http://2012.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=100&target=Luboe2012.igem.org - User contributions [en]2024-03-29T15:18:42ZFrom 2012.igem.orgMediaWiki 1.16.0http://2012.igem.org/Team:Freiburg/Team2Team:Freiburg/Team22013-06-06T15:52:20Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<br />
= Team = <br />
----<br />
<br><br />
[[File:teamsymbolT.png|180px|center|link=]]<br />
<br><br><br />
{|align="center"<br />
|[[Image:team_freiburg.jpg|400px|center|link=]]<br />
|-<br />
|}<br />
<br />
<div style="text-align: center;"><span style="text-align:center; color:##C1E2FE; background:##00C000"> '''The FreiGEM 2012 Team'''<br />
</span><br />
</div><br />
<br />
<br />
<div align="justify">Our interdisciplinary team mainly consists of undergraduate students from every corner of the scientific landscape and beyond: Medicine, Biology, Molecular Medicine, Pharmaceutical Science and even Philosophy.<br />
Our team leader Nicolas started the team in autumn 2011, when he first discussed participation in the competition with a small group of colleagues of his and some molecular medicine students, which were instantly enthusiastic about the prospect of taking part in a famous synthetic biology competition. The remaining team members joined in following up on announcements, through contact with former iGEM members or oral propaganda.<br />
The first meeting of our team was held in a Pub in Freiburg in November 2011 as an opportunity to get to know each other. <br />
Since 2011, weekly iGEM meetings were set on to get things moving: finding a promising idea, investigating former projects and interesting methods, founding a non-profit association, scouting sponsoring options. <br />
In spite of meeting every single week, it almost took us until April, that we finally pinned down an idea for our project: the development of a method to assemble a TAL protein with 14 DNA binding sites in one single reaction and the aim to use these proteins to direct effector enzymes to specific target sequences within the genome. <br />
To realize our project, we were able to go back to the unique knowledge of every single team member. Be it in research issues, financial questions or website-related problems, everyone in our team did his or her best to make the most out of the project. <br />
During the period of lab work, we tried to spend at least some time together away from the lab to strengthen team cohesion. We had a barbecue in Nico´s garden, bike tours around Freiburg and the obligatory late night search trip for food between gel extractions. Our work together was not only on a professional level but brought us together as friends and we surely will keep it that way beyond iGEM. <br />
<br />
In the following, the freiGEM team members will introduce themselves:<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
= Who we are =<br />
<br><br />
----<br />
==Student Leader==<br />
<br><br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Nicolas Wyvekens</th><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/f/fb/NicoW.jpg" width="200px"/></td><br />
<td><div align="justify">I´m a third-year medical student and the student group leader of our iGEM team. What I like most about iGEM is the opportunity to work on a project that we, as a team, have come up with and planned ourselves. As a medical student, I hadn’t received much training in molecular biology techniques, so it was very challenging for me to plan the project. Besides learning new lab skills, it was an important lesson to deal with frustration when days (and nights) of intense work turned up no positive results. In the end, it is even more rewarding to see that our idea actually works very well and that it attracts great interest from ’real’ scientists.</div></td><br />
</tr></table><br />
</html><br />
----<br />
<br />
==Master students==<br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>David Siegel</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/7/7a/DavidS.jpg" width="200px"/></td><br />
<td><div align="justify">I'm 25 years old and studying biology in the 8th semster at the Albert-Ludwigs University Freiburg. Currently, I'm in the master programm and preparing to start my master thesis in the field of syntehtic biology and biotechnology.<br><br />
The whole theory of synthetic biology, the idea of organising the seemingly chaotic structure of nature thrilled me since the first time I heard of it. When I got news of a new iGEM team I instantly took the chance and joined. Through the iGEM contest I was able to follow a project from the idea on a piece of paper, all the way to proof of concept experiments and final evaluation. I experienced the ups and downs of being in a team with people of so many disciplines and I got the chance to take part in every step that was necessary to make something happen.</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Lisa Jerabek</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/a/a8/Lisa.jpg" width="200px"/></td><br />
<td><div align="justify">I´m studying biology in the 8th semester and will start my Master´s thesis in the research area of synthetic biology in October. <br />
By joining in on freiGEM2012 I accepted the challenge of planning and realizing a self-made project in my research area of interest. I considered my participation in the iGEM team as an opportunity to broaden my expertise in many respects. For me, a really important experience was to face the difficulties of lab work in a large team of members with profoundly varying skills and to learn how to cope with these discrepancies. My primary role in the team was the management of cell cultural issues, which is what made me the “cell culture lady” of the team. <br />
I´m very grateful for the opportunity to learn new methods as well as to get to know new approaches to solving scientific problems and for such a great time with freiGEM2012.</div><br />
</td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Natalie Knoll</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/6/6a/Natalie.png" width="200px"/></td><br />
<td><div align="justify">I'm studying biology in the 8th semester and starting to prepare for my master thesis. The iGEM 2012 contest was a great experience for me and im glad i took my last chance to join a iGEM team. It was a great time and i'm sure i will miss my team when the iGEM time ends. When im thinking about the countless hours we spend in the lap, all the days and at the end even the nights, i'm already sure i will miss this time and all the great people of my team. </div><br />
</td><br />
</tr></table><br />
</html><br />
<br />
----<br />
<br />
==Bachelor students==<br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Lucas Schneider</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/b/bb/LucasS.jpg" width="200px"/></td><br />
<td><div align="justify">During completion of my bachelor of science degree in molecular biology, I joined the IGEM Team of Freiburg. My research interests are molecular biology, bioinformatics and plant biotechnology.<br />
My role in freiGEM 2012 was to instruct an interdisciplinary team of students in molecular cloning and experimental design. Finally, I am proud that we got the toolkit and the TAL-Vectors up and running. It was a valuable experience working with such a team.</div><br />
</td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Lukas Boeckelmann</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/f/f9/Lukas.jpg" width="200px"/></td><br />
<td><div align="justify">I am a student of Medicine in my fourth year and have always been fascinated by the opportunities that modern Molecular Biology has to offer. I have just started my MD thesis and many of the experiences I've already made with iGEM help me greatly. I have benefited tremendously from the iGEM project: It has been very rewarding to research a topic in such depth, to discuss it with the wonderful and bright (and funny) people I have met in our team and to then develop methodical solutions that actually function well! <br />
I am incredibly excited about the work we have done so far and about the work we will continue to do!</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Franz Dressler</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/7/79/FranzD.jpg" width="200px"/></td><br />
<td><div align="justify">I´m a medical student in the 4th year and I joined iGEM due to the unlimited possibilities the project offers. It is a unique opportunity to explore a scientific question or to tackle an everyday biological problem - but the best thing about it: you are completely free to choose what field you want to engage in. From the medical point of view it is also intriguing to get more familiar with molecular methods. In all these regards my expectations have completely been fulfilled. We had an amazing time in the lab, but also exciting discussions and presentations, a vivid and enriching exchange of ideas and knowledge amongst the team members and thanks to the iGEM community. <br />
My special contributions to our project were modeling as well as layout and design of our website and posters.</div><br />
</td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Kimon Runge</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/e/e2/Kimon.jpg" width="200px"/></td><br />
<td><div align="justify">I´m studying medicine in the 4th year and I participate in iGEM because I want to get a better insight in the workings of a laboratory. And what better source of insight can you get than operating your own lab as a team? Of course it’s much more than that and an experience I can recommend to anyone. My special mission is to plan the travels of the group.</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Sebastian Kuechlin</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/5/55/Sebastian.jpg" width="200px"/></td><br />
<td><div align="justify">I'm a medical student and currently in my fourth year of studies. What fascinates me about synthetic biology is the engineering aspect: I love reconsidering the knowledge I have learned thus far in my medical education and applying it in new ways: Participating in iGEM has altered my way of thinking about biology for good. When I'm not in the hospital, the lecture halls or labs, I love making music and have found a wonderful opportunity to do so as a piano player in our university's big band."</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Fabian Stritt</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/d/d8/Fabian.jpg" width="200px"/></td><br />
<td><div align="justify">I have completed two years of my bachelor of science curriculum in biology in Freiburg and will continue my studies in Strasburg in a bioengineering program. It was my interest in the synthetic aspects of biology, which motivated me to join the iGEM team. My particular contribution to our project was the organization of the film project, the result of which you can see on our website, as well as the representation of our team in Berlin at the 'Biotechnologie2020+' . For me, iGEM was a valuable experience which strengthened my wish to become a bioengineer. ></div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Philipp Warmer</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/2/25/PhillipW.jpg" width="200px"/></td><br />
<td><div align="justify">This is a TALE about Philipp who grew up to become a bioengineer.<br />
Once upon a time this Philipp started studying biology at Freiburg University and got very attracted to the beauty that resides within the simplicity of SynBio.<br />
As he got older he joined the freiGEM Team to take part in the world wide challenge for SynBio.<br />
And so he and the freiGEM Team lived happily ever after...<br />
See you all at the Jamboree!<br />
</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Jan Patrick Steitz</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/a/a8/Jan-Phillip.jpg" width="200px"/></td><br />
<td><div align="justify">I´m a third year student of pharmaceutics, so most of the time I have to deal with chemistry.<br />
iGEM gave me a great opportunity to gain experience on the subject of synthetic biology and, of course, it was a lot of fun. <br />
</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Leo Scheller</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/8/8c/Leo.jpg" width="200px"/></td><br />
<td><div align="justify">I studied molecular medicine in Freiburg and I just moved to Edinburgh for Systems and Synthetic Biology. I hope to integrate Systems and Synthetic Biology into medical research and iGEM has been a great opportunity for gathering practical skills, for being creative, and for getting to know very cool people. Also I'm happy that we have a very promising project and I look forward to our presentation in Amsterdam.</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Dennis Grishin</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/3/32/Denis.jpg" width="200px"/></td><br />
<td><div align="justify">I study molecular medicine and microelectromechanical systems. With this choice of fields of study my goal is to bring life sciences and engineering together. When I heard about iGEM I realized that for me it would be the perfect opportunity to pursue this objective. I am fascinated by synthetic biology and believe in the great potential of biological engineering approaches. freiGEM 2012 gave me the opportunity to take part in an exciting project and to further develop my lab skills. It was a lot of fun and I have very much enjoyed the work in our team.</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Verena Waehle</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/d/d0/Verena.jpg" width="200px"/></td><br />
<td><div align="justify">During the time of my bachelor studies in molecular medicine, I learned a lot about the function of cells as well as of whole organisms. Nevertheless, the field of synthetic biology remained something impalpable for me. When I first heard about iGEM, I was intrigued by the concept, that a group of students should plan and realize a whole project in the context of synthetic biology almost on their own. Considering this a challenge and a great opportunity to broaden my horizon by emerging into a research area that differs profoundly from everything I have done before, I joined in on the team. During the whole iGEM year, I was able to learn a lot about almost any aspect of research life, which is what makes the time with freiGEM such an invaluable experience. <br />
I really enjoy the opportunity to be part of such a fabulous project and of an even more fabulous team!<br />
</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Josip Herman</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/7/77/Josip.jpg" width="200px"/></td><br />
<td><div align="justify">I´m studying molecular medicine and I was curious about iGEM. iGEM gives me the opportunity to get first insights into the emerging field of synthetic biology, which will very likely influence our future lives. During the time as a freiGEM team member I earned a lot of lab experience and enjoyed the time in the team.<br />
May the TALs be with you.<br />
See you.<br />
</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>David Fuchs</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/a/ab/DavidF.jpg" width="200px"/></td><br />
<td><div align="justify">Biology is going synthetic and it's going there fast. It poses many new and exciting frontiers, so joining in on such a high profile competition as iGEM came natural. Working with people from every corner of the life science landscape and beyond was an eye-opening experience. I learned quite a bit about every facet of lab life during my time with freiGEM, which is what makes this whole endeavor so invaluable.<br />
Cheers to all.<br />
</div></td><br />
</tr></table><br />
</html><br />
----<br />
==Human Practice==<br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Pablo Grassi</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/9/99/Pablo.jpg" width="200px"/></td><br />
<td><div align="justify"><br />
I will try to make a long story short: I obtained a bachelor´s degree in biology and I´m currently studying philosophy. I joined the freiGEM-team because of just two reasons. On the one hand, since 2010 I organize an interdisciplinary project at the University of Freiburg concerning the concept of life. In this project, I intend to combine theoretical biology and philosophy of biology to encounter the phenomena of the living. On the other hand, I specialized in the fields of synthetic biology and biochemistry during my bachelor studies. Through combination of these two aspects, the iGEM competition revealed itself as an unique chance for exploring arising philosophical questions concerning our understanding of life. I was lucky I had the possibility to be a member of this great team, which lively promoted philosophical reflection and precise thinking.<br />
</div></td><br />
</tr></table><br />
</html><br />
<br />
----<br />
==Advisors==<br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Dr. Susanne Proksch</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/6/69/Susanne1.jpg" width="200px"/></td><br />
<td><div align="justify">I have joined the iGEM team as an advisor to share my research experience with the younger team members. After studying dental medicine, and post doctoral work in Paris, I´m currently doing research on regenerative dentistry at the Clinic for Oral & Maxillofacial Surgery of the “Uniklinik Freiburg”. I decided to participate in the iGEM competition due to my enthusiasm, curiosity and passion for the world of science and my tremendous thirst for new knowledge. Furthermore, it is a great experience to get in touch with the initiative, creativity and cleverness of the undergraduate students which is quite impressive. I got to know synthetic biology as a fascinating field of research and I´m really grateful for this superb experience – Chapeau freiGEM 2012!</div></td><br />
</tr></table><br />
</html><br />
<br />
<br><br><br><br><br />
[[#top|Back to top]]</div>Luboehttp://2012.igem.org/Team:Freiburg/Team2Team:Freiburg/Team22013-06-06T15:51:22Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<br />
= Team = <br />
----<br />
<br><br />
[[File:teamsymbolT.png|180px|center|link=]]<br />
<br><br><br />
{|align="center"<br />
|[[Image:team_freiburg.jpg|400px|center|link=]]<br />
|-<br />
|}<br />
<br />
<div style="text-align: center;"><span style="text-align:center; color:##C1E2FE; background:##00C000"> '''The FreiGEM 2012 Team'''<br />
</span><br />
</div><br />
<br />
<br />
<div align="justify">Our interdisciplinary team mainly consists of undergraduate students from every corner of the scientific landscape and beyond: Medicine, Biology, Molecular Medicine, Pharmaceutical Science and even Philosophy.<br />
Our team leader Nicolas started the team in autumn 2011, when he first discussed participation in the competition with a small group of colleagues of his and some molecular medicine students, which were instantly enthusiastic about the prospect of taking part in a famous synthetic biology competition. The remaining team members joined in following up on announcements, through contact with former iGEM members or oral propaganda.<br />
The first meeting of our team was held in a Pub in Freiburg in November 2011 as an opportunity to get to know each other. <br />
Since 2011, weekly iGEM meetings were set on to get things moving: finding a promising idea, investigating former projects and interesting methods, founding a non-profit association, scouting sponsoring options. <br />
In spite of meeting every single week, it almost took us until April, that we finally pinned down an idea for our project: the development of a method to assemble a TAL protein with 14 DNA binding sites in one single reaction and the aim to use these proteins to direct effector enzymes to specific target sequences within the genome. <br />
To realize our project, we were able to go back to the unique knowledge of every single team member. Be it in research issues, financial questions or website-related problems, everyone in our team did his or her best to make the most out of the project. <br />
During the period of lab work, we tried to spend at least some time together away from the lab to strengthen team cohesion. We had a barbecue in Nico´s garden, bike tours around Freiburg and the obligatory late night search trip for food between gel extractions. Our work together was not only on a professional level but brought us together as friends and we surely will keep it that way beyond iGEM. <br />
<br />
In the following, the freiGEM team members will introduce themselves:<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
= Who we are =<br />
<br><br />
----<br />
==Student Leader==<br />
<br><br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Nicolas Wyvekens</th><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/f/fb/NicoW.jpg" width="200px"/></td><br />
<td><div align="justify">I´m a third-year medical student and the student group leader of our iGEM team. What I like most about iGEM is the opportunity to work on a project that we, as a team, have come up with and planned ourselves. As a medical student, I hadn’t received much training in molecular biology techniques, so it was very challenging for me to plan the project. Besides learning new lab skills, it was an important lesson to deal with frustration when days (and nights) of intense work turned up no positive results. In the end, it is even more rewarding to see that our idea actually works very well and that it attracts great interest from ’real’ scientists.</div></td><br />
</tr></table><br />
</html><br />
----<br />
<br />
==Master students==<br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>David Siegel</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/7/7a/DavidS.jpg" width="200px"/></td><br />
<td><div align="justify">I'm 25 years old and studying biology in the 8th semster at the Albert-Ludwigs University Freiburg. Currently, I'm in the master programm and preparing to start my master thesis in the field of syntehtic biology and biotechnology.<br><br />
The whole theory of synthetic biology, the idea of organising the seemingly chaotic structure of nature thrilled me since the first time I heard of it. When I got news of a new iGEM team I instantly took the chance and joined. Through the iGEM contest I was able to follow a project from the idea on a piece of paper, all the way to proof of concept experiments and final evaluation. I experienced the ups and downs of being in a team with people of so many disciplines and I got the chance to take part in every step that was necessary to make something happen.</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Lisa Jerabek</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/a/a8/Lisa.jpg" width="200px"/></td><br />
<td><div align="justify">I´m studying biology in the 8th semester and will start my Master´s thesis in the research area of synthetic biology in October. <br />
By joining in on freiGEM2012 I accepted the challenge of planning and realizing a self-made project in my research area of interest. I considered my participation in the iGEM team as an opportunity to broaden my expertise in many respects. For me, a really important experience was to face the difficulties of lab work in a large team of members with profoundly varying skills and to learn how to cope with these discrepancies. My primary role in the team was the management of cell cultural issues, which is what made me the “cell culture lady” of the team. <br />
I´m very grateful for the opportunity to learn new methods as well as to get to know new approaches to solving scientific problems and for such a great time with freiGEM2012.</div><br />
</td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Natalie Knoll</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/6/6a/Natalie.png" width="200px"/></td><br />
<td><div align="justify">I'm studying biology in the 8th semester and starting to prepare for my master thesis. The iGEM 2012 contest was a great experience for me and im glad i took my last chance to join a iGEM team. It was a great time and i'm sure i will miss my team when the iGEM time ends. When im thinking about the countless hours we spend in the lap, all the days and at the end even the nights, i'm already sure i will miss this time and all the great people of my team. </div><br />
</td><br />
</tr></table><br />
</html><br />
<br />
----<br />
<br />
==Bachelor students==<br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Lucas Schneider</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/b/bb/LucasS.jpg" width="200px"/></td><br />
<td><div align="justify">During completion of my bachelor of science degree in molecular biology, I joined the IGEM Team of Freiburg. My research interests are molecular biology, bioinformatics and plant biotechnology.<br />
My role in freiGEM 2012 was to instruct an interdisciplinary team of students in molecular cloning and experimental design. Finally, I am proud that we got the toolkit and the TAL-Vectors up and running. It was a valuable experience working with such a team.</div><br />
</td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Lukas Boeckelmann</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/f/f9/Lukas.jpg" width="200px"/></td><br />
<td><div align="justify">I am a student of Medicine in my fourth year and have always been fascinated by the opportunities that modern Molecular Biology has to offer. I have just started my MD thesis and many of the experiences I've already made with iGEM help me greatly. I have benefited tremendously from the iGEM project: It has been very rewarding to research a topic in such depth, to discuss it with the wonderful and bright (and funny) people I have met in our team and to then develop methodical solutions that actually function well! <br />
I am incredibly excited about the work we have done so far and about the work we will continue to do!</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Franz Dressler</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/7/79/FranzD.jpg" width="200px"/></td><br />
<td><div align="justify">I´m a medical student in the 4th year and I joined iGEM due to the unlimited possibilities the project offers. It is a unique opportunity to explore a scientific question or to tackle an everyday biological problem - but the best thing about it: you are completely free to choose what field you want to engage in. From the medical point of view it is also intriguing to get more familiar with molecular methods. In all these regards my expectations have completely been fulfilled. We had an amazing time in the lab, but also exciting discussions and presentations, a vivid and enriching exchange of ideas and knowledge amongst the team members and thanks to the iGEM community. <br />
My special contributions to our project were modeling as well as layout and design of our website and posters.</div><br />
</td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Kimon Runge</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/e/e2/Kimon.jpg" width="200px"/></td><br />
<td><div align="justify">I´m studying medicine in the 4th year and I participate in iGEM because I want to get a better insight in the workings of a laboratory. And what better source of insight can you get than operating your own lab as a team? Of course it’s much more than that and an experience I can recommend to anyone. My special mission is to plan the travels of the group.</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Sebastian Kuechlin</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/5/55/Sebastian.jpg" width="200px"/></td><br />
<td><div align="justify">I'm a medical student and currently in my fourth year of studies. What fascinates me about synthetic biology is the engineering aspect: I love reconsidering the knowledge I have learned thus far in my medical education and applying it in new ways: Participating in iGEM has altered my way of thinking about biology for good. When I'm not in the hospital, the lecture halls or labs, I love making music and have found a wonderful opportunity to do so as a piano player in our university's big band."</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Fabian Stritt</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/d/d8/Fabian.jpg" width="200px"/></td><br />
<td><div align="justify">I have completed two years of my bachelor of science curriculum in biology in Freiburg and will continue my studies in Strasburg in a bioengineering program. It was my interest in the synthetic aspects of biology, which motivated me to join the iGEM team. My particular contribution to our project was the organization of the film project, the result of which you can see on our website, as well as the representation of our team in Berlin at the 'Biotechnologie2020+' . For me, iGEM was a valuable experience which strengthened my wish to become a bioengineer. ></div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Philipp Warmer</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/2/25/PhillipW.jpg" width="200px"/></td><br />
<td><div align="justify">This is a TALE about Philipp who grew up to become a bioengineer.<br />
Once upon a time this Philipp started studying biology at Freiburg University and got very attracted to the beauty that resides within the simplicity of SynBio.<br />
As he got older he joined the freiGEM Team to take part in the world wide challenge for SynBio.<br />
And so he and the freiGEM Team lived happily ever after...<br />
See you all at the Jamboree!<br />
</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Jan Patrick Steitz</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/a/a8/Jan-Phillip.jpg" width="200px"/></td><br />
<td><div align="justify">I´m a third year student of pharmaceutics, so most of the time I have to deal with chemistry.<br />
iGEM gave me a great opportunity to gain experience on the subject of synthetic biology and, of course, it was a lot of fun. <br />
</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Leo Scheller</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/8/8c/Leo.jpg" width="200px"/></td><br />
<td><div align="justify">I studied molecular medicine in Freiburg and I just moved to Edinburgh for Systems and Synthetic Biology. I hope to integrate Systems and Synthetic Biology into medical research and iGEM has been a great opportunity for gathering practical skills, for being creative, and for getting to know very cool people. Also I'm happy that we have a very promising project and I look forward to our presentation in Amsterdam.</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Dennis Grishin</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/3/32/Denis.jpg" width="200px"/></td><br />
<td><div align="justify">I study molecular medicine and microelectromechanical systems. With this choice of fields of study my goal is to bring life sciences and engineering together. When I heard about iGEM I realized that for me it would be the perfect opportunity to pursue this objective. I am fascinated by synthetic biology and believe in the great potential of biological engineering approaches. freiGEM 2012 gave me the opportunity to take part in an exciting project and to further develop my lab skills. It was a lot of fun and I have very much enjoyed the work in our team.</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Verena Waehle</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/d/d0/Verena.jpg" width="200px"/></td><br />
<td><div align="justify">During the time of my bachelor studies in molecular medicine, I learned a lot about the function of cells as well as of whole organisms. Nevertheless, the field of synthetic biology remained something impalpable for me. When I first heard about iGEM, I was intrigued by the concept, that a group of students should plan and realize a whole project in the context of synthetic biology almost on their own. Considering this a challenge and a great opportunity to broaden my horizon by emerging into a research area that differs profoundly from everything I have done before, I joined in on the team. During the whole iGEM year, I was able to learn a lot about almost any aspect of research life, which is what makes the time with freiGEM such an invaluable experience. <br />
I really enjoy the opportunity to be part of such a fabulous project and of an even more fabulous team!<br />
</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Josip Herman</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/7/77/Josip.jpg" width="200px"/></td><br />
<td><div align="justify">I´m studying molecular medicine and I was curious about iGEM. iGEM gives me the opportunity to get first insights into the emerging field of synthetic biology, which will very likely influence our future lives. During the time as a freiGEM team member I earned a lot of lab experience and enjoyed the time in the team.<br />
May the TALs be with you.<br />
See you.<br />
</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>David Fuchs</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/a/ab/DavidF.jpg" width="200px"/></td><br />
<td><div align="justify">Biology is going synthetic and it's going there fast. It poses many new and exciting frontiers, so joining in on such a high profile competition as iGEM came natural. Working with people from every corner of the life science landscape and beyond was an eye-opening experience. I learned quite a bit about every facet of lab life during my time with freiGEM, which is what makes this whole endeavor so invaluable.<br />
Cheers to all.<br />
</div></td><br />
</tr></table><br />
</html><br />
----<br />
==Human Practice==<br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Pablo Grassi</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/9/99/Pablo.jpg" width="200px"/></td><br />
<td><div align="justify"><br />
I will try to make a long story short: I obtained a bachelor´s degree in biology and I´m currently studying philosophy. I joined the freiGEM-team because of just two reasons. On the one hand, since 2010 I organize an interdisciplinary project at the University of Freiburg concerning the concept of life. In this project, I intend to combine theoretical biology and philosophy of biology to encounter the phenomena of the living. On the other hand, I specialized in the fields of synthetic biology and biochemistry during my bachelor studies. Through combination of these two aspects, the iGEM competition revealed itself as an unique chance for exploring arising philosophical questions concerning our understanding of life. I was lucky I had the possibility to be a member of this great team, which lively promoted philosophical reflection and precise thinking.<br />
</div></td><br />
</tr></table><br />
</html><br />
<br />
----<br />
==Advisors==<br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Dr. Susanne Proksch</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/0Susanne1.jpg" width="200px"/></td><br />
<td><div align="justify">I have joined the iGEM team as an advisor to share my research experience with the younger team members. After studying dental medicine, and post doctoral work in Paris, I´m currently doing research on regenerative dentistry at the Clinic for Oral & Maxillofacial Surgery of the “Uniklinik Freiburg”. I decided to participate in the iGEM competition due to my enthusiasm, curiosity and passion for the world of science and my tremendous thirst for new knowledge. Furthermore, it is a great experience to get in touch with the initiative, creativity and cleverness of the undergraduate students which is quite impressive. I got to know synthetic biology as a fascinating field of research and I´m really grateful for this superb experience – Chapeau freiGEM 2012!</div></td><br />
</tr></table><br />
</html><br />
<br />
<br><br><br><br><br />
[[#top|Back to top]]<br />
<br />
<br />
[[File:Susanne1.jpg]]</div>Luboehttp://2012.igem.org/File:Susanne1.jpgFile:Susanne1.jpg2013-06-06T15:49:32Z<p>Luboe: </p>
<hr />
<div></div>Luboehttp://2012.igem.org/Team:Freiburg/Team2Team:Freiburg/Team22013-06-06T15:49:15Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<br />
= Team = <br />
----<br />
<br><br />
[[File:teamsymbolT.png|180px|center|link=]]<br />
<br><br><br />
{|align="center"<br />
|[[Image:team_freiburg.jpg|400px|center|link=]]<br />
|-<br />
|}<br />
<br />
<div style="text-align: center;"><span style="text-align:center; color:##C1E2FE; background:##00C000"> '''The FreiGEM 2012 Team'''<br />
</span><br />
</div><br />
<br />
<br />
<div align="justify">Our interdisciplinary team mainly consists of undergraduate students from every corner of the scientific landscape and beyond: Medicine, Biology, Molecular Medicine, Pharmaceutical Science and even Philosophy.<br />
Our team leader Nicolas started the team in autumn 2011, when he first discussed participation in the competition with a small group of colleagues of his and some molecular medicine students, which were instantly enthusiastic about the prospect of taking part in a famous synthetic biology competition. The remaining team members joined in following up on announcements, through contact with former iGEM members or oral propaganda.<br />
The first meeting of our team was held in a Pub in Freiburg in November 2011 as an opportunity to get to know each other. <br />
Since 2011, weekly iGEM meetings were set on to get things moving: finding a promising idea, investigating former projects and interesting methods, founding a non-profit association, scouting sponsoring options. <br />
In spite of meeting every single week, it almost took us until April, that we finally pinned down an idea for our project: the development of a method to assemble a TAL protein with 14 DNA binding sites in one single reaction and the aim to use these proteins to direct effector enzymes to specific target sequences within the genome. <br />
To realize our project, we were able to go back to the unique knowledge of every single team member. Be it in research issues, financial questions or website-related problems, everyone in our team did his or her best to make the most out of the project. <br />
During the period of lab work, we tried to spend at least some time together away from the lab to strengthen team cohesion. We had a barbecue in Nico´s garden, bike tours around Freiburg and the obligatory late night search trip for food between gel extractions. Our work together was not only on a professional level but brought us together as friends and we surely will keep it that way beyond iGEM. <br />
<br />
In the following, the freiGEM team members will introduce themselves:<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
= Who we are =<br />
<br><br />
----<br />
==Student Leader==<br />
<br><br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Nicolas Wyvekens</th><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/f/fb/NicoW.jpg" width="200px"/></td><br />
<td><div align="justify">I´m a third-year medical student and the student group leader of our iGEM team. What I like most about iGEM is the opportunity to work on a project that we, as a team, have come up with and planned ourselves. As a medical student, I hadn’t received much training in molecular biology techniques, so it was very challenging for me to plan the project. Besides learning new lab skills, it was an important lesson to deal with frustration when days (and nights) of intense work turned up no positive results. In the end, it is even more rewarding to see that our idea actually works very well and that it attracts great interest from ’real’ scientists.</div></td><br />
</tr></table><br />
</html><br />
----<br />
<br />
==Master students==<br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>David Siegel</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/7/7a/DavidS.jpg" width="200px"/></td><br />
<td><div align="justify">I'm 25 years old and studying biology in the 8th semster at the Albert-Ludwigs University Freiburg. Currently, I'm in the master programm and preparing to start my master thesis in the field of syntehtic biology and biotechnology.<br><br />
