team:Cambridge/Protocols/RestrictionDigest| Restriction Digest of Lux vector]]'''<br />
<br />
----<br />
<br />
*Results: Digest came out exactly as expected.<br />
<br />
'''Ratiometrica-Flu: [[Team:Cambridge/Protocols/PCRProtocol| PCR of Flourescent Construct DNA fragments]]'''<br />
<br />
----<br />
<br />
*Redo of [[Team:Cambridge/Lab_book/Week_5#Friday|PCR done at the end of July]], as we are running out of fragments to Gibson<br />
<br />
*Used existing DNA fragments as template rather than biobricks from the registry<br />
<br />
*Results: Only the fluorescent protein fragments (eCFP and eYFP) came out clearly; the smaller fragments (B0015, K143053) might have came out but was mistaken for primer dimers, the vector fragments did not come out<br />
<br />
<br />
===Saturday (18/08/12)===<br />
'''Ratiometrica-Flu: [[Team:Cambridge/Protocols/PCRProtocol|2nd attempt at PCR of fragments]]'''<br />
<br />
----<br />
<br />
*Reattempt of pJS130 and smaller fragments<br />
<br />
*Used Velocity from Bioline, new mastermix recipe is used<br />
<br />
*Results: failed- no wanted bands, since the positive control didn't come up, it is suggested that we need to optimise the PCR protocol for Velocity if we are to use it.<br />
<br />
<br />
'''Ratiometrica-Flu: [[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of fluorescent construct]]'''<br />
<br />
----<br />
<br />
*Gibson performed using remaining DNA fragments which has been concentrated by dehydration<br />
<br />
*We realised that though the decreased T5 exonuclease in the gibson mastermix might have lowered the Gibson efficiency in the positive control, the fragments we are trying to assemble are much smaller (~200bp); papers said this is likely to cause trouble<br />
<br />
*We therefore attempt 2 solutions in parallel: (1) adding the T5 only when the reaction is already heated to 50&deg;C (using a water bath); (2) using 1/5 of the amount of T5 exo (in both in parallel)<br />
<br />
*These are all done in duplicates, resulting in 8 Gibson reactions and subsequent transformations<br />
<br />
*Results: (Sunday) There are 2 colonies on one of the plates without either treatment<br />
<br />
===Sunday (19/08/12)===<br />
<br />
'''Ratiometrica-Flu: [[Team:Cambridge/Protocols/PCRProtocol|3rd attempt at PCR of fragments]]'''<br />
<br />
----<br />
<br />
*Similar PCR to the one from yesterday, except Velocity mastermix is further changed, and extension time is changed<br />
<br />
*Results: failed- no bands, probably Velocity mastermix problem, will revert back to Phusion on next attempt<br />
<br />
==Week 9==<br />
<br />
===Monday (20/08/12)===<br />
<br />
'''Ratiometrica-Flu: [[Team:Cambridge/Protocols/PCRProtocol|4th attempt at PCR of fragments]]'''<br />
<br />
----<br />
<br />
*Only vectors this time as we are still not sure if we have got the Velocity mastermix recipe right, as we are waiting for our orders of Phusion to arrive<br />
<br />
*Results: no bands for any lanes including positive control<br />
<br />
'''Ratiometrica-Flu: Restreak of potential Ratiometrica colonies'''<br />
<br />
----<br />
<br />
*One of the 2 colonies from the Gibson reaction and subsequent transformation are restreaked on a Amp 100ug/ml plate<br />
<br />
*this is incubated 37&deg;C overnight<br />
<br />
===Wednesday (22/08/12)===<br />
<br />
'''Ratiometrica-Lux: [[Team:Cambridge/Protocols/PCRProtocol|PCR of lux-vector]]'''<br />
<br />
----<br />
<br />
*Subsplit primers for the other half of the fragment that did not come out last week arrived, also new, extended lux FWD primers as we were afraid that the original primers did not anneal properly<br />
<br />
*We tried combinations of the new and old primers together with the subsplit and split primers<br />
<br />
*Results: only Fragment A2 (Between subsplit FWD and split REV) worked<br />
<br />
'''Ratiometrica-Flu: [[Team:Cambridge/Protocols/PCRProtocol|5th attempt of PCR of fragments]]'''<br />
<br />
----<br />
<br />
*Since we got our PCR protocol working, we reattempted the PCR<br />
<br />
*Results: the smallest fragments (B0015, K143053) came out, gel extraction is done with the new concentrated protocol<br />
<br />
== Week 12==<br />
<br />
===Wednesday (12/09/12)===<br />
<br />
'''Ratiometrica - lux'''<br />
<br />
*DNA 2.0 construct arrived<br />
<br />
*Colonies restreaked and put into 30 &deg;C incubator.<br />
<br />
*Only one set of colonies appears to be fluorescing, which may be of concern.<br />
<br />
===Friday (14/09/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of &alpha; and &beta; fragments for ratiometrica]]'''<br />
<br />
----<br />
<br />
*Although ratiometrica appears to have produced successful colonies, we would still like some extra fragments in case we need to repeat our construction.<br />
<br />
*Previous successful gel extractions of &alpha; and &beta; used as template for PCR.<br />
<br />
*&alpha; has successfuly been amplified, but &beta produced band of the wrong size.<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Gel extraction of &alpha;]]<br />
<br />
----<br />
<br />
* &alpha; successfully extracted from gel.<br />
<br />
===Saturday (15/09/12)===<br />
'''Ratiometrica - lux'''<br />
<br />
----<br />
<br />
*Attempted digestion of DNA 2.0 pure plasmid with EcoRI and SpeI, expected fragments 2648bp and 8738bp.<br />
*Parallel digestion of pSB1C3 backbone ready for ligation<br />
*8738 band extracted, was a little weak<br />
*8738 band and digested backbone ligated together<br />
*Chemically competent ''E. coli'' used for transformation<br />
*Plated on LB Agar with 25&mu;g/ml Chlor<br />
<br />
===Sunday (16/09/12)===<br />
<br />
'''Ratiometrica - lux'''<br />
<br />
----<br />
*Picked colonies from ligation attempt from yesterday, some red colonies on plates, these were avoided with one exception as a control.<br />
*Picked colonies grown in LB with 25&mu;g/ml Chlor<br />
<br />
==Week 13===<br />
<br />
===Monday (17/09/12)===<br />
<br />
'''Ratiometrica - Lux '''<br />
<br />
Testing of the 2.0 construct:<br />
<br />
Numbers 33,35,36 have correct sequence as of being sent to us. However they were not visibly luminescent. *34 was.<br />
<br />
Overnight cultures of each of the 6 culture lines sent were set up. Additionally, inducing plates were streaked, including the 2010 lux biobrick as a luminescence control and pjs130 as an iptg induction control.<br />
<br />
Primers ordered to ligate 2.0 construct into pjs130 for insertion into bacillus.<br />
<br />
===Tuesday (18/09/12)===<br />
<br />
'''Ratiometrica - Lux '''<br />
<br />
None of restreaked plates visibly luminescent, aside from *34 (faint), even under photon counting camera. Pjs130 not green, so iptg induction potentially didn't work. LuxBB induced and luminescent.<br />
<br />
Cultures induced with 1mM iptg or 3mM arabinose for luxBB, imaged after 3 hrs. Some extremely faint luminescence for 33,34,38 on photon counting camera.<br />
<br />
Cultures miniprepped and restriction digests carried out w/spa1. Results are shown. Results indicate problem with the miniprep and/or damage to the construct - expected bands at 6625, 2838, 1876 and 53 bp.<br />
[[File:salI.jpg|300px|center|thumb|Digests are of 33-38, each miniprep, cut and uncut, between 2 ladders.]]<br />
<br />
===Wednesday (19/09/12)===<br />
<br />
''' Ratiometrica - Lux '''<br />
<br />
Digest of 2.0 miniprep with different enzyme, hindIII, carried out. 15ul template DNA used in a 20ul reaction. Again, results were odd. Cut and uncut minipreps ran.[[File:HindIII.jpg|300px|center|thumb|HindIII digest]]<br />
<br />
Cultures of ratiometrica (fluorescent) were miniprepped to be transformed into bacillus. A restriction digest was performed on these minipreps, and produced bands of the correct size.<br />
[[File:Ratiometrica Digest.jpg|300px|center|thumb|Ratiometrica Digest]]<br />
[[File:Ratiometrica Digest Prediction.jpg|300px|center|thumb|Ratiometrica Digest Prediction]]<br />
<br />
===Thursday (20/09/12)===<br />
<br />
'''Ratiometrica - Lux'''<br />
<br />
Transformation of fluorescent ratiometric construct into bacillus was unsuccessful<br />
<br />
Transformations of XL1-blue cells with resuspended construct plasmid from DNA 2.0 yielded orange colonies, with some white, and some showing sectoring, indicating insert loss. <br />
[[File:DSCF4639.JPG|350px|center|thumb|An image showing the variation between fresh transformants. Note sectoring of individual colonies, indicating that the insert is being lost as the colonies grow.]]<br />
Plates all appear to be luminescent. A random selection of colonies was picked and patched in order to investigate whether luminescence cosegregated with orange colour.<br />
<br />
===Friday (21/09/12)===<br />
<br />
Initial pick and patch experiments showed cosegregation, but we did not have immediate access to a photon-counting camera or a DSLR capable of long exposures, so we did not obtain images. Representative colonies were streaked out onto a fresh plate to be imaged later.<br />
<br />
===Saturday (22/09/12)===<br />
<br />
A PCR was run to amplify several fragments, including:<br />
<br />
* The ratiometric luciferase construct, to insert into;<br />
* pSB3C5, a low copy number vector<br />
* Oli's Mg riboswitch construct<br />
<br />
All fragments were obtained.<br />
<br />
===Sunday (23/09/12)===<br />
<br />
Fragments for the fluoride riboswitch and the insertion of the 2.0 construct into pSB3C5 were all digested for two hours in 50 ul reactions, as was the pSB1C3 backbone.<br />
<br />
*5ul NEB2<br />
*1 ul EcoRI<br />
*1 ul PstI<br />
*0.5 ul BSA<br />
*10 ul DNA<br />
*32.5 ul HPLC H20<br />
<br />
Enzyme was heat-inactivated for 20 minutes at 65 C<br />
<br />
for a 6:1 insert:vector ratio (recommended by Knight on openwetware) 2.5 ul of vector digest was ligated to 15 ul insert in all cases, except the luciferase construct. In this case the insert is bigger than the vector, so the ratio was reversed. <br />
<br />
*3ul vector<br />
*18ul insert<br />
*2.5ul 10X T4 ligase buffer<br />
*1.25 ul T4 ligase<br />
<br />
Ligation left overnight at 16C, as recommended by Knight.<br />
<br />
==Week 14==<br />
===Monday (24/09/12)===<br />
<br />
'''Ratiometrica - Lux'''<br />
<br />
Colonies grew. However colony PCR using the sequencing primers revealed them to be transformed with recircularised backbone. [[File:Unsuccessfulcolonypcr.jpg|300px|center|thumb| An amplicon of ~300 bp indicates no insert.]]<br />
<br />
The digestions and ligations were reattempted, this time treating the backbone with alkaline phosphatase in order to reduce or eliminate self-ligation.<br />
<br />
===Tuesday (25/09/12)===<br />
'''Ratiometrica - Lux '''<br />
<br />
Images were taken to show cosegregation of orange colour and luminescence. Additionally, images were taken of the luciferase construct with a gel filter in order to indicate if there was a difference in the emission spectra.<br />
[[File:2.0 Colour.jpg|300px|center|thumb| Representative colours of different luciferase construct transformants]]<br />
[[File:2.0 Glow.jpg|300px|center|thumb| And a long exposure showing luminescence]]<br />
[[File:Lux colour change image 1 small.jpg|300px|center|thumb|Potentially a difference in transmission here, perhaps reflecting a different emission spectrum?]]<br />
<br />
See results page for more details and interpretation.<br />
<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Ratiometrica/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Ratiometrica/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Emmyfthttp://2012.igem.org/Team:Cambridge/Ratiometrica/LabbookTeam:Cambridge/Ratiometrica/Labbook2012-10-27T03:02:20Z<p>Emmyft: Created page with "{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}} <html> <script type="text/javascript"> $(document).keydown(function(e){ //e.which is set by jQuery for those browsers t..."</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Labbook");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Biologger/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= General Labbook =<br />
<br />
==Week 4 ==<br />
<br />
===Monday (16/07/12)===<br />
<br />
'''Ratiometrica- Lux: Transformation of bacillus and e.coli with lux genes from 2010'''<br />
<br />
----<br />
<br />
*Arabinose induction: from [https://2010.igem.org/Team:Cambridge Cambridge 2010 iGEM Team's] data, the arabinose concentration which will give the optimum amount of light is around 3mM. We hence added 0.45mg arabinose to each mL of LB.<br />
*Light is detected after around 5 hours in the transformed E. coli<br />
*B. subtilis plates have no growth, very possibly due to plasmid backbone pSB1C3 not being compatible in B. subtilis<br />
<br />
<br />
===Wednesday (18/07/12)===<br />
'''Ratiometrica-Lux: Transformation of e.coli with lux genes from 2010'''<br />
<br />
----<br />
<br />
*Progress: (1) Streaked 8 25ug/ml Chloramphenicol plates with transformed e.coli and incubate overnight; (2) inoculate individual colonies from the plates in liquid medium; (3) Incubate overnight at 37 degrees<br />
<br />
===Friday (20/07/12)===<br />
<br />
'''Ratiometrica-Lux: Transformation of e.coli with lux genes from 2010'''<br />
<br />
----<br />
<br />
*Arabinose induction: Using the same 3mM arabinose prepared earlier in the week, the E. coli were spun down and the arabinose was added. After 5 hours, light is observed.<br />
*Testing the Arduino kit: the testing took place in the dark room, and the cell culture (in 1.5mL Eppendorf tubes) was held close to the photosensor and then taken away repeatedly. The data recorded was plotted with Matlab, as shown:<br />
[[File:CAM_Sensor_darkroom_glowingbacteria.jpg|thumb|700px|Light level against time]]<br />
<br />
*It should be noted that the background light levels were falling linearly, possibly due to negative feedback on the photosensor, but there is a consistent 5-6% increase of the original base reading upon placing the cells close the the photosensor.<br />
<br />
<br />
==Week 5==<br />
===Thursday (26/07/12)===<br />
'''Ratiometrica: [[Team:Cambridge/Protocols/PCRProtocol|PCR of vectors, CFP, YFP, Promotor, Terminator and mOrange]]'''<br />
<br />
----<br />
<br />
*Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch and constructing the fluorescent ratiometric plasmid. <br />
<br />
*Parts from registry amplified: E0020 (CFP), B0015 (Terminator), K143083 (Pveg) and E0030 (YFP).<br />
<br />
*mOrange from lab also used<br />
<br />
*Primers:<br />
<br />
:*E0020<br />
<br />
::*Forward: cacaattaaaggaggaattcaaa|ATGGTGAGCAAGGGC<br />
<br />
::*Reverse: tcgttttatttgatgcctgg|TTATTACTTGTACAGCTCGTCCA<br />
<br />
:*B0015<br />
<br />
::*Forward: acgagctgtacaagtaataa|CCAGGCATCAAATAAAACGA<br />
<br />
::*Reverse: aaaattattttgacaaaatt|TATAAACGCAGAAAGGCCC<br />
<br />
:*K143083<br />
<br />
::*Forward: tgggcctttctgcgtttata|AATTTTGTCAAAATAATTTTATTG<br />
<br />
::*Reverse: tcctcgcccttgctcaccat|ctagta|TTCACCACCTTTCTCTAGTAACA<br />
<br />
:*E0030<br />
<br />
::*Forward: tgttactagagaaaggtggtgaa|tactag|ATGGTGAGCAAGGGCG<br />
<br />
::*Reverse: gatgcctggctctagtatca|TTATTACTTGTACAGCTCGTCCA<br />
<br />
:*mOrange<br />
<br />
::*Forward: accaaaaaggaatagagt|ATGGTGAGCAAGGGCG<br />
<br />
::*Reverse: caaacttcat|ACTTCCTCCTCCTCCACTTCCTCCTCCTCC|cttgtaagctcgtccatgc<br />
<br />
:*pJS130 Mg2+<br />
<br />
::*Forward: tagaggaggtacgagtcccg|ATGAAACCAGTAACGTTATACGA<br />
<br />
::*Reverse: tacatcacaattacggaaca|CAAAATCGTCTCCCTCC<br />
<br />
:*pJS130 Fluorescent<br />
<br />
::*Forward: acgagctgtacaagtaataa|TGATACTAGAGCCAGGCATC<br />
<br />
::*Reverse: tcctcgcccttgctcaccat|TTTGAATTCCTCCTTTAATT<br />
<br />
*PCR settings:<br />
<br />
:* 95 &deg;C - 6mins<br />
<br />
::* 98 &deg;C - 10secs<br />
<br />
::* 58 &deg;C - 45secs<br />
<br />
::* 72 &deg;C - 180secs<br />
<br />
:* Repeat above 35x<br />
<br />
:* 72 &deg;C - 5mins<br />
<br />
:* 25 &deg;C - 1min<br />
<br />
===Friday (27/07/12)===<br />
<br />
'''Ribosense & Ratiometrica: [[Team:Cambridge/Protocols/GelElectrophoresis|Gel electrophoresis of PCR products]]'''<br />
<br />
----<br />
{|cellspacing="20"<br />
|[[File:CAM_120727_1_edited.jpg|200px|left|thumb|Vector amplification gel. Lanes 2-4 Lux containing vector. Lanes 5-7 Fluorescent construct vector. No products from this gel were amplified.]]<br />
|[[File:CAM_120727_2_edited.jpg|200px|left|thumb|Various. Lanes 3-5 mOrange amplification. Lanes 6-8 eCFP (E0020) amplification. mOrange amplification did not work.]]<br />
|[[File:CAM_120727_3_edited.jpg|200px|left|thumb|Small products for fluorescent construct. Lanes 1-3 Terminator (B0015). Lanes 4-6 Promotor pVEG + SpoVG (K143053).]]<br />
|-<br />
|[[File:CAM_120727_4_edited.jpg|200px|left|thumb|Various. Lanes 2-4 eYFP (E0030) amplification. Lanes 5-7 Mg2+ vector +8 codons. Lane 8 Mg2+ vector -8 codons. Lane 8 amplification did not work.]]<br />
|[[File:CAM_120727_5_edited.jpg|200px|left|thumb|Mg2+ riboswitch gel. Lanes 6+7 positive and negative controls respectively for entire run. Lanes 3-5 genomic riboswitch amplification -8 codons. Lanes 2+3 vector -8 codons.]]<br />
|}<br />
<br />
*PCR fragments for Mg2+ riboswitch, luxA/mOrange fusion and fluorescent construct from yesterday separated on gels. 90mins at 100V.<br />
<br />
*Mostly successful, but will need to repeat four runs: Three vectors (fluorescent, fusion (lux) and Mg2+ riboswitch (-8 codons) and mOrange gene.<br />
<br />
<br />
<br />
'''Ribosense & Ratiometrica: [[Team:Cambridge/Protocols/GelExtractionofDNA|Purification of successfully amplified DNA from gel]]'''<br />
<br />
----<br />
<br />
*Successful CFP, YFP, B0015, Pveg + SpoVG (K143053), riboswitch and vector DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.<br />
<br />
==Week 6==<br />
===Monday (30/07/12)===<br />
<br />
'''Ratiometrica & Ribosense: [[Team:Cambridge/Protocols/PCRProtocol|PCR of vectors and mOrange]]'''<br />
<br />
----<br />
<br />
[[File:mOrangegel.jpg|250px|thumb|mOrange PCR run at multiple temperatures, every two lanes increacing the temperature of the annealing step by 2 &deg;C. No lanes worked.]]<br />
<br />
[[File:vectorgel1.jpg|250px|thumb|Top: Fusion, lux containing vector gel. Lanes 2-4, Vector DNA. Lane 5, +ve control. Lane 6, -ve control. Bottom: Vector gel. Lanes 1-3, Fluorescent contruct vector DNA. Lanes 4-6, Riboswitch construct vector DNA.]]<br />
<br />
*Not all products were obtained during Friday's PCR. Most of these missing products were large vector backbones. They are being run again, with a much longer extension time of 300s. If that fails, primers will be ordered to split the vectors into manageable chunks, and the PCR reattempted when they arrive.<br />
<br />
*PCR cycle x35: <br />
<br />
:* 15s Denaturing at 95 C<br />
:* 45s Annealing at 60 C<br />
:* 300s Extension at 72 C<br />
<br />
*Remaining stray product had a slightly tricky secondary structure at the 3' end. It will be run at a series of annealing temperatures in a PCR machine capable of a temperature gradient.<br />
<br />
*mOrange PCR run at many different temperatures, from 62 &deg;C to 76 &deg;C. However this doesn't seem to solve our problem (refer to Gel photos). It seems likely that it is a primer design problem.<br />
<br />
'''Ratiometrica: [[Team:Cambridge/Protocols/GelElectrophoresis|Separation of vector and mOrange DNA]]'''<br />
<br />
----<br />
<br />
*Positive control produced no band. No primer smear - primers may not be in mix for some reason.<br />
<br />
*Realized correct lux vector template was not added during PCR preparation, consequently no amplification occured. Still appears to be a primer smear.<br />
<br />
*Fluorescent vector backbone produced several bands. Appears to be due to mis-priming during PCR. Either changing the primers or raising the annealing temperature should solve this problem, but may mean that we have to do this PCR separately.<br />
<br />
*Riboswitch vector also failed. However, the extraction from the previous PCR run may have worked. We will try producing a functional plasmid with this extraction before running this PCR again. <br />
<br />
===Tuesday (31/07/12)===<br />
'''Ratiometrica-Flu: [[Team:Cambridge/Protocols/PCRProtocol|PCR of split fluorescent construct]]'''<br />
<br />
----<br />
<br />
[[File:Flu split vector.jpg|250px|right|thumb|Fluorescent construct gels. Top: Lanes 2-4: Fragment A - expected size 4500bp. Bottom: Lanes 2-4: Fragment B - expected size 3000bp. Lane 5: negative control. All lanes worked well.]]<br />
<br />
*Our present theory is that the vectors that we are trying to amplify is too large for the PCR to effectively take place. Given this, we are using split primers to try to reduce the size of the fragments (kindly provided by [[Team:Cambridge/Special_thanks|P.J.Steiner]]).<br />
<br />
*New primer sequences:<br />
<br />
:*Forward: tgaagtgttcgacaatataaatgtg|CGAAACGATCCTCATCCTGT<br />
<br />
:*Reverse: ACAGGATGAGGATCGTTTCG|cacatttatattgtcgaacacttca<br />
<br />
*PCR Programme<br />
<br />
*After gel electrophorsis, it was found that the PCR had worked perfectly. Given we now have all the fragments for the fluorescent construct, we will try to make it with Gibson ASAP.<br />
<br />
===Friday (03/08/12)===<br />
<br />
'''Ratiometrica-Flu: [[Team:Cambridge/Protocols/Gibsonassembly|Construction of fluorescent plasmid with Gibson Assembly]]'''<br />
<br />
----<br />
<br />
*'''Isothermal reaction buffer''' *5 remade with correct composition. Needed to order NAD+, so used some master mix from Haseloff lab.<br />
<br />
*Various Gibson tail tagged DNA fragments produced over last few weeks assembled together using Gibson protocol:<br />
<br />
:*pJS130 plasmid fragment A<br />
<br />
:*pJS130 plasmid fragment B<br />
<br />
:*CFP (E0020)<br />
<br />
:*Terminator (B0015)<br />
<br />
:*pVEG + RBS (K143053)<br />
<br />
:*YFP (E0030)<br />
<br />
'''Ratiometrica-Flu: [[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of TOP10 e.coli with Gibson products]]'''<br />
<br />
----<br />
<br />
*3 tubes of TOP10 transformed with Gibson products. Cells plated out on 100&mu;g/ml ampicillin plates.<br />
<br />
*No positive control added. If no cells grow, will add positive control to all future experiments.<br />
<br />
*Results: no growth (04/08/12)<br />
<br />
'''Ribosense: [[Team:Cambridge/Protocols/PCRProtocol|PCR of split Mg2+ vector]]'''<br />
<br />
----<br />
<br />
[[File:split Mg2+ 1.jpg|right|250px|thumb|results of split magnesium vector PCR. None of the products worked]]<br />
<br />
*PCR of magnesium riboswitch vector repeated with primers to split plasmid.<br />
<br />
*Lanes 2 + 3: Fragment A (center - cut site (promotor side))<br />
<br />
*Lanes 4 + 5: Fragment B (without 8 codon substitution) (cut site (lac I side) - center)<br />
<br />
*Lanes 6 + 7: Fragment B (with 8 codon substitution) (cut stie (lac I side) - center)<br />
<br />
*Gels run, found PCR was unsuccessful.<br />
<br />
'''Ratiometrica-Lux: [[Team:Cambridge/Protocols/PCRProtocol|PCR of mOrange]]'''<br />
<br />
----<br />
<br />
*with the forward primer correctly labelled and the single-base deletion in the reversed primer fixed, we were able to obtain the mOrange fragment<br />
<br />
*PCR Programme: <br />
<br />
*Result: bands of the correct size (Lanes 7-8)<br />
<br />
==Week 7==<br />
===Monday (06/08/12)===<br />
'''Ratiometrica-Lux: [[Team:Cambridge/Protocols/PCRProtocol|Split PCR of Lux vector]]'''<br />
<br />
----<br />
<br />
*Primers for spliting pSB1C3 arrived and were used to PCR the Ratiometrica-Lux vector<br />
<br />
:*Fragment A: Vec FWD and Vec split RVS (expected size: 5kb)<br />
<br />
:*Fragment b: Vec split FWD and Vec RVS (expected size: 4.6kb)<br />
<br />
*PCR Programme:<br />
<br />
*Results: other than one very ambiguous band (lane 6) which might be of the right size, the others did not work.<br />
<br />
===Tuesday (07/08/12)===<br />
'''Ratiometrica-Flu: [[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of Fluorescent construct]]'''<br />
<br />
----<br />
<br />
*6-piece Gibson assembly done in triplicate<br />
<br />
:* Reaction 1: Tube 1 (Fragment A), Tube 4 (Fragment B), Tube 10 (CFP), Tube 13 (B0015), Tube 16 (K143053), Tube 19 (YFP)<br />
<br />
:* Reaction 2: Tube 2 (Fragment A), Tube 5 (Fragment B), Tube 11 (CFP), Tube 14 (B0015), Tube 17 (K143053), Tube 20 (YFP)<br />
<br />
:* Reaction 3: Tube 3 (Fragment A), Tube 6 (Fragment B), Tube 12 (CFP), Tube 15 (B0015), Tube 18 (K143053), Tube 21 (YFP)<br />
<br />
'''Ratiometrica-Lux: [[Team:Cambridge/Protocols/PCRcolony|colony PCR of Lux vector]]'''<br />
<br />
----<br />
<br />
*2nd attempt at amplifying the Lux vector in two fragments, similar to one attempted yesterday<br />
<br />
*Results: no bands of the correct size. There seems to be DNA in the well which indicates presence of very large pieces of DNA.<br />
<br />
===Wednesday (08/08/12)===<br />
<br />
'''Ratiometrica & Ribosense: [[Team:Cambridge/Protocols/ElectricalTransformation|Electrical transformation of competent e.coli with Gibson products]]'''<br />
<br />
----<br />
<br />
*Gibson constructs from yesterday (fluorescent and magnesium riboswitch) transformed into e.coli produced yesterday.<br />
<br />
*Cells plated out onto 50 &mu;g/ml ampicillin plates. Put in incubator overnight.<br />
<br />
'''Ratiometrica-Flu: [[Team:Cambridge/Protocols/RestrictionDigest|Restriction Digest of Gibson products]]'''<br />
<br />
----<br />
<br />
*A restriction digest was performed to investigate if the plasmid was actually successfully constructed in the 6-piece Gibson reaction<br />
<br />
:*Restrictrion Enzymes: SalI (site at 5619), XhoI (site at 8040)<br />
<br />
:*Restriction Enzyme buffer: NEBuffer 3<br />
<br />
*Results: No bands at all; probably because there was too little DNA.<br />
<br />
==Week 8==<br />
===Monday (13/08/12)===<br />
<br />
'''Ratiometrica-Lux: [[Team:Cambridge/Protocols/MiniPrep|Miniprep of LuxBrick plasmid]]'''<br />
<br />
----<br />
<br />
*Miniprepped is done using miniprep kit supplied by Cambio<br />
*Plasmids are miniprepped from 3 cultures<br />
<br />
<br />
'''Ratiometrica-Lux: [[Team:Cambridge/Protocols/PCRProtocol| PCR of lux vector]]'''<br />
<br />
----<br />
<br />
*With split primers, similar conditions to last week (except no longer using E. coli colonies), each half in triplicates<br />
*Results: Half of the vector (Fragment B) came out (gel 1), positive control worked (gel 2 lane 5)<br />
<br />
<br />
'''Ratiometrica-Lux: [[Team:Cambridge/Protocols/ArabinoseInduction| Arabinose induction of Lux E. coli]]'''<br />
<br />
----<br />
<br />
*E. coli with the lux plasmid (K325909) O/N liquid cultures are induced with 3mM arabinose<br />
*They did not produce visible bioluminescence after 7 hours. We suspect it to be a problem associated either with the concentration of cells in the culture or the amount of arabinose we added.<br />
<br />
===Tuesday (14/08/12)===<br />
'''Ratiometrica-Lux: [[Team:Cambridge/Protocols/ArabinoseInduction|Arabinose Induction of Lux E. coli]]'''<br />
<br />
----<br />
<br />
*After our failed liquid culture induction, we made LB agar plates with 3mM arabinose and the appropriate antibiotics.<br />
*Cells are plated out on the arabinose plates and incubated at 37&deg;C overnight.<br />
*Colonies on plates show bioluminescence after overnight incubation<br />
<br />
===Thursday (16/08/12)===<br />
<br />
'''Ratiometrica-Lux: [[Team:Cambridge/Protocols/RestrictionDigest| Restriction Digest of Lux vector]]'''<br />
<br />
----<br />
<br />
*Results: Digest came out exactly as expected.<br />
<br />
'''Ratiometrica-Flu: [[Team:Cambridge/Protocols/PCRProtocol| PCR of Flourescent Construct DNA fragments]]'''<br />
<br />
----<br />
<br />
*Redo of [[Team:Cambridge/Lab_book/Week_5#Friday|PCR done at the end of July]], as we are running out of fragments to Gibson<br />
<br />
*Used existing DNA fragments as template rather than biobricks from the registry<br />
<br />
*Results: Only the fluorescent protein fragments (eCFP and eYFP) came out clearly; the smaller fragments (B0015, K143053) might have came out but was mistaken for primer dimers, the vector fragments did not come out<br />
<br />
<br />
===Saturday (18/08/12)===<br />
'''Ratiometrica-Flu: [[Team:Cambridge/Protocols/PCRProtocol|2nd attempt at PCR of fragments]]'''<br />
<br />
----<br />
<br />
*Reattempt of pJS130 and smaller fragments<br />
<br />
*Used Velocity from Bioline, new mastermix recipe is used<br />
<br />
*Results: failed- no wanted bands, since the positive control didn't come up, it is suggested that we need to optimise the PCR protocol for Velocity if we are to use it.<br />
<br />
<br />
'''Ratiometrica-Flu: [[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of fluorescent construct]]'''<br />
<br />
----<br />
<br />
*Gibson performed using remaining DNA fragments which has been concentrated by dehydration<br />
<br />
*We realised that though the decreased T5 exonuclease in the gibson mastermix might have lowered the Gibson efficiency in the positive control, the fragments we are trying to assemble are much smaller (~200bp); papers said this is likely to cause trouble<br />
<br />
*We therefore attempt 2 solutions in parallel: (1) adding the T5 only when the reaction is already heated to 50&deg;C (using a water bath); (2) using 1/5 of the amount of T5 exo (in both in parallel)<br />
<br />
*These are all done in duplicates, resulting in 8 Gibson reactions and subsequent transformations<br />
<br />
*Results: (Sunday) There are 2 colonies on one of the plates without either treatment<br />
<br />
===Sunday (19/08/12)===<br />
<br />
'''Ratiometrica-Flu: [[Team:Cambridge/Protocols/PCRProtocol|3rd attempt at PCR of fragments]]'''<br />
<br />
----<br />
<br />
*Similar PCR to the one from yesterday, except Velocity mastermix is further changed, and extension time is changed<br />
<br />
*Results: failed- no bands, probably Velocity mastermix problem, will revert back to Phusion on next attempt<br />
<br />
==Week 9==<br />
<br />
===Monday (20/08/12)===<br />
<br />
'''Ratiometrica-Flu: [[Team:Cambridge/Protocols/PCRProtocol|4th attempt at PCR of fragments]]'''<br />
<br />
----<br />
<br />
*Only vectors this time as we are still not sure if we have got the Velocity mastermix recipe right, as we are waiting for our orders of Phusion to arrive<br />
<br />
*Results: no bands for any lanes including positive control<br />
<br />
'''Ratiometrica-Flu: Restreak of potential Ratiometrica colonies'''<br />
<br />
----<br />
<br />
*One of the 2 colonies from the Gibson reaction and subsequent transformation are restreaked on a Amp 100ug/ml plate<br />
<br />
*this is incubated 37&deg;C overnight<br />
<br />
===Wednesday (22/08/12)===<br />
<br />
'''Ratiometrica-Lux: [[Team:Cambridge/Protocols/PCRProtocol|PCR of lux-vector]]'''<br />
<br />
----<br />
<br />
*Subsplit primers for the other half of the fragment that did not come out last week arrived, also new, extended lux FWD primers as we were afraid that the original primers did not anneal properly<br />
<br />
*We tried combinations of the new and old primers together with the subsplit and split primers<br />
<br />
*Results: only Fragment A2 (Between subsplit FWD and split REV) worked<br />
<br />
'''Ratiometrica-Flu: [[Team:Cambridge/Protocols/PCRProtocol|5th attempt of PCR of fragments]]'''<br />
<br />
----<br />
<br />
*Since we got our PCR protocol working, we reattempted the PCR<br />
<br />
*Results: the smallest fragments (B0015, K143053) came out, gel extraction is done with the new concentrated protocol<br />
<br />
== Week 12==<br />
<br />
===Wednesday (12/09/12)===<br />
<br />
'''Ratiometrica - lux'''<br />
<br />
*DNA 2.0 construct arrived<br />
<br />
*Colonies restreaked and put into 30 &deg;C incubator.<br />
<br />
*Only one set of colonies appears to be fluorescing, which may be of concern.<br />
<br />
===Friday (14/09/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of &alpha; and &beta; fragments for ratiometrica]]'''<br />
<br />
----<br />
<br />
*Although ratiometrica appears to have produced successful colonies, we would still like some extra fragments in case we need to repeat our construction.<br />
<br />
*Previous successful gel extractions of &alpha; and &beta; used as template for PCR.<br />
<br />
*&alpha; has successfuly been amplified, but &beta produced band of the wrong size.<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Gel extraction of &alpha;]]<br />
<br />
----<br />
<br />
* &alpha; successfully extracted from gel.<br />
<br />
===Saturday (15/09/12)===<br />
'''Ratiometrica - lux'''<br />
<br />
----<br />
<br />
*Attempted digestion of DNA 2.0 pure plasmid with EcoRI and SpeI, expected fragments 2648bp and 8738bp.<br />
*Parallel digestion of pSB1C3 backbone ready for ligation<br />
*8738 band extracted, was a little weak<br />
*8738 band and digested backbone ligated together<br />
*Chemically competent ''E. coli'' used for transformation<br />
*Plated on LB Agar with 25&mu;g/ml Chlor<br />
<br />
===Sunday (16/09/12)===<br />
<br />
'''Ratiometrica - lux'''<br />
<br />
----<br />
*Picked colonies from ligation attempt from yesterday, some red colonies on plates, these were avoided with one exception as a control.<br />
*Picked colonies grown in LB with 25&mu;g/ml Chlor<br />
<br />
==Week 13===<br />
<br />
===Monday (17/09/12)===<br />
<br />
'''Ratiometrica - Lux '''<br />
<br />
Testing of the 2.0 construct:<br />
<br />
Numbers 33,35,36 have correct sequence as of being sent to us. However they were not visibly luminescent. *34 was.<br />
<br />
Overnight cultures of each of the 6 culture lines sent were set up. Additionally, inducing plates were streaked, including the 2010 lux biobrick as a luminescence control and pjs130 as an iptg induction control.<br />
<br />
Primers ordered to ligate 2.0 construct into pjs130 for insertion into bacillus.<br />
<br />
===Tuesday (18/09/12)===<br />
<br />
'''Ratiometrica - Lux '''<br />
<br />
None of restreaked plates visibly luminescent, aside from *34 (faint), even under photon counting camera. Pjs130 not green, so iptg induction potentially didn't work. LuxBB induced and luminescent.<br />
<br />
Cultures induced with 1mM iptg or 3mM arabinose for luxBB, imaged after 3 hrs. Some extremely faint luminescence for 33,34,38 on photon counting camera.<br />
<br />
Cultures miniprepped and restriction digests carried out w/spa1. Results are shown. Results indicate problem with the miniprep and/or damage to the construct - expected bands at 6625, 2838, 1876 and 53 bp.<br />
[[File:salI.jpg|300px|center|thumb|Digests are of 33-38, each miniprep, cut and uncut, between 2 ladders.]]<br />
<br />
===Wednesday (19/09/12)===<br />
<br />
''' Ratiometrica - Lux '''<br />
<br />
Digest of 2.0 miniprep with different enzyme, hindIII, carried out. 15ul template DNA used in a 20ul reaction. Again, results were odd. Cut and uncut minipreps ran.[[File:HindIII.jpg|300px|center|thumb|HindIII digest]]<br />
<br />
Cultures of ratiometrica (fluorescent) were miniprepped to be transformed into bacillus. A restriction digest was performed on these minipreps, and produced bands of the correct size.<br />
[[File:Ratiometrica Digest.jpg|300px|center|thumb|Ratiometrica Digest]]<br />
[[File:Ratiometrica Digest Prediction.jpg|300px|center|thumb|Ratiometrica Digest Prediction]]<br />
<br />
===Thursday (20/09/12)===<br />
<br />
'''Ratiometrica - Lux'''<br />
<br />
Transformation of fluorescent ratiometric construct into bacillus was unsuccessful<br />
<br />
Transformations of XL1-blue cells with resuspended construct plasmid from DNA 2.0 yielded orange colonies, with some white, and some showing sectoring, indicating insert loss. <br />
[[File:DSCF4639.JPG|350px|center|thumb|An image showing the variation between fresh transformants. Note sectoring of individual colonies, indicating that the insert is being lost as the colonies grow.]]<br />
Plates all appear to be luminescent. A random selection of colonies was picked and patched in order to investigate whether luminescence cosegregated with orange colour.<br />
<br />
===Friday (21/09/12)===<br />
<br />
Initial pick and patch experiments showed cosegregation, but we did not have immediate access to a photon-counting camera or a DSLR capable of long exposures, so we did not obtain images. Representative colonies were streaked out onto a fresh plate to be imaged later.<br />
<br />
===Saturday (22/09/12)===<br />
<br />
A PCR was run to amplify several fragments, including:<br />
<br />
* The ratiometric luciferase construct, to insert into;<br />
* pSB3C5, a low copy number vector<br />
* Oli's Mg riboswitch construct<br />
<br />
All fragments were obtained.<br />
<br />
===Sunday (23/09/12)===<br />
<br />
Fragments for the fluoride riboswitch and the insertion of the 2.0 construct into pSB3C5 were all digested for two hours in 50 ul reactions, as was the pSB1C3 backbone.<br />
<br />
*5ul NEB2<br />
*1 ul EcoRI<br />
*1 ul PstI<br />
*0.5 ul BSA<br />
*10 ul DNA<br />
*32.5 ul HPLC H20<br />
<br />
Enzyme was heat-inactivated for 20 minutes at 65 C<br />
<br />
for a 6:1 insert:vector ratio (recommended by Knight on openwetware) 2.5 ul of vector digest was ligated to 15 ul insert in all cases, except the luciferase construct. In this case the insert is bigger than the vector, so the ratio was reversed. <br />
<br />
*3ul vector<br />
*18ul insert<br />
*2.5ul 10X T4 ligase buffer<br />
*1.25 ul T4 ligase<br />
<br />
Ligation left overnight at 16C, as recommended by Knight.<br />
<br />
==Week 14==<br />
===Monday (24/09/12)===<br />
<br />
'''Ratiometrica - Lux'''<br />
<br />
Colonies grew. However colony PCR using the sequencing primers revealed them to be transformed with recircularised backbone. [[File:Unsuccessfulcolonypcr.jpg|300px|center|thumb| An amplicon of ~300 bp indicates no insert.]]<br />
<br />
The digestions and ligations were reattempted, this time treating the backbone with alkaline phosphatase in order to reduce or eliminate self-ligation.<br />
<br />
===Tuesday (25/09/12)===<br />
'''Ratiometrica - Lux '''<br />
<br />
Images were taken to show cosegregation of orange colour and luminescence. Additionally, images were taken of the luciferase construct with a gel filter in order to indicate if there was a difference in the emission spectra.<br />
[[File:2.0 Colour.jpg|300px|center|thumb| Representative colours of different luciferase construct transformants]]<br />
[[File:2.0 Glow.jpg|300px|center|thumb| And a long exposure showing luminescence]]<br />
[[File:Lux colour change image 1 small.jpg|300px|center|thumb|Potentially a difference in transmission here, perhaps reflecting a different emission spectrum?]]<br />
<br />
See results page for more details and interpretation.<br />
<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Ratiometrica/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Ratiometrica/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Emmyfthttp://2012.igem.org/Team:Cambridge/Ribosense/LabbookTeam:Cambridge/Ribosense/Labbook2012-10-27T02:47:19Z<p>Emmyft: Created page with "{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}} <html> <script type="text/javascript"> $(document).keydown(function(e){ //e.which is set by jQuery for those browsers t..."</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Labbook");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ratiometrica/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= General Labbook =<br />
<br />
==Week 4 ==<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Ribosense/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Emmyfthttp://2012.igem.org/File:CAMV2_Abstractbg.pngFile:CAMV2 Abstractbg.png2012-10-27T02:43:42Z<p>Emmyft: uploaded a new version of &quot;File:CAMV2 Abstractbg.png&quot;: Reverted to version as of 01:19, 27 October 2012</p>