The whole theory of synthetic biology, the idea of organising the seemingly chaotic structure of nature thrilled me since the first time I heard of it. When I got news of a new iGEM team I instantly took the chance and joined. Through the iGEM contest I was able to follow a project from the idea on a piece of paper, all the way to proof of concept experiments and final evaluation. I experienced the ups and downs of being in a team with people of so many disciplines and I got the chance to take part in every step that was necessary to make something happen.</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Lisa Jerabek</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/a/a8/Lisa.jpg" width="200px"/></td><br />
<td><div align="justify">I´m studying biology in the 8th semester and will start my Master´s thesis in the research area of synthetic biology in October. <br />
By joining in on freiGEM2012 I accepted the challenge of planning and realizing a self-made project in my research area of interest. I considered my participation in the iGEM team as an opportunity to broaden my expertise in many respects. For me, a really important experience was to face the difficulties of lab work in a large team of members with profoundly varying skills and to learn how to cope with these discrepancies. My primary role in the team was the management of cell cultural issues, which is what made me the “cell culture lady” of the team. <br />
I´m very grateful for the opportunity to learn new methods as well as to get to know new approaches to solving scientific problems and for such a great time with freiGEM2012.</div><br />
</td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Natalie Knoll</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/6/6a/Natalie.png" width="200px"/></td><br />
<td><div align="justify">I'm studying biology in the 8th semester and starting to prepare for my master thesis. The iGEM 2012 contest was a great experience for me and im glad i took my last chance to join a iGEM team. It was a great time and i'm sure i will miss my team when the iGEM time ends. When im thinking about the countless hours we spend in the lap, all the days and at the end even the nights, i'm already sure i will miss this time and all the great people of my team. </div><br />
</td><br />
</tr></table><br />
</html><br />
<br />
----<br />
<br />
==Bachelor students==<br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Lucas Schneider</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/b/bb/LucasS.jpg" width="200px"/></td><br />
<td><div align="justify">During completion of my bachelor of science degree in molecular biology, I joined the IGEM Team of Freiburg. My research interests are molecular biology, bioinformatics and plant biotechnology.<br />
My role in freiGEM 2012 was to instruct an interdisciplinary team of students in molecular cloning and experimental design. Finally, I am proud that we got the toolkit and the TAL-Vectors up and running. It was a valuable experience working with such a team.</div><br />
</td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Lukas Boeckelmann</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/f/f9/Lukas.jpg" width="200px"/></td><br />
<td><div align="justify">I am a student of Medicine in my fourth year and have always been fascinated by the opportunities that modern Molecular Biology has to offer. I have just started my MD thesis and many of the experiences I've already made with iGEM help me greatly. I have benefited tremendously from the iGEM project: It has been very rewarding to research a topic in such depth, to discuss it with the wonderful and bright (and funny) people I have met in our team and to then develop methodical solutions that actually function well! <br />
I am incredibly excited about the work we have done so far and about the work we will continue to do!</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Franz Dressler</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/7/79/FranzD.jpg" width="200px"/></td><br />
<td><div align="justify">I´m a medical student in the 4th year and I joined iGEM due to the unlimited possibilities the project offers. It is a unique opportunity to explore a scientific question or to tackle an everyday biological problem - but the best thing about it: you are completely free to choose what field you want to engage in. From the medical point of view it is also intriguing to get more familiar with molecular methods. In all these regards my expectations have completely been fulfilled. We had an amazing time in the lab, but also exciting discussions and presentations, a vivid and enriching exchange of ideas and knowledge amongst the team members and thanks to the iGEM community. <br />
My special contributions to our project were modeling as well as layout and design of our website and posters.</div><br />
</td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Kimon Runge</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/e/e2/Kimon.jpg" width="200px"/></td><br />
<td><div align="justify">I´m studying medicine in the 4th year and I participate in iGEM because I want to get a better insight in the workings of a laboratory. And what better source of insight can you get than operating your own lab as a team? Of course it’s much more than that and an experience I can recommend to anyone. My special mission is to plan the travels of the group.</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Sebastian Kuechlin</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/5/55/Sebastian.jpg" width="200px"/></td><br />
<td><div align="justify">I'm a medical student and currently in my fourth year of studies. What fascinates me about synthetic biology is the engineering aspect: I love reconsidering the knowledge I have learned thus far in my medical education and applying it in new ways: Participating in iGEM has altered my way of thinking about biology for good. When I'm not in the hospital, the lecture halls or labs, I love making music and have found a wonderful opportunity to do so as a piano player in our university's big band."</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Fabian Stritt</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/d/d8/Fabian.jpg" width="200px"/></td><br />
<td><div align="justify">I have completed two years of my bachelor of science curriculum in biology in Freiburg and will continue my studies in Strasburg in a bioengineering program. It was my interest in the synthetic aspects of biology, which motivated me to join the iGEM team. My particular contribution to our project was the organization of the film project, the result of which you can see on our website, as well as the representation of our team in Berlin at the 'Biotechnologie2020+' . For me, iGEM was a valuable experience which strengthened my wish to become a bioengineer. ></div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Philipp Warmer</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/2/25/PhillipW.jpg" width="200px"/></td><br />
<td><div align="justify">This is a TALE about Philipp who grew up to become a bioengineer.<br />
Once upon a time this Philipp started studying biology at Freiburg University and got very attracted to the beauty that resides within the simplicity of SynBio.<br />
As he got older he joined the freiGEM Team to take part in the world wide challenge for SynBio.<br />
And so he and the freiGEM Team lived happily ever after...<br />
See you all at the Jamboree!<br />
</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Jan Patrick Steitz</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/a/a8/Jan-Phillip.jpg" width="200px"/></td><br />
<td><div align="justify">I´m a third year student of pharmaceutics, so most of the time I have to deal with chemistry.<br />
iGEM gave me a great opportunity to gain experience on the subject of synthetic biology and, of course, it was a lot of fun. <br />
</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Leo Scheller</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/8/8c/Leo.jpg" width="200px"/></td><br />
<td><div align="justify">I studied molecular medicine in Freiburg and I just moved to Edinburgh for Systems and Synthetic Biology. I hope to integrate Systems and Synthetic Biology into medical research and iGEM has been a great opportunity for gathering practical skills, for being creative, and for getting to know very cool people. Also I'm happy that we have a very promising project and I look forward to our presentation in Amsterdam.</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Dennis Grishin</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/3/32/Denis.jpg" width="200px"/></td><br />
<td><div align="justify">I study molecular medicine and microelectromechanical systems. With this choice of fields of study my goal is to bring life sciences and engineering together. When I heard about iGEM I realized that for me it would be the perfect opportunity to pursue this objective. I am fascinated by synthetic biology and believe in the great potential of biological engineering approaches. freiGEM 2012 gave me the opportunity to take part in an exciting project and to further develop my lab skills. It was a lot of fun and I have very much enjoyed the work in our team.</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Verena Waehle</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/d/d0/Verena.jpg" width="200px"/></td><br />
<td><div align="justify">During the time of my bachelor studies in molecular medicine, I learned a lot about the function of cells as well as of whole organisms. Nevertheless, the field of synthetic biology remained something impalpable for me. When I first heard about iGEM, I was intrigued by the concept, that a group of students should plan and realize a whole project in the context of synthetic biology almost on their own. Considering this a challenge and a great opportunity to broaden my horizon by emerging into a research area that differs profoundly from everything I have done before, I joined in on the team. During the whole iGEM year, I was able to learn a lot about almost any aspect of research life, which is what makes the time with freiGEM such an invaluable experience. <br />
I really enjoy the opportunity to be part of such a fabulous project and of an even more fabulous team!<br />
</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Josip Herman</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/7/77/Josip.jpg" width="200px"/></td><br />
<td><div align="justify">I´m studying molecular medicine and I was curious about iGEM. iGEM gives me the opportunity to get first insights into the emerging field of synthetic biology, which will very likely influence our future lives. During the time as a freiGEM team member I earned a lot of lab experience and enjoyed the time in the team.<br />
May the TALs be with you.<br />
See you.<br />
</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>David Fuchs</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/a/ab/DavidF.jpg" width="200px"/></td><br />
<td><div align="justify">Biology is going synthetic and it's going there fast. It poses many new and exciting frontiers, so joining in on such a high profile competition as iGEM came natural. Working with people from every corner of the life science landscape and beyond was an eye-opening experience. I learned quite a bit about every facet of lab life during my time with freiGEM, which is what makes this whole endeavor so invaluable.<br />
Cheers to all.<br />
</div></td><br />
</tr></table><br />
</html><br />
----<br />
==Human Practice==<br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Pablo Grassi</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/9/99/Pablo.jpg" width="200px"/></td><br />
<td><div align="justify"><br />
I will try to make a long story short: I obtained a bachelor´s degree in biology and I´m currently studying philosophy. I joined the freiGEM-team because of just two reasons. On the one hand, since 2010 I organize an interdisciplinary project at the University of Freiburg concerning the concept of life. In this project, I intend to combine theoretical biology and philosophy of biology to encounter the phenomena of the living. On the other hand, I specialized in the fields of synthetic biology and biochemistry during my bachelor studies. Through combination of these two aspects, the iGEM competition revealed itself as an unique chance for exploring arising philosophical questions concerning our understanding of life. I was lucky I had the possibility to be a member of this great team, which lively promoted philosophical reflection and precise thinking.<br />
</div></td><br />
</tr></table><br />
</html><br />
<br />
----<br />
==Advisors==<br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Dr. Susanne Proksch</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/0/0c/Susanne1.jpg" width="200px"/></td><br />
<td><div align="justify">I have joined the iGEM team as an advisor to share my research experience with the younger team members. After studying dental medicine, and post doctoral work in Paris, I´m currently doing research on regenerative dentistry at the Clinic for Oral & Maxillofacial Surgery of the “Uniklinik Freiburg”. I decided to participate in the iGEM competition due to my enthusiasm, curiosity and passion for the world of science and my tremendous thirst for new knowledge. Furthermore, it is a great experience to get in touch with the initiative, creativity and cleverness of the undergraduate students which is quite impressive. I got to know synthetic biology as a fascinating field of research and I´m really grateful for this superb experience – Chapeau freiGEM 2012!</div></td><br />
</tr></table><br />
</html><br />
<br />
<br><br><br><br><br />
[[#top|Back to top]]<br />
<br />
<br />
[[File:Susanne1.jpg]]</div>Luboehttp://2012.igem.org/Team:Freiburg/Team2Team:Freiburg/Team22013-06-06T15:46:38Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<br />
= Team = <br />
----<br />
<br><br />
[[File:teamsymbolT.png|180px|center|link=]]<br />
<br><br><br />
{|align="center"<br />
|[[Image:team_freiburg.jpg|400px|center|link=]]<br />
|-<br />
|}<br />
<br />
<div style="text-align: center;"><span style="text-align:center; color:##C1E2FE; background:##00C000"> '''The FreiGEM 2012 Team'''<br />
</span><br />
</div><br />
<br />
<br />
<div align="justify">Our interdisciplinary team mainly consists of undergraduate students from every corner of the scientific landscape and beyond: Medicine, Biology, Molecular Medicine, Pharmaceutical Science and even Philosophy.<br />
Our team leader Nicolas started the team in autumn 2011, when he first discussed participation in the competition with a small group of colleagues of his and some molecular medicine students, which were instantly enthusiastic about the prospect of taking part in a famous synthetic biology competition. The remaining team members joined in following up on announcements, through contact with former iGEM members or oral propaganda.<br />
The first meeting of our team was held in a Pub in Freiburg in November 2011 as an opportunity to get to know each other. <br />
Since 2011, weekly iGEM meetings were set on to get things moving: finding a promising idea, investigating former projects and interesting methods, founding a non-profit association, scouting sponsoring options. <br />
In spite of meeting every single week, it almost took us until April, that we finally pinned down an idea for our project: the development of a method to assemble a TAL protein with 14 DNA binding sites in one single reaction and the aim to use these proteins to direct effector enzymes to specific target sequences within the genome. <br />
To realize our project, we were able to go back to the unique knowledge of every single team member. Be it in research issues, financial questions or website-related problems, everyone in our team did his or her best to make the most out of the project. <br />
During the period of lab work, we tried to spend at least some time together away from the lab to strengthen team cohesion. We had a barbecue in Nico´s garden, bike tours around Freiburg and the obligatory late night search trip for food between gel extractions. Our work together was not only on a professional level but brought us together as friends and we surely will keep it that way beyond iGEM. <br />
<br />
In the following, the freiGEM team members will introduce themselves:<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
= Who we are =<br />
<br><br />
----<br />
==Student Leader==<br />
<br><br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Nicolas Wyvekens</th><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/f/fb/NicoW.jpg" width="200px"/></td><br />
<td><div align="justify">I´m a third-year medical student and the student group leader of our iGEM team. What I like most about iGEM is the opportunity to work on a project that we, as a team, have come up with and planned ourselves. As a medical student, I hadn’t received much training in molecular biology techniques, so it was very challenging for me to plan the project. Besides learning new lab skills, it was an important lesson to deal with frustration when days (and nights) of intense work turned up no positive results. In the end, it is even more rewarding to see that our idea actually works very well and that it attracts great interest from ’real’ scientists.</div></td><br />
</tr></table><br />
</html><br />
----<br />
<br />
==Master students==<br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>David Siegel</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/7/7a/DavidS.jpg" width="200px"/></td><br />
<td><div align="justify">I'm 25 years old and studying biology in the 8th semster at the Albert-Ludwigs University Freiburg. Currently, I'm in the master programm and preparing to start my master thesis in the field of syntehtic biology and biotechnology.<br><br />
The whole theory of synthetic biology, the idea of organising the seemingly chaotic structure of nature thrilled me since the first time I heard of it. When I got news of a new iGEM team I instantly took the chance and joined. Through the iGEM contest I was able to follow a project from the idea on a piece of paper, all the way to proof of concept experiments and final evaluation. I experienced the ups and downs of being in a team with people of so many disciplines and I got the chance to take part in every step that was necessary to make something happen.</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Lisa Jerabek</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/a/a8/Lisa.jpg" width="200px"/></td><br />
<td><div align="justify">I´m studying biology in the 8th semester and will start my Master´s thesis in the research area of synthetic biology in October. <br />
By joining in on freiGEM2012 I accepted the challenge of planning and realizing a self-made project in my research area of interest. I considered my participation in the iGEM team as an opportunity to broaden my expertise in many respects. For me, a really important experience was to face the difficulties of lab work in a large team of members with profoundly varying skills and to learn how to cope with these discrepancies. My primary role in the team was the management of cell cultural issues, which is what made me the “cell culture lady” of the team. <br />
I´m very grateful for the opportunity to learn new methods as well as to get to know new approaches to solving scientific problems and for such a great time with freiGEM2012.</div><br />
</td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Natalie Knoll</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/6/6a/Natalie.png" width="200px"/></td><br />
<td><div align="justify">I'm studying biology in the 8th semester and starting to prepare for my master thesis. The iGEM 2012 contest was a great experience for me and im glad i took my last chance to join a iGEM team. It was a great time and i'm sure i will miss my team when the iGEM time ends. When im thinking about the countless hours we spend in the lap, all the days and at the end even the nights, i'm already sure i will miss this time and all the great people of my team. </div><br />
</td><br />
</tr></table><br />
</html><br />
<br />
----<br />
<br />
==Bachelor students==<br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Lucas Schneider</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/b/bb/LucasS.jpg" width="200px"/></td><br />
<td><div align="justify">During completion of my bachelor of science degree in molecular biology, I joined the IGEM Team of Freiburg. My research interests are molecular biology, bioinformatics and plant biotechnology.<br />
My role in freiGEM 2012 was to instruct an interdisciplinary team of students in molecular cloning and experimental design. Finally, I am proud that we got the toolkit and the TAL-Vectors up and running. It was a valuable experience working with such a team.</div><br />
</td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Lukas Boeckelmann</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/f/f9/Lukas.jpg" width="200px"/></td><br />
<td><div align="justify">I am a student of Medicine in my fourth year and have always been fascinated by the opportunities that modern Molecular Biology has to offer. I have just started my MD thesis and many of the experiences I've already made with iGEM help me greatly. I have benefited tremendously from the iGEM project: It has been very rewarding to research a topic in such depth, to discuss it with the wonderful and bright (and funny) people I have met in our team and to then develop methodical solutions that actually function well! <br />
I am incredibly excited about the work we have done so far and about the work we will continue to do!</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Franz Dressler</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/7/79/FranzD.jpg" width="200px"/></td><br />
<td><div align="justify">I´m a medical student in the 4th year and I joined iGEM due to the unlimited possibilities the project offers. It is a unique opportunity to explore a scientific question or to tackle an everyday biological problem - but the best thing about it: you are completely free to choose what field you want to engage in. From the medical point of view it is also intriguing to get more familiar with molecular methods. In all these regards my expectations have completely been fulfilled. We had an amazing time in the lab, but also exciting discussions and presentations, a vivid and enriching exchange of ideas and knowledge amongst the team members and thanks to the iGEM community. <br />
My special contributions to our project were modeling as well as layout and design of our website and posters.</div><br />
</td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Kimon Runge</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/e/e2/Kimon.jpg" width="200px"/></td><br />
<td><div align="justify">I´m studying medicine in the 4th year and I participate in iGEM because I want to get a better insight in the workings of a laboratory. And what better source of insight can you get than operating your own lab as a team? Of course it’s much more than that and an experience I can recommend to anyone. My special mission is to plan the travels of the group.</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Sebastian Kuechlin</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/5/55/Sebastian.jpg" width="200px"/></td><br />
<td><div align="justify">I'm a medical student and currently in my fourth year of studies. What fascinates me about synthetic biology is the engineering aspect: I love reconsidering the knowledge I have learned thus far in my medical education and applying it in new ways: Participating in iGEM has altered my way of thinking about biology for good. When I'm not in the hospital, the lecture halls or labs, I love making music and have found a wonderful opportunity to do so as a piano player in our university's big band."</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Fabian Stritt</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/d/d8/Fabian.jpg" width="200px"/></td><br />
<td><div align="justify">I have completed two years of my bachelor of science curriculum in biology in Freiburg and will continue my studies in Strasburg in a bioengineering program. It was my interest in the synthetic aspects of biology, which motivated me to join the iGEM team. My particular contribution to our project was the organization of the film project, the result of which you can see on our website, as well as the representation of our team in Berlin at the 'Biotechnologie2020+' . For me, iGEM was a valuable experience which strengthened my wish to become a bioengineer. ></div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Philipp Warmer</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/2/25/PhillipW.jpg" width="200px"/></td><br />
<td><div align="justify">This is a TALE about Philipp who grew up to become a bioengineer.<br />
Once upon a time this Philipp started studying biology at Freiburg University and got very attracted to the beauty that resides within the simplicity of SynBio.<br />
As he got older he joined the freiGEM Team to take part in the world wide challenge for SynBio.<br />
And so he and the freiGEM Team lived happily ever after...<br />
See you all at the Jamboree!<br />
</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Jan Patrick Steitz</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/a/a8/Jan-Phillip.jpg" width="200px"/></td><br />
<td><div align="justify">I´m a third year student of pharmaceutics, so most of the time I have to deal with chemistry.<br />
iGEM gave me a great opportunity to gain experience on the subject of synthetic biology and, of course, it was a lot of fun. <br />
</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Leo Scheller</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/8/8c/Leo.jpg" width="200px"/></td><br />
<td><div align="justify">I studied molecular medicine in Freiburg and I just moved to Edinburgh for Systems and Synthetic Biology. I hope to integrate Systems and Synthetic Biology into medical research and iGEM has been a great opportunity for gathering practical skills, for being creative, and for getting to know very cool people. Also I'm happy that we have a very promising project and I look forward to our presentation in Amsterdam.</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Dennis Grishin</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/3/32/Denis.jpg" width="200px"/></td><br />
<td><div align="justify">I study molecular medicine and microelectromechanical systems. With this choice of fields of study my goal is to bring life sciences and engineering together. When I heard about iGEM I realized that for me it would be the perfect opportunity to pursue this objective. I am fascinated by synthetic biology and believe in the great potential of biological engineering approaches. freiGEM 2012 gave me the opportunity to take part in an exciting project and to further develop my lab skills. It was a lot of fun and I have very much enjoyed the work in our team.</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Verena Waehle</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/d/d0/Verena.jpg" width="200px"/></td><br />
<td><div align="justify">During the time of my bachelor studies in molecular medicine, I learned a lot about the function of cells as well as of whole organisms. Nevertheless, the field of synthetic biology remained something impalpable for me. When I first heard about iGEM, I was intrigued by the concept, that a group of students should plan and realize a whole project in the context of synthetic biology almost on their own. Considering this a challenge and a great opportunity to broaden my horizon by emerging into a research area that differs profoundly from everything I have done before, I joined in on the team. During the whole iGEM year, I was able to learn a lot about almost any aspect of research life, which is what makes the time with freiGEM such an invaluable experience. <br />
I really enjoy the opportunity to be part of such a fabulous project and of an even more fabulous team!<br />
</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Josip Herman</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/7/77/Josip.jpg" width="200px"/></td><br />
<td><div align="justify">I´m studying molecular medicine and I was curious about iGEM. iGEM gives me the opportunity to get first insights into the emerging field of synthetic biology, which will very likely influence our future lives. During the time as a freiGEM team member I earned a lot of lab experience and enjoyed the time in the team.<br />
May the TALs be with you.<br />
See you.<br />
</div></td><br />
</tr></table><br />
</html><br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>David Fuchs</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/a/ab/DavidF.jpg" width="200px"/></td><br />
<td><div align="justify">Biology is going synthetic and it's going there fast. It poses many new and exciting frontiers, so joining in on such a high profile competition as iGEM came natural. Working with people from every corner of the life science landscape and beyond was an eye-opening experience. I learned quite a bit about every facet of lab life during my time with freiGEM, which is what makes this whole endeavor so invaluable.<br />
Cheers to all.<br />
</div></td><br />
</tr></table><br />
</html><br />
----<br />
==Human Practice==<br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Pablo Grassi</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/9/99/Pablo.jpg" width="200px"/></td><br />
<td><div align="justify"><br />
I will try to make a long story short: I obtained a bachelor´s degree in biology and I´m currently studying philosophy. I joined the freiGEM-team because of just two reasons. On the one hand, since 2010 I organize an interdisciplinary project at the University of Freiburg concerning the concept of life. In this project, I intend to combine theoretical biology and philosophy of biology to encounter the phenomena of the living. On the other hand, I specialized in the fields of synthetic biology and biochemistry during my bachelor studies. Through combination of these two aspects, the iGEM competition revealed itself as an unique chance for exploring arising philosophical questions concerning our understanding of life. I was lucky I had the possibility to be a member of this great team, which lively promoted philosophical reflection and precise thinking.<br />
</div></td><br />
</tr></table><br />
</html><br />
<br />
----<br />
==Advisors==<br />
<br />
<html><br />
<table border="0" cellspacing="30" style="background-color:transparent"><br />
<tr><br />
<th>Dr. Susanne Proksch</th></tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2012/0/0c/Susanne1.jpg" width="200px"/></td><br />
<td><div align="justify">I have joined the iGEM team as an advisor to share my research experience with the younger team members. After studying dental medicine, and post doctoral work in Paris, I´m currently doing research on regenerative dentistry at the Clinic for Oral & Maxillofacial Surgery of the “Uniklinik Freiburg”. I decided to participate in the iGEM competition due to my enthusiasm, curiosity and passion for the world of science and my tremendous thirst for new knowledge. Furthermore, it is a great experience to get in touch with the initiative, creativity and cleverness of the undergraduate students which is quite impressive. I got to know synthetic biology as a fascinating field of research and I´m really grateful for this superb experience – Chapeau freiGEM 2012!</div></td><br />
</tr></table><br />
</html><br />
<br />
<br><br><br><br><br />
[[#top|Back to top]]</div>Luboehttp://2012.igem.org/Team:Freiburg/Project/ExperimentsTeam:Freiburg/Project/Experiments2012-11-10T15:30:43Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= ''In vitro'' testing =<br />
----<br />
----<br />
<br><br><br />
== The Toolkit ==<br />
----<br />
<br>Admittedly, our GATE assembly kit is a little larger than the kit published from the Zhang group in Nature this year<sup>1</sup> (the latter comprises 78 parts). But considering that future iGEM teams can easily combine the parts to form more than 67 million different effectors, we believe that it was worth the effort. Now, to get from the toolbox to the finished TAL effector, you only need a few components: six direpeats, one effector backbone plasmid, two enzymes and one buffer. If you mix these components and incubate in your thermocycler for 2.5 hours, you get your custom TAL effector. To put this in perspective: The average turnaround time for TALE construction with conventional kits is about two weeks! In the following sections, we want to show you the efficiency of our GATE assembly platform.<br><br />
The creation of a toolkit with 96 different parts not only means a lot of labwork but also a lot of organisational tasks, sequencing and analysis. We don't want to bore you with the 96 sequences of our finished BioBricks, but we want to give you one example of a finished BioBrick and highlight some of the interesting and important strips in its sequence. If you are interested in the other sequences, just have a look at our [[Team:Freiburg/Parts|parts section]] or go to the [http://partsregistry.org Registry of Standard Biological Parts].<br />
<br />
<br />
{|align="center"<br />
|[[Image:AA1sequence.png|400px|no frame|link=]]<br />
|}<br />
<br />
<br />
In this sequence of our BioBrick AA1, the main features of all our BioBricks are highlighted. As pointed out in the [[Team:Freiburg/Project/Golden#GGC|Golden Gate Standard section]] of our project description, all direpeat plasmids are submitted in the Golden Gate Standard, that was developed by us and which is fully compatible with existing iGEM standards. In yellow, you can see the direpeat gene fragment itself, the green parts are iGEM restriction sites (a requirement for all BioBricks), the sequence written in red is part of the psb1C3 vector, the blue sequences are recognition sites for BsmB1 and the red boxes are the cutting sites of BsmB1.<br />
<br><br />
<br><br />
== Varying Cycle number of GATE assembly has limited effect ==<br />
----<br />
Golden Gate protocols published so far for multistep TALE assembly differ significantly in the number of digestion-ligation cycles performed. To assess, whether the cycle number significantly affects outcome, we performed 4 different GATE assemblies, each with three different cycle numbers (50, 25 and 13 cycles). We did not see significant differences in the number of colonies for the three cycle numbers. Consequently, from that point on, we performed GATE assembly with only 13 cycles (which only take approximately 2.5 hours instead of 8.5 hours for 50 cycles).<br><br><br />
{|align="center"<br />
|[[Image:colonies.png|400px|no frame|link=]]<br />
|}<br />
<br><br><br />
<br />
== Direpeat Amplification by Colony PCR ==<br />
----<br />
<br><br />
<html><br />
<div align="justify">To assess if the direpeats have indeed been successfully cloned into our expression vector, we have accomplished colony PCR with a variety of samples. To this end, we have designed primers which bind to both ends of the direpeat region and thus amplify the direpeat array of our TAL protein. <br />
The original vector contains a kill cassette which kills bacteria unless it is replaced by the direpeats during the Golden Gate Cloning reaction. <br />
This cassette will also be amplified by the designed primers. A distinction between the amplification of the kill cassette and that of direpeats can be made upon the amplicon length: if the kill cassette is amplified, the resulting amplicon will contain 1527bp, while direpeat amplification will produce amplicons of 1276bp length. The difference between these two amplicons is 251bp, and can be detected by agarose gel electrophoresis. <br />
<br />
<img src="https://static.igem.org/mediawiki/2012/0/04/Direpeat_amp.jpg" align="right" width="400px" hspace="20" vspace="20" alt="Direpeat amplification by colony PCR"/><br />
<br />
The figure clearly demonstrates the difference in size between the amplicons of negative control (kill cassette still in the vector) and positive (direpeats have replaced the cassette) samples. While lane 2 shows a negative result with a single band of bigger size, all the other samples yielded amplicons of smaller length and thus are considered as positive due to amplification of direpeats.<br />
Nevertheless, it is obvious that the colony PCR did not produce one single product when amplifying the direpeats, but rather a smear consisting of amplicons with varying lengths. <br />
This effect is due to numerous homologies within the direpeats and has previously been described by Briggs et al.<sup>2</sup> . <br />
To eliminate those homologies to the greatest extent possible, we changed codon usage within our direpeats. Nevertheless, as the results of our colony PCR demonstrate, there is still a profound amount of homologies left, which imposes difficulties on the amplification of the direpeat array by PCR and instead results in a smear.<br />
Thus, the existence of this smear indicates the presence of direpeats within the expression vector. Moreover, the light bands at 1276 bp indicates, that the right number of direpeats have been inserted into the vector. We performed 30 colony PCRs from colonies of different GATE assemblies and had no negative results (but in some cases, we could not determine the hight of the light band). Since positive results in colony PCR of TALEs do not exclude wrong order of direpeats, we sequenced 33 clones of different GATE assemblies and analyzed the results: In 32 of the 33 clones, sequencing results entirely matched the right sequence. So the efficiency of GATE assembly is approximately 97 %.<br />
<br><br><br><br />
<br><br />
</html><br />
<br><br><br />
= ''In vivo'' testing =<br />
----<br />
----<br />
<br><br><br />
== Gene activation ==<br />
----<br />
<html><br />
<p><br><br />
<br />
<div align="justify">To show the functionality of our TAL protein as well as the impact of the VP 64 transcription factor fusion protein, we used a TAL-VP64 fusion construct targeting a minimal promotor coupled with the secreted alkaline phosphatase (SEAP). The product of the reporter gene SEAP is - as the name tells - a phosphatase that is secreted by the cells into the surrounding media. The existence of SEAP and therefore the activity of the promotor can be measured by the addition of para-Nitrophenylphosphate (pNPP). The SEAP enzyme catalyzes the reaction from pNPP to para-Nitrophenol, this new product absorbs light at 405 nm and can be measured via photometry. <br />
This reporter system gives us a couple of advantages over standard EGFP or luciferase systems. First of all, the SEAP is secreted into the cell culture media, therefore we don't have to lyse our cells for measuring, but just take a sample from the supernatant. <br><img src="http://imageshack.us/a/img189/6140/seapplasmid.png" align="right" padding:0px width="450px" hspace="20"/><br> We are also able to measure one culture multiple times, e.g. at two different points in time. Another advantage is the measurement via photometry which makes the samples quantitively comparable. Interestingly, we did not have to clone a TALE binding site upstream of the minimal promoter (which would be required for other DNA binding proteins) but simply produced a TALE that specifically bound to the given sequence.<br />
<br><br><br />
<img src="http://imageshack.us/a/img268/53/exp1design2.png" align="left" padding:0px width="250px" hspace="20" /><br />
The experiment was done with four different transfections, either no plasmid, only the TAL vector, only the SEAP plasmid or a cotransfection of both plasmids. The cells were seeded on a twelve well plate the day before in 500µl culture media per well. The transfection was done with CaCl2 after a cell culture course protocol written by the lab of Professor Weber. <br />
<br />