<hr />
<div></div>Emmyfthttp://2012.igem.org/Team:Cambridge/Overview/LabbookTeam:Cambridge/Overview/Labbook2012-10-27T02:36:31Z<p>Emmyft: /* General Labbook */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/HumanPractices/Overview");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= General Labbook =<br />
<br />
==Week 3==<br />
<br />
===Monday (09/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Making ''bacillus'' competent]]'''<br />
<br />
----<br />
<br />
*'''Bacillus salts''' *10 made up and autoclaved.<br />
<br />
*'''Medium A base''' *10 made up (glucose will be added tomorrow)<br />
<br />
*''bacillus'' strain 168 streaked out and grown on plate overnight.<br />
<br />
===Tuesday (10/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Making ''bacillus'' competent]]'''<br />
<br />
----<br />
<br />
*Filtered glucose added to sterile '''Medium A base'''.<br />
<br />
*Sterile aliquots of salts and medium apportioned and put in fridge (10*50ml each)<br />
<br />
*Needed to make up MgCl2 and CaCl2 solutions of the correct concentrations. Required multiple dilution steps:<br />
<br />
:*MgCl2 (250nM), Mr = 147 Da, make 100ml of solution<br />
<br />
::*0.508g of MgCl2 dissolved in 100ml of H2O<br />
<br />
::*1ml of this solution mixed with 99ml of H2O<br />
<br />
::*0.1ml of this solution mixed with 99.9ml of H2O<br />
<br />
:*CaCl2 (50mM), Mr = 203.3 Da, make 100ml of solution<br />
<br />
::*0.735g of CaCl2 dissolved in 100ml of H2O<br />
<br />
*Made up '''Medium A''' (150ml) and '''Medium B''' (50ml)<br />
<br />
===Wednesday (11/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Making ''bacillus'' competent]]'''<br />
<br />
----<br />
<br />
*Colonies of strain 168 removed from plate and added to three separate conical flasks, each with 48ml of '''Medium A''' inside. OD650 readings taken until enough cells were added such that absorbance was between 0.1 and 0.2. [[File:Bsubgrowth.png|250px|''bacillus'' growth curves|thumb|right]]<br />
<br />
*Flasks placed inside a shaking incubator (200rpm) and samples taken every 20mins until growth had leveled off, as determined by the concurrently plotted growth curves.<br />
<br />
*Growth curves, as well as t0 (at 170mins) plotted:<br />
<br />
*90 mins after t0 (at 260 mins), cells removed from shaking incubator.<br />
<br />
*0.45ml of '''Medium B''' pre-warmed in Eppendorf tubes.<br />
<br />
*20 individual samples of 0.05ml taken from each growth flask and added to Eppendorfs.<br />
<br />
*Eppendorfs placed back in shaking incubator for 60 mins with lids off.<br />
<br />
*Eppendorfs centrifuged at ~13000 rpm for 10 mins, supernatant removed.<br />
<br />
*60% glycerol added (0.5ml/tube) and tubes vortexed.<br />
<br />
*All 60 tubes now frozen at -80 &deg;C.<br />
<br />
*Edited protocol so that it actually works.<br />
<br />
[[Image:lightsensorgraph.jpg|400px|left|thumb|Graph of light intensity response aginst time. The LDR was covered at 50 and released at 100]]<br />
<br />
'''Arduino circuitry'''<br />
<br />
----<br />
<br />
*Real-Time image captured by our freshly made primitive software, monitoring a light sensor on an arduino board. C++ was used to communicate with the Arduino and Python was used for data logging.<br />
<br />
===Thursday (12/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Test transformation of frozen ''bacillus'' stocks]]'''<br />
<br />
----<br />
<br />
*Two samples of ''bacillus'' defrosted from different batches.<br />
<br />
*Supernatant spun off, bacterial pellet isolated and 0.1ml of '''Medium B''' added.<br />
<br />
*Plasmid Tag RFP-T unfrozen. Concentration of DNA = 360ng/&mu;l, so 2&mu;l needed for the desired 0.6&mu;g of DNA. DNA added to bacteria.<br />
<br />
*Eppendorfs placed in shaking incubator at 30 &deg;C and 180rpm for 60 mins.<br />
<br />
*Bacteria plated on choramphenicol containing plates. Aseptic technique was used as far as possible.<br />
<br />
===Friday (13/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Test transformation of ''bacillus'' stocks]]'''<br />
<br />
----<br />
<br />
[[File:Plate.jpg|250px|right|thumb|lovely pink colonies]]<br />
<br />
*Results: In this image, several colonies have clearly gained pink coloration from the transfected plasmid. This demonstrates that our stocks should be usable. However, the large number of opportunistic colonies that do not appear to have been transfected means that we will have to be careful to check that our transfected bacteria contain what is expected.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''bacillus'' and]] [[Team:Cambridge/Protocols/TransformationofE.coli|e.coli with lux genes from 2010]]'''<br />
<br />
----<br />
<br />
*Progress so far: (1) made 25ug/ml chloramphenicol plates; (2) Transformed E. coli and B. subtilis using the corresponding [[Team:Cambridge/Protocols| Protocols]] with the Vibrio LuxBrick from Cambridge 2010 ([http://partsregistry.org/Part:BBa_K325909 BBa_K325909]); (3) Plated the transformed cells and incubate at 37 degrees celsius overnight<br />
*Nanodrop was used to determine the concentration of DNA in the biobrick after resuspension. The result reading was 103ng/ul.<br />
<br />
<br />
==Week 7==<br />
===Thursday (09/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/Chemicallycompetentcells|Making chemically competent e.coli]]'''<br />
<br />
----<br />
<br />
* [[Team:Cambridge/Protocols/SOB|SOB]] made up.<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of positive control fragments]]'''<br />
<br />
----<br />
<br />
*Gibson positive control fragments are amplified using PCR<br />
<br />
:* sfGFP from sfGFP-ampR (~700bp)<br />
<br />
:* pSB4K5 backbone which confers kanamycin resistance (~3.3kb)<br />
<br />
*Results: successful amplification; sfGFP (lanes 1-3); pSB4K5 (lanes 4-6)<br />
<br />
'''Ratiometrica-Lux: [[Team:Cambridge/Protocols/PCRcolony|PCR of Lux vector]]<br />
<br />
----<br />
<br />
* Split mOrange vector amplification attempted again.<br />
<br />
*Results: no bands again.<br />
<br />
===Friday (10/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/Chemicallycompetentcells|Making chemically competent e. coli]]'''<br />
<br />
----<br />
<br />
*[[Team:Cambridge/Protocols/GlycerolStocks|Glycerol stocks]] of TOP10 are made competent, aliquoted into 1.5mL eppendorfs in two batches and stored in SOB at -80&deg;C<br />
<br />
*50&mu;l are transformed with pUC19 control and plated on LB agar plates to test for competence<br />
<br />
===Sunday (12/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Assembly of sfGFP construct from known functional DNA fragments]]'''<br />
<br />
----<br />
<br />
*Fragments provided by [[Team:Cambridge/Team|Fernan]] assembled with Gibson.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of e.coli with fluorescent construct and sfGFP positive control]]'''<br />
<br />
----<br />
<br />
*Chemically competent e.coli cells transformed with fluorescent construct Gibson product from 07/08/12.<br />
<br />
*E.coli cells also transformed with sfGFP Gibson product made earlier today in triplicate.<br />
<br />
*All transformants plated out on 100 &mu;g/ml ampicillin.<br />
<br />
*sfGFP fragments have produced successful Gibson products in the past, so this will act as our positive control. If cells grow with the plasmid and fluoresce properly, we will know the master mix works. Otherwise, we will remake the master mix.<br />
<br />
*Results: there is growth on the ampicillin plates but very little- we suspect a problem with positive control fragments DNA concentration being too low. (13/8/12)<br />
<br />
==Week 8==<br />
===Tuesday (14/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of positive control]]'''<br />
<br />
----<br />
<br />
*Fragments from [[Team:Cambridge/Lab_book/Week_7#Thursday_.2809.2F08.2F12.29|Tom's PCR]] from last week are used: the PSB4K5 backbone (in triplicates), and sfGFP from sfGFP-ampR (in triplicates)<br />
<br />
*Protocol changed slightly: 0.5 &mu;l of each DNA fragment solution mixed in with master mix to make up 4 &mu;l total volume (1&mu;l DNA and 3&mu;l master mix).<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of e.coli with positive control DNA]]'''<br />
<br />
----<br />
<br />
*Chemically competent e.coli cells transformed with plasmid DNA produced by Gibson assembly step.<br />
<br />
*Transformants plated out on 50 &mu;g/ml kanomycin plates. Incubated overnight at 37 &deg;C.<br />
<br />
===Wednesday (15/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of positive control fragments]]'''<br />
<br />
----<br />
<br />
*A replication of [[Team:Cambridge/Lab_book/Week_7#Thursday_.2809.2F08.2F12.29|last week's PCR]],except each fragment is done 5 times to generate more fragments so that the positive control could be used for future experiments<br />
<br />
*Results: successful amplification of all fragments.<br />
<br />
'''[[Team:Cambridge/Protocols/GelExtractionofDNA|Extraction of positive control DNA]]'''<br />
<br />
----<br />
<br />
*Positive control DNA from gel excised and purified.<br />
<br />
*Additional elution steps used to concentrate resultant solution: eluants are recycled at least once into the spin column<br />
<br />
*Verified with nanodropper - final DNA concentrations are around 20ng/ul for first eluants, and 15ng/ul for second eluants; this is twice as concentrated as before<br />
<br />
'''[[Team:Cambridge/Protocols/Gibsonassembly|Gibson assembly of positive control DNA]]'''<br />
<br />
----<br />
<br />
* A combination of fragments from the PCR are chosen: the highest, second highest, third highest, lowest concentration first eluants, and the highest concentration second eluants are put together<br />
<br />
* Reading that our T5 exonuclease concentration in Gibson assembly may be too high, we made up some mastermix with 1/5 of the T5 exo concentration and tested that in parallel with the fragments of various concentrations (2x5 = 10 Gibson reactions in total)<br />
<br />
* Results: Successful Gibson assembly reactions. The lowered T5 exo conc seems to lower the Gibson efficiency, and the more concentrated fragments seem to produce more colonies.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofE.coli|Transformation of positive control DNA into e.coli]]'''<br />
<br />
----<br />
<br />
*Chemically competent e.coli transformed with positive control Gibson products made previously.<br />
<br />
*Transformants plated out onto 50 &mu;g/ml kanomycin plates and incubated at 37 &deg;C overnight.<br />
<br />
== Week 9 ==<br />
<br />
===Tuesday (21/08/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of positive control]]'''<br />
<br />
----<br />
<br />
*Our order of Phusion has arrived- though we are still not confident with our PCR so we decided to first test with sfGFP<br />
<br />
*Standard PCR conditions are used<br />
<br />
*Results: success<br />
<br />
== Week 10 ==<br />
'''Gibson efficiency diagnostics'''<br />
<br />
----<br />
<br />
*We decided to try to get to the bottom of why our Gibson assembly is so inefficient. Until this is fixed, we won't be able to do anything higher than 2-part reactions.<br />
<br />
*PJ, a member of the Haseloff lab whose gibson assemblies are working efficiently agreed to help us. Using our control fragments, PJ assembled them with our master mix and his master mix, and transformed them into his competent E.coli. Similarly, we assembled our fragments (from the same tube) with our master mix, but using his competent cells and our competent cells. This should show us if there is a problem with our mix or cells.<br />
<br />
== Week 11==<br />
===Monday (03/09/12)===<br />
<br />
'''Further Gibson diagnostics'''<br />
<br />
No difference between PJs cells and my cells, or PJs master mix and mine, but he still obtains > 10x higher efficiencies.<br />
<br />
Tonight, we both assembled with my positive control again, but this time used our plates and his plates to plate the cells, to check for any difference there.<br />
<br />
===Tuesday (04/09/12)===<br />
<br />
'''Further Gibson Diagnostics'''<br />
<br />
Considered it might be the PCR machine. Theirs is a hot-block, ours is a hot-air/centrifuge - type. This allows them to transfer reactions from ice to 50 C rapidly by preheating the block, theoretically making them much better able to limit the activity of the T5 exonuclease (which should only chew away a couple of dozen bases from the 3', ideally).<br />
<br />
Direct comparison of their PCR machine and ours for another assembly with our positive control.<br />
<br />
===Wednesday (05/09/12)===<br />
'''Further Gibson diagnostics'''<br />
<br />
Direct comparison between PCR machines showed a >10x difference in efficiency. We have isolated most of our efficiency problems to our PCR machine.<br />
<br />
==Week 12==<br />
===Monday (10/09/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of biobrick vector DNA]]'''<br />
<br />
----<br />
<br />
*Attempted to run PCR of the backbone for the biobricks once more. Settings: Annealing temperature: 56&deg;C, elongation time: 30secs.<br />
<br />
*After running on gel, saw that while the -8 vector amplification appears to be producing some correctly sized (~2kb) bands, the other two only seem to be forming many primer dimers. Analysis of the sequence of the prefix and suffix revealed a CG palindrome that appears to be causing self annealing. Inserts are not affected, as they have the palindrome at the 5' end of the primer.<br />
<br />
*Will retry at higher temperatures tomorrow.<br />
<br />
===Tuesday (11/09/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/PCRProtocol|PCR of biobrick backbone]]'''<br />
<br />
----<br />
<br />
*Retried PCR of backbone for +8 magnesium riboswitch biobrick and fluoride biobrick at 60 &deg;C and 64 &deg;C.<br />
<br />
*Verification gel showed that no bands of the appropriate size came out. Once more, only primer dimers produced.<br />
<br />
*Production of primer dimers at these temperatures causes us to doubt that a successful PCR will be carried out at these temperatures. We may have to switch to ordinary ligation to construct our biobricks for submission.<br />
<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Overview/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Emmyfthttp://2012.igem.org/Team:Cambridge/Overview/LabbookTeam:Cambridge/Overview/Labbook2012-10-27T02:24:01Z<p>Emmyft: /* Week 3= */</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/HumanPractices/Overview");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= General Labbook =<br />
<br />
==Week 3==<br />
<br />
===Monday (09/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Making ''bacillus'' competent]]'''<br />
<br />
----<br />
<br />
*'''Bacillus salts''' *10 made up and autoclaved.<br />
<br />
*'''Medium A base''' *10 made up (glucose will be added tomorrow)<br />
<br />
*''bacillus'' strain 168 streaked out and grown on plate overnight.<br />
<br />
===Tuesday (10/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Making ''bacillus'' competent]]'''<br />
<br />
----<br />
<br />
*Filtered glucose added to sterile '''Medium A base'''.<br />
<br />
*Sterile aliquots of salts and medium apportioned and put in fridge (10*50ml each)<br />
<br />
*Needed to make up MgCl2 and CaCl2 solutions of the correct concentrations. Required multiple dilution steps:<br />
<br />
:*MgCl2 (250nM), Mr = 147 Da, make 100ml of solution<br />
<br />
::*0.508g of MgCl2 dissolved in 100ml of H2O<br />
<br />
::*1ml of this solution mixed with 99ml of H2O<br />
<br />
::*0.1ml of this solution mixed with 99.9ml of H2O<br />
<br />
:*CaCl2 (50mM), Mr = 203.3 Da, make 100ml of solution<br />
<br />
::*0.735g of CaCl2 dissolved in 100ml of H2O<br />
<br />
*Made up '''Medium A''' (150ml) and '''Medium B''' (50ml)<br />
<br />
===Wednesday (11/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Making ''bacillus'' competent]]'''<br />
<br />
----<br />
<br />
*Colonies of strain 168 removed from plate and added to three separate conical flasks, each with 48ml of '''Medium A''' inside. OD650 readings taken until enough cells were added such that absorbance was between 0.1 and 0.2. [[File:Bsubgrowth.png|250px|''bacillus'' growth curves|thumb|right]]<br />
<br />
*Flasks placed inside a shaking incubator (200rpm) and samples taken every 20mins until growth had leveled off, as determined by the concurrently plotted growth curves.<br />
<br />
*Growth curves, as well as t0 (at 170mins) plotted:<br />
<br />
*90 mins after t0 (at 260 mins), cells removed from shaking incubator.<br />
<br />
*0.45ml of '''Medium B''' pre-warmed in Eppendorf tubes.<br />
<br />
*20 individual samples of 0.05ml taken from each growth flask and added to Eppendorfs.<br />
<br />
*Eppendorfs placed back in shaking incubator for 60 mins with lids off.<br />
<br />
*Eppendorfs centrifuged at ~13000 rpm for 10 mins, supernatant removed.<br />
<br />
*60% glycerol added (0.5ml/tube) and tubes vortexed.<br />
<br />
*All 60 tubes now frozen at -80 &deg;C.<br />
<br />
*Edited protocol so that it actually works.<br />
<br />
[[Image:lightsensorgraph.jpg|400px|left|thumb|Graph of light intensity response aginst time. The LDR was covered at 50 and released at 100]]<br />
<br />
'''Arduino circuitry'''<br />
<br />
----<br />
<br />
*Real-Time image captured by our freshly made primitive software, monitoring a light sensor on an arduino board. C++ was used to communicate with the Arduino and Python was used for data logging.<br />
<br />
===Thursday (12/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Test transformation of frozen ''bacillus'' stocks]]'''<br />
<br />
----<br />
<br />
*Two samples of ''bacillus'' defrosted from different batches.<br />
<br />
*Supernatant spun off, bacterial pellet isolated and 0.1ml of '''Medium B''' added.<br />
<br />
*Plasmid Tag RFP-T unfrozen. Concentration of DNA = 360ng/&mu;l, so 2&mu;l needed for the desired 0.6&mu;g of DNA. DNA added to bacteria.<br />
<br />
*Eppendorfs placed in shaking incubator at 30 &deg;C and 180rpm for 60 mins.<br />
<br />
*Bacteria plated on choramphenicol containing plates. Aseptic technique was used as far as possible.<br />
<br />
===Friday (13/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Test transformation of ''bacillus'' stocks]]'''<br />
<br />
----<br />
<br />
[[File:Plate.jpg|250px|right|thumb|lovely pink colonies]]<br />
<br />
*Results: In this image, several colonies have clearly gained pink coloration from the transfected plasmid. This demonstrates that our stocks should be usable. However, the large number of opportunistic colonies that do not appear to have been transfected means that we will have to be careful to check that our transfected bacteria contain what is expected.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''bacillus'' and]] [[Team:Cambridge/Protocols/TransformationofE.coli|e.coli with lux genes from 2010]]'''<br />
<br />
----<br />
<br />
*Progress so far: (1) made 25ug/ml chloramphenicol plates; (2) Transformed E. coli and B. subtilis using the corresponding [[Team:Cambridge/Protocols| Protocols]] with the Vibrio LuxBrick from Cambridge 2010 ([http://partsregistry.org/Part:BBa_K325909 BBa_K325909]); (3) Plated the transformed cells and incubate at 37 degrees celsius overnight<br />
*Nanodrop was used to determine the concentration of DNA in the biobrick after resuspension. The result reading was 103ng/ul.<br />
<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Overview/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Emmyfthttp://2012.igem.org/Team:Cambridge/Overview/LabbookTeam:Cambridge/Overview/Labbook2012-10-27T02:23:51Z<p>Emmyft: Created page with "{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}} <html> <script type="text/javascript"> $(document).keydown(function(e){ //e.which is set by jQuery for those browsers t..."</p>