<div align="justify">To show that our TAL effectors are actually working, we used our completed toolkit to produce a TAL protein which is fused to a VP64 transcription factor. With this TAL-TF construct we targeted a sequence upstream of a minimal promotor that controls transcription of the enzyme secreted alkaline phosphatase (SEAP). In theory, the TAL domain should bring the fused VP64 domain in close proximity to the minimal promotor to activate the transcription of the repoter gene SEAP. The phosphatase is secreted an acummulates in the cell culture media. After 24 and 48 hours, we took samples from the media, stored them at -20°C, and subjected them to photometric analysis.<br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/84/IGEMres4.png" width="400px" hspace="20" vspace="20" alt="SEAP essay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br><br><br />
As it is observable in the graph, co-transfection of cells with TAL and SEAP plasmids(++) yielded a high increase in SEAP activity, compared to the control samples. Also the control experiment with a TAL-VP64 targeting a random sequence shows the specificity of our system. The graph shows the average value of three biological replicates with its standard deviation. We further performed a t-test (Table) to prove if our experiment is statistically significant. As it is clearly observable, the p-values range below a value of 0,05, which indicates that our TAL transcription factor is able to elevate the transcription of the SEAP gene in a statistically significant manner.<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/Igemres-p.png" width="400px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br />
After addition of pNPP, the substrate of SEAP, the activity of SEAP was measured over time. In the next image, the results of the first nine minutes of this measurement are shown. After this time, the OD of the double transfection (++) rose too high to be measured by our photometer. As it is clearly visible, the sample with the double transfection shows a profound increase in the OD. This points to the fact that great amounts of SEAP have been secreted into the cell culture media due to elevated gene expression. In the other samples almost no SEAP activity was measureable. The sample transfected with only the SEAP plasmid showed the highest OD but this effect was not statistically significant (p-value:0,25/0,51).<br />
<br><br />
In the samples that had been taken 48h after double transfection, the same effects could be demonstrated. <br />
<br><br />
Furthermore, we reapeated the same experiment for a second time. The corresponding data can be viewed here: <html><div style=text-indent:0px><a href="https://static.igem.org/mediawiki/2012/9/9c/Second_Essay.pdf">Second Experiment.</a><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/TALTF-SEAP-TIME.png" align="middle" width="500px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:120px"/><br><br></html><br />
<br />
== Precise Gene Knockout ==<br />
----<br />
<html><br />
<p><br><br />
TALENs are a very powerful tool for efficient gene knockout. In order to prove that our TALEN construct was functional, we decided to simply knock out a destabilized GFP gene on a plasmid, which we co-transfected with our TALEN plasmids into HEK cells. Moreover, we also transfected our cells with an mCherry vector to normalize for transfection efficiency. TAL constructs were designed to bind to opposite strands of the target plasmid in a way that the FokI monomers of each TALEN construct would be able to dimerize in the spacer region between the TALEN binding sites. 48 hours after transfection, gene knock-out efficiency was evaluated by FACS analysis.<br />
<br><br><br />
</html><br />
<br />
[[Image:xx.png|500px|center|link=]]<br />
<br />
<br><br><br><br><br><br />
== Reference ==<br />
1. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br><br />
2. Briggs, A. W. et al. Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. ''Nucl Acids Res'' (2012).doi:10.1093/nar/gks624<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Luboehttp://2012.igem.org/Team:Freiburg/Project/ExperimentsTeam:Freiburg/Project/Experiments2012-11-10T15:30:19Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= ''In vitro'' testing =<br />
----<br />
----<br />
<br><br><br />
== The Toolkit ==<br />
----<br />
<br>Admittedly, our GATE assembly kit is a little larger than the kit published from the Zhang group in Nature this year<sup>1</sup> (the latter comprises 78 parts). But considering that future iGEM teams can easily combine the parts to form more than 67 million different effectors, we believe that it was worth the effort. Now, to get from the toolbox to the finished TAL effector, you only need a few components: six direpeats, one effector backbone plasmid, two enzymes and one buffer. If you mix these components and incubate in your thermocycler for 2.5 hours, you get your custom TAL effector. To put this in perspective: The average turnaround time for TALE construction with conventional kits is about two weeks! In the following sections, we want to show you the efficiency of our GATE assembly platform.<br><br />
The creation of a toolkit with 96 different parts not only means a lot of labwork but also a lot of organisational tasks, sequencing and analysis. We don't want to bore you with the 96 sequences of our finished BioBricks, but we want to give you one example of a finished BioBrick and highlight some of the interesting and important strips in its sequence. If you are interested in the other sequences, just have a look at our [[Team:Freiburg/Parts|parts section]] or go to the [http://partsregistry.org Registry of Standard Biological Parts].<br />
<br />
<br />
{|align="center"<br />
|[[Image:AA1sequence.png|400px|no frame|link=]]<br />
|}<br />
<br />
<br />
In this sequence of our BioBrick AA1, the main features of all our BioBricks are highlighted. As pointed out in the [[Team:Freiburg/Project/Golden#GGC|Golden Gate Standard section]] of our project description, all direpeat plasmids are submitted in the Golden Gate Standard, that was developed by us and which is fully compatible with existing iGEM standards. In yellow, you can see the direpeat gene fragment itself, the green parts are iGEM restriction sites (a requirement for all BioBricks), the sequence written in red is part of the psb1C3 vector, the blue sequences are recognition sites for BsmB1 and the red boxes are the cutting sites of BsmB1.<br />
<br><br />
<br><br />
== Varying Cycle number of GATE assembly has limited effect ==<br />
----<br />
Golden Gate protocols published so far for multistep TALE assembly differ significantly in the number of digestion-ligation cycles performed. To assess, whether the cycle number significantly affects outcome, we performed 4 different GATE assemblies, each with three different cycle numbers (50, 25 and 13 cycles). We did not see significant differences in the number of colonies for the three cycle numbers. Consequently, from that point on, we performed GATE assembly with only 13 cycles (which only take approximately 2.5 hours instead of 8.5 hours for 50 cycles).<br><br><br />
{|align="center"<br />
|[[Image:colonies.png|400px|no frame|link=]]<br />
|}<br />
<br><br><br />
<br />
== Direpeat Amplification by Colony PCR ==<br />
----<br />
<br><br />
<html><br />
<div align="justify">To assess if the direpeats have indeed been successfully cloned into our expression vector, we have accomplished colony PCR with a variety of samples. To this end, we have designed primers which bind to both ends of the direpeat region and thus amplify the direpeat array of our TAL protein. <br />
The original vector contains a kill cassette which kills bacteria unless it is replaced by the direpeats during the Golden Gate Cloning reaction. <br />
This cassette will also be amplified by the designed primers. A distinction between the amplification of the kill cassette and that of direpeats can be made upon the amplicon length: if the kill cassette is amplified, the resulting amplicon will contain 1527bp, while direpeat amplification will produce amplicons of 1276bp length. The difference between these two amplicons is 251bp, and can be detected by agarose gel electrophoresis. <br />
<br />
<img src="https://static.igem.org/mediawiki/2012/0/04/Direpeat_amp.jpg" align="right" width="400px" hspace="20" vspace="20" alt="Direpeat amplification by colony PCR"/><br />
<br />
The figure clearly demonstrates the difference in size between the amplicons of negative control (kill cassette still in the vector) and positive (direpeats have replaced the cassette) samples. While lane 2 shows a negative result with a single band of bigger size, all the other samples yielded amplicons of smaller length and thus are considered as positive due to amplification of direpeats.<br />
Nevertheless, it is obvious that the colony PCR did not produce one single product when amplifying the direpeats, but rather a smear consisting of amplicons with varying lengths. <br />
This effect is due to numerous homologies within the direpeats and has previously been described by Briggs et al.<sup>2</sup> . <br />
To eliminate those homologies to the greatest extent possible, we changed codon usage within our direpeats. Nevertheless, as the results of our colony PCR demonstrate, there is still a profound amount of homologies left, which imposes difficulties on the amplification of the direpeat array by PCR and instead results in a smear.<br />
Thus, the existence of this smear indicates the presence of direpeats within the expression vector. Moreover, the light bands at 1276 bp indicates, that the right number of direpeats have been inserted into the vector. We performed 30 colony PCRs from colonies of different GATE assemblies and had no negative results (but in some cases, we could not determine the hight of the light band). Since positive results in colony PCR of TALEs do not exclude wrong order of direpeats, we sequenced 33 clones of different GATE assemblies and analyzed the results: In 32 of the 33 clones, sequencing results entirely matched the right sequence. So the efficiency of GATE assembly is approximately 97 %.<br />
<br><br><br><br />
<br><br />
</html><br />
<br />
= ''In vivo'' testing =<br />
----<br />
----<br />
<br><br><br><br><br />
== Gene activation ==<br />
----<br />
<html><br />
<p><br><br />
<br />
<div align="justify">To show the functionality of our TAL protein as well as the impact of the VP 64 transcription factor fusion protein, we used a TAL-VP64 fusion construct targeting a minimal promotor coupled with the secreted alkaline phosphatase (SEAP). The product of the reporter gene SEAP is - as the name tells - a phosphatase that is secreted by the cells into the surrounding media. The existence of SEAP and therefore the activity of the promotor can be measured by the addition of para-Nitrophenylphosphate (pNPP). The SEAP enzyme catalyzes the reaction from pNPP to para-Nitrophenol, this new product absorbs light at 405 nm and can be measured via photometry. <br />
This reporter system gives us a couple of advantages over standard EGFP or luciferase systems. First of all, the SEAP is secreted into the cell culture media, therefore we don't have to lyse our cells for measuring, but just take a sample from the supernatant. <br><img src="http://imageshack.us/a/img189/6140/seapplasmid.png" align="right" padding:0px width="450px" hspace="20"/><br> We are also able to measure one culture multiple times, e.g. at two different points in time. Another advantage is the measurement via photometry which makes the samples quantitively comparable. Interestingly, we did not have to clone a TALE binding site upstream of the minimal promoter (which would be required for other DNA binding proteins) but simply produced a TALE that specifically bound to the given sequence.<br />
<br><br><br />
<img src="http://imageshack.us/a/img268/53/exp1design2.png" align="left" padding:0px width="250px" hspace="20" /><br />
The experiment was done with four different transfections, either no plasmid, only the TAL vector, only the SEAP plasmid or a cotransfection of both plasmids. The cells were seeded on a twelve well plate the day before in 500µl culture media per well. The transfection was done with CaCl2 after a cell culture course protocol written by the lab of Professor Weber. <br />
<br />
<div align="justify">To show that our TAL effectors are actually working, we used our completed toolkit to produce a TAL protein which is fused to a VP64 transcription factor. With this TAL-TF construct we targeted a sequence upstream of a minimal promotor that controls transcription of the enzyme secreted alkaline phosphatase (SEAP). In theory, the TAL domain should bring the fused VP64 domain in close proximity to the minimal promotor to activate the transcription of the repoter gene SEAP. The phosphatase is secreted an acummulates in the cell culture media. After 24 and 48 hours, we took samples from the media, stored them at -20°C, and subjected them to photometric analysis.<br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/84/IGEMres4.png" width="400px" hspace="20" vspace="20" alt="SEAP essay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br><br><br />
As it is observable in the graph, co-transfection of cells with TAL and SEAP plasmids(++) yielded a high increase in SEAP activity, compared to the control samples. Also the control experiment with a TAL-VP64 targeting a random sequence shows the specificity of our system. The graph shows the average value of three biological replicates with its standard deviation. We further performed a t-test (Table) to prove if our experiment is statistically significant. As it is clearly observable, the p-values range below a value of 0,05, which indicates that our TAL transcription factor is able to elevate the transcription of the SEAP gene in a statistically significant manner.<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/Igemres-p.png" width="400px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br />
After addition of pNPP, the substrate of SEAP, the activity of SEAP was measured over time. In the next image, the results of the first nine minutes of this measurement are shown. After this time, the OD of the double transfection (++) rose too high to be measured by our photometer. As it is clearly visible, the sample with the double transfection shows a profound increase in the OD. This points to the fact that great amounts of SEAP have been secreted into the cell culture media due to elevated gene expression. In the other samples almost no SEAP activity was measureable. The sample transfected with only the SEAP plasmid showed the highest OD but this effect was not statistically significant (p-value:0,25/0,51).<br />
<br><br />
In the samples that had been taken 48h after double transfection, the same effects could be demonstrated. <br />
<br><br />
Furthermore, we reapeated the same experiment for a second time. The corresponding data can be viewed here: <html><div style=text-indent:0px><a href="https://static.igem.org/mediawiki/2012/9/9c/Second_Essay.pdf">Second Experiment.</a><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/TALTF-SEAP-TIME.png" align="middle" width="500px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:120px"/><br><br></html><br />
<br />
== Precise Gene Knockout ==<br />
----<br />
<html><br />
<p><br><br />
TALENs are a very powerful tool for efficient gene knockout. In order to prove that our TALEN construct was functional, we decided to simply knock out a destabilized GFP gene on a plasmid, which we co-transfected with our TALEN plasmids into HEK cells. Moreover, we also transfected our cells with an mCherry vector to normalize for transfection efficiency. TAL constructs were designed to bind to opposite strands of the target plasmid in a way that the FokI monomers of each TALEN construct would be able to dimerize in the spacer region between the TALEN binding sites. 48 hours after transfection, gene knock-out efficiency was evaluated by FACS analysis.<br />
<br><br><br />
</html><br />
<br />
[[Image:xx.png|500px|center|link=]]<br />
<br />
<br><br><br><br><br><br />
== Reference ==<br />
1. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br><br />
2. Briggs, A. W. et al. Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. ''Nucl Acids Res'' (2012).doi:10.1093/nar/gks624<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Luboehttp://2012.igem.org/Team:Freiburg/Project/ExperimentsTeam:Freiburg/Project/Experiments2012-11-10T15:29:54Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= ''In vitro'' testing =<br />
----<br />
----<br />
<br><br><br />
== The Toolkit ==<br />
----<br />
<br>Admittedly, our GATE assembly kit is a little larger than the kit published from the Zhang group in Nature this year<sup>1</sup> (the latter comprises 78 parts). But considering that future iGEM teams can easily combine the parts to form more than 67 million different effectors, we believe that it was worth the effort. Now, to get from the toolbox to the finished TAL effector, you only need a few components: six direpeats, one effector backbone plasmid, two enzymes and one buffer. If you mix these components and incubate in your thermocycler for 2.5 hours, you get your custom TAL effector. To put this in perspective: The average turnaround time for TALE construction with conventional kits is about two weeks! In the following sections, we want to show you the efficiency of our GATE assembly platform.<br><br />
The creation of a toolkit with 96 different parts not only means a lot of labwork but also a lot of organisational tasks, sequencing and analysis. We don't want to bore you with the 96 sequences of our finished BioBricks, but we want to give you one example of a finished BioBrick and highlight some of the interesting and important strips in its sequence. If you are interested in the other sequences, just have a look at our [[Team:Freiburg/Parts|parts section]] or go to the [http://partsregistry.org Registry of Standard Biological Parts].<br />
<br />
<br />
{|align="center"<br />
|[[Image:AA1sequence.png|400px|no frame|link=]]<br />
|}<br />
<br />
<br />
In this sequence of our BioBrick AA1, the main features of all our BioBricks are highlighted. As pointed out in the [[Team:Freiburg/Project/Golden#GGC|Golden Gate Standard section]] of our project description, all direpeat plasmids are submitted in the Golden Gate Standard, that was developed by us and which is fully compatible with existing iGEM standards. In yellow, you can see the direpeat gene fragment itself, the green parts are iGEM restriction sites (a requirement for all BioBricks), the sequence written in red is part of the psb1C3 vector, the blue sequences are recognition sites for BsmB1 and the red boxes are the cutting sites of BsmB1.<br />
<br><br />
<br><br />
== Varying Cycle number of GATE assembly has limited effect ==<br />
----<br />
Golden Gate protocols published so far for multistep TALE assembly differ significantly in the number of digestion-ligation cycles performed. To assess, whether the cycle number significantly affects outcome, we performed 4 different GATE assemblies, each with three different cycle numbers (50, 25 and 13 cycles). We did not see significant differences in the number of colonies for the three cycle numbers. Consequently, from that point on, we performed GATE assembly with only 13 cycles (which only take approximately 2.5 hours instead of 8.5 hours for 50 cycles).<br><br><br />
{|align="center"<br />
|[[Image:colonies.png|400px|no frame|link=]]<br />
|}<br />
<br><br><br />
<br />
== Direpeat Amplification by Colony PCR ==<br />
----<br />
<br><br />
<html><br />
<div align="justify">To assess if the direpeats have indeed been successfully cloned into our expression vector, we have accomplished colony PCR with a variety of samples. To this end, we have designed primers which bind to both ends of the direpeat region and thus amplify the direpeat array of our TAL protein. <br />
The original vector contains a kill cassette which kills bacteria unless it is replaced by the direpeats during the Golden Gate Cloning reaction. <br />
This cassette will also be amplified by the designed primers. A distinction between the amplification of the kill cassette and that of direpeats can be made upon the amplicon length: if the kill cassette is amplified, the resulting amplicon will contain 1527bp, while direpeat amplification will produce amplicons of 1276bp length. The difference between these two amplicons is 251bp, and can be detected by agarose gel electrophoresis. <br />
<br />
<img src="https://static.igem.org/mediawiki/2012/0/04/Direpeat_amp.jpg" align="right" width="400px" hspace="20" vspace="20" alt="Direpeat amplification by colony PCR"/><br />
<br />
The figure clearly demonstrates the difference in size between the amplicons of negative control (kill cassette still in the vector) and positive (direpeats have replaced the cassette) samples. While lane 2 shows a negative result with a single band of bigger size, all the other samples yielded amplicons of smaller length and thus are considered as positive due to amplification of direpeats.<br />
Nevertheless, it is obvious that the colony PCR did not produce one single product when amplifying the direpeats, but rather a smear consisting of amplicons with varying lengths. <br />
This effect is due to numerous homologies within the direpeats and has previously been described by Briggs et al.<sup>2</sup> . <br />
To eliminate those homologies to the greatest extent possible, we changed codon usage within our direpeats. Nevertheless, as the results of our colony PCR demonstrate, there is still a profound amount of homologies left, which imposes difficulties on the amplification of the direpeat array by PCR and instead results in a smear.<br />
Thus, the existence of this smear indicates the presence of direpeats within the expression vector. Moreover, the light bands at 1276 bp indicates, that the right number of direpeats have been inserted into the vector. We performed 30 colony PCRs from colonies of different GATE assemblies and had no negative results (but in some cases, we could not determine the hight of the light band). Since positive results in colony PCR of TALEs do not exclude wrong order of direpeats, we sequenced 33 clones of different GATE assemblies and analyzed the results: In 32 of the 33 clones, sequencing results entirely matched the right sequence. So the efficiency of GATE assembly is approximately 97 %.<br />
<br><br><br><br />
<br><br />
</html><br />
<br />
= ''In vivo'' testing =<br />
----<br />
----<br />
<br><br><br />
== Gene activation ==<br />
----<br />
<html><br />
<p><br><br />
<br />
<div align="justify">To show the functionality of our TAL protein as well as the impact of the VP 64 transcription factor fusion protein, we used a TAL-VP64 fusion construct targeting a minimal promotor coupled with the secreted alkaline phosphatase (SEAP). The product of the reporter gene SEAP is - as the name tells - a phosphatase that is secreted by the cells into the surrounding media. The existence of SEAP and therefore the activity of the promotor can be measured by the addition of para-Nitrophenylphosphate (pNPP). The SEAP enzyme catalyzes the reaction from pNPP to para-Nitrophenol, this new product absorbs light at 405 nm and can be measured via photometry. <br />
This reporter system gives us a couple of advantages over standard EGFP or luciferase systems. First of all, the SEAP is secreted into the cell culture media, therefore we don't have to lyse our cells for measuring, but just take a sample from the supernatant. <br><img src="http://imageshack.us/a/img189/6140/seapplasmid.png" align="right" padding:0px width="450px" hspace="20"/><br> We are also able to measure one culture multiple times, e.g. at two different points in time. Another advantage is the measurement via photometry which makes the samples quantitively comparable. Interestingly, we did not have to clone a TALE binding site upstream of the minimal promoter (which would be required for other DNA binding proteins) but simply produced a TALE that specifically bound to the given sequence.<br />
<br><br><br />
<img src="http://imageshack.us/a/img268/53/exp1design2.png" align="left" padding:0px width="250px" hspace="20" /><br />
The experiment was done with four different transfections, either no plasmid, only the TAL vector, only the SEAP plasmid or a cotransfection of both plasmids. The cells were seeded on a twelve well plate the day before in 500µl culture media per well. The transfection was done with CaCl2 after a cell culture course protocol written by the lab of Professor Weber. <br />
<br />
<div align="justify">To show that our TAL effectors are actually working, we used our completed toolkit to produce a TAL protein which is fused to a VP64 transcription factor. With this TAL-TF construct we targeted a sequence upstream of a minimal promotor that controls transcription of the enzyme secreted alkaline phosphatase (SEAP). In theory, the TAL domain should bring the fused VP64 domain in close proximity to the minimal promotor to activate the transcription of the repoter gene SEAP. The phosphatase is secreted an acummulates in the cell culture media. After 24 and 48 hours, we took samples from the media, stored them at -20°C, and subjected them to photometric analysis.<br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/84/IGEMres4.png" width="400px" hspace="20" vspace="20" alt="SEAP essay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br><br><br />
As it is observable in the graph, co-transfection of cells with TAL and SEAP plasmids(++) yielded a high increase in SEAP activity, compared to the control samples. Also the control experiment with a TAL-VP64 targeting a random sequence shows the specificity of our system. The graph shows the average value of three biological replicates with its standard deviation. We further performed a t-test (Table) to prove if our experiment is statistically significant. As it is clearly observable, the p-values range below a value of 0,05, which indicates that our TAL transcription factor is able to elevate the transcription of the SEAP gene in a statistically significant manner.<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/Igemres-p.png" width="400px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br />
After addition of pNPP, the substrate of SEAP, the activity of SEAP was measured over time. In the next image, the results of the first nine minutes of this measurement are shown. After this time, the OD of the double transfection (++) rose too high to be measured by our photometer. As it is clearly visible, the sample with the double transfection shows a profound increase in the OD. This points to the fact that great amounts of SEAP have been secreted into the cell culture media due to elevated gene expression. In the other samples almost no SEAP activity was measureable. The sample transfected with only the SEAP plasmid showed the highest OD but this effect was not statistically significant (p-value:0,25/0,51).<br />
<br><br />
In the samples that had been taken 48h after double transfection, the same effects could be demonstrated. <br />
<br><br />
Furthermore, we reapeated the same experiment for a second time. The corresponding data can be viewed here: <html><div style=text-indent:0px><a href="https://static.igem.org/mediawiki/2012/9/9c/Second_Essay.pdf">Second Experiment.</a><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/TALTF-SEAP-TIME.png" align="middle" width="500px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:120px"/><br><br></html><br />
<br />
== Precise Gene Knockout ==<br />
----<br />
<html><br />
<p><br><br />
TALENs are a very powerful tool for efficient gene knockout. In order to prove that our TALEN construct was functional, we decided to simply knock out a destabilized GFP gene on a plasmid, which we co-transfected with our TALEN plasmids into HEK cells. Moreover, we also transfected our cells with an mCherry vector to normalize for transfection efficiency. TAL constructs were designed to bind to opposite strands of the target plasmid in a way that the FokI monomers of each TALEN construct would be able to dimerize in the spacer region between the TALEN binding sites. 48 hours after transfection, gene knock-out efficiency was evaluated by FACS analysis.<br />
<br><br><br />
</html><br />
<br />
[[Image:xx.png|500px|center|link=]]<br />
<br />
<br><br><br><br><br><br />
== Reference ==<br />
1. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br><br />
2. Briggs, A. W. et al. Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. ''Nucl Acids Res'' (2012).doi:10.1093/nar/gks624<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Luboehttp://2012.igem.org/Team:Freiburg/Project/ExperimentsTeam:Freiburg/Project/Experiments2012-11-10T15:28:35Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= ''In vitro'' testing =<br />
<br><br><br />
== The Toolkit ==<br />
----<br />
<br>Admittedly, our GATE assembly kit is a little larger than the kit published from the Zhang group in Nature this year<sup>1</sup> (the latter comprises 78 parts). But considering that future iGEM teams can easily combine the parts to form more than 67 million different effectors, we believe that it was worth the effort. Now, to get from the toolbox to the finished TAL effector, you only need a few components: six direpeats, one effector backbone plasmid, two enzymes and one buffer. If you mix these components and incubate in your thermocycler for 2.5 hours, you get your custom TAL effector. To put this in perspective: The average turnaround time for TALE construction with conventional kits is about two weeks! In the following sections, we want to show you the efficiency of our GATE assembly platform.<br><br />
The creation of a toolkit with 96 different parts not only means a lot of labwork but also a lot of organisational tasks, sequencing and analysis. We don't want to bore you with the 96 sequences of our finished BioBricks, but we want to give you one example of a finished BioBrick and highlight some of the interesting and important strips in its sequence. If you are interested in the other sequences, just have a look at our [[Team:Freiburg/Parts|parts section]] or go to the [http://partsregistry.org Registry of Standard Biological Parts].<br />
<br />
<br />
{|align="center"<br />
|[[Image:AA1sequence.png|400px|no frame|link=]]<br />
|}<br />
<br />
<br />
In this sequence of our BioBrick AA1, the main features of all our BioBricks are highlighted. As pointed out in the [[Team:Freiburg/Project/Golden#GGC|Golden Gate Standard section]] of our project description, all direpeat plasmids are submitted in the Golden Gate Standard, that was developed by us and which is fully compatible with existing iGEM standards. In yellow, you can see the direpeat gene fragment itself, the green parts are iGEM restriction sites (a requirement for all BioBricks), the sequence written in red is part of the psb1C3 vector, the blue sequences are recognition sites for BsmB1 and the red boxes are the cutting sites of BsmB1.<br />
<br><br />
<br><br />
== Varying Cycle number of GATE assembly has limited effect ==<br />
----<br />
Golden Gate protocols published so far for multistep TALE assembly differ significantly in the number of digestion-ligation cycles performed. To assess, whether the cycle number significantly affects outcome, we performed 4 different GATE assemblies, each with three different cycle numbers (50, 25 and 13 cycles). We did not see significant differences in the number of colonies for the three cycle numbers. Consequently, from that point on, we performed GATE assembly with only 13 cycles (which only take approximately 2.5 hours instead of 8.5 hours for 50 cycles).<br><br><br />
{|align="center"<br />
|[[Image:colonies.png|400px|no frame|link=]]<br />
|}<br />
<br><br><br />
<br />
== Direpeat Amplification by Colony PCR ==<br />
----<br />
<br><br />
<html><br />
<div align="justify">To assess if the direpeats have indeed been successfully cloned into our expression vector, we have accomplished colony PCR with a variety of samples. To this end, we have designed primers which bind to both ends of the direpeat region and thus amplify the direpeat array of our TAL protein. <br />
The original vector contains a kill cassette which kills bacteria unless it is replaced by the direpeats during the Golden Gate Cloning reaction. <br />
This cassette will also be amplified by the designed primers. A distinction between the amplification of the kill cassette and that of direpeats can be made upon the amplicon length: if the kill cassette is amplified, the resulting amplicon will contain 1527bp, while direpeat amplification will produce amplicons of 1276bp length. The difference between these two amplicons is 251bp, and can be detected by agarose gel electrophoresis. <br />
<br />
<img src="https://static.igem.org/mediawiki/2012/0/04/Direpeat_amp.jpg" align="right" width="400px" hspace="20" vspace="20" alt="Direpeat amplification by colony PCR"/><br />
<br />
The figure clearly demonstrates the difference in size between the amplicons of negative control (kill cassette still in the vector) and positive (direpeats have replaced the cassette) samples. While lane 2 shows a negative result with a single band of bigger size, all the other samples yielded amplicons of smaller length and thus are considered as positive due to amplification of direpeats.<br />
Nevertheless, it is obvious that the colony PCR did not produce one single product when amplifying the direpeats, but rather a smear consisting of amplicons with varying lengths. <br />
This effect is due to numerous homologies within the direpeats and has previously been described by Briggs et al.<sup>2</sup> . <br />
To eliminate those homologies to the greatest extent possible, we changed codon usage within our direpeats. Nevertheless, as the results of our colony PCR demonstrate, there is still a profound amount of homologies left, which imposes difficulties on the amplification of the direpeat array by PCR and instead results in a smear.<br />
Thus, the existence of this smear indicates the presence of direpeats within the expression vector. Moreover, the light bands at 1276 bp indicates, that the right number of direpeats have been inserted into the vector. We performed 30 colony PCRs from colonies of different GATE assemblies and had no negative results (but in some cases, we could not determine the hight of the light band). Since positive results in colony PCR of TALEs do not exclude wrong order of direpeats, we sequenced 33 clones of different GATE assemblies and analyzed the results: In 32 of the 33 clones, sequencing results entirely matched the right sequence. So the efficiency of GATE assembly is approximately 97 %.<br />
<br><br><br><br />
<br><br />
</html><br />
<br />
= ''In vivo'' testing =<br />
<br><br><br />
== Gene activation ==<br />
----<br />
<html><br />
<p><br><br />
<br />
<div align="justify">To show the functionality of our TAL protein as well as the impact of the VP 64 transcription factor fusion protein, we used a TAL-VP64 fusion construct targeting a minimal promotor coupled with the secreted alkaline phosphatase (SEAP). The product of the reporter gene SEAP is - as the name tells - a phosphatase that is secreted by the cells into the surrounding media. The existence of SEAP and therefore the activity of the promotor can be measured by the addition of para-Nitrophenylphosphate (pNPP). The SEAP enzyme catalyzes the reaction from pNPP to para-Nitrophenol, this new product absorbs light at 405 nm and can be measured via photometry. <br />
This reporter system gives us a couple of advantages over standard EGFP or luciferase systems. First of all, the SEAP is secreted into the cell culture media, therefore we don't have to lyse our cells for measuring, but just take a sample from the supernatant. <br><img src="http://imageshack.us/a/img189/6140/seapplasmid.png" align="right" padding:0px width="450px" hspace="20"/><br> We are also able to measure one culture multiple times, e.g. at two different points in time. Another advantage is the measurement via photometry which makes the samples quantitively comparable. Interestingly, we did not have to clone a TALE binding site upstream of the minimal promoter (which would be required for other DNA binding proteins) but simply produced a TALE that specifically bound to the given sequence.<br />
<br><br><br />
<img src="http://imageshack.us/a/img268/53/exp1design2.png" align="left" padding:0px width="250px" hspace="20" /><br />
The experiment was done with four different transfections, either no plasmid, only the TAL vector, only the SEAP plasmid or a cotransfection of both plasmids. The cells were seeded on a twelve well plate the day before in 500µl culture media per well. The transfection was done with CaCl2 after a cell culture course protocol written by the lab of Professor Weber. <br />
<br />
<div align="justify">To show that our TAL effectors are actually working, we used our completed toolkit to produce a TAL protein which is fused to a VP64 transcription factor. With this TAL-TF construct we targeted a sequence upstream of a minimal promotor that controls transcription of the enzyme secreted alkaline phosphatase (SEAP). In theory, the TAL domain should bring the fused VP64 domain in close proximity to the minimal promotor to activate the transcription of the repoter gene SEAP. The phosphatase is secreted an acummulates in the cell culture media. After 24 and 48 hours, we took samples from the media, stored them at -20°C, and subjected them to photometric analysis.<br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/84/IGEMres4.png" width="400px" hspace="20" vspace="20" alt="SEAP essay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br><br><br />
As it is observable in the graph, co-transfection of cells with TAL and SEAP plasmids(++) yielded a high increase in SEAP activity, compared to the control samples. Also the control experiment with a TAL-VP64 targeting a random sequence shows the specificity of our system. The graph shows the average value of three biological replicates with its standard deviation. We further performed a t-test (Table) to prove if our experiment is statistically significant. As it is clearly observable, the p-values range below a value of 0,05, which indicates that our TAL transcription factor is able to elevate the transcription of the SEAP gene in a statistically significant manner.<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/Igemres-p.png" width="400px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br />
After addition of pNPP, the substrate of SEAP, the activity of SEAP was measured over time. In the next image, the results of the first nine minutes of this measurement are shown. After this time, the OD of the double transfection (++) rose too high to be measured by our photometer. As it is clearly visible, the sample with the double transfection shows a profound increase in the OD. This points to the fact that great amounts of SEAP have been secreted into the cell culture media due to elevated gene expression. In the other samples almost no SEAP activity was measureable. The sample transfected with only the SEAP plasmid showed the highest OD but this effect was not statistically significant (p-value:0,25/0,51).<br />
<br><br />
In the samples that had been taken 48h after double transfection, the same effects could be demonstrated. <br />
<br><br />
Furthermore, we reapeated the same experiment for a second time. The corresponding data can be viewed here: <html><div style=text-indent:0px><a href="https://static.igem.org/mediawiki/2012/9/9c/Second_Essay.pdf">Second Experiment.</a><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/TALTF-SEAP-TIME.png" align="middle" width="500px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:120px"/><br><br></html><br />
<br />
== Precise Gene Knockout ==<br />
----<br />
<html><br />
<p><br><br />
TALENs are a very powerful tool for efficient gene knockout. In order to prove that our TALEN construct was functional, we decided to simply knock out a destabilized GFP gene on a plasmid, which we co-transfected with our TALEN plasmids into HEK cells. Moreover, we also transfected our cells with an mCherry vector to normalize for transfection efficiency. TAL constructs were designed to bind to opposite strands of the target plasmid in a way that the FokI monomers of each TALEN construct would be able to dimerize in the spacer region between the TALEN binding sites. 48 hours after transfection, gene knock-out efficiency was evaluated by FACS analysis.<br />