<hr />
<div>{{Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEW}}<br />
<br />
<html><br />
<br />
<script type="text/javascript"><br />
$(document).keydown(function(e){<br />
<br />
//e.which is set by jQuery for those browsers that do not normally support e.keyCode.<br />
var keyCode = e.keyCode || e.which;<br />
<br />
<br />
//up<br />
if (keyCode == 38) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/HumanPractices/Overview");<br />
}<br />
<br />
//down<br />
if (keyCode == 40) <br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Ribosense/Labbook");<br />
}<br />
<br />
//left<br />
if (keyCode == 37)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Parts");<br />
}<br />
<br />
//right<br />
if (keyCode == 39)<br />
{<br />
window.location.assign("https://2012.igem.org/Team:Cambridge/Overview/Results");<br />
}<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id="vertnav"><br />
<a href="/Team:Cambridge/HumanPractices/Overview"><br />
<div id="vert_HP" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="vert_OV_on" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ribosense/Labbook"><br />
<div id="vert_RS" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Ratiometrica/Labbook"><br />
<div id="vert_RM" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Biologger/Labbook"><br />
<div id="vert_BL" class="vert_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/SD/Labbook"><br />
<div id="vert_SD" class="vert_nav"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<div id="template_content"><br />
<br />
</html><br />
<br />
= General Labbook =<br />
<br />
==Week 3===<br />
<br />
===Monday (09/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Making ''bacillus'' competent]]'''<br />
<br />
----<br />
<br />
*'''Bacillus salts''' *10 made up and autoclaved.<br />
<br />
*'''Medium A base''' *10 made up (glucose will be added tomorrow)<br />
<br />
*''bacillus'' strain 168 streaked out and grown on plate overnight.<br />
<br />
===Tuesday (10/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Making ''bacillus'' competent]]'''<br />
<br />
----<br />
<br />
*Filtered glucose added to sterile '''Medium A base'''.<br />
<br />
*Sterile aliquots of salts and medium apportioned and put in fridge (10*50ml each)<br />
<br />
*Needed to make up MgCl2 and CaCl2 solutions of the correct concentrations. Required multiple dilution steps:<br />
<br />
:*MgCl2 (250nM), Mr = 147 Da, make 100ml of solution<br />
<br />
::*0.508g of MgCl2 dissolved in 100ml of H2O<br />
<br />
::*1ml of this solution mixed with 99ml of H2O<br />
<br />
::*0.1ml of this solution mixed with 99.9ml of H2O<br />
<br />
:*CaCl2 (50mM), Mr = 203.3 Da, make 100ml of solution<br />
<br />
::*0.735g of CaCl2 dissolved in 100ml of H2O<br />
<br />
*Made up '''Medium A''' (150ml) and '''Medium B''' (50ml)<br />
<br />
===Wednesday (11/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Making ''bacillus'' competent]]'''<br />
<br />
----<br />
<br />
*Colonies of strain 168 removed from plate and added to three separate conical flasks, each with 48ml of '''Medium A''' inside. OD650 readings taken until enough cells were added such that absorbance was between 0.1 and 0.2. [[File:Bsubgrowth.png|250px|''bacillus'' growth curves|thumb|right]]<br />
<br />
*Flasks placed inside a shaking incubator (200rpm) and samples taken every 20mins until growth had leveled off, as determined by the concurrently plotted growth curves.<br />
<br />
*Growth curves, as well as t0 (at 170mins) plotted:<br />
<br />
*90 mins after t0 (at 260 mins), cells removed from shaking incubator.<br />
<br />
*0.45ml of '''Medium B''' pre-warmed in Eppendorf tubes.<br />
<br />
*20 individual samples of 0.05ml taken from each growth flask and added to Eppendorfs.<br />
<br />
*Eppendorfs placed back in shaking incubator for 60 mins with lids off.<br />
<br />
*Eppendorfs centrifuged at ~13000 rpm for 10 mins, supernatant removed.<br />
<br />
*60% glycerol added (0.5ml/tube) and tubes vortexed.<br />
<br />
*All 60 tubes now frozen at -80 &deg;C.<br />
<br />
*Edited protocol so that it actually works.<br />
<br />
[[Image:lightsensorgraph.jpg|400px|left|thumb|Graph of light intensity response aginst time. The LDR was covered at 50 and released at 100]]<br />
<br />
'''Arduino circuitry'''<br />
<br />
----<br />
<br />
*Real-Time image captured by our freshly made primitive software, monitoring a light sensor on an arduino board. C++ was used to communicate with the Arduino and Python was used for data logging.<br />
<br />
===Thursday (12/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Test transformation of frozen ''bacillus'' stocks]]'''<br />
<br />
----<br />
<br />
*Two samples of ''bacillus'' defrosted from different batches.<br />
<br />
*Supernatant spun off, bacterial pellet isolated and 0.1ml of '''Medium B''' added.<br />
<br />
*Plasmid Tag RFP-T unfrozen. Concentration of DNA = 360ng/&mu;l, so 2&mu;l needed for the desired 0.6&mu;g of DNA. DNA added to bacteria.<br />
<br />
*Eppendorfs placed in shaking incubator at 30 &deg;C and 180rpm for 60 mins.<br />
<br />
*Bacteria plated on choramphenicol containing plates. Aseptic technique was used as far as possible.<br />
<br />
===Friday (13/07/12)===<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Test transformation of ''bacillus'' stocks]]'''<br />
<br />
----<br />
<br />
[[File:Plate.jpg|250px|right|thumb|lovely pink colonies]]<br />
<br />
*Results: In this image, several colonies have clearly gained pink coloration from the transfected plasmid. This demonstrates that our stocks should be usable. However, the large number of opportunistic colonies that do not appear to have been transfected means that we will have to be careful to check that our transfected bacteria contain what is expected.<br />
<br />
'''[[Team:Cambridge/Protocols/TransformationofB.subtilis|Transformation of ''bacillus'' and]] [[Team:Cambridge/Protocols/TransformationofE.coli|e.coli with lux genes from 2010]]'''<br />
<br />
----<br />
<br />
*Progress so far: (1) made 25ug/ml chloramphenicol plates; (2) Transformed E. coli and B. subtilis using the corresponding [[Team:Cambridge/Protocols| Protocols]] with the Vibrio LuxBrick from Cambridge 2010 ([http://partsregistry.org/Part:BBa_K325909 BBa_K325909]); (3) Plated the transformed cells and incubate at 37 degrees celsius overnight<br />
*Nanodrop was used to determine the concentration of DNA in the biobrick after resuspension. The result reading was 103ng/ul.<br />
<br />
<br />
<html><br />
<br />
</div><br />
<br />
<div id="hornav"><br />
<br />
<a href="/Team:Cambridge/Overview/Parts"><br />
<div id="leftarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Overview"><br />
<div id="hor_overview" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/DesignProcess"><br />
<div id="hor_designprocess" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Parts"><br />
<div id="hor_parts" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Labbook"><br />
<div id="hor_labbook_on" class="hor_nav"><br />
</div><br />
</a><br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="hor_results" class="hor_nav"><br />
</div><br />
</a><br />
<br />
<a href="/Team:Cambridge/Overview/Results"><br />
<div id="rightarrow" class="hor_nav_arrow"><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
</html><br />
<br />
{{Template:Team:Cambridge/CAM_2012_TEMPLATE_FOOTNEW}}</div>Emmyfthttp://2012.igem.org/Template:Team:Cambridge/CAM_2012_TEMPLATE_HEADNEWTemplate:Team:Cambridge/CAM 2012 TEMPLATE HEADNEW2012-10-27T02:02:57Z<p>Emmyft: </p>
<hr />
<div><html><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.8.2/jquery.min.js"></script><br />
<br />
<style type ='text/css'><br />
/* Wiki Hacks - START */<br />
/* Author: Pieter van Boheemen */<br />
/* Team: TU Delft */<br />
#globalWrapper { background-color: transparent; border: none; margin: 0; padding: 0; width: 100%; height:100%;}<br />
#content { background-color: transparent; border: none; padding: 0; margin: 0; width: 100%; overflow: scroll; height:100%;}<br />
#bodyContent { border: none; padding:0; margin:0; width:100%; height:100%;}<br />
#top-section { height: 15px; margin: 0px; margin-left: auto; margin-right: auto; margin-bottom: 0 !important;<br />
padding:0; border: none; font-size: 10px;}<br />
#p-logo { height:1px; overflow:scroll; display: none;}<br />
#search-controls { overflow:hidden; display:block; background: none; position: absolute; top: 100px; right: 40px;}<br />
#footer-box { width: 100%; margin: -10px auto 0 auto; padding: 20px 0;}<br />
.visualClear { display: none; }<br />
#footer { border: none; width: 965px; margin: 0 auto; padding: 0;}<br />
.firstHeading { display: none;}<br />
#f-list a { color: #333; font-size: 10px;}<br />
#f-list a:hover { color: #666;}<br />
.printfooter { display: none; }<br />
#footer ul { margin: 0; padding: 0;}<br />
#footer ul li { margin-top: 0; margin-bottom: 0; margin-left: 10px; margin-right: 10px; padding: 0;}<br />
#search-controls { display:none; }<br />
h3#siteSub { display: none;}<br />
#contentSub {display: none;}<br />
p:first-child { display: none;}<br />
/* Wiki Hacks - END */<br />
</style><br />
<br />
<link rel='stylesheet' type='text/css' href='/Team:Cambridge/static/wiki_splash.css?action=raw&ctype=text/css'/> <br />
<br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
<br />
$('#abstract').css("display","none");<br />
<br />
$('#abstract_button').click(function() {<br />
$('#abstract').fadeIn(100);<br />
});<br />
<br />
$('#abstractclose').click(function() {<br />
$('#abstract').fadeOut(100);<br />
});<br />
<br />
$('#judgingform').css("display","none");<br />
<br />
$('#judging_button').click(function() {<br />
$('#judgingform').fadeIn(100);<br />
});<br />
<br />
$('#judgingclose').click(function() {<br />
$('#judgingform').fadeOut(100);<br />
});<br />
<br />
<br />
});<br />
<br />
</script><br />
<br />
<div id='cam_page'><br />
<div id='wrapper_template'><br />
<div id='top'><br />
<a href="/Team:Cambridge"><br />
<div id='homepage'><br />
</div><br />
</a><br />
<br />
<div id='abstract_button'><br />
</div><br />
<br />
<div id='judging_button'><br />
</div><br />
<br />
</div><br />
<br />
<div id='main'><br />
<br />
<div id='abstract' style='padding:10px;'><br />
<h8 style="color:black; background-color:white;">Parts for a reliable and field ready biosensing platform</h8><br />
<p><h9 style="color:black; background-color:white;">Implementation of biosensors in real world situations has been made difficult by the unpredictable and non-quantified outputs of existing solutions, as well as a lack of appropriate storage, distribution and utilization systems. This leaves a large gap between a simple, functional sensing mechanism and a fully realised product that can be used in the field. We aim to bridge this gap at all points by developing a standardised ratiometric luciferase output in a Bacillus chassis. This output can be linked up with prototyped instrumentation and software for obtaining reliable quantified results. Additionally, we have reduced the specialized requirements for the storage and distribution of our bacteria by using Bacillus' sporulation system. To improve the performance of our biosensing platform we have genetically modified Bacillus’ germination speed. Lastly, we demonstrated the robustness of our system by testing it with a new fluoride riboswitch, providing the opportunity to tackle real life problems.<br />
<div id='abstractclose' style='position: absolute; top: 300px; left: 10px;'> <h9 style="color:black; background-color:white;"> >> Return to page </h9></div><br />
</div><br />
<br />
<div id='judgingform' style='padding:10px;'><br />
<br />
<div id='judgingclose'> <h9 style="color:black; background-color:white;"> >> Return to page </h9></div><br />
<br />
<div id='judgingtext'><br />
</html><br />
<br />
<br />
=Judging Form=<br />
<br />
*Please help the judges by filling out this form. Tell them what medal you think you deserve and why. Tell them which special prizes you should win. Help them find your best parts. Show them how you thought about the safety of your project. Helping the judges will help you too.<br />
<br />
----<br />
<br />
*Team: Cambridge<br />
*Region: Europe<br />
*iGEM Year:2012<br />
*Track:Foundational Advance<br />
*Project Name:Parts for a reliable and field ready biosensing platform<br />
*Project Abstract: Implementation of biosensors in real world situations has been made difficult by the unpredictable and non-quantified outputs of existing solutions, as well as a lack of appropriate storage, distribution and utilization systems. This leaves a large gap between a simple, functional sensing mechanism and a fully realised product that can be used in the field.<br /><br /> We aim to bridge this gap at all points by developing a standardised ratiometric luciferase output in a Bacillus chassis. This output can be linked up with prototyped instrumentation and software for obtaining reliable quantified results. Additionally, we have reduced the specialized requirements for the storage and distribution of our bacteria by using Bacillus' sporulation system. To improve the performance of our biosensing platform we have genetically modified Bacillus’ germination speed. Lastly, we demonstrated the robustness of our system by testing it with a new fluoride riboswitch, providing the opportunity to tackle real life problems. <br />
<br />
[https://2012.igem.org/Team:Cambridge Back to wiki]<br />
<br />
<br />
== iGEM Medals for non-software teams==<br />
<br />
*We believe our team deserves the following medal:<br />
** Bronze<br />
** Silver<br />
** &radic;Gold<br />
Because we met the following criteria (check all that apply and provide details where needed)<br />
<br />
===Requirements for a Bronze Medal===<br />
*&radic;Register the team, have a great summer, and plan to have fun at the Regional Jamboree.<br />
*&radic;Successfully complete and submit this iGEM 2012 Judging form.<br />
*&radic;Create and share a Description of the team's project using the iGEM wiki and the team's parts using the Registry of Standard Biological Parts.<br />
*&radic;Plan to present a Poster and Talk at the iGEM Jamboree.<br />
*&radic;Enter information detailing at least one new standard BioBrick Part or Device in the Registry of Standard Biological Parts. Including:<br />
**&radic;Primary nucleaic acid sequence<br />
**&radic;Description of function<br />
**&radic;Authorship<br />
**Safety notes, if relevant.<br />
**&radic;Acknowedgment of sources and references<br />
*&radic;Submit DNA for at least one new BioBrick Part or Device to the Registry.<br />
<br />
===Additional Requirements for a Silver Medal===<br />
*&radic;Demonstrate that at least one new BioBrick Part or Device of your own design and construction works as expected; characterize the operation of your new part/device.<br />
*&radic;Enter this information and other documentation on the part's 'Main Page' section of the Registry <br />Part Number(s): [http://partsregistry.org/Part:BBa_K911004 BBa_K911004]<br />
<br />
===Additional Requirements for a Gold Medal: (one OR more)===<br />
*Improve an existing BioBrick Part or Device and enter this information back on the Experience Page of the Registry.<br />Part Number(s): None<br />
*&radic;Help another iGEM team by, for example, characterizing a part, debugging a construct, or modeling or simulating their system.<br />Link to this information on your wiki. Page name: [https://2012.igem.org/Team:Cambridge/Outreach/Collaboration Team:Cambridge/Outreach/Collaboration]<br />
*&radic;Outline and detail a new approach to an issue of Human Practice in synthetic biology as it relates to your project, such as safety, security, ethics, or ownership, sharing, and innovation.<br />Link to this information on your wiki. <br />Page name: [https://2012.igem.org/Team:Cambridge/HumanPractices/Overview Team:Cambridge/HumanPractices/Overview],[https://2012.igem.org/Team:Cambridge/HumanPractices/MarketResearch Team:Cambridge/HumanPractices/MarketResearch],[https://2012.igem.org/Team:Cambridge/HumanPractices/FutureDirections Team:Cambridge/HumanPractices/FutureDirections]<br />
<br />
[https://2012.igem.org/Team:Cambridge Back to wiki]<br />
<br />
==iGEM Prizes==<br />
All teams are eligible for special prizes at the Jamborees. [https://2012.igem.org/Judging' more...] To help the judges, please indicate if you feel you should be evaluated for any of the following special prizes:<br />
*&radic;Best Human Practice Advance<br />
*&radic;Best Experimental Measurement<br />
*Best Model<br />
<br />
===Please explain briefly why you should receive any of these special prizes:===<br />
<br />
'''Best Human Practice Advance:'''<br />
<br />
We feel that we deserve this prize for three reasons: <br />
# We explored the impacts, *both positive and negative*, of synthetic biology as a solution to real world problems, through interviewing professionals working in a relevant field, namely the impact of arsenic water contamination in Bangladesh. <br />
# We recognized existing problems with the way the current direction of synthetic. On going through the registry we found that most of the characterization data for biosensing parts is often neither comparable nor replicable. We have worked to solve this issue, for example with our ratiometric dual channel output. <br />
# *Our project doesn’t stop here*, in Chanel number 6 ([https://2012.igem.org/Team:Cambridge/HumanPractices/FutureDirections Team:Cambridge/HumanPractices/FutureDirections]) we considered the future implications and technological applications of our project, as well as the means by which it could be improved by subsequent users. We feel that the end to an iGEM project should not be the conclusion of an idea, but the start of it.<br />
<br />
'''Best BioBrick Measurement Approach:'''<br />
<br />
It is absolutely vital that a quantitative, numerical, robust, and flexible measurement approach exists to relay information to a user that is an accurate representation of the input processed by a biological device. Working from these principles, the following was done:<br />
# We designed and built Biologger, a *cheap, arduino-based, fully functional automatic rotary device* that has an incorporated ratiolumnometer<br />
# Our project is entirely open-sourced and open-platform. We have published source code for the two applications which serve to operate the device, one for PCs and the other for Android devices, as well as the open source circuit design that provides this ratiometric reading. Furthermore, the Android app is able to receive its data wirelessly, which we feel is a great advance in BioBrick measurement. <br />
# Our dual-channel luciferase reporter was successfully tested with a dilution series of E.coli transformed with the Lux Operon (under pBAD) biobrick (Part BBa_K325909) of the Cambridge iGEM 2010 team. It can detect, with good accuracy, both different light intensities, as well as the percentages of blue or orange frequencies in a sample. <br />
# Our device was successfully tested using artificial light to detect different frequencies (colours) as well.<br />
Having done all the above, we believe that this fully open-sourced instrumentation kit (mechanical) chassis, electronics, software code), estimated at *$35.00* (or $85.00 if a Bluetooth modem is required), is a complete BioBrick measurement solution for any and all BioBricks with a light output.<br />
<br />
[https://2012.igem.org/Team:Cambridge Back to wiki]<br />
<br />
==Team_Parts==<br />
To help the judges evaluate your parts, please identify 3 of your parts that you feel are best documented and are of the highest quality. <br />
*;Best new BioBrick part (natural): [http://partsregistry.org/Part:BBa_K911003 BBa_K911003]<br />
*;Best new BioBrick part (engineered): [http://partsregistry.org/Part:BBa_K911004 BBa_K911004]<br />
*Best improved part(s): None<br />
<br />
List any other parts you would like the judges to examine:[http://partsregistry.org/Part:BBa_K911001 BBa_K911001], [http://partsregistry.org/Part:BBa_K911008 BBa_K911009], [http://partsregistry.org/Part:BBa_K911008 BBa_K911008]<br />
<br />
Please explain briefly why the judges should examine these other parts:<br />
* '''Magnesium Sensitive Riboswitch [http://partsregistry.org/Part:BBa_K911001 BBa_K911001]'''<br />As a riboswitch sensing construct, this part is an entirely new type of biosensor (along with the fluoride construct) that could potentially change the way we think about designing input genetic circuits. Unlike the fluoride riboswitch, it is a derepression system and therefore serves to demonstrate the principle that riboswitches can be used regardless of whether they turn on or off their reporter.<br />
* '''Fluorescent ratiometric construct for standardizing promoter output [http://partsregistry.org/Part:BBa_K911009 BBa_K911009]''' <br />Fluorescence is a major cornerstone for biosensors in the registry, however, most parts do not involve the use of a ratiometric output, which has been shown in the literature to provide much more reliable and meaningful data. This part not only furthers the development of ratiometric measurements in molecular biology but due to the choice of promoters and terminators it can be used to characterize the difference in activity between E. coli and B. Subtilis<br />
* '''Fast Germination (B. subtilis) [http://partsregistry.org/Part:BBa_K911008 BBa_K911008]'''<br />This part is entirely novel for the registry and fully utilizes the recombination machinery inherent in the Bacillus chassis. Have spores that can germinate at a faster rate is certainly a worthy achievement and could help with experiments with B. Subtilis that any future iGEM teams may wish to perform.<br />
<br />
[https://2012.igem.org/Team:Cambridge Back to wiki]<br />
<br />
==iGEM Safety==<br />
For iGEM 2012 teams are asked to detail how they approached any issues of biological safety associated with their projects.<br />
<br />
The iGEM judges expect that you have answered the four safety questions [https://2012.igem.org/Safety Safety page] on your iGEM 2012 wiki.<br />
<br />
Please provide the link to that page:<br />
Page name: [https://2012.igem.org/Team:Cambridge/Safety Team:Cambridge/Safety]<br />
<br />
==Attribution and Contributions==<br />
For iGEM 2012 the description of each project must clearly attribute work done by the team and distinguish it from work done by others, including the host labs, advisors, and instructors.<br />
<br />
Please provide the link to that page, or comments in the box below:<br />
Page name: [https://2012.igem.org/Team:Cambridge/Attributions Team:Cambridge/Attributions]<br />
<br />
==Comments==<br />
If there is any other information about your project you would like to highlight for the judges, please provide a link to your wiki page here: [https://2012.igem.org/Team:Cambridge/Overview/DesignProcess Team:Cambridge/Overview/DesignProcess]<br />
<br />
<html><br />
</div><br />
</div><br />
<br />
<br />
</html></div>Emmyfthttp://2012.igem.org/Team:CambridgeTeam:Cambridge2012-10-27T02:00:02Z<p>Emmyft: </p>
<hr />
<div><html><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<style type ='text/css'><br />
/* Wiki Hacks - START */<br />
/* Author: Pieter van Boheemen */<br />
/* Team: TU Delft */<br />
#globalWrapper { background-color: transparent; border: none; margin: 0; padding: 0; width: 100%; height:100%;}<br />
#content { background-color: transparent; border: none; padding: 0; margin: 0; width: 100%; overflow: scroll; height:100%;}<br />
#bodyContent { border: none; padding:0; margin:0; width:100%; height:100%;}<br />
#top-section { height: 15px; margin: 0px; margin-left: auto; margin-right: auto; margin-bottom: 0 !important;<br />
padding:0; border: none; font-size: 10px;}<br />
#p-logo { height:1px; overflow:scroll; display: none;}<br />
#search-controls { overflow:hidden; display:block; background: none; position: absolute; top: 100px; right: 40px;}<br />
#footer-box { width: 100%; margin: -10px auto 0 auto; padding: 20px 0;}<br />
.visualClear { display: none; }<br />
#footer { border: none; width: 965px; margin: 0 auto; padding: 0;}<br />
.firstHeading { display: none;}<br />
#f-list a { color: #333; font-size: 10px;}<br />
#f-list a:hover { color: #666;}<br />
.printfooter { display: none; }<br />
#footer ul { margin: 0; padding: 0;}<br />
#footer ul li { margin-top: 0; margin-bottom: 0; margin-left: 10px; margin-right: 10px; padding: 0;}<br />
#search-controls { display:none; }<br />
h3#siteSub { display: none;}<br />
#contentSub {display: none;}<br />
p:first-child { display: none;}<br />
/* Wiki Hacks - END */<br />
</style><br />
<br />
<link rel='stylesheet' type='text/css' href='/Team:Cambridge/static/wiki_splash.css?action=raw&ctype=text/css'/> <br />
<br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
<br />
$('.splash_over').css("display","none");<br />
<br />
$('#HP').mouseover(function() {<br />
$('#HP').css("background", "url('https://static.igem.org/mediawiki/2012/c/ce/CAMV2_HP.jpg') no-repeat");<br />
$('#HP h8').css("background-color","white");<br />
$('#HP h9').css("background-color","white");<br />
$('#HP h9').css("color","black");<br />
});<br />
<br />
$('#HP').mouseleave(function() {<br />
$('#HP').css("background-image", "none");<br />
$('#HP h8').css("background-color","black");<br />
$('#HP h9').css("background-color","black");<br />
$('#HP h9').css("color","white");<br />
});<br />
<br />
$('#OV').mouseover(function() {<br />
$('#OV').css("background", "white no-repeat");<br />
$('#OV h8').css("background-color","white");<br />
$('#OV h8').css("color","black");<br />
$('#OV h9').css("background-color","white");<br />
$('#OV h9').css("color","black");<br />
});<br />
<br />
$('#OV').mouseleave(function() {<br />
$('#OV').css("background", "none");<br />
$('#OV h8').css("background-color","black");<br />
$('#OV h8').css("color","white");<br />
$('#OV h9').css("background-color","black");<br />
$('#OV h9').css("color","white");<br />
});<br />
<br />
$('#RS').mouseover(function() {<br />
$('#RS').css("background", "url('https://static.igem.org/mediawiki/2012/9/9e/CAMV2_RS.jpg') no-repeat");<br />
$('#RS h8').css("background-color","white");<br />
$('#RS h9').css("background-color","white");<br />
$('#RS h9').css("color","black");<br />
});<br />
<br />
$('#RS').mouseleave(function() {<br />
$('#RS').css("background-image", "none");<br />
$('#RS h8').css("background-color","black");<br />
$('#RS h9').css("background-color","black");<br />
$('#RS h9').css("color","white");<br />
});<br />
<br />
$('#RM').mouseover(function() {<br />
$('#RM').css("background", "url('https://static.igem.org/mediawiki/2012/2/23/CAMV2_RM.JPG') no-repeat");<br />
$('#RM h8').css("background-color","white");<br />
$('#RM h9').css("background-color","white");<br />
$('#RM h9').css("color","black");<br />
});<br />
<br />
$('#RM').mouseleave(function() {<br />
$('#RM').css("background-image", "none");<br />
$('#RM h8').css("background-color","black");<br />
$('#RM h9').css("background-color","black");<br />
$('#RM h9').css("color","white");<br />
});<br />
<br />
$('#BL').mouseover(function() {<br />
$('#BL').css("background", "url('https://static.igem.org/mediawiki/2012/e/e1/CAMV2_BL.jpg') no-repeat");<br />
$('#BL h8').css("background-color","white");<br />
$('#BL h9').css("background-color","white");<br />
$('#BL h9').css("color","black");<br />
});<br />
<br />
$('#BL').mouseleave(function() {<br />
$('#BL').css("background-image", "none");<br />
$('#BL h8').css("background-color","black");<br />
$('#BL h9').css("background-color","black");<br />
$('#BL h9').css("color","white");<br />
});<br />
<br />
$('#SD').mouseover(function() {<br />
$('#SD').css("background", "url('https://static.igem.org/mediawiki/2012/8/88/CAMV2_SD.jpg') no-repeat");<br />
$('#SD h8').css("background-color","white");<br />
$('#SD h9').css("background-color","white");<br />
$('#SD h9').css("color","black");<br />
});<br />
<br />
$('#SD').mouseleave(function() {<br />
$('#SD').css("background-image", "none");<br />
$('#SD h8').css("background-color","black");<br />
$('#SD h9').css("background-color","black");<br />
$('#SD h9').css("color","white");<br />
});<br />
<br />
<br />
$('#abstract').css("display","none");<br />
<br />
$('#abstract_button').click(function() {<br />
$('#abstract').fadeIn(100);<br />
});<br />
<br />
$('#abstractclose').click(function() {<br />
$('#abstract').fadeOut(100);<br />
});<br />
<br />
$('#judgingform').css("display","none");<br />
<br />
$('#judging_button').click(function() {<br />
$('#judgingform').fadeIn(100);<br />
});<br />
<br />
$('#judgingclose').click(function() {<br />
$('#judgingform').fadeOut(100);<br />
});<br />
<br />
<br />
});<br />
<br />
</script><br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<div id='cam_page'><br />
<br />
<div id='wrapper'><br />
<div id='top'><br />
<div id='abstract_button'><br />
</div><br />
<div id='judging_button'><br />
</div><br />
</div><br />
<div id='main'><br />
<br />
<div id='abstract' style='padding:10px;'><br />
<h8 style="color:black; background-color:white;">Parts for a reliable and field ready biosensing platform</h8><br />
<p><h9 style="color:black; background-color:white;">Implementation of biosensors in real world situations has been made difficult by the unpredictable and non-quantified outputs of existing solutions, as well as a lack of appropriate storage, distribution and utilization systems. This leaves a large gap between a simple, functional sensing mechanism and a fully realised product that can be used in the field. We aim to bridge this gap at all points by developing a standardised ratiometric luciferase output in a Bacillus chassis. This output can be linked up with prototyped instrumentation and software for obtaining reliable quantified results. Additionally, we have reduced the specialized requirements for the storage and distribution of our bacteria by using Bacillus' sporulation system. To improve the performance of our biosensing platform we have genetically modified Bacillus’ germination speed. Lastly, we demonstrated the robustness of our system by testing it with a new fluoride riboswitch, providing the opportunity to tackle real life problems.<br />
<div id='abstractclose' style='position: absolute; top: 300px; left: 10px;'> <h9 style="color:black; background-color:white;"> >> Return to page </h9></div><br />
</div><br />
<br />
<div id='judgingform' style='padding:10px;'><br />
<br />
<div id='judgingclose'> <h9 style="color:black; background-color:white;"> >> Return to page </h9></div><br />
<br />
<div id='judgingtext'><br />
</html><br />
<br />
<br />
=Judging Form=<br />
<br />
*Please help the judges by filling out this form. Tell them what medal you think you deserve and why. Tell them which special prizes you should win. Help them find your best parts. Show them how you thought about the safety of your project. Helping the judges will help you too.<br />
<br />
----<br />
<br />
*Team: Cambridge<br />
*Region: Europe<br />
*iGEM Year:2012<br />
*Track:Foundational Advance<br />
*Project Name:Parts for a reliable and field ready biosensing platform<br />
*Project Abstract: Implementation of biosensors in real world situations has been made difficult by the unpredictable and non-quantified outputs of existing solutions, as well as a lack of appropriate storage, distribution and utilization systems. This leaves a large gap between a simple, functional sensing mechanism and a fully realised product that can be used in the field.<br /><br /> We aim to bridge this gap at all points by developing a standardised ratiometric luciferase output in a Bacillus chassis. This output can be linked up with prototyped instrumentation and software for obtaining reliable quantified results. Additionally, we have reduced the specialized requirements for the storage and distribution of our bacteria by using Bacillus' sporulation system. To improve the performance of our biosensing platform we have genetically modified Bacillus’ germination speed. Lastly, we demonstrated the robustness of our system by testing it with a new fluoride riboswitch, providing the opportunity to tackle real life problems. <br />
<br />
[https://2012.igem.org/Team:Cambridge Back to wiki]<br />
<br />
<br />
== iGEM Medals for non-software teams==<br />
<br />
*We believe our team deserves the following medal:<br />
** Bronze<br />
** Silver<br />
** &radic;Gold<br />
Because we met the following criteria (check all that apply and provide details where needed)<br />
<br />
===Requirements for a Bronze Medal===<br />
*&radic;Register the team, have a great summer, and plan to have fun at the Regional Jamboree.<br />
*&radic;Successfully complete and submit this iGEM 2012 Judging form.<br />
*&radic;Create and share a Description of the team's project using the iGEM wiki and the team's parts using the Registry of Standard Biological Parts.<br />
*&radic;Plan to present a Poster and Talk at the iGEM Jamboree.<br />
*&radic;Enter information detailing at least one new standard BioBrick Part or Device in the Registry of Standard Biological Parts. Including:<br />
**&radic;Primary nucleaic acid sequence<br />
**&radic;Description of function<br />
**&radic;Authorship<br />
**Safety notes, if relevant.<br />
**&radic;Acknowedgment of sources and references<br />
*&radic;Submit DNA for at least one new BioBrick Part or Device to the Registry.<br />
<br />
===Additional Requirements for a Silver Medal===<br />
*&radic;Demonstrate that at least one new BioBrick Part or Device of your own design and construction works as expected; characterize the operation of your new part/device.<br />
*&radic;Enter this information and other documentation on the part's 'Main Page' section of the Registry <br />Part Number(s): [http://partsregistry.org/Part:BBa_K911004 BBa_K911004]<br />
<br />
===Additional Requirements for a Gold Medal: (one OR more)===<br />
*Improve an existing BioBrick Part or Device and enter this information back on the Experience Page of the Registry.<br />Part Number(s): None<br />
*&radic;Help another iGEM team by, for example, characterizing a part, debugging a construct, or modeling or simulating their system.<br />Link to this information on your wiki. Page name: [https://2012.igem.org/Team:Cambridge/Outreach/Collaboration Team:Cambridge/Outreach/Collaboration]<br />
*&radic;Outline and detail a new approach to an issue of Human Practice in synthetic biology as it relates to your project, such as safety, security, ethics, or ownership, sharing, and innovation.<br />Link to this information on your wiki. <br />Page name: [https://2012.igem.org/Team:Cambridge/HumanPractices/Overview Team:Cambridge/HumanPractices/Overview],[https://2012.igem.org/Team:Cambridge/HumanPractices/MarketResearch Team:Cambridge/HumanPractices/MarketResearch],[https://2012.igem.org/Team:Cambridge/HumanPractices/FutureDirections Team:Cambridge/HumanPractices/FutureDirections]<br />
<br />
[https://2012.igem.org/Team:Cambridge Back to wiki]<br />
<br />
==iGEM Prizes==<br />
All teams are eligible for special prizes at the Jamborees. [https://2012.igem.org/Judging' more...] To help the judges, please indicate if you feel you should be evaluated for any of the following special prizes:<br />
*&radic;Best Human Practice Advance<br />
*&radic;Best Experimental Measurement<br />
*Best Model<br />
<br />
===Please explain briefly why you should receive any of these special prizes:===<br />
<br />
'''Best Human Practice Advance:'''<br />
<br />
We feel that we deserve this prize for three reasons: <br />
# We explored the impacts, *both positive and negative*, of synthetic biology as a solution to real world problems, through interviewing professionals working in a relevant field, namely the impact of arsenic water contamination in Bangladesh. <br />
# We recognized existing problems with the way the current direction of synthetic. On going through the registry we found that most of the characterization data for biosensing parts is often neither comparable nor replicable. We have worked to solve this issue, for example with our ratiometric dual channel output. <br />
# *Our project doesn’t stop here*, in Chanel number 6 ([https://2012.igem.org/Team:Cambridge/HumanPractices/FutureDirections Team:Cambridge/HumanPractices/FutureDirections]) we considered the future implications and technological applications of our project, as well as the means by which it could be improved by subsequent users. We feel that the end to an iGEM project should not be the conclusion of an idea, but the start of it.<br />
<br />
'''Best BioBrick Measurement Approach:'''<br />
<br />
It is absolutely vital that a quantitative, numerical, robust, and flexible measurement approach exists to relay information to a user that is an accurate representation of the input processed by a biological device. Working from these principles, the following was done:<br />
# We designed and built Biologger, a *cheap, arduino-based, fully functional automatic rotary device* that has an incorporated ratiolumnometer<br />
# Our project is entirely open-sourced and open-platform. We have published source code for the two applications which serve to operate the device, one for PCs and the other for Android devices, as well as the open source circuit design that provides this ratiometric reading. Furthermore, the Android app is able to receive its data wirelessly, which we feel is a great advance in BioBrick measurement. <br />
# Our dual-channel luciferase reporter was successfully tested with a dilution series of E.coli transformed with the Lux Operon (under pBAD) biobrick (Part BBa_K325909) of the Cambridge iGEM 2010 team. It can detect, with good accuracy, both different light intensities, as well as the percentages of blue or orange frequencies in a sample. <br />
# Our device was successfully tested using artificial light to detect different frequencies (colours) as well.<br />
Having done all the above, we believe that this fully open-sourced instrumentation kit (mechanical) chassis, electronics, software code), estimated at *$35.00* (or $85.00 if a Bluetooth modem is required), is a complete BioBrick measurement solution for any and all BioBricks with a light output.<br />
<br />
[https://2012.igem.org/Team:Cambridge Back to wiki]<br />
<br />
==Team_Parts==<br />
To help the judges evaluate your parts, please identify 3 of your parts that you feel are best documented and are of the highest quality. <br />
*;Best new BioBrick part (natural): [http://partsregistry.org/Part:BBa_K911003 BBa_K911003]<br />
*;Best new BioBrick part (engineered): [http://partsregistry.org/Part:BBa_K911004 BBa_K911004]<br />
*Best improved part(s): None<br />
<br />
List any other parts you would like the judges to examine:[http://partsregistry.org/Part:BBa_K911001 BBa_K911001], [http://partsregistry.org/Part:BBa_K911008 BBa_K911009], [http://partsregistry.org/Part:BBa_K911008 BBa_K911008]<br />
<br />
Please explain briefly why the judges should examine these other parts:<br />
* '''Magnesium Sensitive Riboswitch [http://partsregistry.org/Part:BBa_K911001 BBa_K911001]'''<br />As a riboswitch sensing construct, this part is an entirely new type of biosensor (along with the fluoride construct) that could potentially change the way we think about designing input genetic circuits. Unlike the fluoride riboswitch, it is a derepression system and therefore serves to demonstrate the principle that riboswitches can be used regardless of whether they turn on or off their reporter.<br />