<br><br><br />
</html><br />
<br />
[[Image:xx.png|500px|center|link=]]<br />
<br />
<br><br><br><br><br><br />
== Reference ==<br />
1. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br><br />
2. Briggs, A. W. et al. Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. ''Nucl Acids Res'' (2012).doi:10.1093/nar/gks624<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Luboehttp://2012.igem.org/Team:Freiburg/Project/ExperimentsTeam:Freiburg/Project/Experiments2012-11-10T15:25:42Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= ''In vitro'' testing =<br />
<br><br><br />
== The Toolkit ==<br />
----<br />
<br>Admittedly, our GATE assembly kit is a little larger than the kit published from the Zhang group in Nature this year<sup>1</sup> (the latter comprises 78 parts). But considering that future iGEM teams can easily combine the parts to form more than 67 million different effectors, we believe that it was worth the effort. Now, to get from the toolbox to the finished TAL effector, you only need a few components: six direpeats, one effector backbone plasmid, two enzymes and one buffer. If you mix these components and incubate in your thermocycler for 2.5 hours, you get your custom TAL effector. To put this in perspective: The average turnaround time for TALE construction with conventional kits is about two weeks! In the following sections, we want to show you the efficiency of our GATE assembly platform.<br><br />
The creation of a toolkit with 96 different parts not only means a lot of labwork but also a lot of organisational tasks, sequencing and analysis. We don't want to bore you with the 96 sequences of our finished BioBricks, but we want to give you one example of a finished BioBrick and highlight some of the interesting and important strips in its sequence. If you are interested in the other sequences, just have a look at our [[Team:Freiburg/Parts|parts section]] or go to the [http://partsregistry.org Registry of Standard Biological Parts].<br />
<br />
<br />
{|align="center"<br />
|[[Image:AA1sequence.png|400px|no frame|link=]]<br />
|}<br />
<br />
<br />
In this sequence of our BioBrick AA1, the main features of all our BioBricks are highlighted. As pointed out in the [[Team:Freiburg/Project/Golden#GGC|Golden Gate Standard section]] of our project description, all direpeat plasmids are submitted in the Golden Gate Standard, that was developed by us and which is fully compatible with existing iGEM standards. In yellow, you can see the direpeat gene fragment itself, the green parts are iGEM restriction sites (a requirement for all BioBricks), the sequence written in red is part of the psb1C3 vector, the blue sequences are recognition sites for BsmB1 and the red boxes are the cutting sites of BsmB1.<br />
<br><br />
<br><br />
== Varying Cycle number of GATE assembly has limited effect ==<br />
----<br />
Golden Gate protocols published so far for multistep TALE assembly differ significantly in the number of digestion-ligation cycles performed. To assess, whether the cycle number significantly affects outcome, we performed 4 different GATE assemblies, each with three different cycle numbers (50, 25 and 13 cycles). We did not see significant differences in the number of colonies for the three cycle numbers. Consequently, from that point on, we performed GATE assembly with only 13 cycles (which only take approximately 2.5 hours instead of 8.5 hours for 50 cycles).<br><br><br />
{|align="center"<br />
|[[Image:colonies.png|400px|no frame|link=]]<br />
|}<br />
<br><br><br />
<br />
== Direpeat Amplification by Colony PCR ==<br />
----<br />
<br><br />
<html><br />
<div align="justify">To assess if the direpeats have indeed been successfully cloned into our expression vector, we have accomplished colony PCR with a variety of samples. To this end, we have designed primers which bind to both ends of the direpeat region and thus amplify the direpeat array of our TAL protein. <br />
The original vector contains a kill cassette which kills bacteria unless it is replaced by the direpeats during the Golden Gate Cloning reaction. <br />
This cassette will also be amplified by the designed primers. A distinction between the amplification of the kill cassette and that of direpeats can be made upon the amplicon length: if the kill cassette is amplified, the resulting amplicon will contain 1527bp, while direpeat amplification will produce amplicons of 1276bp length. The difference between these two amplicons is 251bp, and can be detected by agarose gel electrophoresis. <br />
<br />
<img src="https://static.igem.org/mediawiki/2012/0/04/Direpeat_amp.jpg" align="right" width="400px" hspace="20" vspace="20" alt="Direpeat amplification by colony PCR"/><br />
<br />
The figure clearly demonstrates the difference in size between the amplicons of negative control (kill cassette still in the vector) and positive (direpeats have replaced the cassette) samples. While lane 2 shows a negative result with a single band of bigger size, all the other samples yielded amplicons of smaller length and thus are considered as positive due to amplification of direpeats.<br />
Nevertheless, it is obvious that the colony PCR did not produce one single product when amplifying the direpeats, but rather a smear consisting of amplicons with varying lengths. <br />
This effect is due to numerous homologies within the direpeats and has previously been described by Briggs et al.<sup>2</sup> . <br />
To eliminate those homologies to the greatest extent possible, we changed codon usage within our direpeats. Nevertheless, as the results of our colony PCR demonstrate, there is still a profound amount of homologies left, which imposes difficulties on the amplification of the direpeat array by PCR and instead results in a smear.<br />
Thus, the existence of this smear indicates the presence of direpeats within the expression vector. Moreover, the light bands at 1276 bp indicates, that the right number of direpeats have been inserted into the vector. We performed 30 colony PCRs from colonies of different GATE assemblies and had no negative results (but in some cases, we could not determine the hight of the light band). Since positive results in colony PCR of TALEs do not exclude wrong order of direpeats, we sequenced 33 clones of different GATE assemblies and analyzed the results: In 32 of the 33 clones, sequencing results entirely matched the right sequence. So the efficiency of GATE assembly is approximately 97 %.<br />
<br><br><br><br />
<br><br />
</html><br />
<br />
= ''In vivo'' testing =<br />
<br><br><br />
== Gene activation ==<br />
----<br />
<html><br />
<p><br><br />
<br />
<div align="justify">To show the functionality of our TAL protein as well as the impact of the VP 64 transcription factor fusion protein, we used a TAL-VP64 fusion construct targeting a minimal promotor coupled with the secreted alkaline phosphatase (SEAP). The product of the reporter gene SEAP is - as the name tells - a phosphatase that is secreted by the cells into the surrounding media. The existence of SEAP and therefore the activity of the promotor can be measured by the addition of para-Nitrophenylphosphate (pNPP). The SEAP enzyme catalyzes the reaction from pNPP to para-Nitrophenol, this new product absorbs light at 405 nm and can be measured via photometry. <br />
This reporter system gives us a couple of advantages over standard EGFP or luciferase systems. First of all, the SEAP is secreted into the cell culture media, therefore we don't have to lyse our cells for measuring, but just take a sample from the supernatant. <br><img src="http://imageshack.us/a/img189/6140/seapplasmid.png" align="right" padding:0px width="450px" hspace="20"/><br> We are also able to measure one culture multiple times, e.g. at two different points in time. Another advantage is the measurement via photometry which makes the samples quantitively comparable. Interestingly, we did not have to clone a TALE binding site upstream of the minimal promoter (which would be required for other DNA binding proteins) but simply produced a TALE that specifically bound to the given sequence.<br />
<br><br><br />
<img src="http://imageshack.us/a/img268/53/exp1design2.png" align="left" padding:0px width="250px" hspace="20" /><br />
The experiment was done with four different transfections, either no plasmid, only the TAL vector, only the SEAP plasmid or a cotransfection of both plasmids. The cells were seeded on a twelve well plate the day before in 500µl culture media per well. The transfection was done with CaCl2 after a cell culture course protocol written by the lab of Professor Weber. <br />
<br />
<div align="justify">To show that our TAL effectors are actually working, we used our completed toolkit to produce a TAL protein which is fused to a VP64 transcription factor. With this TAL-TF construct we targeted a sequence upstream of a minimal promotor that controls transcription of the enzyme secreted alkaline phosphatase (SEAP). In theory, the TAL domain should bring the fused VP64 domain in close proximity to the minimal promotor to activate the transcription of the repoter gene SEAP. The phosphatase is secreted an acummulates in the cell culture media. After 24 and 48 hours, we took samples from the media, stored them at -20°C, and subjected them to photometric analysis.<br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/84/IGEMres4.png" width="400px" hspace="20" vspace="20" alt="SEAP essay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br><br><br />
As it is observable in the graph, co-transfection of cells with TAL and SEAP plasmids(++) yielded a high increase in SEAP activity, compared to the control samples. Also the control experiment with a TAL-VP64 targeting a random sequence shows the specificity of our system. The graph shows the average value of three biological replicates with its standard deviation. We further performed a t-test (Table) to prove if our experiment is statistically significant. As it is clearly observable, the p-values range below a value of 0,05, which indicates that our TAL transcription factor is able to elevate the transcription of the SEAP gene in a statistically significant manner.<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/Igemres-p.png" width="400px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br />
After addition of pNPP, the substrate of SEAP, the activity of SEAP was measured over time. In the next image, the results of the first nine minutes of this measurement are shown. After this time, the OD of the double transfection (++) rose too high to be measured by our photometer. As it is clearly visible, the sample with the double transfection shows a profound increase in the OD. This points to the fact that great amounts of SEAP have been secreted into the cell culture media due to elevated gene expression. In the other samples almost no SEAP activity was measureable. The sample transfected with only the SEAP plasmid showed the highest OD but this effect was not statistically significant (p-value:0,25/0,51).<br />
<br><br />
In the samples that had been taken 48h after double transfection, the same effects could be demonstrated. <br />
<br><br />
Furthermore, we reapeated the same experiment for a second time. The corresponding data can be viewed here: <html><div style=text-indent:0px><a href="https://static.igem.org/mediawiki/2012/9/9c/Second_Essay.pdf">Second Experiment.</a><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/TALTF-SEAP-TIME.png" align="middle" width="500px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:120px"/><br><br></html><br />
<br />
== Precise Gene Knockout ==<br />
----<br />
<html><br />
<p><br><br />
TALENs are a very powerful tool for efficient gene knockout. In order to prove that our TALEN construct was functional, we decided to simply knock out a destabilized GFP gene on a plasmid, which we co-transfected with our TALEN plasmids into HEK cells. Moreover, we also transfected our cells with an mCherry vector to normalize for transfection efficiency. TAL constructs were designed to bind to opposite strands of the target plasmid in a way that the FokI monomers of each TALEN construct would be able to dimerize in the spacer region between the TALEN binding sites. 48 hours after transfection, gene knock-out efficiency was evaluated by FACS analysis.<br />
<br><br><br />
</html><br />
[[File:xx.png]|link=]<br />
<br />
<br><br><br><br><br><br />
== Reference ==<br />
1. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br><br />
2. Briggs, A. W. et al. Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. ''Nucl Acids Res'' (2012).doi:10.1093/nar/gks624<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Luboehttp://2012.igem.org/Team:FreiburgTeam:Freiburg2012-11-10T15:24:25Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<br />
<html><br />
<head><br />
<br />
<link rel="stylesheet" href="http://omnibus.uni-freiburg.de/~lb125/linking/css/global.css"><br />
<br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.5.1/jquery.min.js"></script><br />
<script src="http://omnibus.uni-freiburg.de/~lb125/linking/js/slides.min.jquery.js"></script><br />
<script><br />
$(function(){<br />
// Set starting slide to 1<br />
var startSlide = 1;<br />
// Get slide number if it exists<br />
if (window.location.hash) {<br />
startSlide = window.location.hash.replace('#','');<br />
}<br />
// Initialize Slides<br />
$('#slides').slides({<br />
preload: true,<br />
preloadImage: 'img/loading.gif',<br />
generatePagination: true,<br />
play: 0,<br />
pause: 2500,<br />
hoverPause: true,<br />
// Get the starting slide<br />
start: startSlide,<br />
animationComplete: function(current){<br />
// Set the slide number as a hash<br />
window.location.hash = '#' + current;<br />
}<br />
});<br />
});<br />
</script><br />
<br />
<br />
<br />
<br />
</head><br />
<body><br />
<br />
<div id="container"><br />
<div id="example"><br />
<div id="slides"><br />
<div class="slides_container"><br />
<br />
<br />
<div class="slide"><br />
<h1>Let us tell you a fabulous TALE...</h1><br />
Transactivator-Like Effectors (TALEs) are a brand-new technology that currently revolutionizes the way researchers manipulate DNA with exceptional site specificity. Originally derived from ''Xanthomonas spp.'', this type of protein comprizes an effector domain and a modular DNA binding domain that can be rationally designed to bind to virtually any target sequence of DNA. Over the past two years, universal endonucleases (TALENs) and transcription factors have been tested in various organisms ranging from bacteria to humans. According to existing protocols, TALE assembly requires several weeks of work and substantial lab skills. In order to bring this technology within reach for iGEM students, we invented an extremely fast and easy TALE assembly strategy and developed a TALE platform with expression plasmids and new classes of TALEs. With our so called GATE assembly kit, future iGEM students will be able to precisely manipulate genomic loci easier and faster than anyone else in the world.<br />
</div><br />
<br />
<div class="slide"><br />
<h1>European iGEM Jamboree 2012 Amsterdam:</h1><br />
Team freiGEM won a gold medal and a special prize for the 'Best New BioBrick Part or Device, Engineered'! Team freiGEM also advanced to World Championship in Boston!<br />
<p align="center"><A HREF="http://www.flickr.com/photos/igemeurope/8096765971/in/photostream/" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/won1.png' width="75%" height="75%"/></A></p><br />
</div><br />
<br />
<div class="slide"><br />
<h1><iframe style="margin-left:10px" align="right" width="300" height="250" src="http://player.vimeo.com/video/49902809" frameborder="0" webkitAllowFullScreen mozallowfullscreen allowFullScreen></iframe>Watch our freiGEM movie...<h1><br />
<br><br />
<h1>...or get some impressions in the freiGEM Photo Gallery:</h1><br />
<p><a style="font-weight:bold; font-size:1.3em;" href="/Team:Freiburg/gallery">FreiGEM 2012 Gallery</a></p><br />
</div><br />
<br />
<div class="slide"><br />
<h1><iframe style="margin-right:10px" align="left" width="300" height="250" src="http://player.vimeo.com/video/52254697?badge=0" frameborder="0" webkitAllowFullScreen mozallowfullscreen allowFullScreen></iframe>See how easy it is to get your own custom made TAL...</h1><br />
<br><br><br />
<h1>...for further information visit our project page:</h1><br />
<p><a style="font-weight:bold; font-size:1.3em;" href="/Team:Freiburg/Project">Overview TAL Project</a></p><br />
</div><br />
<br />
<div class="slide"><br />
<h1>Check out our modeling:</h1><br />
<p align="center"><A HREF="/Team:Freiburg/Modeling"><img class="thumbnail" img src='https://static.igem.org/mediawiki/2012/9/99/FreigemCompanelDNAlogo.png' width="60%" /></A></p><br />
Companel|DNA is dedicated to bringing biology closer to quantitative predictitive science. <br />
<p><a style="font-weight:bold; font-size:1.1em;" href="/Team:Freiburg/Modeling">Let our application help you to clear up complicated or codepending effects in signaling or protein interaction for instance...</a></p><br />
</div><br />
<br />
</div><br />
<a href="#" class="prev"><img src="http://omnibus.uni-freiburg.de/~lb125/linking/img/arrow-prev.png" width="24" height="43" alt="Arrow Prev"></a><br />
<a href="#" class="next"><img src="http://omnibus.uni-freiburg.de/~lb125/linking/img/arrow-next.png" width="24" height="43" alt="Arrow Next"></a><br />
</div><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/linking/img/example-frame.png" width="739" height="420" alt="Example Frame" id="frame"><br />
</div><br />
</div><br />
</body><br />
</html><br />
<br />
<br />
<br />
<html><br />
<div style="position:absolute; top:550px;"><br />
<p style="text-align:center"><br />
<span style="color:#4F8DDE; font-weight:bold;"><br />
With kind support of<br />
<br><br />
<br><br />
</span><br />
<A HREF="http://www.bioss.uni-freiburg.de/cms/index.php" target="_blank"><img class="thumbnail" img src="https://static.igem.org/mediawiki/2012/7/7b/Logo_bioss.gif" width= "200" /></A><br />
<A HREF="http://www.med.uni-freiburg.de/" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/uniklinik.png' width= "250"/></A><br />
<img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/metabion.png' width= "180"/><br />
<A HREF="http://www.genscript.com/" target="_blank"><img class="thumbnail" img src='https://static.igem.org/mediawiki/2012/0/0d/Genscript_logo.gif' width= "180"/></A><br />
<A HREF="http://eu.idtdna.com/site" target="_blank"><img class="thumbnail" img src='https://static.igem.org/mediawiki/2012/2/21/IDTLogo2010.png' width= "200"/></A><br />
<A HREF="http://www.lifetechnologies.com" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/life.png' width= "150"/></A><br />
<A HREF="http://www.eurofinsdna.com/home.html" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/eurofins.jpg' width= "150"/></A><br />
<img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/gatc.png' width= "150"/><br />
<A HREF="http://www.erasynbio.net/" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/erasynbio.png' width= "200"/></A><br />
</p><br />
</div><br />
</html><br />
<br />
<br />
<br />
<!--- The Mission, Experiments ---></div>Luboehttp://2012.igem.org/Team:FreiburgTeam:Freiburg2012-11-10T15:23:30Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<br />
<html><br />
<head><br />
<br />
<link rel="stylesheet" href="http://omnibus.uni-freiburg.de/~lb125/linking/css/global.css"><br />
<br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.5.1/jquery.min.js"></script><br />
<script src="http://omnibus.uni-freiburg.de/~lb125/linking/js/slides.min.jquery.js"></script><br />
<script><br />
$(function(){<br />
// Set starting slide to 1<br />
var startSlide = 1;<br />
// Get slide number if it exists<br />
if (window.location.hash) {<br />
startSlide = window.location.hash.replace('#','');<br />
}<br />
// Initialize Slides<br />
$('#slides').slides({<br />
preload: true,<br />
preloadImage: 'img/loading.gif',<br />
generatePagination: true,<br />
play: 0,<br />
pause: 2500,<br />
hoverPause: true,<br />
// Get the starting slide<br />
start: startSlide,<br />
animationComplete: function(current){<br />
// Set the slide number as a hash<br />
window.location.hash = '#' + current;<br />
}<br />
});<br />
});<br />
</script><br />
<br />
<br />
<br />
<br />
</head><br />
<body><br />
<br />
<div id="container"><br />
<div id="example"><br />
<div id="slides"><br />
<div class="slides_container"><br />
<br />
<br />
<div class="slide"><br />
<h1>Let us tell you a fabulous TALE...</h1><br />
Transactivator-Like Effectors (TALEs) are a brand-new technology that currently revolutionizes the way researchers manipulate DNA with exceptional site specificity. Originally derived from ''Xanthomonas spp.'', this type of protein comprizes an effector domain and a modular DNA binding domain that can be rationally designed to bind to virtually any target sequence of DNA. Over the past two years, universal endonucleases (TALENs) and transcription factors have been tested in various organisms ranging from bacteria to humans. According to existing protocols, TALE assembly requires several weeks of work and substantial lab skills. In order to bring this technology within reach for iGEM students, we invented an extremely fast and easy TALE assembly strategy and developed a TALE platform with expression plasmids and new classes of TALEs. With our so called GATE assembly kit, future iGEM students will be able to precisely manipulate genomic loci easier and faster than anyone else in the world.<br />
</div><br />
<br />
<div class="slide"><br />
<h1>European iGEM Jamboree 2012 Amsterdam:</h1><br />
Team freiGEM won a gold medal and a special prize for the 'Best New BioBrick Part or Device, Engineered'! Team freiGEM also advanced to World Championship in Boston!<br />
<p align="center"><A HREF="http://www.flickr.com/photos/igemeurope/8096765971/in/photostream/" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/won1.png' width="75%" height="75%"/></A></p><br />
</div><br />
<br />
<div class="slide"><br />
<h1><iframe style="margin-left:10px" align="right" width="300" height="250" src="http://player.vimeo.com/video/49902809" frameborder="0" webkitAllowFullScreen mozallowfullscreen allowFullScreen></iframe>Watch our freiGEM movie...<h1><br />
<br><br />
<h1>...or get some impressions in the freiGEM Photo Gallery:</h1><br />
<p><a style="font-weight:bold; font-size:1.3em;" href="/Team:Freiburg/gallery">FreiGEM 2012 Gallery</a></p><br />
</div><br />
<br />
<div class="slide"><br />
<h1><iframe style="margin-right:10px" align="left" width="300" height="250" src="http://player.vimeo.com/video/52254697?badge=0" frameborder="0" webkitAllowFullScreen mozallowfullscreen allowFullScreen></iframe>See how easy it is to get your own custom made TAL...</h1><br />
<br><br><br />
<h1>..for further information visit our project page:</h1><br />
<p><a style="font-weight:bold; font-size:1.3em;" href="/Team:Freiburg/Project">Overview TAL Project</a></p><br />
</div><br />
<br />
<div class="slide"><br />
<h1>Check out our modeling</h1><br />
<p align="center"><A HREF="/Team:Freiburg/Modeling"><img class="thumbnail" img src='https://static.igem.org/mediawiki/2012/9/99/FreigemCompanelDNAlogo.png' width="60%" /></A></p><br />
Companel|DNA is dedicated to bringing biology closer to quantitative predictitive science. <br />
<p><a style="font-weight:bold; font-size:1.1em;" href="/Team:Freiburg/Modeling">Let our application help you to clear up complicated or codepending effects in signaling or protein interaction for instance...</a></p><br />
</div><br />
<br />
</div><br />
<a href="#" class="prev"><img src="http://omnibus.uni-freiburg.de/~lb125/linking/img/arrow-prev.png" width="24" height="43" alt="Arrow Prev"></a><br />
<a href="#" class="next"><img src="http://omnibus.uni-freiburg.de/~lb125/linking/img/arrow-next.png" width="24" height="43" alt="Arrow Next"></a><br />
</div><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/linking/img/example-frame.png" width="739" height="420" alt="Example Frame" id="frame"><br />
</div><br />
</div><br />
</body><br />
</html><br />
<br />
<br />
<br />
<html><br />
<div style="position:absolute; top:550px;"><br />
<p style="text-align:center"><br />
<span style="color:#4F8DDE; font-weight:bold;"><br />
With kind support of<br />
<br><br />
<br><br />
</span><br />
<A HREF="http://www.bioss.uni-freiburg.de/cms/index.php" target="_blank"><img class="thumbnail" img src="https://static.igem.org/mediawiki/2012/7/7b/Logo_bioss.gif" width= "200" /></A><br />
<A HREF="http://www.med.uni-freiburg.de/" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/uniklinik.png' width= "250"/></A><br />
<img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/metabion.png' width= "180"/><br />
<A HREF="http://www.genscript.com/" target="_blank"><img class="thumbnail" img src='https://static.igem.org/mediawiki/2012/0/0d/Genscript_logo.gif' width= "180"/></A><br />
<A HREF="http://eu.idtdna.com/site" target="_blank"><img class="thumbnail" img src='https://static.igem.org/mediawiki/2012/2/21/IDTLogo2010.png' width= "200"/></A><br />
<A HREF="http://www.lifetechnologies.com" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/life.png' width= "150"/></A><br />
<A HREF="http://www.eurofinsdna.com/home.html" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/eurofins.jpg' width= "150"/></A><br />
<img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/gatc.png' width= "150"/><br />
<A HREF="http://www.erasynbio.net/" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/erasynbio.png' width= "200"/></A><br />
</p><br />
</div><br />
</html><br />
<br />
<br />
<br />
<!--- The Mission, Experiments ---></div>Luboehttp://2012.igem.org/Team:Freiburg/Project/TalTeam:Freiburg/Project/Tal2012-10-27T01:15:03Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Using the Toolkit =<br />
----<br />
<br><br />
<div align="justify">Here, we give you a manual on how to use our toolkit to design TAL proteins. We recommend reading through all of the manual prior to using the toolkit. Moreover, we included a short introductional video on how to use the toolkit.<br />
<br />
<html><br />
<br />
<br><br><br />
<iframe style="margin-left:200px; align:center;" src="http://player.vimeo.com/video/52254697" width="400" height="300" align="middle" frameborder="0" webkitAllowFullScreen mozallowfullscreen allowFullScreen></iframe><br />
<br><br><br><br><br />
</html><br />
= Step 1. Choosing effector and target sequence =<br />
----<br />
<br>First, you need to think about your experimental setup. When working with TAL proteins it's pretty clear you want to target a DNA sequence. To choose your sequence, you need to know some of the operational details of TAL proteins in order to pick it the right way. <br />
<br />
<br />
<b>1. Every TAL binding site starts and ends with a thymine</b><br />
<br />
These thymine binding modules are already inserted in our expression plasmids. So the protein won't bind to other sequences than those which start with a T and end with a T.<br />
<br />
<br />
<b>2. Your sequence must be twelve base pair long</b><br />
<br />
Our toolbox is optimized for sequences of twelve plus two (the thymine at upstream and downstream positions). This lenght guarantees a high specifity and a library size that's good to handle at the same time.<br />
<br />
<br />
You can check out the following online softwares for perfect TAL-TF or TALEN binding sites:<br><br><br />
https://boglab.plp.iastate.edu/node/add/talen (for TALENs)<br><br />
https://boglab.plp.iastate.edu/node/add/single-tale (for TAL-TFs)<br />
<br />
<br><br />
<br />
<br><br />
<br />
= Step 2. Building a TAL =<br />
----<br />
<br>Building your TAL starts with your selected sequence. In this manual, we use a fictive sequence that you can substitute with your own. <p>Our sequence will be as follows:</p><br />
<br />
<br />
[[Image:sequence1.png|200px|center|no frame|link=]]<br />
<br />
<br />
<br />
<br>Because the two thymines are already in the cloning vector, they are of no interest for our TAL protein:<br />
<br />
[[Image:sequence2.png|200px|center|no frame|link=]]<br />
<br />
<br />
<br>To build this sequence from our toolkit we need to split it up in pairs of two:<br />
<br />
<br />
[[Image:sequence3.png|350px|center|no frame|link=]]<br />
<br />
<br>Now, we need to give our pairs position numbers inside the TAL protein:<br />
<br />
<br />
[[Image:sequence4.png|500px|center|no frame|link=]]<br />
<br />
<br />
<br />
<br>Next, we can start taking the parts out of the toolkit. A short look at the toolkit shows you that for every possible pair of bases, for example AA, we have 6 places. Every place stands for one of the six possible positions of the pair AA inside the TAL protein.<br />
<br />
<br />
[[Image:toolkit3.png|300px|center|no frame|link=]]<br />
<br />
<br />
<br>All you have to do now is pick the six direpeats consistent with the six pairs of your sequence. In our case, we would take the the first one of AA because the first pair of bases in our sequence is AA. Then we take the second one of TG the third of AG and so forth. The idea behind this is that every direpeat knows through his downstream and upstream part at which position of the final TAL protein it ought to be. You can find the exact mechanisms behind this in the [[Team:Freiburg/Project/Overview|'GATE Assembly Kit']] part of our project section. <br><br><br />
<br />
[[Image:sequence5.png|500px|center|no frame|link=]]<br />
<br />
<br />
<br><br />
For lazy iGEM students, we have written a simple program. So you just have to type in your target DNA sequence and we give you a list of parts that you need to pipet into your Golden Gate reaction mix:<br><br><br />
<br />
<br />
<html><br />
<div align="center"><br />
<iframe src="http://omnibus.uni-freiburg.de/~lb125/index.html"; width=95%; frameborder="0"; scrolling="no"><br />
</iframe><br />
</div><br />
</html><br />
<br />
<br />
<br />
<br><br />
<br />
= Step 3. Adding a Function =<br />
----<br />
<br><br />
Now that you have your TAL BioBricks, you are almost done. But targeting a sequence without doing anything is not really helpful, so you need a fusion protein that does something to your DNA. There are a couple of things you could do with your target sequence, and normally you have thought of this before you chose your sequence. With our toolkit you get a transcription factor (to turn on or enhance the trancription of a gene), a restriction enzyme (to make cuts wherever you want) and a desaminase (to make site-specific mutations). Every one of these factors is already placed inside the final TAL vector and designed to fit the 3'-end of your TAL BioBricks. Conveniently, you just choose one and put it in your reaction tube along with the other BioBricks.<br />
<br />
<br />
<br />
[[Image:TALfunction.png|600px|center|no frame|link=]]<br />
<br />
<br />
<br />
With the six TAL BioBricks and the fusion enzyme in your reaction tube you now only need the type two restriction enzyme BsmB1 and a T7 Ligase to put all the parts together.<br><br><br />
<br />
[[Image:protocolggc.png|300px|left|no frame|link=]]<br />
<br />
<br><br />
<br />
[[Image:thermocycler.png|200px|center|no frame|link=]]<br />
<br />
<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
= Step 4. Transformation and Use =<br />
----<br />
<br><br />
Transform 5 μl of the GATE assembly product into 50 μl of transformation competent bacteria.<br> <br />
<br>'''Important note:''' Your cells need to be sensitive to the ccdB kill cassette in our TAL expression vectors! Otherwise also bacteria that have taken up plasmids without the six direpeats will form false positive colonies. We used the DH10B E.coli strain.<br><br />
In case you want to express your TALE in bacteria, you need to induce the promoter of our prokaryotic expression plasmid with IPTG. <br>For use in a eukaryotic system, such as HEK 239 cells, perform a midiprep and directly transfect the eukaryotic TAL expression plasmid (or its derivatives pTAL-TF, pTALEN etc.) according to your transfection protocol. <br />
<!--- The Mission, Experiments ---><br />
<br><br><br><br><br><br><br />
[[#top|Back to top]]</div>Luboehttp://2012.igem.org/Team:Freiburg/Project/TalTeam:Freiburg/Project/Tal2012-10-27T01:13:27Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Using the Toolkit =<br />
----<br />
<br><br />
<div align="justify">Here, we give you a manual on how to use our toolkit to design TAL proteins. We recommend reading through all of the manual prior to using the toolkit. Moreover, we included a short introductional video on how to use the toolkit.<br />
<br />
<html><br />
<br />
<br><br><br />
<iframe style="margin-left:200px; align:center;" src="http://player.vimeo.com/video/52254697" width="400" height="300" align="middle" frameborder="0" webkitAllowFullScreen mozallowfullscreen allowFullScreen></iframe><br />
<br><br><br><br><br />
</html><br />
= Step 1. Choosing effector and target sequence =<br />
----<br />
<br>First, you need to think about your experimental setup. When working with TAL proteins it's pretty clear you want to target a DNA sequence. To choose your sequence, you need to know some of the operational details of TAL proteins in order to pick it the right way. <br />
<br />
<br />
<b>1. Every TAL binding site starts and ends with a thymine</b><br />
<br />
These thymine binding modules are already inserted in our expression plasmids. So the protein won't bind to other sequences than those which start with a T and end with a T.<br />
<br />
<br />
<b>2. Your sequence must be twelve base pair long</b><br />
<br />
Our toolbox is optimized for sequences of twelve plus two (the thymine at upstream and downstream positions). This lenght guarantees a high specifity and a library size that's good to handle at the same time.<br />
<br />
<br />
You can check out the following online softwares for perfect TAL-TF or TALEN binding sites:<br><br><br />
https://boglab.plp.iastate.edu/node/add/talen (for TALENs)<br><br />
https://boglab.plp.iastate.edu/node/add/single-tale (for TAL-TFs)<br />
<br />
<br><br />
<br />
<br><br />
<br />
= Step 2. Building a TAL =<br />
----<br />
<br>Building your TAL starts with your selected sequence. In this manual, we use a fictive sequence that you can substitute with your own. <p>Our sequence will be as follows:</p><br />
<br />
<br />
[[Image:sequence1.png|200px|center|no frame|link=]]<br />
<br />
<br />
<br />
<br>Because the two thymines are already in the cloning vector, they are of no interest for our TAL protein:<br />
<br />
[[Image:sequence2.png|200px|center|no frame|link=]]<br />
<br />
<br />
<br>To build this sequence from our toolkit we need to split it up in pairs of two:<br />
<br />
<br />
[[Image:sequence3.png|350px|center|no frame|link=]]<br />
<br />
<br>Now, we need to give our pairs position numbers inside the TAL protein:<br />
<br />
<br />
[[Image:sequence4.png|500px|center|no frame|link=]]<br />
<br />
<br />
<br />
<br>Next, we can start taking the parts out of the toolkit. A short look at the toolkit shows you that for every possible pair of bases, for example AA, we have 6 places. Every place stands for one of the six possible positions of the pair AA inside the TAL protein.<br />
<br />
<br />
[[Image:toolkit3.png|300px|center|no frame|link=]]<br />
<br />
<br />
<br>All you have to do now is pick the six direpeats consistent with the six pairs of your sequence. In our case, we would take the the first one of AA because the first pair of bases in our sequence is AA. Then we take the second one of TG the third of AG and so forth. The idea behind this is that every direpeat knows through his downstream and upstream part at which position of the final TAL protein it ought to be. You can find the exact mechanisms behind this in the [[Team:Freiburg/Project/Overview|'GATE Assembly Kit']] part of our project section. <br><br><br />
<br />
[[Image:sequence5.png|500px|center|no frame|link=]]<br />
<br />
<br />
<br><br />
For lazy iGEM students, we have written a simple program. So you just have to type in your target DNA sequence and we give you a list of parts that you need to pipet into your Golden Gate reaction mix:<br><br><br />
<br />
<br />
<html><br />
<div align="center"><br />
<iframe src="http://omnibus.uni-freiburg.de/~lb125/index.html"; width=95%; frameborder="1"; scrolling="no"><br />
</iframe><br />
</div><br />
</html><br />
<br />
<br />
<br />
<br><br />
<br />
= Step 3. Adding a Function =<br />
----<br />
<br><br />
Now that you have your TAL BioBricks, you are almost done. But targeting a sequence without doing anything is not really helpful, so you need a fusion protein that does something to your DNA. There are a couple of things you could do with your target sequence, and normally you have thought of this before you chose your sequence. With our toolkit you get a transcription factor (to turn on or enhance the trancription of a gene), a restriction enzyme (to make cuts wherever you want) and a desaminase (to make site-specific mutations). Every one of these factors is already placed inside the final TAL vector and designed to fit the 3'-end of your TAL BioBricks. Conveniently, you just choose one and put it in your reaction tube along with the other BioBricks.<br />
<br />
<br />
<br />
[[Image:TALfunction.png|600px|center|no frame|link=]]<br />
<br />
<br />
<br />
With the six TAL BioBricks and the fusion enzyme in your reaction tube you now only need the type two restriction enzyme BsmB1 and a T7 Ligase to put all the parts together.<br><br><br />
<br />
[[Image:protocolggc.png|300px|left|no frame|link=]]<br />
<br />
<br><br />
<br />
[[Image:thermocycler.png|200px|center|no frame|link=]]<br />
<br />
<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
= Step 4. Transformation and Use =<br />
----<br />
<br><br />
Transform 5 μl of the GATE assembly product into 50 μl of transformation competent bacteria.<br> <br />
<br>'''Important note:''' Your cells need to be sensitive to the ccdB kill cassette in our TAL expression vectors! Otherwise also bacteria that have taken up plasmids without the six direpeats will form false positive colonies. We used the DH10B E.coli strain.<br><br />
In case you want to express your TALE in bacteria, you need to induce the promoter of our prokaryotic expression plasmid with IPTG. <br>For use in a eukaryotic system, such as HEK 239 cells, perform a midiprep and directly transfect the eukaryotic TAL expression plasmid (or its derivatives pTAL-TF, pTALEN etc.) according to your transfection protocol. <br />
<!--- The Mission, Experiments ---><br />
<br><br><br><br><br><br><br />
[[#top|Back to top]]</div>Luboehttp://2012.igem.org/Team:Freiburg/Project/TalTeam:Freiburg/Project/Tal2012-10-27T01:13:07Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Using the Toolkit =<br />
----<br />
<br><br />
<div align="justify">Here, we give you a manual on how to use our toolkit to design TAL proteins. We recommend reading through all of the manual prior to using the toolkit. Moreover, we included a short introductional video on how to use the toolkit.<br />
<br />
<html><br />
<br />
<br><br><br />
<iframe style="margin-left:200px; align:center;" src="http://player.vimeo.com/video/52254697" width="400" height="300" align="middle" frameborder="0" webkitAllowFullScreen mozallowfullscreen allowFullScreen></iframe><br />
<br><br><br><br><br />
</html><br />
= Step 1. Choosing effector and target sequence =<br />
----<br />
<br>First, you need to think about your experimental setup. When working with TAL proteins it's pretty clear you want to target a DNA sequence. To choose your sequence, you need to know some of the operational details of TAL proteins in order to pick it the right way. <br />
<br />
<br />
<b>1. Every TAL binding site starts and ends with a thymine</b><br />
<br />
These thymine binding modules are already inserted in our expression plasmids. So the protein won't bind to other sequences than those which start with a T and end with a T.<br />
<br />
<br />
<b>2. Your sequence must be twelve base pair long</b><br />
<br />
Our toolbox is optimized for sequences of twelve plus two (the thymine at upstream and downstream positions). This lenght guarantees a high specifity and a library size that's good to handle at the same time.<br />
<br />
<br />
You can check out the following online softwares for perfect TAL-TF or TALEN binding sites:<br><br><br />
https://boglab.plp.iastate.edu/node/add/talen (for TALENs)<br><br />
https://boglab.plp.iastate.edu/node/add/single-tale (for TAL-TFs)<br />
<br />
<br><br />
<br />
<br><br />
<br />
= Step 2. Building a TAL =<br />
----<br />
<br>Building your TAL starts with your selected sequence. In this manual, we use a fictive sequence that you can substitute with your own. <p>Our sequence will be as follows:</p><br />
<br />
<br />
[[Image:sequence1.png|200px|center|no frame|link=]]<br />
<br />
<br />
<br />
<br>Because the two thymines are already in the cloning vector, they are of no interest for our TAL protein:<br />
<br />
[[Image:sequence2.png|200px|center|no frame|link=]]<br />
<br />
<br />
<br>To build this sequence from our toolkit we need to split it up in pairs of two:<br />
<br />
<br />
[[Image:sequence3.png|350px|center|no frame|link=]]<br />
<br />
<br>Now, we need to give our pairs position numbers inside the TAL protein:<br />
<br />
<br />
[[Image:sequence4.png|500px|center|no frame|link=]]<br />
<br />
<br />
<br />
<br>Next, we can start taking the parts out of the toolkit. A short look at the toolkit shows you that for every possible pair of bases, for example AA, we have 6 places. Every place stands for one of the six possible positions of the pair AA inside the TAL protein.<br />
<br />
<br />
[[Image:toolkit3.png|300px|center|no frame|link=]]<br />
<br />
<br />
<br>All you have to do now is pick the six direpeats consistent with the six pairs of your sequence. In our case, we would take the the first one of AA because the first pair of bases in our sequence is AA. Then we take the second one of TG the third of AG and so forth. The idea behind this is that every direpeat knows through his downstream and upstream part at which position of the final TAL protein it ought to be. You can find the exact mechanisms behind this in the [[Team:Freiburg/Project/Overview|'GATE Assembly Kit']] part of our project section. <br><br><br />
<br />
[[Image:sequence5.png|500px|center|no frame|link=]]<br />
<br />
<br />
<br><br />
For lazy iGEM students, we have written a simple program. So you just have to type in your target DNA sequence and we give you a list of parts that you need to pipet into your Golden Gate reaction mix:<br><br><br />
<br />
<br />
<html><br />
<div align="center"><br />
<iframe src="http://omnibus.uni-freiburg.de/~lb125/index.html"; width=95%; frameborder="0"; scrolling="no"><br />
</iframe><br />
</div><br />
</html><br />
<br />
<br />
<br />
<br><br />
<br />
= Step 3. Adding a Function =<br />
----<br />
<br><br />
Now that you have your TAL BioBricks, you are almost done. But targeting a sequence without doing anything is not really helpful, so you need a fusion protein that does something to your DNA. There are a couple of things you could do with your target sequence, and normally you have thought of this before you chose your sequence. With our toolkit you get a transcription factor (to turn on or enhance the trancription of a gene), a restriction enzyme (to make cuts wherever you want) and a desaminase (to make site-specific mutations). Every one of these factors is already placed inside the final TAL vector and designed to fit the 3'-end of your TAL BioBricks. Conveniently, you just choose one and put it in your reaction tube along with the other BioBricks.<br />
<br />
<br />
<br />
[[Image:TALfunction.png|600px|center|no frame|link=]]<br />
<br />
<br />
<br />
With the six TAL BioBricks and the fusion enzyme in your reaction tube you now only need the type two restriction enzyme BsmB1 and a T7 Ligase to put all the parts together.<br><br><br />
<br />
[[Image:protocolggc.png|300px|left|no frame|link=]]<br />
<br />
<br><br />
<br />
[[Image:thermocycler.png|200px|center|no frame|link=]]<br />
<br />
<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
= Step 4. Transformation and Use =<br />
----<br />
<br><br />
Transform 5 μl of the GATE assembly product into 50 μl of transformation competent bacteria.<br> <br />
<br>'''Important note:''' Your cells need to be sensitive to the ccdB kill cassette in our TAL expression vectors! Otherwise also bacteria that have taken up plasmids without the six direpeats will form false positive colonies. We used the DH10B E.coli strain.<br><br />
In case you want to express your TALE in bacteria, you need to induce the promoter of our prokaryotic expression plasmid with IPTG. <br>For use in a eukaryotic system, such as HEK 239 cells, perform a midiprep and directly transfect the eukaryotic TAL expression plasmid (or its derivatives pTAL-TF, pTALEN etc.) according to your transfection protocol. <br />
<!--- The Mission, Experiments ---><br />
<br><br><br><br><br><br><br />
[[#top|Back to top]]</div>Luboehttp://2012.igem.org/Team:Freiburg/Project/TalTeam:Freiburg/Project/Tal2012-10-27T00:59:42Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Using the Toolkit =<br />
----<br />
<br><br />
<div align="justify">Here, we give you a manual on how to use our toolkit to design TAL proteins. We recommend reading through all of the manual prior to using the toolkit. Moreover, we included a short introductional video on how to use the toolkit.<br />
<br />
<html><br />
<br />
<br><br><br />
<iframe style="margin-left:200px; align:center;" src="http://player.vimeo.com/video/52254697" width="400" height="300" align="middle" frameborder="0" webkitAllowFullScreen mozallowfullscreen allowFullScreen></iframe><br />
<br><br><br><br><br />
</html><br />
= Step 1. Choosing effector and target sequence =<br />
----<br />
<br>First, you need to think about your experimental setup. When working with TAL proteins it's pretty clear you want to target a DNA sequence. To choose your sequence, you need to know some of the operational details of TAL proteins in order to pick it the right way. <br />
<br />
<br />
<b>1. Every TAL binding site starts and ends with a thymine</b><br />
<br />
These thymine binding modules are already inserted in our expression plasmids. So the protein won't bind to other sequences than those which start with a T and end with a T.<br />
<br />
<br />
<b>2. Your sequence must be twelve base pair long</b><br />
<br />
Our toolbox is optimized for sequences of twelve plus two (the thymine at upstream and downstream positions). This lenght guarantees a high specifity and a library size that's good to handle at the same time.<br />
<br />
<br />
You can check out the following online softwares for perfect TAL-TF or TALEN binding sites:<br><br><br />
https://boglab.plp.iastate.edu/node/add/talen (for TALENs)<br><br />
https://boglab.plp.iastate.edu/node/add/single-tale (for TAL-TFs)<br />
<br />
<br><br />
<br />
<br><br />
<br />
= Step 2. Building a TAL =<br />
----<br />
<br>Building your TAL starts with your selected sequence. In this manual, we use a fictive sequence that you can substitute with your own. <p>Our sequence will be as follows:</p><br />
<br />
<br />
[[Image:sequence1.png|200px|center|no frame|link=]]<br />
<br />
<br />
<br />
<br>Because the two thymines are already in the cloning vector, they are of no interest for our TAL protein:<br />
<br />
[[Image:sequence2.png|200px|center|no frame|link=]]<br />
<br />
<br />
<br>To build this sequence from our toolkit we need to split it up in pairs of two:<br />
<br />
<br />
[[Image:sequence3.png|350px|center|no frame|link=]]<br />
<br />
<br>Now, we need to give our pairs position numbers inside the TAL protein:<br />
<br />
<br />
[[Image:sequence4.png|500px|center|no frame|link=]]<br />
<br />
<br />
<br />
<br>Next, we can start taking the parts out of the toolkit. A short look at the toolkit shows you that for every possible pair of bases, for example AA, we have 6 places. Every place stands for one of the six possible positions of the pair AA inside the TAL protein.<br />
<br />
<br />
[[Image:toolkit3.png|300px|center|no frame|link=]]<br />
<br />
<br />
<br>All you have to do now is pick the six direpeats consistent with the six pairs of your sequence. In our case, we would take the the first one of AA because the first pair of bases in our sequence is AA. Then we take the second one of TG the third of AG and so forth. The idea behind this is that every direpeat knows through his downstream and upstream part at which position of the final TAL protein it ought to be. You can find the exact mechanisms behind this in the [[Team:Freiburg/Project/Overview|'GATE Assembly Kit']] part of our project section. <br><br><br />
<br />
[[Image:sequence5.png|500px|center|no frame|link=]]<br />
<br />
<br />
<br><br />
For lazy iGEM students, we have written a simple program. So you just have to type in your target DNA sequence and we give you a list of parts that you need to pipet into your Golden Gate reaction mix:<br><br><br />
<br />
<br />
<html><br />
<div align="center"><br />
<iframe src="http://omnibus.uni-freiburg.de/~lb125/index.html"; width=90%; frameborder="0"; scrolling="no"><br />
</iframe><br />
</div><br />
</html><br />
<br />
<br />
<br />
<br><br />
<br />
= Step 3. Adding a Function =<br />
----<br />
<br><br />
Now that you have your TAL BioBricks, you are almost done. But targeting a sequence without doing anything is not really helpful, so you need a fusion protein that does something to your DNA. There are a couple of things you could do with your target sequence, and normally you have thought of this before you chose your sequence. With our toolkit you get a transcription factor (to turn on or enhance the trancription of a gene), a restriction enzyme (to make cuts wherever you want) and a desaminase (to make site-specific mutations). Every one of these factors is already placed inside the final TAL vector and designed to fit the 3'-end of your TAL BioBricks. Conveniently, you just choose one and put it in your reaction tube along with the other BioBricks.<br />
<br />
<br />
<br />
[[Image:TALfunction.png|600px|center|no frame|link=]]<br />
<br />
<br />
<br />
With the six TAL BioBricks and the fusion enzyme in your reaction tube you now only need the type two restriction enzyme BsmB1 and a T7 Ligase to put all the parts together.<br><br><br />
<br />
[[Image:protocolggc.png|300px|left|no frame|link=]]<br />
<br />
<br><br />
<br />
[[Image:thermocycler.png|200px|center|no frame|link=]]<br />
<br />
<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
= Step 4. Transformation and Use =<br />
----<br />
<br><br />
Transform 5 μl of the GATE assembly product into 50 μl of transformation competent bacteria.<br> <br />
<br>'''Important note:''' Your cells need to be sensitive to the ccdB kill cassette in our TAL expression vectors! Otherwise also bacteria that have taken up plasmids without the six direpeats will form false positive colonies. We used the DH10B E.coli strain.<br><br />
In case you want to express your TALE in bacteria, you need to induce the promoter of our prokaryotic expression plasmid with IPTG. <br>For use in a eukaryotic system, such as HEK 239 cells, perform a midiprep and directly transfect the eukaryotic TAL expression plasmid (or its derivatives pTAL-TF, pTALEN etc.) according to your transfection protocol. <br />
<!--- The Mission, Experiments ---><br />
<br><br><br><br><br><br><br />
[[#top|Back to top]]</div>Luboehttp://2012.igem.org/Team:Freiburg/Project/TalTeam:Freiburg/Project/Tal2012-10-27T00:54:06Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Using the Toolkit =<br />
----<br />
<br><br />
<div align="justify">Here, we give you a manual on how to use our toolkit to design TAL proteins. We recommend reading through all of the manual prior to using the toolkit. Moreover, we included a short introductional video on how to use the toolkit.<br />
<br />
<html><br />
<br />
<br><br><br />
<iframe style="margin-left:200px; align:center;" src="http://player.vimeo.com/video/52254697" width="400" height="300" align="middle" frameborder="0" webkitAllowFullScreen mozallowfullscreen allowFullScreen></iframe><br />
<br><br><br><br><br />
</html><br />
= Step 1. Choosing effector and target sequence =<br />
----<br />
<br>First, you need to think about your experimental setup. When working with TAL proteins it's pretty clear you want to target a DNA sequence. To choose your sequence, you need to know some of the operational details of TAL proteins in order to pick it the right way. <br />
<br />
<br />
<b>1. Every TAL binding site starts and ends with a thymine</b><br />
<br />
These thymine binding modules are already inserted in our expression plasmids. So the protein won't bind to other sequences than those which start with a T and end with a T.<br />
<br />
<br />
<b>2. Your sequence must be twelve base pair long</b><br />
<br />
Our toolbox is optimized for sequences of twelve plus two (the thymine at upstream and downstream positions). This lenght guarantees a high specifity and a library size that's good to handle at the same time.<br />
<br />
<br />
You can check out the following online softwares for perfect TAL-TF or TALEN binding sites:<br><br><br />
https://boglab.plp.iastate.edu/node/add/talen (for TALENs)<br><br />
https://boglab.plp.iastate.edu/node/add/single-tale (for TAL-TFs)<br />
<br />
<br><br />
<br />
<br><br />
<br />
= Step 2. Building a TAL =<br />
----<br />
<br>Building your TAL starts with your selected sequence. In this manual, we use a fictive sequence that you can substitute with your own. <p>Our sequence will be as follows:</p><br />
<br />
<br />
[[Image:sequence1.png|200px|center|no frame|link=]]<br />
<br />
<br />
<br />
<br>Because the two thymines are already in the cloning vector, they are of no interest for our TAL protein:<br />
<br />
[[Image:sequence2.png|200px|center|no frame|link=]]<br />
<br />
<br />
<br>To build this sequence from our toolkit we need to split it up in pairs of two:<br />
<br />
<br />
[[Image:sequence3.png|350px|center|no frame|link=]]<br />
<br />
<br>Now, we need to give our pairs position numbers inside the TAL protein:<br />
<br />
<br />
[[Image:sequence4.png|500px|center|no frame|link=]]<br />
<br />
<br />
<br />
<br>Next, we can start taking the parts out of the toolkit. A short look at the toolkit shows you that for every possible pair of bases, for example AA, we have 6 places. Every place stands for one of the six possible positions of the pair AA inside the TAL protein.<br />
<br />
<br />
[[Image:toolkit3.png|300px|center|no frame|link=]]<br />
<br />
<br />
<br>All you have to do now is pick the six direpeats consistent with the six pairs of your sequence. In our case, we would take the the first one of AA because the first pair of bases in our sequence is AA. Then we take the second one of TG the third of AG and so forth. The idea behind this is that every direpeat knows through his downstream and upstream part at which position of the final TAL protein it ought to be. You can find the exact mechanisms behind this in the [[Team:Freiburg/Project/Overview|'GATE Assembly Kit']] part of our project section. <br><br><br />
<br />
[[Image:sequence5.png|500px|center|no frame|link=]]<br />
<br />
<br />
<br><br />
For lazy iGEM students, we have written a simple program. So you just have to type in your target DNA sequence and we give you a list of parts that you need to pipet into your Golden Gate reaction mix:<br><br><br />
<br />
<br />
<html><br />
<div align="center"><br />
<iframe src="http://omnibus.uni-freiburg.de/~lb125/index.html"; width=80%; frameborder="1"; scrolling="no"><br />
</iframe><br />
</div><br />
</html><br />
<br />
<br />
<br />
<br><br />
<br />
= Step 3. Adding a Function =<br />
----<br />
<br><br />
Now that you have your TAL BioBricks, you are almost done. But targeting a sequence without doing anything is not really helpful, so you need a fusion protein that does something to your DNA. There are a couple of things you could do with your target sequence, and normally you have thought of this before you chose your sequence. With our toolkit you get a transcription factor (to turn on or enhance the trancription of a gene), a restriction enzyme (to make cuts wherever you want) and a desaminase (to make site-specific mutations). Every one of these factors is already placed inside the final TAL vector and designed to fit the 3'-end of your TAL BioBricks. Conveniently, you just choose one and put it in your reaction tube along with the other BioBricks.<br />
<br />
<br />
<br />
[[Image:TALfunction.png|600px|center|no frame|link=]]<br />
<br />
<br />
<br />
With the six TAL BioBricks and the fusion enzyme in your reaction tube you now only need the type two restriction enzyme BsmB1 and a T7 Ligase to put all the parts together.<br><br><br />
<br />
[[Image:protocolggc.png|300px|left|no frame|link=]]<br />
<br />
<br><br />
<br />
[[Image:thermocycler.png|200px|center|no frame|link=]]<br />
<br />
<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
= Step 4. Transformation and Use =<br />
----<br />
<br><br />
Transform 5 μl of the GATE assembly product into 50 μl of transformation competent bacteria.<br> <br />
<br>'''Important note:''' Your cells need to be sensitive to the ccdB kill cassette in our TAL expression vectors! Otherwise also bacteria that have taken up plasmids without the six direpeats will form false positive colonies. We used the DH10B E.coli strain.<br><br />
In case you want to express your TALE in bacteria, you need to induce the promoter of our prokaryotic expression plasmid with IPTG. <br>For use in a eukaryotic system, such as HEK 239 cells, perform a midiprep and directly transfect the eukaryotic TAL expression plasmid (or its derivatives pTAL-TF, pTALEN etc.) according to your transfection protocol. <br />
<!--- The Mission, Experiments ---><br />
<br><br><br><br><br><br><br />
[[#top|Back to top]]</div>Luboehttp://2012.igem.org/Team:Freiburg/Project/TalTeam:Freiburg/Project/Tal2012-10-27T00:53:04Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Using the Toolkit =<br />
----<br />
<br><br />
<div align="justify">Here, we give you a manual on how to use our toolkit to design TAL proteins. We recommend reading through all of the manual prior to using the toolkit. Moreover, we included a short introductional video on how to use the toolkit.<br />
<br />
<html><br />
<br />
<br><br><br />
<iframe style="margin-left:200px; align:center;" src="http://player.vimeo.com/video/52254697" width="400" height="300" align="middle" frameborder="1" webkitAllowFullScreen mozallowfullscreen allowFullScreen></iframe><br />
<br><br><br><br><br />
</html><br />
= Step 1. Choosing effector and target sequence =<br />
----<br />
<br>First, you need to think about your experimental setup. When working with TAL proteins it's pretty clear you want to target a DNA sequence. To choose your sequence, you need to know some of the operational details of TAL proteins in order to pick it the right way. <br />
<br />
<br />
<b>1. Every TAL binding site starts and ends with a thymine</b><br />
<br />
These thymine binding modules are already inserted in our expression plasmids. So the protein won't bind to other sequences than those which start with a T and end with a T.<br />
<br />
<br />
<b>2. Your sequence must be twelve base pair long</b><br />
<br />
Our toolbox is optimized for sequences of twelve plus two (the thymine at upstream and downstream positions). This lenght guarantees a high specifity and a library size that's good to handle at the same time.<br />
<br />
<br />
You can check out the following online softwares for perfect TAL-TF or TALEN binding sites:<br><br><br />
https://boglab.plp.iastate.edu/node/add/talen (for TALENs)<br><br />
https://boglab.plp.iastate.edu/node/add/single-tale (for TAL-TFs)<br />
<br />
<br><br />
<br />
<br><br />
<br />
= Step 2. Building a TAL =<br />
----<br />
<br>Building your TAL starts with your selected sequence. In this manual, we use a fictive sequence that you can substitute with your own. <p>Our sequence will be as follows:</p><br />
<br />
<br />
[[Image:sequence1.png|200px|center|no frame|link=]]<br />
<br />
<br />
<br />
<br>Because the two thymines are already in the cloning vector, they are of no interest for our TAL protein:<br />
<br />
[[Image:sequence2.png|200px|center|no frame|link=]]<br />
<br />
<br />
<br>To build this sequence from our toolkit we need to split it up in pairs of two:<br />
<br />
<br />
[[Image:sequence3.png|350px|center|no frame|link=]]<br />
<br />
<br>Now, we need to give our pairs position numbers inside the TAL protein:<br />
<br />
<br />
[[Image:sequence4.png|500px|center|no frame|link=]]<br />
<br />
<br />
<br />
<br>Next, we can start taking the parts out of the toolkit. A short look at the toolkit shows you that for every possible pair of bases, for example AA, we have 6 places. Every place stands for one of the six possible positions of the pair AA inside the TAL protein.<br />
<br />
<br />
[[Image:toolkit3.png|300px|center|no frame|link=]]<br />
<br />
<br />
<br>All you have to do now is pick the six direpeats consistent with the six pairs of your sequence. In our case, we would take the the first one of AA because the first pair of bases in our sequence is AA. Then we take the second one of TG the third of AG and so forth. The idea behind this is that every direpeat knows through his downstream and upstream part at which position of the final TAL protein it ought to be. You can find the exact mechanisms behind this in the [[Team:Freiburg/Project/Overview|'GATE Assembly Kit']] part of our project section. <br><br><br />
<br />
[[Image:sequence5.png|500px|center|no frame|link=]]<br />
<br />
<br />
<br><br />
For lazy iGEM students, we have written a simple program. So you just have to type in your target DNA sequence and we give you a list of parts that you need to pipet into your Golden Gate reaction mix:<br><br><br />
<br />
<br />
<html><br />
<div align="center"><br />
<iframe src="http://omnibus.uni-freiburg.de/~lb125/index.html"; width=80%; frameborder="0"; scrolling="no"><br />
</iframe><br />
</div><br />
</html><br />
<br />
<br />
<br />
<br><br />
<br />
= Step 3. Adding a Function =<br />
----<br />
<br><br />
Now that you have your TAL BioBricks, you are almost done. But targeting a sequence without doing anything is not really helpful, so you need a fusion protein that does something to your DNA. There are a couple of things you could do with your target sequence, and normally you have thought of this before you chose your sequence. With our toolkit you get a transcription factor (to turn on or enhance the trancription of a gene), a restriction enzyme (to make cuts wherever you want) and a desaminase (to make site-specific mutations). Every one of these factors is already placed inside the final TAL vector and designed to fit the 3'-end of your TAL BioBricks. Conveniently, you just choose one and put it in your reaction tube along with the other BioBricks.<br />
<br />
<br />
<br />
[[Image:TALfunction.png|600px|center|no frame|link=]]<br />
<br />
<br />
<br />
With the six TAL BioBricks and the fusion enzyme in your reaction tube you now only need the type two restriction enzyme BsmB1 and a T7 Ligase to put all the parts together.<br><br><br />
<br />
[[Image:protocolggc.png|300px|left|no frame|link=]]<br />
<br />
<br><br />
<br />
[[Image:thermocycler.png|200px|center|no frame|link=]]<br />
<br />
<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
= Step 4. Transformation and Use =<br />
----<br />
<br><br />
Transform 5 μl of the GATE assembly product into 50 μl of transformation competent bacteria.<br> <br />
<br>'''Important note:''' Your cells need to be sensitive to the ccdB kill cassette in our TAL expression vectors! Otherwise also bacteria that have taken up plasmids without the six direpeats will form false positive colonies. We used the DH10B E.coli strain.<br><br />
In case you want to express your TALE in bacteria, you need to induce the promoter of our prokaryotic expression plasmid with IPTG. <br>For use in a eukaryotic system, such as HEK 239 cells, perform a midiprep and directly transfect the eukaryotic TAL expression plasmid (or its derivatives pTAL-TF, pTALEN etc.) according to your transfection protocol. <br />
<!--- The Mission, Experiments ---><br />
<br><br><br><br><br><br><br />
[[#top|Back to top]]</div>Luboehttp://2012.igem.org/Team:Freiburg/Project/OverviewTeam:Freiburg/Project/Overview2012-10-27T00:22:06Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= The GATE Assembly Kit =<br />
----<br />
<br><br />
<div align="justify">TALEs make sequence-specific genome modification much easier than before and therefore attract great interest in the synbio community and beyond. Interestingly, many of the researchers who hold the patents on TALEs also released open source toolkits for TALE assembly for academic research. However, most strategies of TALE gene assembly published thus far rely on a hierarchical procedure, that is very time consuming, laborious and not automatable.<br />
Therefore, we herein describe the Golden Gate cloning-based TAL Effector (GATE) Assembly platform, which enables literally everyone to produce low-cost, tailored TALEs within a few minutes of labwork and basic lab equipment. Moreover, we have automated this strategy and produced different TAL Effector Transcription Factors with 97 % success rate faster than any other method published before.<br />
<br><br />
<br />
<br />
== Review of existing TALE construction methods ==<br />
<br><br />
<div align="justify"><br />
Although TALE assembly is considerably easier than e.g. screening for novel zinc fingers, the highly repetitive structure of the TALE gene implies some challenges, because conventional PCR or homologous recombination-based gene assembly strategies cannot be applied.<br />
To our knowledge, the numerous approaches of TAL-Effector gene assembly, published so far, fall under the following three categories:<br />
<br />
<br />
1. Few groups have applied methods called unit assembly<sup>1</sup> or Restriction Enzyme And Ligation (REAL)<sup>2</sup>. In the first step, both strategies perform conventional restriction enzyme digestion in order to assemble two gene fragments of single repeats. The pairs of repeat gene fragments are subsequently assembled to form tetramers, and this highly hierarchical assembly strategy is continued until the desired number of repeats is assembled. These platforms obviously involve multiple laborious and time consuming rounds of digestion, ligation and isolation of the right ligation products. The recently published fast ligation-based automatable solid-phase high-throughput (FLASH) system circumvents major challenges of REAL by attaching the first repeat to streptavidin-coated magnetic beads and, successively, adding further repeats or oligorepeats from a 376-plasmid library. Although Reyon et al.<sup>11</sup> claim that FLASH can also be performed manually, this probably does not represent the most convenient and low-cost protocol for iGEM students.<br />
<br />
<br />
2. We call the second category of TALE production methods the synthesis optimization approach. The major challenge of TAL synthesis is the highly repetitive amino acid sequence of the DNA binding part. Since synthetic genes are typically produced from overlapping synthesized oligos, overlaps of different pairs of overlapping oligos need to be distinct. The synthesis optimization approach employs a sophisticated computer program that optimizes codon usage in order to reduce repetitiveness of the TAL gene and calculates optimal oligos for synthesis<sup>3,4</sup>. Although this approach might be the method of the future, it is currently too expensive for iGEM teams. <br />
<br />
<br />
3. The third category of TALE assembly protocols applies Golden Gate Cloning (GGC)<sup>5,6,7,8,9</sup> (for details on GGC, see the [[Team:Freiburg/Project/Golden#GGC|Golden Gate Standard page]]). In all GGC-based TALE repeat assembly strategies, level 1 modules (i.e. single repeat gene fragments) are flanked by type IIs restriction sites adjacent to their first or last 4 nucleotides, respectively, that produce sticky ends after digestion with the type IIs restriction enzyme. Since each level 1 module codes for the same amino acid sequence (despite of the RVDs), the codon usage must be changed at these 4 external nucleotides for producing unique sticky ends that assemble in the predefined order after digestion. Consequently, the 4 bp overlaps of a level 1 module specify its future position within the TALE gene.<br />
So, in order to be able to target any sequence of DNA, a method that is using GGC requires N x K modules. N signifies the number of level 1 module positions (i.e. number of modules that the TALE should contain after GGC) and K signifies the number of different repeats that the user should be able to put into each of the N positions (in most kits K equals 4, one repeat for each DNA base, see figure 1).<br />
<br><br><br />
[[File:Conventionaltalconstruction.jpg|600px|center|link=]]<br />
<p align="center">Figure 1: Conventional TAL construction</p><br />
<br><br />
Unfortunately, using GGC, only up to 10 modules <sup>5</sup> can be assembled with high accuracy. So in the GGC-based protocols, level 1 modules get assembled to form level 2 modules (oligorepeats). These level 2 modules need to be amplified and isolated before a second GGC reaction assembles them to form the complete repeat array. The bottleneck of the GGC-based methods is the need for amplification and isolation of level 2 modules, which costs a lot of time, requires some extra knowledge, additional enzymes and lab equipment (we actually tried one of the GGC-based open source kits, but, even after 2.5 weeks, were not able to assemble the whole TALE).<br><br><br />
<br />
<br />
<br />
== GATE Assembly Kit ==<br />
<br />
<br><br />
<div align="justify">Right from the beginning, we were very much intrigued by the efficiency of Golden Gate Cloning and hypothesized, that instant TAL assembly would be possible if we overcame the need for a second (or even third) round of GGC. Since we were sure we were not able to improve GGC reaction conditions so much that we could actually assemble all repeats at once, we came up with another solution: Why not use direpeats instead of single repeats as level 1 modules? This would cut the number of level 1 modules half and allow us to perform TAL assembly in one single reaction. Unfortunately, our idea would not only cut half N but would also quadruple M, and thus would double the toolkit size.<br />
<br><br />
<br />
[[Image:Synthese_3.png|200px|center|no frame|link=]]<br />
<br />
<br><br />
So we needed to further reduce N down to 6 to obtain a reasonable toolkit size of 96 level 1 modules. We actually liked the idea that our kit would perfectly fit on a 96 well plate.<br />
<br><br><br />
<br />
[[Image:Toolkit.png|700px|center|no frame|link=]]<br />
<br />
<br><br />
Next, we looked into the literature to check, if TALEs that recognize 14 bp (instead of around 18 bp) are actually functional. We were very fortunate to see that efficiency of TAL transcription factors (TAL-TFs)<sup>10 </sup> and TAL effector nucleases (TALENs)<sup>11 </sup> remains constant between for target sequences between 13 and 20 bp. Moreover, Zhang et al. published splendid results with 14 bp-binding TAL-TFs in a human cell line<sup>7</sup>. <br />
Since we wanted our TALEs to function in both bacteria and eukaryotic systems, while published TAL repeats were always designed for one particular organism, we decided to design the direpeat nucleotide sequences from scratch: We used the amino acid sequence of the hex3 gene of Xanthomonas oryzae to find out the amino acid sequences for the 16 direpeats. Next, we reverse-tanslated the sequences into DNA, codon optimized them for E.coli and human cells and reduced homologies between and within gene fragments (only the extention PCR binding sites were the same for every direpeat gene).<br />
After receiving the sequences that were synthesized as G-blocks by IDT, we performed 6 extention PCRs on every sequence to add 4 bp overlaps, BsmBI restriction sites and iGEM prefix and suffix to the parts. The 4 bp overlaps would later determine the position of the respective direpeat in the repeat array of the TALE.<br />
<br><br><br />
<br />
[[Image:Biobrickfreigem.png|500px|center|no frame|link=]]<br />
<br><br><br><br><br />
<br />
[[Image:Extension3.png|600px|center|no frame|link=]]<br />
<br />
<br><br />
One of the advantages of GGC is that you can insert complete plasmids containing the parts you want to assemble. So we decided to clone all 96 parts into the standard iGEM vector pSB1C3. We hypothesized that the BsmBI restriction site in the chloramphenicol gene would decrease GGC efficiency, so we performed a mutagenesis PCR to introduce the silent mutation (G434C) prior to cloning the 96 PCR products into it. When doing so many cloning experiments at a time, error rate needs to be minimal, so at first, we spent weeks optimizing every single step from the G-block to the Golden Gate standard compatible BioBrick (see [[Team:Freiburg/Project/Golden#GGC|protocol section]]). In the end, we are very happy that we have a full GATE assembly kit with [[Team:Freiburg/Parts|96 unique direpeats]] and 100% accurate sequencing results.<br />
Our first attempts to use the GATE assembly kit were actually very discouraging - no colonies were found on the agar plates after transforming the GGC product into DH10B cells for more than one week - at least, we knew that our ccdb kill cassette was working well (details about the <html><a href="https://2012.igem.org/Team:Freiburg/Project/Vektor">expression vector</a></html>). After systematically testing all kinds of buffers and reaction additives, the results where quite overwhelming. We were even able to dramatically reduce GGC reaction time down to 2.5 hours - which is probably the fastest way anyone has ever built a custom tal effector.<br />
<br />
<br><br><br />
<br />
== References ==<br />
<br><br />
1. Huang, P. et al. Heritable gene targeting in zebrafish using customized TALENs. ''Nat Biotechnol'' 29, 699–700 (2011).<br><br />
2. Sander, J. D. et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. ''Nat Biotechnol 2''9, 697–698 (2011).<br><br />
3. Hoover, D. M. & Lubkowski, J. DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis. ''Nucl Acids Res'' 30, e43–e43 (2002).<br><br />
4. Miller, J. C. et al. A TALE nuclease architecture for efficient genome editing. ''Nat Biotechnol'' 29, 143–148 (2010).<br><br />
5. Morbitzer, R., Elsaesser, J., Hausner, J. & Lahaye, T. Assembly of Custom TALE-Type DNA Binding Domains by Modular Cloning. ''Nucl Acids Res'' 39, 5790–5799 (2011).<br><br />
6. Weber, E., Gruetzner, R., Werner, S., Engler, C. & Marillonnet, S. Assembly of designer TAL effectors by golden gate cloning. ''PloS one'' 6, e19722 (2011).<br><br />
7. Zhang, F. et al. Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. ''Nat Biotechnol'' 29, 149–153 (2011).<br><br />
8. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucl Acids Res'' 39, e82 (2011).<br><br />
9. Li, T. et al. Modularly Assembled Designer TAL Effector Nucleases for Targeted Gene Knockout and Gene Replacement in Eukaryotes. ''Nucl Acids Res'' 39, 6315–6325 (2011).<br><br />
10. Boch, J. et al. Breaking the Code of DNA Binding Specificity of TAL-Type III Effectors. ''Science'' 326, 1509–1512 (2009).<br><br />
11. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nat Biotechnol'' 30, 460–465 (2012).<br />
<br />
<br />
<br />
<br />
<br><br><br />
[[#top|Back to top]]<br />
<!--- The Mission, Experiments ---></div>Luboehttp://2012.igem.org/File:Conventionaltalconstruction.jpgFile:Conventionaltalconstruction.jpg2012-10-27T00:15:35Z<p>Luboe: </p>
<hr />
<div></div>Luboehttp://2012.igem.org/Team:Freiburg/Project/ExperimentsTeam:Freiburg/Project/Experiments2012-10-27T00:07:04Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Experiments =<br />
----<br />
<br />
<br />
== Gene activation ==<br />
----<br />
<html><br />
<p><br><br />
<br />
<div align="justify">To show the functionality of our TAL protein as well as the impact of the VP 64 transcription factor fusion protein, we used a TAL-VP64 fusion construct targeting a minimal promotor coupled with the secreted alkaline phosphatase (SEAP). The product of the reporter gene SEAP is - as the name tells - a phosphatase that is secreted by the cells into the surrounding media. The existence of SEAP and therefore the activity of the promotor can be measured by the addition of para-Nitrophenylphosphate (pNPP). The SEAP enzyme catalyzes the reaction from pNPP to para-Nitrophenol, this new product absorps light at 405 nm and can be measured via photometry. <br />
This reporter system gives us a couple of advantages over standard EGFP or luciferase systems. First of all, the SEAP is secreted into the cell culture media, therefore we don't have to lyse our cells for measuring, but just take a sample from the supernatant. <img src="http://imageshack.us/a/img189/6140/seapplasmid.png" align="right" padding:0px width="450px" hspace="20"/> We are also able to measure one culture multiple times, e.g. at two different points in time. Another advantage is the measurement via photometry which makes the samples quantitively comparable. Interestingly, we did not have to clone a TALE binding site upstream of the minimal promoter (which would be required for other DNA binding proteins) but simply produced a TALE that specifically bound to the given sequence.<br />
<br><br><br><br />
</html><br />
<br />
== Experimental design ==<br />
----<br />
<html><br />
<p><br><br />
<img src="http://imageshack.us/a/img268/53/exp1design2.png" align="left" padding:0px width="250px" hspace="20" /><br />
The experiment was done with four different transfections, either no plasmid, only the TAL vector, only the SEAP plasmid or a cotransfection of both plasmids. The cells were seeded on a twelve well plate the day before in 500µl culture media per well. The transfection was done with CaCl2 after a cell culture course protocol written by the lab of Professor Weber. <br />
<br><br><br><br><br><br><br><br><br />
</html><br />
<br />
= Results =<br />
----<br />
<br><div align="justify">The result of our lab work was mainly the GATE assembly toolkit and the corresponding vectors. Further experiments were performed to validate the function of the kit both ''in vitro'' and ''in vivo''. <br />
<br />
<br />
== The Toolkit ==<br />
----<br />
<br><br />
The creation of a toolkit with 96 different parts not only means a lot of labwork but also a lot of organisational tasks, sequencing and analysis. We don't want to bore you with the 96 sequences of our finished BioBricks, but we want to give you one example of a finished BioBrick and highlight some of the interesting and important strips in its sequence. If you are interested in the other sequences, just have a look at our [[Team:Freiburg/Parts|parts section]] or go to the [http://partsregistry.org Registry of Standard Biological Parts].<br />
<br />
<br />
{|align="center"<br />
|[[Image:AA1sequence.png|400px|no frame|link=]]<br />
|}<br />
<br />
<br />
In this sequence of our BioBrick AA1, the main features of all our BioBricks are highlighted. As pointed out in the Golden Gate Standard section of our project description, all direpeat plasmids are submitted in the Golden Gate Standard, that was developed by us and which is fully compatible with existing iGEM standards. In yellow you can see the direpeat gene fragment itself, the green parts are iGEM restriction sites (a requirement for all BioBricks), the sequence written in red is part of the psb1C3 vector, the blue sequences are recognition sites for BsmB1 and the red boxes are the cutting sites of BsmB1.<br />
<br><br><br />
<br />
== Creation of TAL sequences - Golden Gate Cloning ==<br />
----<br />
<br><br />