* '''Fluorescent ratiometric construct for standardizing promoter output [http://partsregistry.org/Part:BBa_K911009 BBa_K911009]''' <br />Fluorescence is a major cornerstone for biosensors in the registry, however, most parts do not involve the use of a ratiometric output, which has been shown in the literature to provide much more reliable and meaningful data. This part not only furthers the development of ratiometric measurements in molecular biology but due to the choice of promoters and terminators it can be used to characterize the difference in activity between E. coli and B. Subtilis<br />
* '''Fast Germination (B. subtilis) [http://partsregistry.org/Part:BBa_K911008 BBa_K911008]'''<br />This part is entirely novel for the registry and fully utilizes the recombination machinery inherent in the Bacillus chassis. Have spores that can germinate at a faster rate is certainly a worthy achievement and could help with experiments with B. Subtilis that any future iGEM teams may wish to perform.<br />
<br />
[https://2012.igem.org/Team:Cambridge Back to wiki]<br />
<br />
==iGEM Safety==<br />
For iGEM 2012 teams are asked to detail how they approached any issues of biological safety associated with their projects.<br />
<br />
The iGEM judges expect that you have answered the four safety questions [https://2012.igem.org/Safety Safety page] on your iGEM 2012 wiki.<br />
<br />
Please provide the link to that page:<br />
Page name: [https://2012.igem.org/Team:Cambridge/Safety Team:Cambridge/Safety]<br />
<br />
==Attribution and Contributions==<br />
For iGEM 2012 the description of each project must clearly attribute work done by the team and distinguish it from work done by others, including the host labs, advisors, and instructors.<br />
<br />
Please provide the link to that page, or comments in the box below:<br />
Page name: [https://2012.igem.org/Team:Cambridge/Attributions Team:Cambridge/Attributions]<br />
<br />
==Comments==<br />
If there is any other information about your project you would like to highlight for the judges, please provide a link to your wiki page here: [https://2012.igem.org/Team:Cambridge/Overview/DesignProcess Team:Cambridge/Overview/DesignProcess]<br />
<br />
<html><br />
</div><br />
</div><br />
<br />
<div id='HP' class='splash'><br />
<h8 style='color:#339900;'>Human Practices</h8><br />
<p><h9>THE DRIVING FORCE</h9><br />
<p><h9>Our goal is to standardise the output of biosensors, and to develop a cheap, user-friendly kit to be used in the field</h9><br />
<p><a href="/Team:Cambridge/HumanPractices/Overview"><h9> >>Overview</h9></a><br />
<p><a href="/Team:Cambridge/HumanPractices/MarketResearch"><h9> >>Market Research</h9></a><br />
<p><a href="/Team:Cambridge/HumanPractices/OutreachCollaboration"><h9> >>Outreach & Collaborations</h9></a><br />
<p><a href="/Team:Cambridge/HumanPractices/FutureDirections"><h9> >>Future Directions </h9></a><br />
</div><br />
<br />
<div id='OV' class='splash' style='padding-top: 0px;'><br />
<h8 style='color:#FFFFFF;'>Parts for a Reliable and Field Ready Biosensing Platform</h8><br />
<p><h9>OVERVIEW</h9><br />
<p><h9>There are many biosensors available but there is no standard way to deploy them. Many are also non-quantitative and unpredictable. We have been working on a ratiometric luciferase output which can be read by an Arduino device.<br />
This output could be used with theoretically any biosensor. We investigated the potential of riboswitches as future biosensors. We use a B.subtilis chassis as these form low maintenance spores for easy, long-term storage. </h9><br />
<p><a href="/Team:Cambridge/Overview/Overview"><h9> >>Overview</h9></a><br />
<p><a href="/Team:Cambridge/Overview/DesignProcess"><h9> >>Design Process</h9></a><br />
<p><a href="/Team:Cambridge/Overview/Parts"><h9> >>Parts</h9></a><br />
<p><a href="/Team:Cambridge/Overview/Labbook"><h9> >>Lab book</h9></a><br />
<p><a href="/Team:Cambridge/Overview/Results"><h9> >>Results</h9></a><br />
</div><br />
<br />
<div id='RS' class='splash'><br />
<h8 style='color:#4682B4;'>RiboSense</h8><br />
<p><h9>A NOVEL FLUORIDE SENSOR BASED ON A RIBOSWITCH CONSTRUCT</h9><br />
<p><h9>Riboswitches may well be the biosensor of the future though they are currently under-represented in the registry.</h9><br />
<p><a href='/Team:Cambridge/Ribosense/Overview'><h9> >>Overview</h9></a><br />
<p><a href='/Team:Cambridge/Ribosense/DesignProcess'><h9> >>Design Process</h9></a><br />
<p><a href='/Team:Cambridge/Ribosense/Parts'><h9> >>Parts</h9></a><br />
<p><a href='/Team:Cambridge/Ribosense/Labbook'><h9> >>Lab book</h9></a><br />
<p><a href='/Team:Cambridge/Ribosense/Results'><h9> >>Results</h9></a><br />
</div><br />
<br />
<div id='RM' class='splash'><br />
<h8 style='color:#FF9900;'>Ratiometrica</h8><br />
<p><h9>INVESTIGATING THE POTENTIAL OF RATIOMETRIC REPORTER CONSTRUCTS FOR ACCURATE AND REPRODUCIBLE CHARACTERISATION</h9><br />
<p><h9>We designed fluorescence and luminescence-based constructs that would function in both E.coli and B.subtilis</h9><br />
<p><a href="/Team:Cambridge/Ratiometrica/Overview"><h9> >>Overview</h9></a><br />
<p><a href="/Team:Cambridge/Ratiometrica/DesignProcess"><h9> >>Design Process</h9></a><br />
<p><a href="/Team:Cambridge/Ratiometrica/Parts"><h9> >>Parts</h9></a><br />
<p><a href="/Team:Cambridge/Ratiometrica/Labbook"><h9> >>Lab book</h9></a><br />
<p><a href="/Team:Cambridge/Ratiometrica/Results"><h9> >>Results</h9></a><br />
</div><br />
<br />
<div id='BL' class='splash'><br />
<h8 style='color:#FFFF00;'>Biologger</h8><br />
<p><h9>A CHEAP, ARDUINO-BASED, AUTOMATIC ROTARY RATIOLUMINOMETER</h9><br />
<p><h9>An open-sourced, open-platform approach relaying easily interpretable information to a user that is an accurate representation of the input processed by a biological device.</h9><br />
<p><a href="/Team:Cambridge/Biologger/Overview"><h9> >>Overview</h9></a><br />
<p><a href="/Team:Cambridge/Biologger/DesignProcess"><h9> >>Design Process</h9></a><br />
<p><a href="/Team:Cambridge/Biologger/Parts"><h9> >>Parts</h9></a><br />
<p><a href="/Team:Cambridge/Biologger/Labbook"><h9> >>Lab book</h9></a><br />
<p><a href="/Team:Cambridge/Biologger/Results"><h9> >>Results</h9></a><br />
</div><br />
<br />
<div id='SD' class='splash'><br />
<h8 style='color:#FF0033;'>Sporage & Distribution</h8><br />
<p><h9>B. SUBTILIS: LONG TERM, USER-FRIENDLY STORAGE</h9><br />
<p><h9>We developed and optimised procedures for sporulation and germination.</h9><br />
<p><a href="/Team:Cambridge/SD/Overview"><h9> >>Overview</h9><br />
<p><a href="/Team:Cambridge/SD/DesignProcess"><h9> >>Design Process</h9></a><br />
<p><a href="/Team:Cambridge/SD/Parts"><h9> >>Parts</h9></a><br />
<p><a href="/Team:Cambridge/SD/Labbook"><h9> >>Lab book</h9></a><br />
<p><a href="/Team:Cambridge/SD/Results"><h9> >>Results</h9></a><br />
</div><br />
<br />
</div><br />
<div id='bottom'><br />
<a href= "/Team:Cambridge/Diary/Week_1"><br />
<div id='diary' class='bottom_nav'><br />
</div><br />
</a><br />
<a href= "/Team:Cambridge/Protocols"><br />
<div id='protocols' class='bottom_nav'><br />
</div><br />
</a><br />
<a href= "/Team:Cambridge/Team"><br />
<div id='team' class='bottom_nav'><br />
</div><br />
</a><br />
<a href= "/Team:Cambridge/Sponsors"><br />
<div id='sponsors' class='bottom_nav'><br />
</div><br />
</a><br />
<a href= "/Team:Cambridge/Safety"><br />
<div id='safety' class='bottom_nav'><br />
</div><br />
</a><br />
<a href= "http://www.facebook.com/CambridgeIgem2012" class="cam-external"><br />
<div id='facebook' class='bottom_social'><br />
</div><br />
</a><br />
<a href= "http://www.flickr.com/photos/cambridgeigem2012/" class="cam-external"><br />
<div id='flickr' class='bottom_social'><br />
</div><br />
</a><br />
<a href= "http://twitter.com/cambridgeigem12" class="cam-external"><br />
<div id='twitter' class='bottom_social'><br />
</div><br />
</a><br />
<a href= "http://www.youtube.com/watch?v=lO6ajD0KfVI&feature=youtu.be" class="cam-external"><br />
<div id='youtube' class='bottom_social'><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<br />
<br />
<br />
</div><br />
<br />
<br />
</html></div>Emmyfthttp://2012.igem.org/Team:CambridgeTeam:Cambridge2012-10-27T01:59:31Z<p>Emmyft: </p>
<hr />
<div><html><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<style type ='text/css'><br />
/* Wiki Hacks - START */<br />
/* Author: Pieter van Boheemen */<br />
/* Team: TU Delft */<br />
#globalWrapper { background-color: transparent; border: none; margin: 0; padding: 0; width: 100%; height:100%;}<br />
#content { background-color: transparent; border: none; padding: 0; margin: 0; width: 100%; overflow: scroll; height:100%;}<br />
#bodyContent { border: none; padding:0; margin:0; width:100%; height:100%;}<br />
#top-section { height: 15px; margin: 0px; margin-left: auto; margin-right: auto; margin-bottom: 0 !important;<br />
padding:0; border: none; font-size: 10px;}<br />
#p-logo { height:1px; overflow:scroll; display: none;}<br />
#search-controls { overflow:hidden; display:block; background: none; position: absolute; top: 100px; right: 40px;}<br />
#footer-box { width: 100%; margin: -10px auto 0 auto; padding: 20px 0;}<br />
.visualClear { display: none; }<br />
#footer { border: none; width: 965px; margin: 0 auto; padding: 0;}<br />
.firstHeading { display: none;}<br />
#f-list a { color: #333; font-size: 10px;}<br />
#f-list a:hover { color: #666;}<br />
.printfooter { display: none; }<br />
#footer ul { margin: 0; padding: 0;}<br />
#footer ul li { margin-top: 0; margin-bottom: 0; margin-left: 10px; margin-right: 10px; padding: 0;}<br />
#search-controls { display:none; }<br />
h3#siteSub { display: none;}<br />
#contentSub {display: none;}<br />
p:first-child { display: none;}<br />
/* Wiki Hacks - END */<br />
</style><br />
<br />
<link rel='stylesheet' type='text/css' href='/Team:Cambridge/static/wiki_splash.css?action=raw&ctype=text/css'/> <br />
<br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
<br />
$('.splash_over').css("display","none");<br />
<br />
$('#HP').mouseover(function() {<br />
$('#HP').css("background", "url('https://static.igem.org/mediawiki/2012/c/ce/CAMV2_HP.jpg') no-repeat");<br />
$('#HP h8').css("background-color","white");<br />
$('#HP h9').css("background-color","white");<br />
$('#HP h9').css("color","black");<br />
});<br />
<br />
$('#HP').mouseleave(function() {<br />
$('#HP').css("background-image", "none");<br />
$('#HP h8').css("background-color","black");<br />
$('#HP h9').css("background-color","black");<br />
$('#HP h9').css("color","white");<br />
});<br />
<br />
$('#OV').mouseover(function() {<br />
$('#OV').css("background", "white no-repeat");<br />
$('#OV h8').css("background-color","white");<br />
$('#OV h8').css("color","black");<br />
$('#OV h9').css("background-color","white");<br />
$('#OV h9').css("color","black");<br />
});<br />
<br />
$('#OV').mouseleave(function() {<br />
$('#OV').css("background", "none");<br />
$('#OV h8').css("background-color","black");<br />
$('#OV h8').css("color","white");<br />
$('#OV h9').css("background-color","black");<br />
$('#OV h9').css("color","white");<br />
});<br />
<br />
$('#RS').mouseover(function() {<br />
$('#RS').css("background", "url('https://static.igem.org/mediawiki/2012/9/9e/CAMV2_RS.jpg') no-repeat");<br />
$('#RS h8').css("background-color","white");<br />
$('#RS h9').css("background-color","white");<br />
$('#RS h9').css("color","black");<br />
});<br />
<br />
$('#RS').mouseleave(function() {<br />
$('#RS').css("background-image", "none");<br />
$('#RS h8').css("background-color","black");<br />
$('#RS h9').css("background-color","black");<br />
$('#RS h9').css("color","white");<br />
});<br />
<br />
$('#RM').mouseover(function() {<br />
$('#RM').css("background", "url('https://static.igem.org/mediawiki/2012/2/23/CAMV2_RM.JPG') no-repeat");<br />
$('#RM h8').css("background-color","white");<br />
$('#RM h9').css("background-color","white");<br />
$('#RM h9').css("color","black");<br />
});<br />
<br />
$('#RM').mouseleave(function() {<br />
$('#RM').css("background-image", "none");<br />
$('#RM h8').css("background-color","black");<br />
$('#RM h9').css("background-color","black");<br />
$('#RM h9').css("color","white");<br />
});<br />
<br />
$('#BL').mouseover(function() {<br />
$('#BL').css("background", "url('https://static.igem.org/mediawiki/2012/e/e1/CAMV2_BL.jpg') no-repeat");<br />
$('#BL h8').css("background-color","white");<br />
$('#BL h9').css("background-color","white");<br />
$('#BL h9').css("color","black");<br />
});<br />
<br />
$('#BL').mouseleave(function() {<br />
$('#BL').css("background-image", "none");<br />
$('#BL h8').css("background-color","black");<br />
$('#BL h9').css("background-color","black");<br />
$('#BL h9').css("color","white");<br />
});<br />
<br />
$('#SD').mouseover(function() {<br />
$('#SD').css("background", "url('https://static.igem.org/mediawiki/2012/8/88/CAMV2_SD.jpg') no-repeat");<br />
$('#SD h8').css("background-color","white");<br />
$('#SD h9').css("background-color","white");<br />
$('#SD h9').css("color","black");<br />
});<br />
<br />
$('#SD').mouseleave(function() {<br />
$('#SD').css("background-image", "none");<br />
$('#SD h8').css("background-color","black");<br />
$('#SD h9').css("background-color","black");<br />
$('#SD h9').css("color","white");<br />
});<br />
<br />
<br />
$('#abstract').css("display","none");<br />
<br />
$('#abstract_button').click(function() {<br />
$('#abstract').fadeIn(100);<br />
});<br />
<br />
$('#abstractclose').click(function() {<br />
$('#abstract').fadeOut(100);<br />
});<br />
<br />
$('#judgingform').css("display","none");<br />
<br />
$('#judging_button').click(function() {<br />
$('#judgingform').fadeIn(100);<br />
});<br />
<br />
$('#judgingclose').click(function() {<br />
$('#judgingform').fadeOut(100);<br />
});<br />
<br />
<br />
});<br />
<br />
</script><br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<div id='cam_page'><br />
<br />
<div id='wrapper'><br />
<div id='top'><br />
<div id='abstract_button'><br />
</div><br />
<div id='judging_button'><br />
</div><br />
</div><br />
<div id='main'><br />
<br />
<div id='abstract' style='padding:10px;'><br />
<h8 style="color:black; background-color:white;">Parts for a reliable and field ready biosensing platform</h8><br />
<p><h9 style="color:black; background-color:white;">Implementation of biosensors in real world situations has been made difficult by the unpredictable and non-quantified outputs of existing solutions, as well as a lack of appropriate storage, distribution and utilization systems. This leaves a large gap between a simple, functional sensing mechanism and a fully realised product that can be used in the field. We aim to bridge this gap at all points by developing a standardised ratiometric luciferase output in a Bacillus chassis. This output can be linked up with prototyped instrumentation and software for obtaining reliable quantified results. Additionally, we have reduced the specialized requirements for the storage and distribution of our bacteria by using Bacillus' sporulation system. To improve the performance of our biosensing platform we have genetically modified Bacillus’ germination speed. Lastly, we demonstrated the robustness of our system by testing it with a new fluoride riboswitch, providing the opportunity to tackle real life problems.<br />
<div id='abstractclose' style='position: absolute; top: 500px; left: 10px;'> <h9 style="color:black; background-color:white;"> >> Return to page </h9></div><br />
</div><br />
<br />
<div id='judgingform' style='padding:10px;'><br />
<br />
<div id='judgingclose'> <h9 style="color:black; background-color:white;"> >> Return to page </h9></div><br />
<br />
<div id='judgingtext'><br />
</html><br />
<br />
<br />
=Judging Form=<br />
<br />
*Please help the judges by filling out this form. Tell them what medal you think you deserve and why. Tell them which special prizes you should win. Help them find your best parts. Show them how you thought about the safety of your project. Helping the judges will help you too.<br />
<br />
----<br />
<br />
*Team: Cambridge<br />
*Region: Europe<br />
*iGEM Year:2012<br />
*Track:Foundational Advance<br />
*Project Name:Parts for a reliable and field ready biosensing platform<br />
*Project Abstract: Implementation of biosensors in real world situations has been made difficult by the unpredictable and non-quantified outputs of existing solutions, as well as a lack of appropriate storage, distribution and utilization systems. This leaves a large gap between a simple, functional sensing mechanism and a fully realised product that can be used in the field.<br /><br /> We aim to bridge this gap at all points by developing a standardised ratiometric luciferase output in a Bacillus chassis. This output can be linked up with prototyped instrumentation and software for obtaining reliable quantified results. Additionally, we have reduced the specialized requirements for the storage and distribution of our bacteria by using Bacillus' sporulation system. To improve the performance of our biosensing platform we have genetically modified Bacillus’ germination speed. Lastly, we demonstrated the robustness of our system by testing it with a new fluoride riboswitch, providing the opportunity to tackle real life problems. <br />
<br />
[https://2012.igem.org/Team:Cambridge Back to wiki]<br />
<br />
<br />
== iGEM Medals for non-software teams==<br />
<br />
*We believe our team deserves the following medal:<br />
** Bronze<br />
** Silver<br />
** &radic;Gold<br />
Because we met the following criteria (check all that apply and provide details where needed)<br />
<br />
===Requirements for a Bronze Medal===<br />
*&radic;Register the team, have a great summer, and plan to have fun at the Regional Jamboree.<br />
*&radic;Successfully complete and submit this iGEM 2012 Judging form.<br />
*&radic;Create and share a Description of the team's project using the iGEM wiki and the team's parts using the Registry of Standard Biological Parts.<br />
*&radic;Plan to present a Poster and Talk at the iGEM Jamboree.<br />
*&radic;Enter information detailing at least one new standard BioBrick Part or Device in the Registry of Standard Biological Parts. Including:<br />
**&radic;Primary nucleaic acid sequence<br />
**&radic;Description of function<br />
**&radic;Authorship<br />
**Safety notes, if relevant.<br />
**&radic;Acknowedgment of sources and references<br />
*&radic;Submit DNA for at least one new BioBrick Part or Device to the Registry.<br />
<br />
===Additional Requirements for a Silver Medal===<br />
*&radic;Demonstrate that at least one new BioBrick Part or Device of your own design and construction works as expected; characterize the operation of your new part/device.<br />
*&radic;Enter this information and other documentation on the part's 'Main Page' section of the Registry <br />Part Number(s): [http://partsregistry.org/Part:BBa_K911004 BBa_K911004]<br />
<br />
===Additional Requirements for a Gold Medal: (one OR more)===<br />
*Improve an existing BioBrick Part or Device and enter this information back on the Experience Page of the Registry.<br />Part Number(s): None<br />
*&radic;Help another iGEM team by, for example, characterizing a part, debugging a construct, or modeling or simulating their system.<br />Link to this information on your wiki. Page name: [https://2012.igem.org/Team:Cambridge/Outreach/Collaboration Team:Cambridge/Outreach/Collaboration]<br />
*&radic;Outline and detail a new approach to an issue of Human Practice in synthetic biology as it relates to your project, such as safety, security, ethics, or ownership, sharing, and innovation.<br />Link to this information on your wiki. <br />Page name: [https://2012.igem.org/Team:Cambridge/HumanPractices/Overview Team:Cambridge/HumanPractices/Overview],[https://2012.igem.org/Team:Cambridge/HumanPractices/MarketResearch Team:Cambridge/HumanPractices/MarketResearch],[https://2012.igem.org/Team:Cambridge/HumanPractices/FutureDirections Team:Cambridge/HumanPractices/FutureDirections]<br />
<br />
[https://2012.igem.org/Team:Cambridge Back to wiki]<br />
<br />
==iGEM Prizes==<br />
All teams are eligible for special prizes at the Jamborees. [https://2012.igem.org/Judging' more...] To help the judges, please indicate if you feel you should be evaluated for any of the following special prizes:<br />
*&radic;Best Human Practice Advance<br />
*&radic;Best Experimental Measurement<br />
*Best Model<br />
<br />
===Please explain briefly why you should receive any of these special prizes:===<br />
<br />
'''Best Human Practice Advance:'''<br />
<br />
We feel that we deserve this prize for three reasons: <br />
# We explored the impacts, *both positive and negative*, of synthetic biology as a solution to real world problems, through interviewing professionals working in a relevant field, namely the impact of arsenic water contamination in Bangladesh. <br />
# We recognized existing problems with the way the current direction of synthetic. On going through the registry we found that most of the characterization data for biosensing parts is often neither comparable nor replicable. We have worked to solve this issue, for example with our ratiometric dual channel output. <br />
# *Our project doesn’t stop here*, in Chanel number 6 ([https://2012.igem.org/Team:Cambridge/HumanPractices/FutureDirections Team:Cambridge/HumanPractices/FutureDirections]) we considered the future implications and technological applications of our project, as well as the means by which it could be improved by subsequent users. We feel that the end to an iGEM project should not be the conclusion of an idea, but the start of it.<br />
<br />
'''Best BioBrick Measurement Approach:'''<br />
<br />
It is absolutely vital that a quantitative, numerical, robust, and flexible measurement approach exists to relay information to a user that is an accurate representation of the input processed by a biological device. Working from these principles, the following was done:<br />
# We designed and built Biologger, a *cheap, arduino-based, fully functional automatic rotary device* that has an incorporated ratiolumnometer<br />
# Our project is entirely open-sourced and open-platform. We have published source code for the two applications which serve to operate the device, one for PCs and the other for Android devices, as well as the open source circuit design that provides this ratiometric reading. Furthermore, the Android app is able to receive its data wirelessly, which we feel is a great advance in BioBrick measurement. <br />
# Our dual-channel luciferase reporter was successfully tested with a dilution series of E.coli transformed with the Lux Operon (under pBAD) biobrick (Part BBa_K325909) of the Cambridge iGEM 2010 team. It can detect, with good accuracy, both different light intensities, as well as the percentages of blue or orange frequencies in a sample. <br />
# Our device was successfully tested using artificial light to detect different frequencies (colours) as well.<br />
Having done all the above, we believe that this fully open-sourced instrumentation kit (mechanical) chassis, electronics, software code), estimated at *$35.00* (or $85.00 if a Bluetooth modem is required), is a complete BioBrick measurement solution for any and all BioBricks with a light output.<br />
<br />
[https://2012.igem.org/Team:Cambridge Back to wiki]<br />
<br />
==Team_Parts==<br />
To help the judges evaluate your parts, please identify 3 of your parts that you feel are best documented and are of the highest quality. <br />
*;Best new BioBrick part (natural): [http://partsregistry.org/Part:BBa_K911003 BBa_K911003]<br />
*;Best new BioBrick part (engineered): [http://partsregistry.org/Part:BBa_K911004 BBa_K911004]<br />
*Best improved part(s): None<br />
<br />
List any other parts you would like the judges to examine:[http://partsregistry.org/Part:BBa_K911001 BBa_K911001], [http://partsregistry.org/Part:BBa_K911008 BBa_K911009], [http://partsregistry.org/Part:BBa_K911008 BBa_K911008]<br />
<br />
Please explain briefly why the judges should examine these other parts:<br />
* '''Magnesium Sensitive Riboswitch [http://partsregistry.org/Part:BBa_K911001 BBa_K911001]'''<br />As a riboswitch sensing construct, this part is an entirely new type of biosensor (along with the fluoride construct) that could potentially change the way we think about designing input genetic circuits. Unlike the fluoride riboswitch, it is a derepression system and therefore serves to demonstrate the principle that riboswitches can be used regardless of whether they turn on or off their reporter.<br />
* '''Fluorescent ratiometric construct for standardizing promoter output [http://partsregistry.org/Part:BBa_K911009 BBa_K911009]''' <br />Fluorescence is a major cornerstone for biosensors in the registry, however, most parts do not involve the use of a ratiometric output, which has been shown in the literature to provide much more reliable and meaningful data. This part not only furthers the development of ratiometric measurements in molecular biology but due to the choice of promoters and terminators it can be used to characterize the difference in activity between E. coli and B. Subtilis<br />
* '''Fast Germination (B. subtilis) [http://partsregistry.org/Part:BBa_K911008 BBa_K911008]'''<br />This part is entirely novel for the registry and fully utilizes the recombination machinery inherent in the Bacillus chassis. Have spores that can germinate at a faster rate is certainly a worthy achievement and could help with experiments with B. Subtilis that any future iGEM teams may wish to perform.<br />
<br />
[https://2012.igem.org/Team:Cambridge Back to wiki]<br />
<br />
==iGEM Safety==<br />
For iGEM 2012 teams are asked to detail how they approached any issues of biological safety associated with their projects.<br />
<br />
The iGEM judges expect that you have answered the four safety questions [https://2012.igem.org/Safety Safety page] on your iGEM 2012 wiki.<br />
<br />
Please provide the link to that page:<br />
Page name: [https://2012.igem.org/Team:Cambridge/Safety Team:Cambridge/Safety]<br />
<br />
==Attribution and Contributions==<br />
For iGEM 2012 the description of each project must clearly attribute work done by the team and distinguish it from work done by others, including the host labs, advisors, and instructors.<br />
<br />
Please provide the link to that page, or comments in the box below:<br />
Page name: [https://2012.igem.org/Team:Cambridge/Attributions Team:Cambridge/Attributions]<br />
<br />
==Comments==<br />
If there is any other information about your project you would like to highlight for the judges, please provide a link to your wiki page here: [https://2012.igem.org/Team:Cambridge/Overview/DesignProcess Team:Cambridge/Overview/DesignProcess]<br />
<br />
<html><br />
</div><br />
</div><br />
<br />
<div id='HP' class='splash'><br />
<h8 style='color:#339900;'>Human Practices</h8><br />
<p><h9>THE DRIVING FORCE</h9><br />
<p><h9>Our goal is to standardise the output of biosensors, and to develop a cheap, user-friendly kit to be used in the field</h9><br />
<p><a href="/Team:Cambridge/HumanPractices/Overview"><h9> >>Overview</h9></a><br />
<p><a href="/Team:Cambridge/HumanPractices/MarketResearch"><h9> >>Market Research</h9></a><br />
<p><a href="/Team:Cambridge/HumanPractices/OutreachCollaboration"><h9> >>Outreach & Collaborations</h9></a><br />
<p><a href="/Team:Cambridge/HumanPractices/FutureDirections"><h9> >>Future Directions </h9></a><br />
</div><br />
<br />
<div id='OV' class='splash' style='padding-top: 0px;'><br />
<h8 style='color:#FFFFFF;'>Parts for a Reliable and Field Ready Biosensing Platform</h8><br />
<p><h9>OVERVIEW</h9><br />
<p><h9>There are many biosensors available but there is no standard way to deploy them. Many are also non-quantitative and unpredictable. We have been working on a ratiometric luciferase output which can be read by an Arduino device.<br />
This output could be used with theoretically any biosensor. We investigated the potential of riboswitches as future biosensors. We use a B.subtilis chassis as these form low maintenance spores for easy, long-term storage. </h9><br />
<p><a href="/Team:Cambridge/Overview/Overview"><h9> >>Overview</h9></a><br />
<p><a href="/Team:Cambridge/Overview/DesignProcess"><h9> >>Design Process</h9></a><br />
<p><a href="/Team:Cambridge/Overview/Parts"><h9> >>Parts</h9></a><br />
<p><a href="/Team:Cambridge/Overview/Labbook"><h9> >>Lab book</h9></a><br />
<p><a href="/Team:Cambridge/Overview/Results"><h9> >>Results</h9></a><br />
</div><br />
<br />
<div id='RS' class='splash'><br />
<h8 style='color:#4682B4;'>RiboSense</h8><br />
<p><h9>A NOVEL FLUORIDE SENSOR BASED ON A RIBOSWITCH CONSTRUCT</h9><br />
<p><h9>Riboswitches may well be the biosensor of the future though they are currently under-represented in the registry.</h9><br />
<p><a href='/Team:Cambridge/Ribosense/Overview'><h9> >>Overview</h9></a><br />
<p><a href='/Team:Cambridge/Ribosense/DesignProcess'><h9> >>Design Process</h9></a><br />
<p><a href='/Team:Cambridge/Ribosense/Parts'><h9> >>Parts</h9></a><br />
<p><a href='/Team:Cambridge/Ribosense/Labbook'><h9> >>Lab book</h9></a><br />
<p><a href='/Team:Cambridge/Ribosense/Results'><h9> >>Results</h9></a><br />
</div><br />
<br />
<div id='RM' class='splash'><br />
<h8 style='color:#FF9900;'>Ratiometrica</h8><br />
<p><h9>INVESTIGATING THE POTENTIAL OF RATIOMETRIC REPORTER CONSTRUCTS FOR ACCURATE AND REPRODUCIBLE CHARACTERISATION</h9><br />
<p><h9>We designed fluorescence and luminescence-based constructs that would function in both E.coli and B.subtilis</h9><br />
<p><a href="/Team:Cambridge/Ratiometrica/Overview"><h9> >>Overview</h9></a><br />
<p><a href="/Team:Cambridge/Ratiometrica/DesignProcess"><h9> >>Design Process</h9></a><br />
<p><a href="/Team:Cambridge/Ratiometrica/Parts"><h9> >>Parts</h9></a><br />
<p><a href="/Team:Cambridge/Ratiometrica/Labbook"><h9> >>Lab book</h9></a><br />
<p><a href="/Team:Cambridge/Ratiometrica/Results"><h9> >>Results</h9></a><br />
</div><br />
<br />
<div id='BL' class='splash'><br />
<h8 style='color:#FFFF00;'>Biologger</h8><br />
<p><h9>A CHEAP, ARDUINO-BASED, AUTOMATIC ROTARY RATIOLUMINOMETER</h9><br />
<p><h9>An open-sourced, open-platform approach relaying easily interpretable information to a user that is an accurate representation of the input processed by a biological device.</h9><br />
<p><a href="/Team:Cambridge/Biologger/Overview"><h9> >>Overview</h9></a><br />
<p><a href="/Team:Cambridge/Biologger/DesignProcess"><h9> >>Design Process</h9></a><br />
<p><a href="/Team:Cambridge/Biologger/Parts"><h9> >>Parts</h9></a><br />
<p><a href="/Team:Cambridge/Biologger/Labbook"><h9> >>Lab book</h9></a><br />
<p><a href="/Team:Cambridge/Biologger/Results"><h9> >>Results</h9></a><br />
</div><br />
<br />
<div id='SD' class='splash'><br />
<h8 style='color:#FF0033;'>Sporage & Distribution</h8><br />
<p><h9>B. SUBTILIS: LONG TERM, USER-FRIENDLY STORAGE</h9><br />
<p><h9>We developed and optimised procedures for sporulation and germination.</h9><br />
<p><a href="/Team:Cambridge/SD/Overview"><h9> >>Overview</h9><br />
<p><a href="/Team:Cambridge/SD/DesignProcess"><h9> >>Design Process</h9></a><br />
<p><a href="/Team:Cambridge/SD/Parts"><h9> >>Parts</h9></a><br />
<p><a href="/Team:Cambridge/SD/Labbook"><h9> >>Lab book</h9></a><br />
<p><a href="/Team:Cambridge/SD/Results"><h9> >>Results</h9></a><br />
</div><br />
<br />
</div><br />
<div id='bottom'><br />
<a href= "/Team:Cambridge/Diary/Week_1"><br />
<div id='diary' class='bottom_nav'><br />
</div><br />
</a><br />
<a href= "/Team:Cambridge/Protocols"><br />
<div id='protocols' class='bottom_nav'><br />
</div><br />
</a><br />
<a href= "/Team:Cambridge/Team"><br />
<div id='team' class='bottom_nav'><br />
</div><br />
</a><br />
<a href= "/Team:Cambridge/Sponsors"><br />
<div id='sponsors' class='bottom_nav'><br />
</div><br />
</a><br />
<a href= "/Team:Cambridge/Safety"><br />
<div id='safety' class='bottom_nav'><br />
</div><br />
</a><br />
<a href= "http://www.facebook.com/CambridgeIgem2012" class="cam-external"><br />
<div id='facebook' class='bottom_social'><br />
</div><br />
</a><br />
<a href= "http://www.flickr.com/photos/cambridgeigem2012/" class="cam-external"><br />
<div id='flickr' class='bottom_social'><br />
</div><br />
</a><br />
<a href= "http://twitter.com/cambridgeigem12" class="cam-external"><br />
<div id='twitter' class='bottom_social'><br />
</div><br />
</a><br />
<a href= "http://www.youtube.com/watch?v=lO6ajD0KfVI&feature=youtu.be" class="cam-external"><br />
<div id='youtube' class='bottom_social'><br />
</div><br />
</a><br />
<br />
</div><br />
<br />
<br />
<br />
<br />
</div><br />
<br />
<br />
</html></div>Emmyfthttp://2012.igem.org/Team:Cambridge/static/wiki_splash.cssTeam:Cambridge/static/wiki splash.css2012-10-27T01:57:52Z<p>Emmyft: </p>
<hr />
<div>/*<br />
This file is part of the cambridge 2011 igem team's wiki. nothing is guaranteed.<br />
<br />
Version 2, December 2004<br />
<br />
Copyright (C) 2011 Haydn King hjking734@gmail.com<br />
<br />
TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION<br />
<br />
*/<br />
<br />
/*splash */<br />
<br />
#wrapper {<br />
top: 0px;<br />
left: -150px; <br />
position: relative;<br />
width: 1280px;<br />
height: 1024px;<br />
background-image: url('https://static.igem.org/mediawiki/2012/6/6e/CAMV2_background.png');<br />
}<br />
<br />
#top {<br />
height: 145px;<br />
width: 1280px;<br />
position: relative;<br />
top: 0px;<br />
left: 0px;<br />
}<br />
<br />
#homepage {<br />
top: 39px;<br />
left: 72px;<br />
width: 392px;<br />
height: 93px;<br />
position: absolute;<br />
}<br />
<br />
#abstract_button {<br />
height: 30px;<br />
width: 128px;<br />
position: absolute;<br />
top: 100px;<br />
left: 925px;<br />
cursor: hand;<br />
cursor: pointer;<br />
}<br />
<br />
#judging_button {<br />
height: 30px;<br />
width: 180px;<br />
position: absolute;<br />
top: 100px;<br />
left: 1070px;<br />
cursor: hand;<br />
cursor: pointer;<br />
}<br />
<br />
#abstract {<br />
position: absolute;<br />
top: 145px;<br />
left: 0px;<br />
height: 781px;<br />
width: 1260px;<br />
background-image: url('https://static.igem.org/mediawiki/2012/4/49/CAMV2_Abstractbg.png');<br />
background-position: right bottom;<br />
z-index: 999;<br />
}<br />
<br />
#judgingform {<br />
position: absolute;<br />
top: 145px;<br />
left: 0px;<br />
height: 781px;<br />
width: 1260px;<br />
background-image: url('https://static.igem.org/mediawiki/2012/4/49/CAMV2_Abstractbg.png');<br />
background-position: right bottom;<br />
z-index: 999;<br />
}<br />
<br />
#judgingtext {<br />
max-height: 741px;<br />
width: 1260px;<br />
overflow: auto;<br />
overflow-y: scroll;<br />
}<br />
<br />
#abstractclose {<br />
position: absolute;<br />
top: 155px;<br />
left: 10px;<br />
z-index: 1000;<br />
cursor: hand;<br />
cursor: pointer;<br />
}<br />
<br />
#judgingclose {<br />
z-index: 1000;<br />
cursor: hand;<br />
cursor: pointer;<br />
}<br />
<br />
#main {<br />
height: 781px;<br />
width: 1280px;<br />
}<br />
<br />
.splash {<br />
height: 778px;<br />
width: 213.3px;<br />
float: left;<br />
}<br />
<br />
#bottom {<br />
top: 926px;<br />
left: 0px;<br />
width: 1280px;<br />
height: 98px;<br />
}<br />
<br />
.bottom_nav {<br />
position: absolute;<br />
top: 950px;<br />
height: 24px;<br />
}<br />
<br />
#diary {left: 128px; width: 71px; }<br />
#protocols {left: 260px; width: 157px; }<br />
#team {left: 477px; width: 66px; }<br />
#sponsors {left: 614px; width: 133px; }<br />
#safety {left: 807px; width: 88px; }<br />
<br />
.bottom_social {<br />
position: absolute;<br />
top: 950px;<br />
height: 50px;<br />
width: 50px;<br />
}<br />
<br />
#facebook {left: 975px; }<br />
#flickr {left: 1041px; }<br />
#twitter {left: 1111px; }<br />
#youtube {left: 1178px; }<br />
<br />
h8 {<br />
text-indent: 0px;<br />
line-height: 120%;<br />
text-align: justify;<br />
font-family: Verdana, sans-serif;<br />
font-size: 32px;<br />
background-color: black;<br />
z-index: 110;<br />
}<br />
<br />
h9 {<br />
line-height: 120%;<br />
text-align: justify;<br />
color: #FFFFFF;<br />
font-family: Georgia, serif;<br />
font-size: 18px;<br />
background-color: black;<br />
z-index: 110;<br />
}<br />
<br />
li {<br />
color: black;<br />
font-family: Verdana, Geneva, sans-serif;<br />
font-size: 14px;<br />
line-height: 1.3em;<br />
}<br />
<br />
/*template*/<br />
<br />
#wrapper_template {<br />
top: 0px;<br />
left: -150px; <br />
position: relative;<br />
width: 1280px;<br />
height: 1024px;<br />
background-image: url('https://static.igem.org/mediawiki/2012/b/b7/CAM_template_background_new.png');<br />
}<br />
<br />
#vertnav {<br />
position: absolute;<br />
left: 48px;<br />
top: 350px;<br />
height: 216px;<br />
width: 240px;<br />
}<br />
<br />
.vert_nav {<br />
height: 36px;<br />
width: 240px;<br />
float: left;<br />
}<br />
<br />
#vert_HP {background-image: url('https://static.igem.org/mediawiki/2012/2/2d/CAMV2_HP.png');}<br />
#vert_HP:hover {background-image: url('https://static.igem.org/mediawiki/2012/3/39/CAMV2_HP_hover.png');}<br />
#vert_OV {background-image: url('https://static.igem.org/mediawiki/2012/c/ce/CAMV2_OV.png');}<br />
#vert_OV:hover {background-image: url('https://static.igem.org/mediawiki/2012/e/e5/CAMV2_OV_hover.png');}<br />
#vert_RS {background-image: url('https://static.igem.org/mediawiki/2012/1/19/CAMV2_RS.png');}<br />
#vert_RS:hover {background-image: url('https://static.igem.org/mediawiki/2012/0/01/CAMV2_RS_hover.png');}<br />
#vert_RM {background-image: url('https://static.igem.org/mediawiki/2012/f/fa/CAMV2_RM.png');}<br />
#vert_RM:hover {background-image: url('https://static.igem.org/mediawiki/2012/8/88/CAMV2_RM_hover.png');}<br />
#vert_BL {background-image: url('https://static.igem.org/mediawiki/2012/8/81/CAMV2_BL.png');}<br />
#vert_BL:hover {background-image: url('https://static.igem.org/mediawiki/2012/7/7c/CAMV2_BL_hover.png');}<br />
#vert_SD {background-image: url('https://static.igem.org/mediawiki/2012/5/51/CAMV2_SD.png');}<br />
#vert_SD:hover {background-image: url('https://static.igem.org/mediawiki/2012/5/56/CAMV2_SD_hover.png');}<br />
#vert_RiskAssessment {background-image: url('https://static.igem.org/mediawiki/2012/1/15/CAMV2_RiskAssessment.png');}<br />
#vert_RiskAssessment:hover {background-image: url('https://static.igem.org/mediawiki/2012/2/21/CAMV2_RiskAssessment_hover.png');}<br />
#vert_MSDS {background-image: url('https://static.igem.org/mediawiki/2012/3/34/CAMV2_MSDS.png');}<br />
#vert_MSDS:hover {background-image: url('https://static.igem.org/mediawiki/2012/1/1c/CAMV2_MSDS_hover.png');}<br />
#vert_TeamMembers {background-image: url('https://static.igem.org/mediawiki/2012/3/38/CAMV2_TeamMembers.png');}<br />
#vert_TeamMembers:hover {background-image: url('https://static.igem.org/mediawiki/2012/1/13/CAMV2_TeamMembers_hover.png');}<br />
#vert_OfficialTeam {background-image: url('https://static.igem.org/mediawiki/2012/3/32/CAMV2_OfficialTeam.png');}<br />
#vert_OfficialTeam:hover {background-image: url('https://static.igem.org/mediawiki/2012/2/20/CAMV2_OfficialTeam_hover.png');}<br />
#vert_Attributions {background-image: url('https://static.igem.org/mediawiki/2012/b/bb/CAMV2_Attributions.png');}<br />
#vert_Attributions:hover {background-image: url('https://static.igem.org/mediawiki/2012/e/e1/CAMV2_Attributions_hover.png');}<br />
<br />