Admittedly, our GATE assembly kit is a little larger than the kit published from the Zhang kit in Nature this year (the latter comprises 78 parts). But considering that future iGEM teams can easily combine the parts to form more than 67 million different effectors, we believe that it was worth the effort. Now, to get from the toolbox to the finished TAL effector, you only need a few components: six direpeats, one effector backbone plasmid, two enzymes and one buffer. If you mix these components and incubate in your thermocycler for 2.5 hours, you get your custom TAL effector. To put this in perspective: The average turnaround time for TALE construction with conventional kits is about two weeks! In the following sections, we want to show you the efficiency of our GATE assembly platform<br />
<br />
<br><br />
== Varying Cycle number of GATE assembly has limited effect ==<br />
----<br />
Golden Gate protocols published so far for multistep TALE assembly differ significantly in the number of digestion-ligation cycles performed. To asses, whether the cycle number significantly affects outcome, we performed 4 different GATE assemblies, each with three different cycle numbers (50, 25 and 13 cycles). We did not see significant differences in the number of colonies for the three cycle numbers. Consequently, from that point on, we performed GATE assembly with only 13 cycles (which only take approximately 2.5 hours instead of 8.5 hours for 50 cycles).<br><br><br />
{|align="center"<br />
|[[Image:colonies.png|400px|no frame|link=]]<br />
|}<br />
<br><br><br />
<br />
== Direpeat Amplification by Colony PCR ==<br />
----<br />
<br><br />
<html><br />
<div align="justify">To assess if the direpeats have indeed been successfully cloned into our expression vector, we have accomplished colony PCR with a variety of samples. To this end, we have designed primers which bind to both ends of the direpeat region and thus amplify the direpeats of our TAL protein. <br />
The original vector contains a kill cassette which kills bacteria unless it is replaced by the direpeats during the Golden Gate Cloning reaction. <br />
This cassette will also be amplified by the designed primers. A distinction between the amplification of the kill cassette and that of direpeats can be made upon the amplicon length: if the kill cassette is amplified, the resulting amplicon will contain 1527bp, while direpeat amplification will produce amplicons of 1276bp length. The difference between these two amplicons is 251bp, and can be detected by agarose gel electrophoresis. <br />
<br />
<img src="https://static.igem.org/mediawiki/2012/0/04/Direpeat_amp.jpg" align="right" width="400px" hspace="20" vspace="20" alt="Direpeat amplification by colony PCR"/><br />
<br />
The figure clearly demonstrates the difference in size between the amplicons of negative control (kill cassette still in the vector) and positive (direpeats have replaced the cassette) samples. While lane 2 shows a negative result with a single band of bigger size, all the other samples yielded amplicons of smaller length and thus are considered as positive due to amplification of direpeats.<br />
Nevertheless, it is obvious that the colony PCR did not produce one single product when amplifying the direpeats, but rather a smear consisting of amplicons with varying lengths. <br />
This effect is due to numerous homologies within the direpeats and has previously been described by Briggs et al.<sup>1</sup> . <br />
To eliminate those homologies to the greatest extent possible, we changed codon usage within our direpeats. Nevertheless, as the results of our colony PCR demonstrate, there is still a profound amount of homologies left, which imposes difficulties on the amplification of the direpeats array by PCR and instead results in a smear.<br />
Thus, the existence of this smear indicates the presence of direpeats within the expression vector. Moreover, the light bands at 1276 bp indicates, that the right number of direpeats have been inserted into the vector. We performed 30 colony PCRs from colonies of different GATE assemblies and had no negative results (but in some cases, we could not determine the hight of the light band). Since positive results in colony PCR of TALEs do not exclude wrong order of direpeats, we sequenced 28 clones of different GATE assemblies and analyzed the results: in 27 of the 28 clones, sequencing results entirely matched the right sequence. So the efficiency of GATE assembly is approximately 96 %.<br />
<br><br><br><br />
<br><br />
</html><br />
<br />
== Activation of transcription ==<br />
----<br />
<html><br />
<br><br />
<div align="justify">To show that our TAL effectors are actually working, we used our completed toolkit to produce a TAL protein which is fused to a VP64 transcription factor. With this TAL-TF construct we targeted a sequence upstream of a minimal promotor that controls transcription of the enzyme secreted alkaline phosphatase (SEAP).In theory, the TAL domain should bring the fused VP64 domain in close proximity to the minimal promotor to activate the transcription of the repoter gene SEAP. The phosphatase is secreted an acummulates in the cell culture media. After 24 and 48 hours, we took samples from the media, stored them at -20°C, and subjected them two to photometric analysis.<br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/84/IGEMres4.png" width="400px" hspace="20" vspace="20" alt="SEAP essay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br><br><br />
As it is observable in the graph, co-transfection of cells with TAL and SEAP plasmids(++) yielded a high increase in SEAP activity, compared to the control samples. Also the control experiment with a TAL-VP64 targeting a random sequence shows the specificity of our system. The graph shows the average value of three biological replicates with its standard deviation. We further performed a t-test (Table) to prove if our experiment is statistically significant. As it is clearly observable, the p-values range below a value of 0,05, which indicates that our TAL transcription factor is able to elevate the transcription of the SEAP gene in a statistically significant manner.<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/Igemres-p.png" width="400px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br />
After addition of pNPP, the substrate of SEAP, the activity of SEAP was measured over a period of time. In the next image, the results of the first nine minutes of this measurement are shown. After this time, the OD of the double transfection (++) rose too high to be measured by our photometer. As it is clearly visible, the sample with the double transfection shows a profound increase in the OD. This points to the fact that great amounts of SEAP have been secreted into the cell culture media due to elevated gene expression. In the other samples almost no SEAP activity was measureable. The sample transfected with only the SEAP plasmid showed the highest OD but this effect was not statistically significant (p-value:0,25/0,51).<br />
<br><br />
In the samples, that had been taken 48h after double transfection, the same effects could be demonstrated. <br />
<br><br />
Furthermore, we reapeated the same experiment for a second time. The corresponding data can be viewed here: <html><div style=text-indent:0px><a href="https://static.igem.org/mediawiki/2012/9/9c/Second_Essay.pdf">Second Experiment.</a><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/TALTF-SEAP-TIME.png" align="middle" width="500px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:120px"/><br />
</html><br />
<br />
<br><br><br><br />
== Reference ==<br />
1. Briggs, A. W. et al. Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. ''Nucl Acids Res'' (2012).doi:10.1093/nar/gks624<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Luboehttp://2012.igem.org/Team:Freiburg/Project/OverviewTeam:Freiburg/Project/Overview2012-10-27T00:05:33Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= The GATE Assembly Kit =<br />
----<br />
<br><br />
<div align="justify">TALEs make sequence-specific genome modification much easier than before and therefore attract great interest in the synbio community and beyond. Interestingly, many of the researchers who hold the patents on TALEs also released open source toolkits for TALE assembly for academic research. However, most strategies of TALE gene assembly published thus far rely on a hierarchical procedure, that is very time consuming, laborious and not automatable.<br />
Therefore, we herein describe the Golden Gate cloning-based TAL Effector (GATE) Assembly platform, which enables literally everyone to produce low-cost, tailored TALEs within a few minutes of labwork and basic lab equipment. Moreover, we have automated this strategy and produced different TAL Effector Transcription Factors with 97 % success rate faster than any other method published before.<br />
<br><br />
<br />
<br />
== Review of existing TALE construction methods ==<br />
<br><br />
<div align="justify"><br />
Although TALE assembly is considerably easier than e.g. screening for novel zinc fingers, the highly repetitive structure of the TALE gene implies some challenges, because conventional PCR or homologous recombination-based gene assembly strategies cannot be applied.<br />
To our knowledge, the numerous approaches of TAL-Effector gene assembly, published so far, fall under the following three categories:<br />
<br />
<br />
1. Few groups have applied methods called unit assembly<sup>1</sup> or Restriction Enzyme And Ligation (REAL)<sup>2</sup>. In the first step, both strategies perform conventional restriction enzyme digestion in order to assemble two gene fragments of single repeats. The pairs of repeat gene fragments are subsequently assembled to form tetramers, and this highly hierarchical assembly strategy is continued until the desired number of repeats is assembled. These platforms obviously involve multiple laborious and time consuming rounds of digestion, ligation and isolation of the right ligation products. The recently published fast ligation-based automatable solid-phase high-throughput (FLASH) system circumvents major challenges of REAL by attaching the first repeat to streptavidin-coated magnetic beads and, successively, adding further repeats or oligorepeats from a 376-plasmid library. Although Reyon et al.<sup>11</sup> claim that FLASH can also be performed manually, this probably does not represent the most convenient and low-cost protocol for iGEM students.<br />
<br />
<br />
2. We call the second category of TALE production methods the synthesis optimization approach. The major challenge of TAL synthesis is the highly repetitive amino acid sequence of the DNA binding part. Since synthetic genes are typically produced from overlapping synthesized oligos, overlaps of different pairs of overlapping oligos need to be distinct. The synthesis optimization approach employs a sophisticated computer program that optimizes codon usage in order to reduce repetitiveness of the TAL gene and calculates optimal oligos for synthesis<sup>3,4</sup>. Although this approach might be the method of the future, it is currently too expensive for iGEM teams. <br />
<br />
<br />
3. The third category of TALE assembly protocols applies Golden Gate Cloning (GGC)<sup>5,6,7,8,9</sup> (for details on GGC, see the [[Team:Freiburg/Project/Golden#GGC|Golden Gate Standard page]]). In all GGC-based TALE repeat assembly strategies, level 1 modules (i.e. single repeat gene fragments) are flanked by type IIs restriction sites adjacent to their first or last 4 nucleotides, respectively, that produce sticky ends after digestion with the type IIs restriction enzyme. Since each level 1 module codes for the same amino acid sequence (despite of the RVDs), the codon usage must be changed at these 4 external nucleotides for producing unique sticky ends that assemble in the predefined order after digestion. Consequently, the 4 bp overlaps of a level 1 module specify its future position within the TALE gene.<br />
So, in order to be able to target any sequence of DNA, a method that is using GGC requires N x K modules. N signifies the number of level 1 module positions (i.e. number of modules that the TALE should contain after GGC) and K signifies the number of different repeats that the user should be able to put into each of the N positions (in most kits K equals 4, one repeat for each DNA base, see figure 1).<br />
Unfortunately, using GGC, only up to 10 modules <sup>5</sup> can be assembled with high accuracy. So in the GGC-based protocols, level 1 modules get assembled to form level 2 modules (oligorepeats). These level 2 modules need to be amplified and isolated before a second GGC reaction assembles them to form the complete repeat array. The bottleneck of the GGC-based methods is the need for amplification and isolation of level 2 modules, which costs a lot of time, requires some extra knowledge, additional enzymes and lab equipment (we actually tried one of the GGC-based open source kits, but, even after 2.5 weeks, were not able to assemble the whole TALE).<br><br><br />
<br />
<br />
<br />
== GATE Assembly Kit ==<br />
<br />
<br><br />
<div align="justify">Right from the beginning, we were very much intrigued by the efficiency of Golden Gate Cloning and hypothesized, that instant TAL assembly would be possible if we overcame the need for a second (or even third) round of GGC. Since we were sure we were not able to improve GGC reaction conditions so much that we could actually assemble all repeats at once, we came up with another solution: Why not use direpeats instead of single repeats as level 1 modules? This would cut the number of level 1 modules half and allow us to perform TAL assembly in one single reaction. Unfortunately, our idea would not only cut half N but would also quadruple M, and thus would double the toolkit size.<br />
<br><br />
<br />
[[Image:Synthese_3.png|200px|center|no frame|link=]]<br />
<br />
<br><br />
So we needed to further reduce N down to 6 to obtain a reasonable toolkit size of 96 level 1 modules. We actually liked the idea that our kit would perfectly fit on a 96 well plate.<br />
<br><br><br />
<br />
[[Image:Toolkit.png|700px|center|no frame|link=]]<br />
<br />
<br><br />
Next, we looked into the literature to check, if TALEs that recognize 14 bp (instead of around 18 bp) are actually functional. We were very fortunate to see that efficiency of TAL transcription factors (TAL-TFs) <sup>10 </sup> and TAL effector nucleases (TALENs)<sup>11 </sup> remains constant between for target sequences between 13 and 20 bp. Moreover, Zhang et al. published splendid results with 14 bp-binding TAL-TFs in a human cell line<sup>7</sup>. <br />
Since we wanted our TALEs to function in both bacteria and eukaryotic systems, while published TAL repeats were always designed for one particular organism, we decided to design the direpeat nucleotide sequences from scratch: We used the amino acid sequence of the hex3 gene of Xanthomonas oryzae to find out the amino acid sequences for the 16 direpeats. Next, we reverse-tanslated the sequences into DNA, codon optimized them for E.coli and human cells and reduced homologies between and within gene fragments (only the extention PCR binding sites were the same for every direpeat gene).<br />
After receiving the sequences that were synthesized as G-blocks by IDT, we performed 6 extention PCRs on every sequence to add 4 bp overlaps, BsmBI restriction sites and iGEM prefix and suffix to the parts. The 4 bp overlaps would later determine the position of the respective direpeat in the repeat array of the TALE.<br />
<br><br><br />
<br />
[[Image:Biobrickfreigem.png|500px|center|no frame|link=]]<br />
<br><br><br><br><br />
<br />
[[Image:Extension3.png|600px|center|no frame|link=]]<br />
<br />
<br><br />
One of the advantages of GGC is that you can insert complete plasmids containing the parts you want to assemble. So we decided to clone all 96 parts into the standard iGEM vector pSB1C3. We hypothesized that the BsmBI restriction site in the chloramphenicol gene would decrease GGC efficiency, so we performed a mutagenesis PCR to introduce the silent mutation (G434C) prior to cloning the 96 PCR products into it. When doing so many cloning experiments at a time, error rate needs to be minimal, so at first, we spent weeks optimizing every single step from the G-block to the Golden Gate standard compatible BioBrick (see [[Team:Freiburg/Project/Golden#GGC|protocol section]]). In the end, we are very happy that we have a full GATE assembly kit with [[Team:Freiburg/Parts|96 unique direpeats]] and 100% accurate sequencing results.<br />
Our first attempts to use the GATE assembly kit were actually very discouraging - no colonies were found on the agar plates after transforming the GGC product into DH10B cells for more than one week - at least, we knew that our ccdb kill cassette was working well (details about the <html><a href="https://2012.igem.org/Team:Freiburg/Project/Vektor">expression vector</a></html>). After systematically testing all kinds of buffers and reaction additives, the results where quite overwhelming. We were even able to dramatically reduce GGC reaction time down to 2.5 hours - which is probably the fastest way anyone has ever built a custom tal effector.<br />
<br />
<br><br><br />
<br />
== References ==<br />
<br><br />
1. Huang, P. et al. Heritable gene targeting in zebrafish using customized TALENs. ''Nat Biotechnol'' 29, 699–700 (2011).<br><br />
2. Sander, J. D. et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. ''Nat Biotechnol 2''9, 697–698 (2011).<br><br />
3. Hoover, D. M. & Lubkowski, J. DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis. ''Nucl Acids Res'' 30, e43–e43 (2002).<br><br />
4. Miller, J. C. et al. A TALE nuclease architecture for efficient genome editing. ''Nat Biotechnol'' 29, 143–148 (2010).<br><br />
5. Morbitzer, R., Elsaesser, J., Hausner, J. & Lahaye, T. Assembly of Custom TALE-Type DNA Binding Domains by Modular Cloning. ''Nucl Acids Res'' 39, 5790–5799 (2011).<br><br />
6. Weber, E., Gruetzner, R., Werner, S., Engler, C. & Marillonnet, S. Assembly of designer TAL effectors by golden gate cloning. ''PloS one'' 6, e19722 (2011).<br><br />
7. Zhang, F. et al. Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. ''Nat Biotechnol'' 29, 149–153 (2011).<br><br />
8. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucl Acids Res'' 39, e82 (2011).<br><br />
9. Li, T. et al. Modularly Assembled Designer TAL Effector Nucleases for Targeted Gene Knockout and Gene Replacement in Eukaryotes. ''Nucl Acids Res'' 39, 6315–6325 (2011).<br><br />
10. Boch, J. et al. Breaking the Code of DNA Binding Specificity of TAL-Type III Effectors. ''Science'' 326, 1509–1512 (2009).<br><br />
11. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nat Biotechnol'' 30, 460–465 (2012).<br />
<br />
<br />
<br />
<br />
<br><br><br />
[[#top|Back to top]]<br />
<!--- The Mission, Experiments ---></div>Luboehttp://2012.igem.org/Team:Freiburg/Project/OverviewTeam:Freiburg/Project/Overview2012-10-27T00:05:16Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= The GATE Assembly Kit =<br />
----<br />
<br><br />
<div align="justify">TALEs make sequence-specific genome modification much easier than before and therefore attract great interest in the synbio community and beyond. Interestingly, many of the researchers who hold the patents on TALEs also released open source toolkits for TALE assembly for academic research. However, most strategies of TALE gene assembly published thus far rely on a hierarchical procedure, that is very time consuming, laborious and not automatable.<br />
Therefore, we herein describe the Golden Gate cloning-based TAL Effector (GATE) Assembly platform, which enables literally everyone to produce low-cost, tailored TALEs within a few minutes of labwork and basic lab equipment. Moreover, we have automated this strategy and produced different TAL Effector Transcription Factors with 97 % success rate faster than any other method published before.<br />
<br><br />
<br />
<br />
== Review of existing TALE construction methods ==<br />
<br><br />
<div align="justify"><br />
Although TALE assembly is considerably easier than e.g. screening for novel zinc fingers, the highly repetitive structure of the TALE gene implies some challenges, because conventional PCR or homologous recombination-based gene assembly strategies cannot be applied.<br />
To our knowledge, the numerous approaches of TAL-Effector gene assembly, published so far, fall under the following three categories:<br />
<br />
<br />
1. Few groups have applied methods called unit assembly<sup>1</sup> or Restriction Enzyme And Ligation (REAL)<sup>2</sup>. In the first step, both strategies perform conventional restriction enzyme digestion in order to assemble two gene fragments of single repeats. The pairs of repeat gene fragments are subsequently assembled to form tetramers, and this highly hierarchical assembly strategy is continued until the desired number of repeats is assembled. These platforms obviously involve multiple laborious and time consuming rounds of digestion, ligation and isolation of the right ligation products. The recently published fast ligation-based automatable solid-phase high-throughput (FLASH) system circumvents major challenges of REAL by attaching the first repeat to streptavidin-coated magnetic beads and, successively, adding further repeats or oligorepeats from a 376-plasmid library. Although Reyon et al.<sup>11</sup> claim that FLASH can also be performed manually, this probably does not represent the most convenient and low-cost protocol for iGEM students.<br />
<br />
<br />
2. We call the second category of TALE production methods the synthesis optimization approach. The major challenge of TAL synthesis is the highly repetitive amino acid sequence of the DNA binding part. Since synthetic genes are typically produced from overlapping synthesized oligos, overlaps of different pairs of overlapping oligos need to be distinct. The synthesis optimization approach employs a sophisticated computer program that optimizes codon usage in order to reduce repetitiveness of the TAL gene and calculates optimal oligos for synthesis<sup>3,4</sup>. Although this approach might be the method of the future, it is currently too expensive for iGEM teams. <br />
<br />
<br />
3. The third category of TALE assembly protocols applies Golden Gate Cloning (GGC)<sup>5,6,7,8,9</sup> (for details on GGC, see the [[Team:Freiburg/Project/Golden#GGC|Golden Gate Standard page]]). In all GGC-based TALE repeat assembly strategies, level 1 modules (i.e. single repeat gene fragments) are flanked by type IIs restriction sites adjacent to their first or last 4 nucleotides, respectively, that produce sticky ends after digestion with the type IIs restriction enzyme. Since each level 1 module codes for the same amino acid sequence (despite of the RVDs), the codon usage must be changed at these 4 external nucleotides for producing unique sticky ends that assemble in the predefined order after digestion. Consequently, the 4 bp overlaps of a level 1 module specify its future position within the TALE gene.<br />
So, in order to be able to target any sequence of DNA, a method that is using GGC requires N x K modules. N signifies the number of level 1 module positions (i.e. number of modules that the TALE should contain after GGC) and K signifies the number of different repeats that the user should be able to put into each of the N positions (in most kits K equals 4, one repeat for each DNA base, see figure 1).<br />
Unfortunately, using GGC, only up to 10 modules <sup>5</sup> can be assembled with high accuracy. So in the GGC-based protocols, level 1 modules get assembled to form level 2 modules (oligorepeats). These level 2 modules need to be amplified and isolated before a second GGC reaction assembles them to form the complete repeat array. The bottleneck of the GGC-based methods is the need for amplification and isolation of level 2 modules, which costs a lot of time, requires some extra knowledge, additional enzymes and lab equipment (we actually tried one of the GGC-based open source kits, but, even after 2.5 weeks, were not able to assemble the whole TALE).<br><br><br />
<br />
== GATE Assembly Kit ==<br />
<br />
<br><br />
<div align="justify">Right from the beginning, we were very much intrigued by the efficiency of Golden Gate Cloning and hypothesized, that instant TAL assembly would be possible if we overcame the need for a second (or even third) round of GGC. Since we were sure we were not able to improve GGC reaction conditions so much that we could actually assemble all repeats at once, we came up with another solution: Why not use direpeats instead of single repeats as level 1 modules? This would cut the number of level 1 modules half and allow us to perform TAL assembly in one single reaction. Unfortunately, our idea would not only cut half N but would also quadruple M, and thus would double the toolkit size.<br />
<br><br />
<br />
[[Image:Synthese_3.png|200px|center|no frame|link=]]<br />
<br />
<br><br />
So we needed to further reduce N down to 6 to obtain a reasonable toolkit size of 96 level 1 modules. We actually liked the idea that our kit would perfectly fit on a 96 well plate.<br />
<br><br><br />
<br />
[[Image:Toolkit.png|700px|center|no frame|link=]]<br />
<br />
<br><br />
Next, we looked into the literature to check, if TALEs that recognize 14 bp (instead of around 18 bp) are actually functional. We were very fortunate to see that efficiency of TAL transcription factors (TAL-TFs) <sup>10 </sup> and TAL effector nucleases (TALENs)<sup>11 </sup> remains constant between for target sequences between 13 and 20 bp. Moreover, Zhang et al. published splendid results with 14 bp-binding TAL-TFs in a human cell line<sup>7</sup>. <br />
Since we wanted our TALEs to function in both bacteria and eukaryotic systems, while published TAL repeats were always designed for one particular organism, we decided to design the direpeat nucleotide sequences from scratch: We used the amino acid sequence of the hex3 gene of Xanthomonas oryzae to find out the amino acid sequences for the 16 direpeats. Next, we reverse-tanslated the sequences into DNA, codon optimized them for E.coli and human cells and reduced homologies between and within gene fragments (only the extention PCR binding sites were the same for every direpeat gene).<br />
After receiving the sequences that were synthesized as G-blocks by IDT, we performed 6 extention PCRs on every sequence to add 4 bp overlaps, BsmBI restriction sites and iGEM prefix and suffix to the parts. The 4 bp overlaps would later determine the position of the respective direpeat in the repeat array of the TALE.<br />
<br><br><br />
<br />
[[Image:Biobrickfreigem.png|500px|center|no frame|link=]]<br />
<br><br><br><br><br />
<br />
[[Image:Extension3.png|600px|center|no frame|link=]]<br />
<br />
<br><br />
One of the advantages of GGC is that you can insert complete plasmids containing the parts you want to assemble. So we decided to clone all 96 parts into the standard iGEM vector pSB1C3. We hypothesized that the BsmBI restriction site in the chloramphenicol gene would decrease GGC efficiency, so we performed a mutagenesis PCR to introduce the silent mutation (G434C) prior to cloning the 96 PCR products into it. When doing so many cloning experiments at a time, error rate needs to be minimal, so at first, we spent weeks optimizing every single step from the G-block to the Golden Gate standard compatible BioBrick (see [[Team:Freiburg/Project/Golden#GGC|protocol section]]). In the end, we are very happy that we have a full GATE assembly kit with [[Team:Freiburg/Parts|96 unique direpeats]] and 100% accurate sequencing results.<br />
Our first attempts to use the GATE assembly kit were actually very discouraging - no colonies were found on the agar plates after transforming the GGC product into DH10B cells for more than one week - at least, we knew that our ccdb kill cassette was working well (details about the <html><a href="https://2012.igem.org/Team:Freiburg/Project/Vektor">expression vector</a></html>). After systematically testing all kinds of buffers and reaction additives, the results where quite overwhelming. We were even able to dramatically reduce GGC reaction time down to 2.5 hours - which is probably the fastest way anyone has ever built a custom tal effector.<br />
<br />
<br><br><br />
<br />
== References ==<br />
<br><br />
1. Huang, P. et al. Heritable gene targeting in zebrafish using customized TALENs. ''Nat Biotechnol'' 29, 699–700 (2011).<br><br />
2. Sander, J. D. et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. ''Nat Biotechnol 2''9, 697–698 (2011).<br><br />
3. Hoover, D. M. & Lubkowski, J. DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis. ''Nucl Acids Res'' 30, e43–e43 (2002).<br><br />
4. Miller, J. C. et al. A TALE nuclease architecture for efficient genome editing. ''Nat Biotechnol'' 29, 143–148 (2010).<br><br />
5. Morbitzer, R., Elsaesser, J., Hausner, J. & Lahaye, T. Assembly of Custom TALE-Type DNA Binding Domains by Modular Cloning. ''Nucl Acids Res'' 39, 5790–5799 (2011).<br><br />
6. Weber, E., Gruetzner, R., Werner, S., Engler, C. & Marillonnet, S. Assembly of designer TAL effectors by golden gate cloning. ''PloS one'' 6, e19722 (2011).<br><br />
7. Zhang, F. et al. Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. ''Nat Biotechnol'' 29, 149–153 (2011).<br><br />
8. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucl Acids Res'' 39, e82 (2011).<br><br />
9. Li, T. et al. Modularly Assembled Designer TAL Effector Nucleases for Targeted Gene Knockout and Gene Replacement in Eukaryotes. ''Nucl Acids Res'' 39, 6315–6325 (2011).<br><br />
10. Boch, J. et al. Breaking the Code of DNA Binding Specificity of TAL-Type III Effectors. ''Science'' 326, 1509–1512 (2009).<br><br />
11. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nat Biotechnol'' 30, 460–465 (2012).<br />
<br />
<br />
<br />
<br />
<br><br><br />
[[#top|Back to top]]<br />
<!--- The Mission, Experiments ---></div>Luboehttp://2012.igem.org/Team:Freiburg/Project/OverviewTeam:Freiburg/Project/Overview2012-10-27T00:04:43Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= The GATE Assembly Kit =<br />
----<br />
<br><br />
<div align="justify">TALEs make sequence-specific genome modification much easier than before and therefore attract great interest in the synbio community and beyond. Interestingly, many of the researchers who hold the patents on TALEs also released open source toolkits for TALE assembly for academic research. However, most strategies of TALE gene assembly published thus far rely on a hierarchical procedure, that is very time consuming, laborious and not automatable.<br />
Therefore, we herein describe the Golden Gate cloning-based TAL Effector (GATE) Assembly platform, which enables literally everyone to produce low-cost, tailored TALEs within a few minutes of labwork and basic lab equipment. Moreover, we have automated this strategy and produced different TAL Effector Transcription Factors with 97 % success rate faster than any other method published before.<br />
<br><br />
<br />
<br />
== Review of existing TALE construction methods ==<br />
<br><br />
<div align="justify"><br />
Although TALE assembly is considerably easier than e.g. screening for novel zinc fingers, the highly repetitive structure of the TALE gene implies some challenges, because conventional PCR or homologous recombination-based gene assembly strategies cannot be applied.<br />
To our knowledge, the numerous approaches of TAL-Effector gene assembly, published so far, fall under the following three categories:<br />
<br />
<br />
1. Few groups have applied methods called unit assembly<sup>1</sup> or Restriction Enzyme And Ligation (REAL)<sup>2</sup>. In the first step, both strategies perform conventional restriction enzyme digestion in order to assemble two gene fragments of single repeats. The pairs of repeat gene fragments are subsequently assembled to form tetramers, and this highly hierarchical assembly strategy is continued until the desired number of repeats is assembled. These platforms obviously involve multiple laborious and time consuming rounds of digestion, ligation and isolation of the right ligation products. The recently published fast ligation-based automatable solid-phase high-throughput (FLASH) system circumvents major challenges of REAL by attaching the first repeat to streptavidin-coated magnetic beads and, successively, adding further repeats or oligorepeats from a 376-plasmid library. Although Reyon et al.<sup>11</sup> claim that FLASH can also be performed manually, this probably does not represent the most convenient and low-cost protocol for iGEM students.<br />
<br />
<br />
2. We call the second category of TALE production methods the synthesis optimization approach. The major challenge of TAL synthesis is the highly repetitive amino acid sequence of the DNA binding part. Since synthetic genes are typically produced from overlapping synthesized oligos, overlaps of different pairs of overlapping oligos need to be distinct. The synthesis optimization approach employs a sophisticated computer program that optimizes codon usage in order to reduce repetitiveness of the TAL gene and calculates optimal oligos for synthesis<sup>3,4</sup>. Although this approach might be the method of the future, it is currently too expensive for iGEM teams. <br />
<br />
<br />
3. The third category of TALE assembly protocols applies Golden Gate Cloning (GGC)<sup>5,6,7,8,9</sup> (for details on GGC, see the [[Team:Freiburg/Project/Golden#GGC|Golden Gate Standard page]]). In all GGC-based TALE repeat assembly strategies, level 1 modules (i.e. single repeat gene fragments) are flanked by type IIs restriction sites adjacent to their first or last 4 nucleotides, respectively, that produce sticky ends after digestion with the type IIs restriction enzyme. Since each level 1 module codes for the same amino acid sequence (despite of the RVDs), the codon usage must be changed at these 4 external nucleotides for producing unique sticky ends that assemble in the predefined order after digestion. Consequently, the 4 bp overlaps of a level 1 module specify its future position within the TALE gene.<br />
So, in order to be able to target any sequence of DNA, a method that is using GGC requires N x K modules. N signifies the number of level 1 module positions (i.e. number of modules that the TALE should contain after GGC) and K signifies the number of different repeats that the user should be able to put into each of the N positions (in most kits K equals 4, one repeat for each DNA base, see figure 1).<br />
Unfortunately, using GGC, only up to 10 modules <sup>5</sup> can be assembled with high accuracy. So in the GGC-based protocols, level 1 modules get assembled to form level 2 modules (oligorepeats). These level 2 modules need to be amplified and isolated before a second GGC reaction assembles them to form the complete repeat array. The bottleneck of the GGC-based methods is the need for amplification and isolation of level 2 modules, which costs a lot of time, requires some extra knowledge, additional enzymes and lab equipment (we actually tried one of the GGC-based open source kits, but, even after 2.5 weeks, were not able to assemble the whole TALE).<br><br><br />
<br />
== GATE Assembly Kit ==<br />
----<br />
<br><br />
<div align="justify">Right from the beginning, we were very much intrigued by the efficiency of Golden Gate Cloning and hypothesized, that instant TAL assembly would be possible if we overcame the need for a second (or even third) round of GGC. Since we were sure we were not able to improve GGC reaction conditions so much that we could actually assemble all repeats at once, we came up with another solution: Why not use direpeats instead of single repeats as level 1 modules? This would cut the number of level 1 modules half and allow us to perform TAL assembly in one single reaction. Unfortunately, our idea would not only cut half N but would also quadruple M, and thus would double the toolkit size.<br />
<br><br />
<br />
[[Image:Synthese_3.png|200px|center|no frame|link=]]<br />
<br />
<br><br />
So we needed to further reduce N down to 6 to obtain a reasonable toolkit size of 96 level 1 modules. We actually liked the idea that our kit would perfectly fit on a 96 well plate.<br />
<br><br><br />
<br />
[[Image:Toolkit.png|700px|center|no frame|link=]]<br />
<br />
<br><br />
Next, we looked into the literature to check, if TALEs that recognize 14 bp (instead of around 18 bp) are actually functional. We were very fortunate to see that efficiency of TAL transcription factors (TAL-TFs) <sup>10 </sup> and TAL effector nucleases (TALENs)<sup>11 </sup> remains constant between for target sequences between 13 and 20 bp. Moreover, Zhang et al. published splendid results with 14 bp-binding TAL-TFs in a human cell line<sup>7</sup>. <br />
Since we wanted our TALEs to function in both bacteria and eukaryotic systems, while published TAL repeats were always designed for one particular organism, we decided to design the direpeat nucleotide sequences from scratch: We used the amino acid sequence of the hex3 gene of Xanthomonas oryzae to find out the amino acid sequences for the 16 direpeats. Next, we reverse-tanslated the sequences into DNA, codon optimized them for E.coli and human cells and reduced homologies between and within gene fragments (only the extention PCR binding sites were the same for every direpeat gene).<br />
After receiving the sequences that were synthesized as G-blocks by IDT, we performed 6 extention PCRs on every sequence to add 4 bp overlaps, BsmBI restriction sites and iGEM prefix and suffix to the parts. The 4 bp overlaps would later determine the position of the respective direpeat in the repeat array of the TALE.<br />
<br><br><br />
<br />
[[Image:Biobrickfreigem.png|500px|center|no frame|link=]]<br />
<br><br><br><br><br />
<br />
[[Image:Extension3.png|600px|center|no frame|link=]]<br />
<br />
<br><br />
One of the advantages of GGC is that you can insert complete plasmids containing the parts you want to assemble. So we decided to clone all 96 parts into the standard iGEM vector pSB1C3. We hypothesized that the BsmBI restriction site in the chloramphenicol gene would decrease GGC efficiency, so we performed a mutagenesis PCR to introduce the silent mutation (G434C) prior to cloning the 96 PCR products into it. When doing so many cloning experiments at a time, error rate needs to be minimal, so at first, we spent weeks optimizing every single step from the G-block to the Golden Gate standard compatible BioBrick (see [[Team:Freiburg/Project/Golden#GGC|protocol section]]). In the end, we are very happy that we have a full GATE assembly kit with [[Team:Freiburg/Parts|96 unique direpeats]] and 100% accurate sequencing results.<br />
Our first attempts to use the GATE assembly kit were actually very discouraging - no colonies were found on the agar plates after transforming the GGC product into DH10B cells for more than one week - at least, we knew that our ccdb kill cassette was working well (details about the <html><a href="https://2012.igem.org/Team:Freiburg/Project/Vektor">expression vector</a></html>). After systematically testing all kinds of buffers and reaction additives, the results where quite overwhelming. We were even able to dramatically reduce GGC reaction time down to 2.5 hours - which is probably the fastest way anyone has ever built a custom tal effector.<br />
<br />
<br><br><br />
<br />
== References ==<br />
<br><br />
1. Huang, P. et al. Heritable gene targeting in zebrafish using customized TALENs. ''Nat Biotechnol'' 29, 699–700 (2011).<br><br />
2. Sander, J. D. et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. ''Nat Biotechnol 2''9, 697–698 (2011).<br><br />
3. Hoover, D. M. & Lubkowski, J. DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis. ''Nucl Acids Res'' 30, e43–e43 (2002).<br><br />
4. Miller, J. C. et al. A TALE nuclease architecture for efficient genome editing. ''Nat Biotechnol'' 29, 143–148 (2010).<br><br />
5. Morbitzer, R., Elsaesser, J., Hausner, J. & Lahaye, T. Assembly of Custom TALE-Type DNA Binding Domains by Modular Cloning. ''Nucl Acids Res'' 39, 5790–5799 (2011).<br><br />
6. Weber, E., Gruetzner, R., Werner, S., Engler, C. & Marillonnet, S. Assembly of designer TAL effectors by golden gate cloning. ''PloS one'' 6, e19722 (2011).<br><br />
7. Zhang, F. et al. Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. ''Nat Biotechnol'' 29, 149–153 (2011).<br><br />
8. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucl Acids Res'' 39, e82 (2011).<br><br />
9. Li, T. et al. Modularly Assembled Designer TAL Effector Nucleases for Targeted Gene Knockout and Gene Replacement in Eukaryotes. ''Nucl Acids Res'' 39, 6315–6325 (2011).<br><br />
10. Boch, J. et al. Breaking the Code of DNA Binding Specificity of TAL-Type III Effectors. ''Science'' 326, 1509–1512 (2009).<br><br />
11. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nat Biotechnol'' 30, 460–465 (2012).<br />
<br />
<br />
<br />
<br />
<br><br><br />
[[#top|Back to top]]<br />
<!--- The Mission, Experiments ---></div>Luboehttp://2012.igem.org/Team:Freiburg/Project/OverviewTeam:Freiburg/Project/Overview2012-10-27T00:04:12Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= The GATE Assembly Kit =<br />
----<br />
<br><br />
<div align="justify">TALEs make sequence-specific genome modification much easier than before and therefore attract great interest in the synbio community and beyond. Interestingly, many of the researchers who hold the patents on TALEs also released open source toolkits for TALE assembly for academic research. However, most strategies of TALE gene assembly published thus far rely on a hierarchical procedure, that is very time consuming, laborious and not automatable.<br />
Therefore, we herein describe the Golden Gate cloning-based TAL Effector (GATE) Assembly platform, which enables literally everyone to produce low-cost, tailored TALEs within a few minutes of labwork and basic lab equipment. Moreover, we have automated this strategy and produced different TAL Effector Transcription Factors with 97 % success rate faster than any other method published before.<br />
<br><br />
<br />
<br />
== Review of existing TALE construction methods ==<br />
<br><br />
<div align="justify"><br />
Although TALE assembly is considerably easier than e.g. screening for novel zinc fingers, the highly repetitive structure of the TALE gene implies some challenges, because conventional PCR or homologous recombination-based gene assembly strategies cannot be applied.<br />
To our knowledge, the numerous approaches of TAL-Effector gene assembly, published so far, fall under the following three categories:<br />
<br />
<br />
1. Few groups have applied methods called unit assembly<sup>1</sup> or Restriction Enzyme And Ligation (REAL)<sup>2</sup>. In the first step, both strategies perform conventional restriction enzyme digestion in order to assemble two gene fragments of single repeats. The pairs of repeat gene fragments are subsequently assembled to form tetramers, and this highly hierarchical assembly strategy is continued until the desired number of repeats is assembled. These platforms obviously involve multiple laborious and time consuming rounds of digestion, ligation and isolation of the right ligation products. The recently published fast ligation-based automatable solid-phase high-throughput (FLASH) system circumvents major challenges of REAL by attaching the first repeat to streptavidin-coated magnetic beads and, successively, adding further repeats or oligorepeats from a 376-plasmid library. Although Reyon et al.<sup>11</sup> claim that FLASH can also be performed manually, this probably does not represent the most convenient and low-cost protocol for iGEM students.<br />
<br />
<br />
2. We call the second category of TALE production methods the synthesis optimization approach. The major challenge of TAL synthesis is the highly repetitive amino acid sequence of the DNA binding part. Since synthetic genes are typically produced from overlapping synthesized oligos, overlaps of different pairs of overlapping oligos need to be distinct. The synthesis optimization approach employs a sophisticated computer program that optimizes codon usage in order to reduce repetitiveness of the TAL gene and calculates optimal oligos for synthesis<sup>3,4</sup>. Although this approach might be the method of the future, it is currently too expensive for iGEM teams. <br />
<br />
<br />
3. The third category of TALE assembly protocols applies Golden Gate Cloning (GGC)<sup>5,6,7,8,9</sup> (for details on GGC, see the [[Team:Freiburg/Project/Golden#GGC|Golden Gate Standard page]]). In all GGC-based TALE repeat assembly strategies, level 1 modules (i.e. single repeat gene fragments) are flanked by type IIs restriction sites adjacent to their first or last 4 nucleotides, respectively, that produce sticky ends after digestion with the type IIs restriction enzyme. Since each level 1 module codes for the same amino acid sequence (despite of the RVDs), the codon usage must be changed at these 4 external nucleotides for producing unique sticky ends that assemble in the predefined order after digestion. Consequently, the 4 bp overlaps of a level 1 module specify its future position within the TALE gene.<br />
So, in order to be able to target any sequence of DNA, a method that is using GGC requires N x K modules. N signifies the number of level 1 module positions (i.e. number of modules that the TALE should contain after GGC) and K signifies the number of different repeats that the user should be able to put into each of the N positions (in most kits K equals 4, one repeat for each DNA base, see figure 1).<br />
Unfortunately, using GGC, only up to 10 modules <sup>5</sup> can be assembled with high accuracy. So in the GGC-based protocols, level 1 modules get assembled to form level 2 modules (oligorepeats). These level 2 modules need to be amplified and isolated before a second GGC reaction assembles them to form the complete repeat array. The bottleneck of the GGC-based methods is the need for amplification and isolation of level 2 modules, which costs a lot of time, requires some extra knowledge, additional enzymes and lab equipment (we actually tried one of the GGC-based open source kits, but, even after 2.5 weeks, were not able to assemble the whole TALE).<br><br><br />
<br />
== GATE Assembly Kit ==<br />
----<br />
<br><br />
<div align="justify">Right from the beginning, we were very much intrigued by the efficiency of Golden Gate Cloning and hypothesized, that instant TAL assembly would be possible if we overcame the need for a second (or even third) round of GGC. Since we were sure we were not able to improve GGC reaction conditions so much that we could actually assemble all repeats at once, we came up with another solution: Why not use direpeats instead of single repeats as level 1 modules? This would cut the number of level 1 modules half and allow us to perform TAL assembly in one single reaction. Unfortunately, our idea would not only cut half N but would also quadruple M, and thus would double the toolkit size.<br />
<br><br />
<br />
[[Image:Synthese_3.png|200px|center|no frame|link=]]<br />
<br />
<br><br />
So we needed to further reduce N down to 6 to obtain a reasonable toolkit size of 96 level 1 modules. We actually liked the idea that our kit would perfectly fit on a 96 well plate.<br />
<br><br><br />
<br />
[[Image:Toolkit.png|700px|center|no frame|link=]]<br />
<br />
<br><br />
Next, we looked into the literature to check, if TALEs that recognize 14 bp (instead of around 18 bp) are actually functional. We were very fortunate to see that efficiency of TAL transcription factors (TAL-TFs) <sup>10 </sup> and TAL effector nucleases (TALENs)<sup>11 </sup> remains constant between for target sequences between 13 and 20 bp. Moreover, Zhang et al. published splendid results with 14 bp-binding TAL-TFs in a human cell line<sup>7</sup>. <br />
Since we wanted our TALEs to function in both bacteria and eukaryotic systems, while published TAL repeats were always designed for one particular organism, we decided to design the direpeat nucleotide sequences from scratch: We used the amino acid sequence of the hex3 gene of Xanthomonas oryzae to find out the amino acid sequences for the 16 direpeats. Next, we reverse-tanslated the sequences into DNA, codon optimized them for E.coli and human cells and reduced homologies between and within gene fragments (only the extention PCR binding sites were the same for every direpeat gene).<br />
After receiving the sequences that were synthesized as G-blocks by IDT, we performed 6 extention PCRs on every sequence to add 4 bp overlaps, BsmBI restriction sites and iGEM prefix and suffix to the parts. The 4 bp overlaps would later determine the position of the respective direpeat in the repeat array of the TALE.<br />
<br><br><br />
<br />
[[Image:Biobrickfreigem.png|500px|center|no frame|link=]]<br />
<br><br><br><br><br />
<br />
[[Image:Extension3.png|600px|center|no frame|link=]]<br />
<br />
<br><br />
One of the advantages of GGC is that you can insert complete plasmids containing the parts you want to assemble. So we decided to clone all 96 parts into the standard iGEM vector pSB1C3. We hypothesized that the BsmBI restriction site in the chloramphenicol gene would decrease GGC efficiency, so we performed a mutagenesis PCR to introduce the silent mutation (G434C) prior to cloning the 96 PCR products into it. When doing so many cloning experiments at a time, error rate needs to be minimal, so at first, we spent weeks optimizing every single step from the G-block to the Golden Gate standard compatible BioBrick (see [[Team:Freiburg/Project/Golden#GGC|protocol section]]). In the end, we are very happy that we have a full GATE assembly kit with [[Team:Freiburg/Parts|96 unique direpeats]] and 100% accurate sequencing results.<br />
Our first attempts to use the GATE assembly kit were actually very discouraging - no colonies were found on the agar plates after transforming the GGC product into DH10B cells for more than one week - at least, we knew that our ccdb kill cassette was working well (details about the <html><a href="https://2012.igem.org/Team:Freiburg/Project/Vektor">expression vector</a></html>). After systematically testing all kinds of buffers and reaction additives, the results where quite overwhelming. We were even able to dramatically reduce GGC reaction time down to 2.5 hours - which is probably the fastest way anyone has ever built a custom tal effector.<br />
<br />
<br><br />
<br />
== References ==<br />
<br><br />
1. Huang, P. et al. Heritable gene targeting in zebrafish using customized TALENs. ''Nat Biotechnol'' 29, 699–700 (2011).<br><br />
2. Sander, J. D. et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. ''Nat Biotechnol 2''9, 697–698 (2011).<br><br />
3. Hoover, D. M. & Lubkowski, J. DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis. ''Nucl Acids Res'' 30, e43–e43 (2002).<br><br />
4. Miller, J. C. et al. A TALE nuclease architecture for efficient genome editing. ''Nat Biotechnol'' 29, 143–148 (2010).<br><br />
5. Morbitzer, R., Elsaesser, J., Hausner, J. & Lahaye, T. Assembly of Custom TALE-Type DNA Binding Domains by Modular Cloning. ''Nucl Acids Res'' 39, 5790–5799 (2011).<br><br />
6. Weber, E., Gruetzner, R., Werner, S., Engler, C. & Marillonnet, S. Assembly of designer TAL effectors by golden gate cloning. ''PloS one'' 6, e19722 (2011).<br><br />
7. Zhang, F. et al. Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. ''Nat Biotechnol'' 29, 149–153 (2011).<br><br />
8. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucl Acids Res'' 39, e82 (2011).<br><br />
9. Li, T. et al. Modularly Assembled Designer TAL Effector Nucleases for Targeted Gene Knockout and Gene Replacement in Eukaryotes. ''Nucl Acids Res'' 39, 6315–6325 (2011).<br><br />
10. Boch, J. et al. Breaking the Code of DNA Binding Specificity of TAL-Type III Effectors. ''Science'' 326, 1509–1512 (2009).<br><br />
11. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nat Biotechnol'' 30, 460–465 (2012).<br><br />
<br />
<br />
<br />
<br />
<br><br><br />
[[#top|Back to top]]<br />
<!--- The Mission, Experiments ---></div>Luboehttp://2012.igem.org/Team:Freiburg/Project/VektorTeam:Freiburg/Project/Vektor2012-10-27T00:03:30Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Creating the TAL Mammobrick vector =<br />
----<br />
<br />
<br />
<br />
== Introduction: ==<br />
<html><br />
<div align="justify">In nature, TALEs are injected into the host cells by plant pathogenic bacteria in order to modulate their gene expression. From the synthetic biologist’s point of view, this is very convenient because it implies that TALEs can be expressed in bacteria but also function in a eukaryotic system. We therefore provide plasmids for expression in either human cell lines or in bacteria.<br><br></html><br />
<br />
== Eukaryotic expression vector: ==<br />
<br />
<div align="justify">Since we wanted to express our TAL effectors in Human Embryonic Kidney (HEK) cells, we needed a eukaryotic expression vector. Unfortunately, the registry does not offer such a vector, so we decided to build one our own. In order to avoid intellectual property rights violations, we ordered the vector pTALEN (v2) NG (along with the Zhang Lab TALE Toolbox) from the open source plasmid repository [http://www.addgene.org/ Addgene]. The Zhang Lab at MIT has constructed this plasmid for TAL effector expression, so we decided that it would be a good template for our own vector. Converting pTALEN (v2) NG into a RFC10 compatible vector would have taken more mutagenesis PCRs than we would have been able to perform over the summer, so we chose the following two-step vector assembly strategy:</div><br><br><br />
<b>Step 1: Mammobrick</b><br />
<br><br><br />
In the first step, we wanted to built a universal mammalian expression vector (called MammoBrick), which would allows future iGEM students to express any gene in human cell lines simply by cloning the open reading frame into the MammoBrick using the BioBrick assembly protocol. We assembled the MammoBrick from the following four parts, essentially, using the protocol described [[Team:Freiburg/Project/Golden#GGC|here]]:<br><br><br />
:Part 1: '''BACKBONE''' <br>We have cut the backbone out of pTALEN (v2) NG with Ngo MIV and AfiII and purified the corresponding 2234bp band from a gel. Since both enzymes produce 5’ overhangs, they were compatible with overhangs produced by BsaI digestion. This backbone contains a SV 40 polyadenylation signal, an ampicillin resistance gene and an origin of replication.<br><br><br />
:Part2: '''CMV promoter'''<br>At first, we tried to use the CMV promotor that was included in the 2012 distribution kit. Part BBa_J52034 was submitted to the registry by Team Slovenia in 2006 and has been on the distribution kit since then (although sequencing was inconsistent every year). After numerous attempts to use this part, we sequenced it and found out that it was not a CMV promotor, but a part of the lacI gene. Reading the part’s review, we noticed that Team Munich 2010 had already pointed out that it was a lacI fragment. Interestingly, Team DTU Denmark was able to induce fluorescent protein expression with this bacterial gene fragment- magic. Since no other mammalian promoter was available on this year’s distribution kit, we designed the following primers and amplified the CMV promoter from the vector pPhi-Yellow-C:<br><br><br />
::::GTTACCGGTCTCGTTAAGAATTCGCGGCCGCTTCTAGAGATAGTAATCAATTACGGGGTC<br><br />
::::CTAGAGGTCTCGCTGCCTGCAGCGGCCGCTACTAGTAGATCTGACGGTTCACTAAAC<br><br><br />
:After amplifying the CMV promoter with these primers, the promoter is not only flanked by the iGEM prefix and suffix, but also by distal BsaI restriction sites. This way, we were able to directly assemble the PCR product with the other MammoBrick parts.<br><br><br />
:Part 3: '''PuroORF''' <br>We replaced the hygromycin resistance gene in pTALEN (v2) NG for two reasons: Firstly, it contained multiple iGEM restriction sites and secondly, selection via hygromycin takes much longer than selection with puromycin. Since we also didn’t find a puromycin ORF without illegal restriction sites, we decided to make silent mutations in the PuroORF to remove these sites and get it synthesized, flanked by BsaI restriction sites and appropriate overlaps for subsequent Golden Gate cloning.<br><br><br />
:Part 4: '''PostORF''' <br>We called the region between the stop codon of the TAL ORF and the start codon of the antibiotic resistance gene PostORF. We wanted to use this part in our vector because it contains the SV40 promoter and enhancer for expression of the antibiotic selection marker. So we used PCR to “excise the fragment and add BsaI sites and appropriate overlaps to it.<br><br><br />
:After every single part had been purified, we used Golden Gate cloning to assemble them in one step. After quite some testing, we came up with the following protocol:<br />
<br><br><br />
<br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>pTALEN (v2) NG backbone (56 ng)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>CMV promoter (17 ng)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>Post ORF (17,5 ng)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;11,5</td> <br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>BsaI (15 U)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>T4 Ligase buffer</td><td>&#160;2</td><br />
</tr><tr><br />
<td>Total</td><td>&#160;20</td> <br />
</tr></table></html><br />
<br />
<br />
<html><br />
<table align=right border=0 style="margin-right:150px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20 °C, 5 min</td><br />
</tr><tr><br />
<td>go to 1. 50 times</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br />
<br />
<br />
:So we assembled the whole MammoBrick vector in one single reaction:<br><br><br />
<html><img src="https://static.igem.org/mediawiki/2012/8/8d/Figure6T.png" width="450px" style="margin-left:150px"/></html><br />
<br />
<br><br><br />
<b>Step 2: Eukaryotic TALE expression vector:</b><br><br><br />
<br />
Once the MammoBrick was ready, we inserted the TAL open reading frame and thereby evaluated, how easy it would be for future iGEM students to expression any desired ORF in eukaryotic cells.<br><br><br />
<br />
:'''Designing the TAL open reading frame:'''<br><br />
:For this purpose, we designed a TAL ORF by adding the following modifications to the TAL open reading frame in pTALEN (v2) NG:<br><br><br />
:1. We removed all EcoRI, XbaI, SpeI, PstI, BsmBI, BbsI and PmeI restriction sites.<br><br />
:2. We replaced the BsaI restriction sites for inserting direpeats by BsmBI sites, because – according to the manufacturer - BsmBI is better suited for digest over one hour.<br><br />
:3. We added a consensus RBS in front of the ORF for expression in bacteria<br><br />
:4. We added a His-Tag to the n-terminal end to allow protein purification.<br><br />
:5. We flanked the whole sequence with the iGEM prefix and suffix.<br><br />
:6. Most importantly, we replaced the FokI nuclease at the C-terminal end of the protein by one of our inventions: The Plug and Play Effector Cassette.<br />
:This whole construct was synthesized by IDT.<br><br />
:'''Plug and Play Effecor Cassette:''' Our project was designed to enable future iGEM teams to easily use the powerful TALE technology. On top of that, we wanted to built a TALE platform which allows iGEM students to develop their own TAL constructs. We therefore invented the easy-to-use '''P'''lug and '''P'''lay '''E'''ffector '''C'''assette ('''PPEC'''), which can be used to fuse BioBricks, that are in the [[Team:Freiburg/Project/Golden|Golden Gate standard]], to the c-terminus of the TAL protein. <br><br />
[[File:Figure7_2.png|center|500px|link=]]<br><br />
:The PPEC consists of two BbsI binding sites that point in opposite directions. Digestion with BbsI leads to removal of the PPEC and to the formation of sticky ends at which the upstream sticky end (GGCA) is the last 4 nucleotides of the TAL protein and the downstream sticky end (TAAA) contains the stop codon. When an equimolar amount of the effector containing plasmid (flanked also by BbsI sites and the same overlaps) is added to the GGC mix, the effector is cut out of the iGEM vector and ligated into the eukaryotic TAL expression vector in-frame and without a scar. We have optimized this reaction by systematically testing different reaction buffers and thermocycler programs and came up with the following protocol:<br><br><br />
<br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;11,5</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts</td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:100px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20 °C, 5 min</td><br />
</tr><tr><br />
<td>go back to 1. 20 times</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 80°C, 10 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 4°C, ∞</td><br />
</tr></table><br><br><br><br><br><br><br><br><br><br><br><br></html><br />
<br />
:But even Golden Gate cloning is not 100 % efficient. In order to remove those plasmids that did not take up a vector insert, we added the restriction site of the blunt end cutter PmeI (MssI) to the PPEC. We chose PmeI because it has a 8 bp binding site, which is very unlikely to occur in the gene of an effector that you would like to fuse with the TAL gene.<br />
:So after performing the Golden Gate reaction described above, we digested with MssI fast digest (fermentas) according to the following protocol:<br />
<br><br><br />
<br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>GGC-Product</td><td>&#160;10</td><br />
</tr><tr><br />
<td>PmeI/MssI FastDigest</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>Fast Digest Buffer (10x)</td><td>&#160;1,5</td> <br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;2,5</td><br />
</tr><tr><br />
<td>Total</td><td>&#160;15</td> <br />
</tr></table><br />
<br />
<br />
<table align=right border=0 style="margin-right:100px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 1h</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80 °C, 20 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 4°C, ∞</td><br />
</tr></table><br><br><br><br><br><br><br><br></html><br />
<br />
:This linearizes all vectors that do not contain the effector (at least, we do not see colonies on the negative control plate). To be sure, these linearized vectors do not religate, perform the following digest with T5 exonuclease, which specifically removes linearized DNA:<br><br><br />
<br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Product of PmeI digest</td><td>&#160;7,5</td><br />
</tr><tr><br />
<td>T5 Exonuclease</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>Total</td><td>&#160;8,5</td> <br />
</tr></table><br />
<br />
<table align=right border=0 style="margin-right:100px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 1h</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80 °C, 20 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 4°C, ∞</td><br />
</tr></table><br><br><br><br><br><br><br />
</html><br />
:The efficiency of our own little invention – the PPEC – actually surprised us a little bit, for details, see the [[#Team:Freiburg/Project/Experiments|results section]].<br><br><br />
<br />
:'''Insertion of the TAL ORF into the MammoBrick vector:'''<br><br><br />
:Since we wanted to put the TAL ORF under the control of the CMV promoter, we digested both the MammoBrick vector (with SpeI and PstI) and the TAL ORF (with XbaI and PstI), ligated them and transformed into a ccdB-cassette resistant E.coli strain. The resulting clones were verified by sequencing and contained the eukaryotic TAL expression vector:<br><br><br />
<html><img src="https://static.igem.org/mediawiki/2012/3/3b/Figure8T.png" width="450px" style="margin-left:150px"/><br><br></html><br />
<br />
:'''Prokaryotic TAL expression vector:'''<br><br />
:Although for the most part, TAL effectors have been used in eukaryotic organisms, we wanted to enable future iGEM teams to also use this exciting technology in bacteria. So we used BioBrick assembly to construct the following protein generator using TAL ORF, Part:BBa_J04500 (IPTG inducible promoter with RBS) and BBa_B0015 (double terminator):<br />
<br><br><br />
<html><img src="https://static.igem.org/mediawiki/2012/d/d6/Figure9T.png" width="450px" style="margin-left:150px"/></html><br />
<br />
<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Luboehttp://2012.igem.org/Team:Freiburg/Project/GoldenTeam:Freiburg/Project/Golden2012-10-27T00:02:43Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Golden Gate Standard =<br />
----<br />
<br><br />
<div align="justify">On this page, we introduce the Golden Gate Standard to the Registry of Standard Biological parts. We explain in detail, how Golden Gate Cloning works and how it can be made compatible with existing standards. Moreover, we provide step-by-step protocols for using this new standard.<br />
<br />
<br />
==Introduction ==<br />
----<br />
<br><br />
<html><br />
Although BioBrick assembly is a powerful tool for the synbio community because it allows standardized and simple construction of complex genetic constructs from basic genetic modules, it is not the best option when it comes to assembling larger numbers of modules in a short period of time. Furthermore, BioBrick assembly leaves scars between assembled parts, which is not optimal for protein fusion constructs. One popular method which overcomes these obstacles is Gibson Cloning (see figure 1). <br />
This method uses an exonuclease to produce sticky ends on overlapping PCR products, a polymerase to fill up single stranded gaps after annealing and a ligase to connect the different parts.<img src="https://static.igem.org/mediawiki/2012/d/d8/Figure2T.png" align="right" width="400px" style="margin-left:10px; margin-top:10px" ><br />
Gibson cloning allows for assembling whole constructs in one reaction and has been used by many iGEM teams over the past years. However, this technique is not compatible with parts provided by the Registry, unless they are PCR-amplified in order to linearize them and to add overlapping sequences. Furthermore, Gibson cloning requires three different enzymes and can be very tricky.<br />
We therefore propose another method called Golden Gate Cloning<sup>1</sup> (or its derivatives MoClo<sup>2</sup> and GoldenBraid<sup>3</sup>). Golden Gate Cloning (GGC) can be used to assemble many fragments with very high efficiency in one reaction. Importantly, insert fragments can be cut out of amplification vectors (such as iGEM standard vectors) and assembled in one single reaction.<br />
</p></html><br><div style="margin-left:460px">Figure 1: Gibson Cloning</div><br />
<br><br />
<br />
== Mechanism ==<br />
----<br />
<br><html><br />
In conventional cloning, restriction enzymes bind to and cut at the exact same spot. Consequently, one conventional restriction enzyme only produces one type of sticky ends. That is the reason why in conventional cloning, only two DNA parts can be assembled in one step. Golden Gate Cloning overcomes this restriction by exploiting the ability of type IIs restriction enzymes (such as BsaI, BsmBI or BbsI) to produce 4 bp sticky ends right next to their binding sites, irrespective of the adjacent nucleotide sequence. Thus, these enzymes are capable of producing multiple sticky ends at different DNA fragments in one reaction. Importantly, binding sites of type IIs restriction enzymes are not palindromic and therefore are oriented towards the cutting site (figure 2). <br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/7/72/Bsmb1.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 2: BsmB1 restriction mechanism</div><br><br><br />
<br />
So, if a part is flanked by 4 bp overlaps and two binding sites of a type IIs restriction enzyme, which are oriented towards the centre of the part, digestion will lead to predefined sticky ends at each side of the part. In case multiple parts are designed this way and overlaps at both ends of the parts are chosen carefully, the parts align in a predefined order (figure 3).<br><br><br><br />
<img src="https://static.igem.org/mediawiki/2012/f/f7/Figure3T.png" width="400px" style="margin-left:150px"/><br><br><div align="center">Figure 3 : Golden Gate mechanism</div><br><br> <br />
<br />
In case a destination vector is added, that contains type IIs restriction sites pointing in opposite directions, the intermediate piece gets replaced by the assembled parts – magic! After transformation, the antibiotic resistance of the destination vector selects for the right clones.<br><br />
Golden Gate Cloning is typically performed as an all-in-one-pot reaction. This means that all DNA parts, the type IIs restriction enzyme and a ligase are mixed in a PCR tube and put into a thermocycler. By cycling back and forth 10 to 50 times between 37°C and 20°C, the DNA parts get digested and ligated over and over again. Digested DNA fragments are either religated into their plasmids or get assembled with other parts as described above. Since assembled parts lack restriction sites for the type IIs enzyme, the parts get “trapped” in the desired construct. This is the reason why Golden Gate Cloning assembles DNA fragments with such exceptional efficiency.<br />
We successfully used this approach to assemble whole TAL effector expression vectors from six different parts – all in one reaction.<br />
<br><br></html><br />
<br />
== Merging BioBrick Standard and Golden Gate Cloning ==<br />
----<br />
<br><br />
As described above, the overlaps flanking a part determine the position of the particular part within the construct after GGC. We therefore propose the following two strategies for implementing Golden Gate Cloning within the Registry of standard biological parts.<br><br><br />
<br />
<div font-size:15xp>'''Strategy 1'''</div><br><br />
In most cases, iGEM teams seek to assemble so called protein generators, which consist of one part of each of the following categories:<br><br />
::- Promoters<br><br />
::- Ribosome binding sites (RBS)<br><br />
::- Protein coding regions<br><br />
::- and terminators<br><br />
Since the order of these parts in a protein generator is always the same (promoter first, RBS second, etc.), we can attribute a particular pair of overlaps to each of these categories and thereby define the order of the corresponding parts. From our experience with GGC, we propose the following overlaps which have shown no mispairing in our experiments:<br><br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/2/2a/Figure4.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 4 : Overlaps of GGC</div><br><br></html><br />
<br />
We believe that new standards should only be introduced to the Registry of Standard Biological Parts if they are compatible with the existing standards (most importantly with RFC10). Otherwise, the registry would get functionally split up into smaller part libraries and teams using one standard could not collaborate with teams using another. We therefore were very careful with introducing type IIs restriction sites into iGEM backbones. In this context, choosing the optimal relative position of the type IIs binding site to the BioBrick prefix and suffix restriction sites is essential for preserving idempotency of the RFC10 standard. Idempotency in this context means that assembling BioBricks results in higher order constructs that meet BioBrick standard requirements (i.e. they are flanked by the four standard restriction sites and do not contain any of them). The type IIs restriction site can principally be placed in three different positions: <br><br><br />
::1. between prefix/suffix restriction sites and the actual part<br><br />
::2. between the two restriction sites of the prefix and suffix (EcoRI and XbaI or SpeI and PstI, respectively)<br><br />
::3. distal from both RFC10 restriction sites.<br><br><br />
<html><br />
<img src="https://static.igem.org/mediawiki/2012/e/ef/Figure5T.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 5 : Restriction sites</div><br><br></html><br />
<br />
As illustrated in figure 5, only placing the type IIs site between the RFC10 standard restriction sites maintains idempotency of the BioBrick standard. In each of the other cases, constructs assembled by Golden Gate Cloning are not iGEM standard compatible because they contain RFC10 standard restriction sites. We actually built [[Team:Freiburg/Parts|'''96 BioBricks''']] using this Golden Gate Standard and successfully applied both RFC10 or "Golden Gate standard".<br />
We therefore propose the following Protocol:<br><br><br />
<br />
<br><br />
For creating new BioBricks by PCR amplifying the corresponding DNA sequences, we propose the following primers:<br><br><br />
<br />
::1. For '''Promoters''':<br><html><br />
<div style="text-indent:10px">Pro fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT CCTG + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Pro re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::2. For '''RBS''':<html><br />
<div style="text-indent:10px">RBS fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">RBS re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GTCA + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::3. For '''ORF''':<br><html><br />
<div style="text-indent:10px">ORF fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT TGAC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">ORF re: GATACTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::4. For '''Terminators''':<html><br />
<div style="text-indent:10px">Ter fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTT + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Ter re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGT + appr. 17 bp overlap (reverse complement)</div><br />
</html><br />
<br><br />
After purification of the PCR product, you can digest your linearized iGEM vector and your part with EcoRI and PstI using the following Protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Purified PCR product</td><td>&#160;30</td><br />
</tr><tr><br />
<td>EcoRI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>PstI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>BsaI</td><td>&#160;0,5</td> <br />
</tr><tr><br />
<td>NEB buffer 4 (10x)</td><td>&#160;4</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;3,5</td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;40</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 12 hours</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80°C, 20 minutes</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
We very much advise you to digest the vector for 12 hours and purify the product on a gel. This significantly reduces the risk of religation of you vector. We usually had no colonies on our negative control plate after ligation with T4 ligase and transformation into DH10B cells.<br><br />
<br />
Since most standard iGEM plasmids contain binding sites of the most common two type IIs restriction enzymes (namely BsaI/Eco31I and BsmBI/Esp3I), we propose using BbsI/BpiI. We have tested this enzyme in various reaction conditions with many different reaction additives (such as ATP or DTT). Although ligase buffer worked best with other type IIs restriction enzymes (in those cases, ligase activity probably was the bottleneck), we had best results with G Buffer (Fermantas) plus several additives using BbsI.<br><br />
For assembling parts that are in Golden Gate standard, we recommend the following protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts </td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20°C, 5 min</td><br />
</tr><tr><br />
<td>repeat (1. and 2.) 50 times</td><br />
</tr><tr><br />
<td>3. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br />
We always used this 8:40 hour thermocycler program to obtain best results. However you can also reduce the number of cycles.<br><br><br />
<br />
'''Strategy 2'''<br><br><br />
The Golden Gate Standard described above is very efficient, however, it does not exploit the exceptional advantage of GGC to assemble parts in-frame and without a scar. In the past iGEM competitions, several attempts to clone protein modules in-frame have been proposed (see http://partsregistry.org/Help:Standards/Assembly#Registry_Supported_Assembly_Standards), but no standard allows for scarless products (which is crucial for many applications, such as protein domain assembly). For scarless cloning of BioBricks, we therefore propose the following strategy:<br><br><br />
<br />
:'''Step 1:''' Define the sequences of DNA that you want to assemble without a scar. In case the sequences contain protein-coding sequences, make sure your sequences are in frame (e.g. the last three bp of the upstream part form a codon and the first three bp of the downstream part form a codon).<br><br />
:'''Step 2:''' Choose your 4 bp overlaps: In most cases, you can define the last 4 bp of every part as your overlaps.<br><br />
<br />
:Exceptions:<br><br />
::1. Overlaps are palindromic (don’t worry, the chance of a palindromic 4 bp sequence is less than 7 %). In this case, the part not only aligns with the downstream part but also with itself.<br><br />
::2. Several parts end with the same 4 bp sequence.<br><br />
::3. Three out of four base pairs of different parts are similar. In this case, mispairing may occur. However, we tried several 4 bp overhangs that overlap in 3 of 4 bp and haven’t had any false cloning product yet.<br><br><br />
::In case you encounter one of these exceptions, try one of the following overlaps:<br><br />
:::1. Use the first 4 bp of the downstream part as overlap.<br><br />
:::2. Use 2 bp of the upstream and 2 bp of the downstream part as overlap.<br />
::Usually, you should be able to define your overlaps now.<br><br />
<br />
:'''Step 3''': Design your primers:<br><br />
<br />
::Forward primer: GAT GAAGAC CG XXXX + first appr. 17 bp of the part (xxxx represents the overlap for the upstream part)<br><br />
::Reverse primer: GATCA GAAGAC CG + reverse complement of the last appr. 17 bp of the part<br><br />
<br />
:'''Step 4:''' Perform PCR using a high-fidelity polymerase to amplify the BioBricks with the corresponding primers.<br><br />
<br />
:'''Step 5:''' Load the entire PCR product on a 1,5 % agarose gel and check whether your PCR product has the right size.<br><br />
<br />
:'''Step 6:''' Excise corresponding band and perform gel purification.<br><br />
<br />
:'''Step 7:''' Perform Golden Gate Cloning as described in strategy 1.<br><br><br />
<br />
We used this approach to built the BioBricks for assembling multiple protein domains of our TAL proteins in one single reaction without forming scars. <br><br><br><br />
<br />
<br><br><br><br />
== References ==<br />
<br><br />
<html><br />
1. Engler, C., Gruetzner, R., Kandzia, R. & Marillonnet, S. Golden Gate Shuffling: A One-Pot DNA Shuffling Method Based on Type IIs Restriction Enzymes. PLoS ONE 4, e5553 (2009).<br><br />
2. Werner, S., Engler, C., Weber, E., Gruetzner, R. & Marillonnet, S. Fast track assembly of multigene constructs using golden gate cloning and the MoClo system. Bioengineered Bugs 3, 38–43 (2012).<br><br />
3. Sarrion-Perdigones, A. et al. GoldenBraid: An Iterative Cloning System for Standardized Assembly of Reusable Genetic Modules. PLoS ONE 6, e21622 (2011).<br />
</html><br />
<br><br><br><br />
[[#top|Back to top]]</div>Luboehttp://2012.igem.org/Team:Freiburg/Project/GoldenTeam:Freiburg/Project/Golden2012-10-27T00:02:19Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Golden Gate Standard =<br />
----<br />
<br><br />
<div align="justify">On this page, we introduce the Golden Gate Standard to the Registry of Standard Biological parts. We explain in detail, how Golden Gate Cloning works and how it can be made compatible with existing standards. Moreover, we provide step-by-step protocols for using this new standard.<br />
<br />
<br />
==Introduction ==<br />
----<br />
<br><br />
<html><br />
Although BioBrick assembly is a powerful tool for the synbio community because it allows standardized and simple construction of complex genetic constructs from basic genetic modules, it is not the best option when it comes to assembling larger numbers of modules in a short period of time. Furthermore, BioBrick assembly leaves scars between assembled parts, which is not optimal for protein fusion constructs. One popular method which overcomes these obstacles is Gibson Cloning (see figure 1). <br />