#vert_HP_on {background-image: url('https://static.igem.org/mediawiki/2012/a/a7/CAMV2_HP_on.png');}<br />
#vert_OV_on {background-image: url('https://static.igem.org/mediawiki/2012/2/2e/CAMV2_OV_on.png');}<br />
#vert_RS_on {background-image: url('https://static.igem.org/mediawiki/2012/3/32/CAMV2_RS_on.png');}<br />
#vert_RM_on {background-image: url('https://static.igem.org/mediawiki/2012/6/64/CAMV2_RM_on.png');}<br />
#vert_BL_on {background-image: url('https://static.igem.org/mediawiki/2012/4/4b/CAMV2_BL_on.png');}<br />
#vert_SD_on {background-image: url('https://static.igem.org/mediawiki/2012/e/e2/CAMV2_SD_on.png');}<br />
#vert_RiskAssessment_on {background-image: url('https://static.igem.org/mediawiki/2012/e/ee/CAMV2_RiskAssessment_on.png');}<br />
#vert_MSDS_on {background-image: url('https://static.igem.org/mediawiki/2012/3/3d/CAMV2_MSDS_on.png');}<br />
#vert_TeamMembers_on {background-image: url('https://static.igem.org/mediawiki/2012/5/59/CAMV2_TeamMembers_on.png');}<br />
#vert_OfficialTeam_on {background-image: url('https://static.igem.org/mediawiki/2012/d/d0/CAMV2_OfficialTeam_on.png');}<br />
#vert_Attributions_on {background-image: url('https://static.igem.org/mediawiki/2012/7/7e/CAMV2_Attributions_on.png');}<br />
<br />
#template_content {<br />
position: absolute;<br />
top: 200px;<br />
left: 290px;<br />
height: 620px;<br />
width: 960px;<br />
overflow: auto;<br />
overflow-y: scroll;<br />
}<br />
<br />
#hornav {<br />
position: absolute;<br />
top: 840px;<br />
left: 100px;<br />
width: 1072px;<br />
height: 36px;<br />
}<br />
<br />
.hor_nav {<br />
height: 36px;<br />
width: 200px;<br />
float: left;<br />
}<br />
<br />
.hor_nav_arrow {<br />
height: 36px;<br />
width: 36px;<br />
float: left;<br />
}<br />
<br />
#hor_overview {background: url('https://static.igem.org/mediawiki/2012/4/4e/CAMV2_Overview.png') center;}<br />
#hor_designprocess {background: url('https://static.igem.org/mediawiki/2012/b/b3/CAMV2_Designprocess.png') center;}<br />
#hor_parts {background: url('https://static.igem.org/mediawiki/2012/b/b5/CAMV2_Parts.png') center;}<br />
#hor_labbook {background: url('https://static.igem.org/mediawiki/2012/8/88/CAMV2_Labbook.png') center;}<br />
#hor_results {background: url('https://static.igem.org/mediawiki/2012/d/da/CAMV2_Results.png') center;}<br />
#hor_marketresearch {background: url('https://static.igem.org/mediawiki/2012/4/48/CAMV2_Marketresearch.png') center;}<br />
#hor_futuredirections {background: url('https://static.igem.org/mediawiki/2012/d/dd/CAMV2_Futuredirections.png') center;}<br />
#hor_outreach {background: url('https://static.igem.org/mediawiki/2012/e/e5/CAMV2_Outreach.png') center;}<br />
<br />
#hor_overview_on {background: url('https://static.igem.org/mediawiki/2012/3/3a/CAMV2_Overview_on.png') center;}<br />
#hor_designprocess_on {background: url('https://static.igem.org/mediawiki/2012/d/df/CAMV2_Designprocess_on.png') center;}<br />
#hor_parts_on {background: url('https://static.igem.org/mediawiki/2012/b/b4/CAMV2_Parts_on.png') center;}<br />
#hor_labbook_on {background: url('https://static.igem.org/mediawiki/2012/4/4b/CAMV2_Labbook_on.png') center;}<br />
#hor_results_on {background: url('https://static.igem.org/mediawiki/2012/2/27/CAMV2_Results_on.png') center;}<br />
#hor_marketresearch_on {background: url('https://static.igem.org/mediawiki/2012/f/f0/CAMV2_Marketresearch_on.png') center;}<br />
#hor_futuredirections_on {background: url('https://static.igem.org/mediawiki/2012/3/3a/CAMV2_Futuredirections_on.png') center;}<br />
#hor_outreach_on {background: url('https://static.igem.org/mediawiki/2012/d/df/CAMV2_Outreadch_on.png') center;}<br />
<br />
#leftarrow {background-image: url('https://static.igem.org/mediawiki/2012/4/42/CAMV2_Leftarrow.png');}<br />
#leftarrow:hover {background-image: url('https://static.igem.org/mediawiki/2012/b/b1/CAMV2_Leftarrow_hover.png');}<br />
#rightarrow {background-image: url('https://static.igem.org/mediawiki/2012/2/26/CAMV2_Rightarrow.png');}<br />
#rightarrow:hover {background-image: url('https://static.igem.org/mediawiki/2012/2/29/CAMV2_Rightarrow_hover.png');}<br />
<br />
::-webkit-scrollbar {<br />
width: 12px;<br />
}<br />
<br />
::-webkit-scrollbar-track {<br />
-webkit-box-shadow: inset 0 0 6px rgba(0,0,0,0.3); <br />
border-radius: 10px;<br />
}<br />
<br />
::-webkit-scrollbar-thumb {<br />
border-radius: 10px;<br />
-webkit-box-shadow: inset 0 0 6px rgba(0,0,0,0.5); <br />
}<br />
<br />
<br />
/*2011*/<br />
<br />
.cam-ui-icon {width:16px;height:16px;background-image:url(/wiki/images/b/b1/CAM_Bactiridescence_Icons_normal.png);display:inline-block;margin:1px;}<br />
.cam-ui-icon.cam-hover {background-image:url(/wiki/images/c/c2/CAM_Bactiridescence_Icons_hover.png);}<br />
.cam-ui-icon-discuss {background-position: 0 0;}<br />
.cam-ui-icon-key {background-position: -16px 0;}<br />
.cam-ui-icon-user {background-position: -32px 0;}<br />
.cam-ui-icon-edit {background-position: -48px 0;}<br />
<br />
.cam-ui-icon-igem {width:21px!important;height:16px!important;background-image:url(/wiki/images/a/aa/CAM_IGEM_21x16_low.png)!important;}<br />
.cam-ui-icon-igem.cam-hover {background-image:url(/wiki/images/3/3b/CAM_IGEM_21x16_high.png)!important;}<br />
<br />
.cam-social-icon {width:48px;height:48px;display:inline-block;background-image:url(/wiki/images/5/50/CAM_Bactiridescence_Social.png);}<br />
.cam-social-facebook{background-position: 0 0;}<br />
.cam-social-twitter{background-position: -48px 0;}<br />
.cam-social-flickr{background-position: -96px 0;}<br />
<br />
* {padding: 0; margin:0; word-break:break-word;}<br />
body{ text-align: center; background: #eeeeee no-repeat fixed center top; margin-bottom: 10px; overflow-x:hidden;}<br />
<br />
#cam_page{width: 960px;text-align:left;display:inline-block;}<br />
#cam_topbar{height:18px; margin: 0 6px 10px 2px;}<br />
#cam_topbar a {font: 12px verdana, sans-serif; font-weight:bold; vertical-align:text-top;}<br />
<br />
#cam_left { width:186px; margin-right: 10px; float: left;}<br />
#cam_right {width: 760px; float:left;}<br />
.cam-header {height: 96px; margin-bottom: 12px!important;}<br />
#cam_menubar{margin-bottom:14px;height:96px;}<br />
.cam-box{background:url(/wiki/images/c/c9/CAM_Bactiridescence_White_85.png);margin:2px;position:relative;color:black;}<br />
.cam-box-content{font: 16px verdana, sans-serif;}<br />
#cam_pagecontent {font-size:15px;}<br />
<br />
.cam-menu-item{float:left;width:148px;font: 16px verdana, sans-serif;color:#666666;z-index:800;}<br />
.cam-menu-item:hover{color:black;}<br />
.cam-menu-item.cam-menu-selected{font-weight:bold!important;}<br />
.cam-menu-top{height:50px;text-align:center;padding-top:36px;}<br />
.cam-menu-text{font-size:16px;}<br />
.cam-menu-bottom{height:10px;background-color:#ffffff!important; width:148px;}<br />
<br />
a{text-decoration:none;color:#000000;font: inherit verdana, sans-serif; cursor:pointer;}<br />
a:hover{opacity:.8;filter:alpha(opacity=80);}<br />
a {outline: none!important;} /*Fix for Firefox*/<br />
<br />
a.cam-overview {color:#ee2424;}<br />
a.cam-project {color:#4fb84e;}<br />
a.cam-labwork {color:#a54098;}<br />
a.cam-society {color:#3953a4;}<br />
a.cam-team {color:#eea900;}<br />
a.cam-ext {color:#54b8ec;}<br />
a.cam-external{color:#FFF;}<br />
<br />
#cam_logo {position:relative;}<br />
#cam_innerlogo {position:absolute; left: -10px; right: -10px; top:8px;}<br />
<br />
#cam_desc {margin:2px;}<br />
#cam_desc_top {margin-bottom: 5px;}<br />
#cam_desc_color {float:left;width:10px;height:56px;}<br />
#cam_desc_title {float:left;font:18px verdana, sans-serif;}<br />
#cam_desc_area {margin: 5px;}<br />
#cam_desc_subarea {margin: 5px; font-size:16px; padding-left:10px;}<br />
#cam_desc_content {border-top: 1px solid grey; font: 12px verdana, sans-serif; padding:3px; word-wrap: break-word;}<br />
#cam_desc_content a {font: inherit;}<br />
<br />
.cam-desc-overview {background-color:#ee2424!important;}<br />
.cam-desc-project {background-color:#4fb84e!important;}<br />
.cam-desc-labwork {background-color:#a54098!important;}<br />
.cam-desc-society {background-color:#3953a4!important;}<br />
.cam-desc-team {background-color:#fee600!important;}<br />
<br />
/* area_hover */<br />
#cam_overview:hover .cam-menu-bottom{background-color:#ee2424!important;}<br />
#cam_project:hover .cam-menu-bottom{background-color:#4fb84e!important;}<br />
#cam_labwork:hover .cam-menu-bottom{background-color:#a54098!important;}<br />
#cam_society:hover .cam-menu-bottom{background-color:#3953a4!important;}<br />
#cam_team:hover .cam-menu-bottom{background-color:#fee600!important;}<br />
/* area select */<br />
#cam_overview.cam-selected .cam-menu-bottom{background-color:#ee2424!important;}<br />
#cam_project.cam-selected .cam-menu-bottom{background-color:#4fb84e!important;}<br />
#cam_labwork.cam-selected .cam-menu-bottom{background-color:#a54098!important;}<br />
#cam_society.cam-selected .cam-menu-bottom{background-color:#3953a4!important;}<br />
#cam_team.cam-selected .cam-menu-bottom{background-color:#fee600!important;}<br />
/* subarea select*/<br />
.cam-subitems li.cam-selected a {margin-left:2px;color:black;}<br />
.cam-overview li.cam-selected a {border-left:3px solid #ee2424;}<br />
.cam-project li.cam-selected a {border-left:3px solid #4fb84e;}<br />
.cam-labwork li.cam-selected a {border-left:3px solid #a54098;}<br />
.cam-society li.cam-selected a {border-left:3px solid #3953a4;}<br />
.cam-team li.cam-selected a {border-left:3px solid #fee600;}<br />
<br />
<br />
.cam-menu-all{position:absolute;opacity:0.95;filter:alpha(opacity=95);}<br />
.cam-menu-drop{display:none;width:148px;}<br />
ul.cam-menu-drop {list-style:none;margin:0!important;list-style-image:none;}<br />
.cam-menu-drop li {display:block; padding: 5px 2px; background-color:#272727;margin:0!important; }<br />
.cam-menu-drop li a {display:block;color:#bbbbbb;padding: 7px 2px;}<br />
.cam-menu-drop li a:hover {background-color:#aaaaaa;color:#000000;}<br />
#cam_nav{min-height:300px;}<br />
#cam_pagecontent {padding: 10px; min-height:480px;}<br />
.printfooter {display:none;}<br />
#cam_blog{position:absolute;right:-70px;top:82px;width:105px;height:105px;background-color:green;}<br />
#cam_icons{height:60px;margin:4px 2px;overflow:hidden}<br />
.cam-social-link{height:60px;width:48px;float:left;cursor:pointer;position:relative}<br />
.cam-social-icon{position:absolute; top:12px;}<br />
<br />
#cam_loading {display:none; padding: 0 5px 5px 5px; background-image: url(/wiki/images/3/37/CAM_black_85.png); font: bold 20px verdana, sans-serif; position:fixed; top:0; left:50%; width: 150px; margin-left:-75px; z-index: 10;}<br />
#cam_loading div {background-color: white; color:black; text-align:center;}<br />
<br />
/*<br />
** MediaWiki 'monobook' style sheet for CSS2-capable browsers.<br />
** Copyright Gabriel Wicke - http://wikidev.net/<br />
** License: GPL (http://www.gnu.org/copyleft/gpl.html)<br />
**<br />
** Loosely based on http://www.positioniseverything.net/ordered-floats.html by Big John<br />
** and the Plone 2.0 styles, see http://plone.org/ (Alexander Limi,Joe Geldart & Tom Croucher,<br />
** Michael Zeltner and Geir Bækholt)<br />
** All you guys rock :)<br />
* <br />
** All iGEM-related content removed by Haydn King, iGEM Cambridge, 2011<br />
*/<br />
<br />
/*****************************************************************************************************<br />
* The content div contains all of the contents of the page - provided by mediawiki<br />
****************************************************************************************************/<br />
<br />
/* the left column width is specified in class .portlet */<br />
<br />
/* general styles */<br />
<br />
table {<br />
font-size: 100%;<br />
color: black;<br />
text-align: center;<br />
}<br />
table td {<br />
border: 1px solid grey;<br />
padding: 3px;<br />
}<br />
table th {<br />
border: 1px solid grey;<br />
padding: 3px;<br />
font-weight: bold;<br />
}<br />
table.gallery td{<br />
vertical-align: top;<br />
border: none!important;<br />
}<br />
<br />
caption {font-weight:bold; text-style:italic;}<br />
<br />
div.gallerybox {<br />
border: 1px solid lightgrey;<br />
padding: 2px;<br />
}<br />
<br />
img {<br />
border: none;<br />
vertical-align: middle;<br />
}<br />
<br />
p img {<br />
margin: 0;<br />
}<br />
<br />
hr {<br />
height: 1px;<br />
color: #aaa;<br />
border: 0;<br />
margin: .2em 0 .2em 0;<br />
}<br />
<br />
h1, h2, h3, h4, h5 {<br />
color: black;<br />
background: none;<br />
font-weight: normal;<br />
margin: 0;<br />
padding-top: .5em;<br />
padding-bottom: .17em;<br />
border-bottom: 1px solid #aaa;<br />
}<br />
h1 { font-size: 188%; }<br />
h2 { font-size: 150%; }<br />
h3, h4, h5 {<br />
border-bottom: none;<br />
font-weight: bold;<br />
}<br />
h3 { font-size: 132%; }<br />
h4 { font-size: 116%; }<br />
h5 { font-size: 100%; }<br />
<br />
ul {<br />
line-height: 1.5em;<br />
list-style-type: square;<br />
margin: .3em 0 0 1.5em;<br />
padding: 0;<br />
}<br />
ol {<br />
line-height: 1.5em;<br />
margin: .3em 0 0 3.2em;<br />
padding: 0;<br />
list-style-image: none;<br />
}<br />
li {<br />
margin-bottom: .1em;<br />
}<br />
dt {<br />
font-weight: bold;<br />
margin-bottom: .1em;<br />
}<br />
dl {<br />
margin-top: .2em;<br />
margin-bottom: .5em;<br />
}<br />
dd {<br />
line-height: 1.5em;<br />
margin-left: 2em;<br />
margin-bottom: .1em;<br />
}<br />
<br />
fieldset {<br />
border: 1px solid #2f6fab;<br />
margin: 1em 0 1em 0;<br />
padding: 0 1em 1em;<br />
line-height: 1.5em;<br />
}<br />
legend {<br />
background: white;<br />
padding: .5em;<br />
font-size: 95%;<br />
}<br />
<br />
select {<br />
vertical-align: top;<br />
}<br />
abbr, acronym, .explain {<br />
border-bottom: 1px dotted black;<br />
color: black;<br />
background: none;<br />
cursor: help;<br />
}<br />
q {<br />
font-family: Times, "Times New Roman", serif;<br />
font-style: italic;<br />
}<br />
code {<br />
<br />
}<br />
pre {<br />
padding: 1em;<br />
border: 1px dashed #2f6fab;<br />
color: black;<br />
line-height: 1.1em;<br />
}<br />
<br />
/*<br />
** the main content area<br />
*/<br />
<br />
#siteSub {<br />
display: none;<br />
}<br />
#contentSub {<br />
font-size: 84%;<br />
line-height: 1.2em;<br />
margin: 0 0 1.4em 1em;<br />
color: #7d7d7d;<br />
width: auto;<br />
}<br />
span.subpages {<br />
display: block;<br />
}<br />
<br />
/* Some space under the headers in the content area */<br />
#bodyContent h1, #bodyContent h2 {<br />
margin-bottom: .6em;<br />
}<br />
#bodyContent h3, #bodyContent h4, #bodyContent h5 {<br />
margin-bottom: .3em;<br />
}<br />
.firstHeading {<br />
margin-bottom: .1em;<br />
}<br />
<br />
.error {<br />
color: red;<br />
font-size: larger;<br />
}<br />
/* currently unused, intended to be used by a metadata box<br />
in the bottom-right corner of the content area */<br />
.documentDescription {<br />
/* The summary text describing the document */<br />
font-weight: bold;<br />
display: block;<br />
margin: 1em 0;<br />
line-height: 1.5em;<br />
}<br />
.documentByLine {<br />
text-align: right;<br />
font-size: 90%;<br />
clear: both;<br />
font-weight: normal;<br />
color: #76797c;<br />
}<br />
<br />
/* emulate center */<br />
.center {<br />
width: 100%;<br />
text-align: center;<br />
}<br />
*.center * {<br />
margin-left: auto;<br />
margin-right: auto;<br />
}<br />
/* small for tables and similar */<br />
.small, .small * {<br />
font-size: 94%;<br />
}<br />
table.small {<br />
font-size: 100%;<br />
}<br />
span.editsection<br />
{<br />
font-size: 15px;<br />
float: right;<br />
font-weight: normal;<br />
}<br />
span.editsection a {font-size: 12px;}<br />
<br />
/*<br />
** content styles<br />
*/<br />
<br />
#toc,<br />
.toc {<br />
display: none; /*hide TOC forever and for always!*/<br />
}<br />
<br />
/* images */<br />
div.floatright, table.floatright {<br />
clear: right;<br />
float: right;<br />
position: relative;<br />
margin: 0 0 .5em .5em;<br />
border: 0;<br />
}<br />
div.floatright p { font-style: italic; }<br />
div.floatleft, table.floatleft {<br />
float: left;<br />
position: relative;<br />
margin: 0 .5em .5em 0;<br />
border: 0;<br />
}<br />
div.floatleft p { font-style: italic; }<br />
/* thumbnails */<br />
div.thumb {<br />
margin-bottom: .5em;<br />
border-style: solid;<br />
border-color: transparent;<br />
width: auto;<br />
}<br />
div.thumb div {<br />
border: 1px solid #ccc;<br />
padding: 3px !important;<br />
font-size: 94%;<br />
text-align: center;<br />
overflow: hidden;<br />
}<br />
div.thumb div a img {<br />
border: 1px solid #ccc;<br />
}<br />
div.thumb div div.thumbcaption {<br />
border: none;<br />
text-align: left;<br />
line-height: 1.4em;<br />
padding: .3em 0 .1em 0;<br />
}<br />
div.magnify {<br />
float: right;<br />
border: none !important;<br />
background: none !important;<br />
}<br />
div.magnify a, div.magnify img {<br />
display: block;<br />
border: none !important;<br />
background: none !important;<br />
}<br />
div.tright {<br />
clear: right;<br />
float: right;<br />
border-width: .5em 0 .8em 1.4em;<br />
}<br />
div.tleft {<br />
float: left;<br />
margin-right: .5em;<br />
border-width: .5em 1.4em .8em 0;<br />
}<br />
<br />
.hiddenStructure {<br />
display: none;<br />
}<br />
img.tex {<br />
vertical-align: middle;<br />
}<br />
span.texhtml {<br />
font-family: serif;<br />
}<br />
<br />
/*<br />
** classes for special content elements like town boxes<br />
** intended to be referenced directly from the wiki src<br />
*/<br />
<br />
/*<br />
** User styles<br />
*/<br />
/* table standards */<br />
table.rimage {<br />
float: right;<br />
position: relative;<br />
margin-left: 1em;<br />
margin-bottom: 1em;<br />
text-align: center;<br />
}<br />
.toccolours {<br />
border: 1px solid #aaa;<br />
padding: 5px;<br />
font-size: 95%;<br />
}<br />
div.townBox {<br />
position: relative;<br />
float: right;<br />
background: white;<br />
margin-left: 1em;<br />
border: 1px solid gray;<br />
padding: .3em;<br />
width: 200px;<br />
overflow: hidden;<br />
clear: right;<br />
}<br />
div.townBox dl {<br />
padding: 0;<br />
margin: 0 0 .3em;<br />
font-size: 96%;<br />
}<br />
div.townBox dl dt {<br />
background: none;<br />
margin: .4em 0 0;<br />
}<br />
div.townBox dl dd {<br />
margin: .1em 0 0 1.1em;<br />
}<br />
<br />
/*<br />
** keep the whitespace in front of the ^=, hides rule from konqueror<br />
** this is css3, the validator doesn't like it when validating as css2<br />
*/<br />
#bodyContent a[href ^="http://"],<br />
#bodyContent a[href ^="gopher://"] {<br />
/* background: url(external.png) center right no-repeat; rdr */<br />
/* padding-right: 13px; rdr */<br />
}<br />
#bodyContent a[href ^="https://"],<br />
.link-https {<br />
background: url(lock_icon.gif) center right no-repeat;<br />
padding-right: 16px;<br />
}<br />
#bodyContent a[href ^="mailto:"],<br />
.link-mailto {<br />
background: url(mail_icon.gif) center right no-repeat;<br />
padding-right: 18px;<br />
}<br />
#bodyContent a[href ^="news://"] {<br />
background: url(news_icon.png) center right no-repeat;<br />
padding-right: 18px;<br />
}<br />
#bodyContent a[href ^="ftp://"],<br />
.link-ftp {<br />
background: url(file_icon.gif) center right no-repeat;<br />
padding-right: 18px;<br />
}<br />
#bodyContent a[href ^="irc://"],<br />
.link-irc {<br />
background: url(discussionitem_icon.gif) center right no-repeat;<br />
padding-right: 18px;<br />
}<br />
/* disable interwiki styling */<br />
#bodyContent a.extiw,<br />
#bodyContent a.extiw:active {<br />
color: #36b;<br />
background: none;<br />
padding: 0;<br />
}<br />
/* this can be used in the content area to switch off<br />
special external link styling */<br />
#bodyContent .plainlinks a {<br />
background: none !important;<br />
padding: 0;<br />
}</div>Emmyft