This method uses an exonuclease to produce sticky ends on overlapping PCR products, a polymerase to fill up single stranded gaps after annealing and a ligase to connect the different parts.<img src="https://static.igem.org/mediawiki/2012/d/d8/Figure2T.png" align="right" width="400px" style="margin-left:10px; margin-top:10px" ><br />
Gibson cloning allows for assembling whole constructs in one reaction and has been used by many iGEM teams over the past years. However, this technique is not compatible with parts provided by the Registry, unless they are PCR-amplified in order to linearize them and to add overlapping sequences. Furthermore, Gibson cloning requires three different enzymes and can be very tricky.<br />
We therefore propose another method called Golden Gate Cloning<sup>1</sup> (or its derivatives MoClo<sup>2</sup> and GoldenBraid<sup>3</sup>). Golden Gate Cloning (GGC) can be used to assemble many fragments with very high efficiency in one reaction. Importantly, insert fragments can be cut out of amplification vectors (such as iGEM standard vectors) and assembled in one single reaction.<br />
</p></html><br><div style="margin-left:460px">Figure 1: Gibson Cloning</div><br />
<br><br />
<br />
== Mechanism ==<br />
----<br />
<br><html><br />
In conventional cloning, restriction enzymes bind to and cut at the exact same spot. Consequently, one conventional restriction enzyme only produces one type of sticky ends. That is the reason why in conventional cloning, only two DNA parts can be assembled in one step. Golden Gate Cloning overcomes this restriction by exploiting the ability of type IIs restriction enzymes (such as BsaI, BsmBI or BbsI) to produce 4 bp sticky ends right next to their binding sites, irrespective of the adjacent nucleotide sequence. Thus, these enzymes are capable of producing multiple sticky ends at different DNA fragments in one reaction. Importantly, binding sites of type IIs restriction enzymes are not palindromic and therefore are oriented towards the cutting site (figure 2). <br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/7/72/Bsmb1.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 2: BsmB1 restriction mechanism</div><br><br><br />
<br />
So, if a part is flanked by 4 bp overlaps and two binding sites of a type IIs restriction enzyme, which are oriented towards the centre of the part, digestion will lead to predefined sticky ends at each side of the part. In case multiple parts are designed this way and overlaps at both ends of the parts are chosen carefully, the parts align in a predefined order (figure 3).<br><br><br><br />
<img src="https://static.igem.org/mediawiki/2012/f/f7/Figure3T.png" width="400px" style="margin-left:150px"/><br><br><div align="center">Figure 3 : Golden Gate mechanism</div><br><br> <br />
<br />
In case a destination vector is added, that contains type IIs restriction sites pointing in opposite directions, the intermediate piece gets replaced by the assembled parts – magic! After transformation, the antibiotic resistance of the destination vector selects for the right clones.<br><br />
Golden Gate Cloning is typically performed as an all-in-one-pot reaction. This means that all DNA parts, the type IIs restriction enzyme and a ligase are mixed in a PCR tube and put into a thermocycler. By cycling back and forth 10 to 50 times between 37°C and 20°C, the DNA parts get digested and ligated over and over again. Digested DNA fragments are either religated into their plasmids or get assembled with other parts as described above. Since assembled parts lack restriction sites for the type IIs enzyme, the parts get “trapped” in the desired construct. This is the reason why Golden Gate Cloning assembles DNA fragments with such exceptional efficiency.<br />
We successfully used this approach to assemble whole TAL effector expression vectors from six different parts – all in one reaction.<br />
<br><br></html><br />
<br />
== Merging BioBrick Standard and Golden Gate Cloning ==<br />
----<br />
<br><br />
As described above, the overlaps flanking a part determine the position of the particular part within the construct after GGC. We therefore propose the following two strategies for implementing Golden Gate Cloning within the Registry of standard biological parts.<br><br><br />
<br />
<div font-size:15xp>'''Strategy 1'''</div><br><br />
In most cases, iGEM teams seek to assemble so called protein generators, which consist of one part of each of the following categories:<br><br />
::- Promoters<br><br />
::- Ribosome binding sites (RBS)<br><br />
::- Protein coding regions<br><br />
::- and terminators<br><br />
Since the order of these parts in a protein generator is always the same (promoter first, RBS second, etc.), we can attribute a particular pair of overlaps to each of these categories and thereby define the order of the corresponding parts. From our experience with GGC, we propose the following overlaps which have shown no mispairing in our experiments:<br><br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/2/2a/Figure4.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 4 : Overlaps of GGC</div><br><br></html><br />
<br />
We believe that new standards should only be introduced to the Registry of Standard Biological Parts if they are compatible with the existing standards (most importantly with RFC10). Otherwise, the registry would get functionally split up into smaller part libraries and teams using one standard could not collaborate with teams using another. We therefore were very careful with introducing type IIs restriction sites into iGEM backbones. In this context, choosing the optimal relative position of the type IIs binding site to the BioBrick prefix and suffix restriction sites is essential for preserving idempotency of the RFC10 standard. Idempotency in this context means that assembling BioBricks results in higher order constructs that meet BioBrick standard requirements (i.e. they are flanked by the four standard restriction sites and do not contain any of them). The type IIs restriction site can principally be placed in three different positions: <br><br><br />
::1. between prefix/suffix restriction sites and the actual part<br><br />
::2. between the two restriction sites of the prefix and suffix (EcoRI and XbaI or SpeI and PstI, respectively)<br><br />
::3. distal from both RFC10 restriction sites.<br><br><br />
<html><br />
<img src="https://static.igem.org/mediawiki/2012/e/ef/Figure5T.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 5 : Restriction sites</div><br><br></html><br />
<br />
As illustrated in figure 5, only placing the type IIs site between the RFC10 standard restriction sites maintains idempotency of the BioBrick standard. In each of the other cases, constructs assembled by Golden Gate Cloning are not iGEM standard compatible because they contain RFC10 standard restriction sites. We actually built [[Team:Freiburg/Parts|'''96 BioBricks''']] using this Golden Gate Standard and successfully applied both RFC10 or "Golden Gate standard".<br />
We therefore propose the following Protocol:<br><br><br />
<br />
<br><br />
For creating new BioBricks by PCR amplifying the corresponding DNA sequences, we propose the following primers:<br><br><br />
<br />
::1. For '''Promoters''':<br><html><br />
<div style="text-indent:10px">Pro fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT CCTG + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Pro re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::2. For '''RBS''':<html><br />
<div style="text-indent:10px">RBS fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">RBS re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GTCA + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::3. For '''ORF''':<br><html><br />
<div style="text-indent:10px">ORF fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT TGAC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">ORF re: GATACTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::4. For '''Terminators''':<html><br />
<div style="text-indent:10px">Ter fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTT + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Ter re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGT + appr. 17 bp overlap (reverse complement)</div><br />
</html><br />
<br><br />
After purification of the PCR product, you can digest your linearized iGEM vector and your part with EcoRI and PstI using the following Protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Purified PCR product</td><td>&#160;30</td><br />
</tr><tr><br />
<td>EcoRI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>PstI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>BsaI</td><td>&#160;0,5</td> <br />
</tr><tr><br />
<td>NEB buffer 4 (10x)</td><td>&#160;4</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;3,5</td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;40</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 12 hours</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80°C, 20 minutes</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
We very much advise you to digest the vector for 12 hours and purify the product on a gel. This significantly reduces the risk of religation of you vector. We usually had no colonies on our negative control plate after ligation with T4 ligase and transformation into DH10B cells.<br><br />
<br />
Since most standard iGEM plasmids contain binding sites of the most common two type IIs restriction enzymes (namely BsaI/Eco31I and BsmBI/Esp3I), we propose using BbsI/BpiI. We have tested this enzyme in various reaction conditions with many different reaction additives (such as ATP or DTT). Although ligase buffer worked best with other type IIs restriction enzymes (in those cases, ligase activity probably was the bottleneck), we had best results with G Buffer (Fermantas) plus several additives using BbsI.<br><br />
For assembling parts that are in Golden Gate standard, we recommend the following protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts </td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20°C, 5 min</td><br />
</tr><tr><br />
<td>repeat (1. and 2.) 50 times</td><br />
</tr><tr><br />
<td>3. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br />
We always used this 8:40 hour thermocycler program to obtain best results. However you can also reduce the number of cycles.<br><br><br />
<br />
'''Strategy 2'''<br><br><br />
The Golden Gate Standard described above is very efficient, however, it does not exploit the exceptional advantage of GGC to assemble parts in-frame and without a scar. In the past iGEM competitions, several attempts to clone protein modules in-frame have been proposed (see http://partsregistry.org/Help:Standards/Assembly#Registry_Supported_Assembly_Standards), but no standard allows for scarless products (which is crucial for many applications, such as protein domain assembly). For scarless cloning of BioBricks, we therefore propose the following strategy:<br><br><br />
<br />
:'''Step 1:''' Define the sequences of DNA that you want to assemble without a scar. In case the sequences contain protein-coding sequences, make sure your sequences are in frame (e.g. the last three bp of the upstream part form a codon and the first three bp of the downstream part form a codon).<br><br />
:'''Step 2:''' Choose your 4 bp overlaps: In most cases, you can define the last 4 bp of every part as your overlaps.<br><br />
<br />
:Exceptions:<br><br />
::1. Overlaps are palindromic (don’t worry, the chance of a palindromic 4 bp sequence is less than 7 %). In this case, the part not only aligns with the downstream part but also with itself.<br><br />
::2. Several parts end with the same 4 bp sequence.<br><br />
::3. Three out of four base pairs of different parts are similar. In this case, mispairing may occur. However, we tried several 4 bp overhangs that overlap in 3 of 4 bp and haven’t had any false cloning product yet.<br><br><br />
::In case you encounter one of these exceptions, try one of the following overlaps:<br><br />
:::1. Use the first 4 bp of the downstream part as overlap.<br><br />
:::2. Use 2 bp of the upstream and 2 bp of the downstream part as overlap.<br />
::Usually, you should be able to define your overlaps now.<br><br />
<br />
:'''Step 3''': Design your primers:<br><br />
<br />
::Forward primer: GAT GAAGAC CG XXXX + first appr. 17 bp of the part (xxxx represents the overlap for the upstream part)<br><br />
::Reverse primer: GATCA GAAGAC CG + reverse complement of the last appr. 17 bp of the part<br><br />
<br />
:'''Step 4:''' Perform PCR using a high-fidelity polymerase to amplify the BioBricks with the corresponding primers.<br><br />
<br />
:'''Step 5:''' Load the entire PCR product on a 1,5 % agarose gel and check whether your PCR product has the right size.<br><br />
<br />
:'''Step 6:''' Excise corresponding band and perform gel purification.<br><br />
<br />
:'''Step 7:''' Perform Golden Gate Cloning as described in strategy 1.<br><br><br />
<br />
We used this approach to built the BioBricks for assembling multiple protein domains of our TAL proteins in one single reaction without forming scars. <br><br><br><br />
<br />
== References ==<br />
<br><br><br><br />
<html><br />
1. Engler, C., Gruetzner, R., Kandzia, R. & Marillonnet, S. Golden Gate Shuffling: A One-Pot DNA Shuffling Method Based on Type IIs Restriction Enzymes. PLoS ONE 4, e5553 (2009).<br><br />
2. Werner, S., Engler, C., Weber, E., Gruetzner, R. & Marillonnet, S. Fast track assembly of multigene constructs using golden gate cloning and the MoClo system. Bioengineered Bugs 3, 38–43 (2012).<br><br />
3. Sarrion-Perdigones, A. et al. GoldenBraid: An Iterative Cloning System for Standardized Assembly of Reusable Genetic Modules. PLoS ONE 6, e21622 (2011).<br />
</html><br />
<br><br><br><br />
[[#top|Back to top]]</div>Luboehttp://2012.igem.org/Team:Freiburg/Project/GoldenTeam:Freiburg/Project/Golden2012-10-27T00:01:50Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Golden Gate Standard =<br />
----<br />
<br><br />
<div align="justify">On this page, we introduce the Golden Gate Standard to the Registry of Standard Biological parts. We explain in detail, how Golden Gate Cloning works and how it can be made compatible with existing standards. Moreover, we provide step-by-step protocols for using this new standard.<br />
<br />
<br />
==Introduction ==<br />
----<br />
<br><br />
<html><br />
Although BioBrick assembly is a powerful tool for the synbio community because it allows standardized and simple construction of complex genetic constructs from basic genetic modules, it is not the best option when it comes to assembling larger numbers of modules in a short period of time. Furthermore, BioBrick assembly leaves scars between assembled parts, which is not optimal for protein fusion constructs. One popular method which overcomes these obstacles is Gibson Cloning (see figure 1). <br />
This method uses an exonuclease to produce sticky ends on overlapping PCR products, a polymerase to fill up single stranded gaps after annealing and a ligase to connect the different parts.<img src="https://static.igem.org/mediawiki/2012/d/d8/Figure2T.png" align="right" width="400px" style="margin-left:10px; margin-top:10px" ><br />
Gibson cloning allows for assembling whole constructs in one reaction and has been used by many iGEM teams over the past years. However, this technique is not compatible with parts provided by the Registry, unless they are PCR-amplified in order to linearize them and to add overlapping sequences. Furthermore, Gibson cloning requires three different enzymes and can be very tricky.<br />
We therefore propose another method called Golden Gate Cloning<sup>1</sup> (or its derivatives MoClo<sup>2</sup> and GoldenBraid<sup>3</sup>). Golden Gate Cloning (GGC) can be used to assemble many fragments with very high efficiency in one reaction. Importantly, insert fragments can be cut out of amplification vectors (such as iGEM standard vectors) and assembled in one single reaction.<br />
</p></html><br><div style="margin-left:460px">Figure 1: Gibson Cloning</div><br />
<br><br />
<br />
== Mechanism ==<br />
----<br />
<br><html><br />
In conventional cloning, restriction enzymes bind to and cut at the exact same spot. Consequently, one conventional restriction enzyme only produces one type of sticky ends. That is the reason why in conventional cloning, only two DNA parts can be assembled in one step. Golden Gate Cloning overcomes this restriction by exploiting the ability of type IIs restriction enzymes (such as BsaI, BsmBI or BbsI) to produce 4 bp sticky ends right next to their binding sites, irrespective of the adjacent nucleotide sequence. Thus, these enzymes are capable of producing multiple sticky ends at different DNA fragments in one reaction. Importantly, binding sites of type IIs restriction enzymes are not palindromic and therefore are oriented towards the cutting site (figure 2). <br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/7/72/Bsmb1.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 2: BsmB1 restriction mechanism</div><br><br><br />
<br />
So, if a part is flanked by 4 bp overlaps and two binding sites of a type IIs restriction enzyme, which are oriented towards the centre of the part, digestion will lead to predefined sticky ends at each side of the part. In case multiple parts are designed this way and overlaps at both ends of the parts are chosen carefully, the parts align in a predefined order (figure 3).<br><br><br><br />
<img src="https://static.igem.org/mediawiki/2012/f/f7/Figure3T.png" width="400px" style="margin-left:150px"/><br><br><div align="center">Figure 3 : Golden Gate mechanism</div><br><br> <br />
<br />
In case a destination vector is added, that contains type IIs restriction sites pointing in opposite directions, the intermediate piece gets replaced by the assembled parts – magic! After transformation, the antibiotic resistance of the destination vector selects for the right clones.<br><br />
Golden Gate Cloning is typically performed as an all-in-one-pot reaction. This means that all DNA parts, the type IIs restriction enzyme and a ligase are mixed in a PCR tube and put into a thermocycler. By cycling back and forth 10 to 50 times between 37°C and 20°C, the DNA parts get digested and ligated over and over again. Digested DNA fragments are either religated into their plasmids or get assembled with other parts as described above. Since assembled parts lack restriction sites for the type IIs enzyme, the parts get “trapped” in the desired construct. This is the reason why Golden Gate Cloning assembles DNA fragments with such exceptional efficiency.<br />
We successfully used this approach to assemble whole TAL effector expression vectors from six different parts – all in one reaction.<br />
<br><br></html><br />
<br />
== Merging BioBrick Standard and Golden Gate Cloning ==<br />
----<br />
<br><br />
As described above, the overlaps flanking a part determine the position of the particular part within the construct after GGC. We therefore propose the following two strategies for implementing Golden Gate Cloning within the Registry of standard biological parts.<br><br><br />
<br />
<div font-size:15xp>'''Strategy 1'''</div><br><br />
In most cases, iGEM teams seek to assemble so called protein generators, which consist of one part of each of the following categories:<br><br />
::- Promoters<br><br />
::- Ribosome binding sites (RBS)<br><br />
::- Protein coding regions<br><br />
::- and terminators<br><br />
Since the order of these parts in a protein generator is always the same (promoter first, RBS second, etc.), we can attribute a particular pair of overlaps to each of these categories and thereby define the order of the corresponding parts. From our experience with GGC, we propose the following overlaps which have shown no mispairing in our experiments:<br><br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/2/2a/Figure4.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 4 : Overlaps of GGC</div><br><br></html><br />
<br />
We believe that new standards should only be introduced to the Registry of Standard Biological Parts if they are compatible with the existing standards (most importantly with RFC10). Otherwise, the registry would get functionally split up into smaller part libraries and teams using one standard could not collaborate with teams using another. We therefore were very careful with introducing type IIs restriction sites into iGEM backbones. In this context, choosing the optimal relative position of the type IIs binding site to the BioBrick prefix and suffix restriction sites is essential for preserving idempotency of the RFC10 standard. Idempotency in this context means that assembling BioBricks results in higher order constructs that meet BioBrick standard requirements (i.e. they are flanked by the four standard restriction sites and do not contain any of them). The type IIs restriction site can principally be placed in three different positions: <br><br><br />
::1. between prefix/suffix restriction sites and the actual part<br><br />
::2. between the two restriction sites of the prefix and suffix (EcoRI and XbaI or SpeI and PstI, respectively)<br><br />
::3. distal from both RFC10 restriction sites.<br><br><br />
<html><br />
<img src="https://static.igem.org/mediawiki/2012/e/ef/Figure5T.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 5 : Restriction sites</div><br><br></html><br />
<br />
As illustrated in figure 5, only placing the type IIs site between the RFC10 standard restriction sites maintains idempotency of the BioBrick standard. In each of the other cases, constructs assembled by Golden Gate Cloning are not iGEM standard compatible because they contain RFC10 standard restriction sites. We actually built [[Team:Freiburg/Parts|'''96 BioBricks''']] using this Golden Gate Standard and successfully applied both RFC10 or "Golden Gate standard".<br />
We therefore propose the following Protocol:<br><br><br />
<br />
<br><br />
For creating new BioBricks by PCR amplifying the corresponding DNA sequences, we propose the following primers:<br><br><br />
<br />
::1. For '''Promoters''':<br><html><br />
<div style="text-indent:10px">Pro fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT CCTG + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Pro re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::2. For '''RBS''':<html><br />
<div style="text-indent:10px">RBS fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">RBS re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GTCA + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::3. For '''ORF''':<br><html><br />
<div style="text-indent:10px">ORF fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT TGAC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">ORF re: GATACTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::4. For '''Terminators''':<html><br />
<div style="text-indent:10px">Ter fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTT + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Ter re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGT + appr. 17 bp overlap (reverse complement)</div><br />
</html><br />
<br><br />
After purification of the PCR product, you can digest your linearized iGEM vector and your part with EcoRI and PstI using the following Protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Purified PCR product</td><td>&#160;30</td><br />
</tr><tr><br />
<td>EcoRI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>PstI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>BsaI</td><td>&#160;0,5</td> <br />
</tr><tr><br />
<td>NEB buffer 4 (10x)</td><td>&#160;4</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;3,5</td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;40</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 12 hours</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80°C, 20 minutes</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
We very much advise you to digest the vector for 12 hours and purify the product on a gel. This significantly reduces the risk of religation of you vector. We usually had no colonies on our negative control plate after ligation with T4 ligase and transformation into DH10B cells.<br><br />
<br />
Since most standard iGEM plasmids contain binding sites of the most common two type IIs restriction enzymes (namely BsaI/Eco31I and BsmBI/Esp3I), we propose using BbsI/BpiI. We have tested this enzyme in various reaction conditions with many different reaction additives (such as ATP or DTT). Although ligase buffer worked best with other type IIs restriction enzymes (in those cases, ligase activity probably was the bottleneck), we had best results with G Buffer (Fermantas) plus several additives using BbsI.<br><br />
For assembling parts that are in Golden Gate standard, we recommend the following protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts </td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20°C, 5 min</td><br />
</tr><tr><br />
<td>repeat (1. and 2.) 50 times</td><br />
</tr><tr><br />
<td>3. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br />
We always used this 8:40 hour thermocycler program to obtain best results. However you can also reduce the number of cycles.<br><br><br />
<br />
'''Strategy 2'''<br><br><br />
The Golden Gate Standard described above is very efficient, however, it does not exploit the exceptional advantage of GGC to assemble parts in-frame and without a scar. In the past iGEM competitions, several attempts to clone protein modules in-frame have been proposed (see http://partsregistry.org/Help:Standards/Assembly#Registry_Supported_Assembly_Standards), but no standard allows for scarless products (which is crucial for many applications, such as protein domain assembly). For scarless cloning of BioBricks, we therefore propose the following strategy:<br><br><br />
<br />
:'''Step 1:''' Define the sequences of DNA that you want to assemble without a scar. In case the sequences contain protein-coding sequences, make sure your sequences are in frame (e.g. the last three bp of the upstream part form a codon and the first three bp of the downstream part form a codon).<br><br />
:'''Step 2:''' Choose your 4 bp overlaps: In most cases, you can define the last 4 bp of every part as your overlaps.<br><br />
<br />
:Exceptions:<br><br />
::1. Overlaps are palindromic (don’t worry, the chance of a palindromic 4 bp sequence is less than 7 %). In this case, the part not only aligns with the downstream part but also with itself.<br><br />
::2. Several parts end with the same 4 bp sequence.<br><br />
::3. Three out of four base pairs of different parts are similar. In this case, mispairing may occur. However, we tried several 4 bp overhangs that overlap in 3 of 4 bp and haven’t had any false cloning product yet.<br><br><br />
::In case you encounter one of these exceptions, try one of the following overlaps:<br><br />
:::1. Use the first 4 bp of the downstream part as overlap.<br><br />
:::2. Use 2 bp of the upstream and 2 bp of the downstream part as overlap.<br />
::Usually, you should be able to define your overlaps now.<br><br />
<br />
:'''Step 3''': Design your primers:<br><br />
<br />
::Forward primer: GAT GAAGAC CG XXXX + first appr. 17 bp of the part (xxxx represents the overlap for the upstream part)<br><br />
::Reverse primer: GATCA GAAGAC CG + reverse complement of the last appr. 17 bp of the part<br><br />
<br />
:'''Step 4:''' Perform PCR using a high-fidelity polymerase to amplify the BioBricks with the corresponding primers.<br><br />
<br />
:'''Step 5:''' Load the entire PCR product on a 1,5 % agarose gel and check whether your PCR product has the right size.<br><br />
<br />
:'''Step 6:''' Excise corresponding band and perform gel purification.<br><br />
<br />
:'''Step 7:''' Perform Golden Gate Cloning as described in strategy 1.<br><br><br />
<br />
We used this approach to built the BioBricks for assembling multiple protein domains of our TAL proteins in one single reaction without forming scars. <br><br><br><br />
<br />
== References ==<br />
<br><html><br />
1. Engler, C., Gruetzner, R., Kandzia, R. & Marillonnet, S. Golden Gate Shuffling: A One-Pot DNA Shuffling Method Based on Type IIs Restriction Enzymes. PLoS ONE 4, e5553 (2009).<br><br />
2. Werner, S., Engler, C., Weber, E., Gruetzner, R. & Marillonnet, S. Fast track assembly of multigene constructs using golden gate cloning and the MoClo system. Bioengineered Bugs 3, 38–43 (2012).<br><br />
3. Sarrion-Perdigones, A. et al. GoldenBraid: An Iterative Cloning System for Standardized Assembly of Reusable Genetic Modules. PLoS ONE 6, e21622 (2011).<br />
</html><br />
<br><br><br><br />
[[#top|Back to top]]</div>Luboehttp://2012.igem.org/Team:Freiburg/galleryTeam:Freiburg/gallery2012-10-26T23:31:24Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
= Photo Gallery = <br />
----<br />
<br />
<html><br />
<head><br />
<link rel="stylesheet" href="http://omnibus.uni-freiburg.de/~lb125/css_sl/default/default.css" type="text/css" media="screen" /><br />
<link rel="stylesheet" href="http://omnibus.uni-freiburg.de/~lb125/css_sl/light/light.css" type="text/css" media="screen" /><br />
<link rel="stylesheet" href="http://omnibus.uni-freiburg.de/~lb125/css_sl/dark/dark.css" type="text/css" media="screen" /><br />
<link rel="stylesheet" href="http://omnibus.uni-freiburg.de/~lb125/css_sl/bar/bar.css" type="text/css" media="screen" /><br />
<link rel="stylesheet" href="http://omnibus.uni-freiburg.de/~lb125/css_sl/nivo-slider.css" type="text/css" media="screen" /><br />
<link rel="stylesheet" href="http://omnibus.uni-freiburg.de/~lb125/css_sl/style.css" type="text/css" media="screen" /><br />
</head><br />
<body><br />
<div><br />
<div class="slider-wrapper theme-default" style="position:absolute; top:50px; left:10%"><br />
<div id="slider" class="nivoSlider"><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/000.png" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/001.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/002.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/003.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/004.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/005.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/006.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/007.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/008.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/010.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/011.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/013.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/014.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/015.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/016.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/017.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/018.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/019.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/020.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/021.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/022.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/023.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/024.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/025.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/026.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/027.jpg" /><br />
</div><br />
</div><br />
<br />
<br />
<br />
<script type="text/javascript" src="http://omnibus.uni-freiburg.de/~lb125/js_sl/jquery-1.7.1.min.js"></script><br />
<script type="text/javascript" src="http://omnibus.uni-freiburg.de/~lb125/js_sl/jquery.nivo.slider.js"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('#slider').nivoSlider();<br />
});<br />
</script><br />
</body><br />
</html></div>Luboehttp://2012.igem.org/Team:Freiburg/galleryTeam:Freiburg/gallery2012-10-26T23:24:28Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
= Photo Gallery = <br />
----<br />
<br />
<html><br />
<head><br />
<link rel="stylesheet" href="http://omnibus.uni-freiburg.de/~lb125/css_sl/default/default.css" type="text/css" media="screen" /><br />
<link rel="stylesheet" href="http://omnibus.uni-freiburg.de/~lb125/css_sl/light/light.css" type="text/css" media="screen" /><br />
<link rel="stylesheet" href="http://omnibus.uni-freiburg.de/~lb125/css_sl/dark/dark.css" type="text/css" media="screen" /><br />
<link rel="stylesheet" href="http://omnibus.uni-freiburg.de/~lb125/css_sl/bar/bar.css" type="text/css" media="screen" /><br />
<link rel="stylesheet" href="http://omnibus.uni-freiburg.de/~lb125/css_sl/nivo-slider.css" type="text/css" media="screen" /><br />
<link rel="stylesheet" href="http://omnibus.uni-freiburg.de/~lb125/css_sl/style.css" type="text/css" media="screen" /><br />
</head><br />
<body><br />
<div><br />
<div class="slider-wrapper theme-default" style="position:absolute; top:50px; left:10%"><br />
<div id="slider" class="nivoSlider"><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/000.png" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/001.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/002.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/003.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/004.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/005.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/006.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/007.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/008.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/009.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/010.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/011.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/012.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/013.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/014.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/015.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/016.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/017.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/018.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/019.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/020.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/021.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/022.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/023.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/024.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/025.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/026.jpg" /><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/images_sl/027.jpg" /><br />
</div><br />
</div><br />
<br />
<br />
<br />
<script type="text/javascript" src="http://omnibus.uni-freiburg.de/~lb125/js_sl/jquery-1.7.1.min.js"></script><br />
<script type="text/javascript" src="http://omnibus.uni-freiburg.de/~lb125/js_sl/jquery.nivo.slider.js"></script><br />
<script type="text/javascript"><br />
$(window).load(function() {<br />
$('#slider').nivoSlider();<br />
});<br />
</script><br />
</body><br />
</html></div>Luboehttp://2012.igem.org/Team:FreiburgTeam:Freiburg2012-10-26T23:10:53Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<br />
<html><br />
<head><br />
<br />
<link rel="stylesheet" href="http://omnibus.uni-freiburg.de/~lb125/linking/css/global.css"><br />
<br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.5.1/jquery.min.js"></script><br />
<script src="http://omnibus.uni-freiburg.de/~lb125/linking/js/slides.min.jquery.js"></script><br />
<script><br />
$(function(){<br />
// Set starting slide to 1<br />
var startSlide = 1;<br />
// Get slide number if it exists<br />
if (window.location.hash) {<br />
startSlide = window.location.hash.replace('#','');<br />
}<br />
// Initialize Slides<br />
$('#slides').slides({<br />
preload: true,<br />
preloadImage: 'img/loading.gif',<br />
generatePagination: true,<br />
play: 0,<br />
pause: 2500,<br />
hoverPause: true,<br />
// Get the starting slide<br />
start: startSlide,<br />
animationComplete: function(current){<br />
// Set the slide number as a hash<br />
window.location.hash = '#' + current;<br />
}<br />
});<br />
});<br />
</script><br />
<br />
<br />
<br />
<br />
</head><br />
<body><br />
<br />
<div id="container"><br />
<div id="example"><br />
<div id="slides"><br />
<div class="slides_container"><br />
<br />
<br />
<div class="slide"><br />
<h1>Let us tell you a fabulous TALE...</h1><br />
Transactivator-Like Effectors (TALEs) are a brand-new technology that currently revolutionizes the way researchers manipulate DNA with exceptional site specificity. Originally derived from ''Xanthomonas spp.'', this type of protein comprizes an effector domain and a modular DNA binding domain that can be rationally designed to bind to virtually any target sequence of DNA. Over the past two years, universal endonucleases (TALENs) and transcription factors have been tested in various organisms ranging from bacteria to humans. According to existing protocols, TALE assembly requires several weeks of work and substantial lab skills. In order to bring this technology within reach for iGEM students, we invented an extremely fast and easy TALE assembly strategy and developed a TALE platform with expression plasmids and new classes of TALEs. With our so called GATE assembly kit, future iGEM students will be able to precisely manipulate genomic loci easier and faster than anyone else in the world.<br />
</div><br />
<br />
<div class="slide"><br />
<h1>European iGEM Jamboree 2012 Amsterdam:</h1><br />
Team freiGEM won a gold medal and a special prize for the 'Best New BioBrick Part or Device, Engineered'! Team freiGEM also advanced to World Championship in Boston!<br />
<p align="center"><A HREF="http://www.flickr.com/photos/igemeurope/8096765971/in/photostream/" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/won1.png' width="75%" height="75%"/></A></p><br />
</div><br />
<br />
<div class="slide"><br />
<h1><iframe style="margin-left:10px" align="right" width="300" height="250" src="http://player.vimeo.com/video/49902809" frameborder="0" webkitAllowFullScreen mozallowfullscreen allowFullScreen></iframe>Watch our freiGEM movie...<h1><br />
<br><br />
<h1>...or get some impressions in the freiGEM Photo Gallery:</h1><br />
<p><a style="font-weight:bold; font-size:1.3em;" href="/Team:Freiburg/gallery">FreiGEM 2012 Gallery</a></p><br />
</div><br />
<br />
<div class="slide"><br />
<h1><iframe style="margin-right:10px" align="left" width="300" height="250" src="http://player.vimeo.com/video/52254697?badge=0" frameborder="0" webkitAllowFullScreen mozallowfullscreen allowFullScreen></iframe>See how easy it is to get your own custom made TAL...</h1><br />
<br><br><br />
<h1>For further information visit our project page:</h1><br />
<p><a style="font-weight:bold; font-size:1.3em;" href="/Team:Freiburg/Project">Overview TAL Project</a></p><br />
</div><br />
<br />
<div class="slide"><br />
<h1>Check out our modeling</h1><br />
<p align="center"><A HREF="/Team:Freiburg/Modeling"><img class="thumbnail" img src='https://static.igem.org/mediawiki/2012/9/99/FreigemCompanelDNAlogo.png' width="60%" /></A></p><br />
Companel|DNA is dedicated to bringing biology closer to quantitative predictitive science. <br />
<p><a style="font-weight:bold; font-size:1.1em;" href="/Team:Freiburg/Modeling">Let our application help you to clear up complicated or codepending effects in signaling or protein interaction for instance...</a></p><br />
</div><br />
<br />
</div><br />
<a href="#" class="prev"><img src="http://omnibus.uni-freiburg.de/~lb125/linking/img/arrow-prev.png" width="24" height="43" alt="Arrow Prev"></a><br />
<a href="#" class="next"><img src="http://omnibus.uni-freiburg.de/~lb125/linking/img/arrow-next.png" width="24" height="43" alt="Arrow Next"></a><br />
</div><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/linking/img/example-frame.png" width="739" height="420" alt="Example Frame" id="frame"><br />
</div><br />
</div><br />
</body><br />
</html><br />
<br />
<br />
<br />
<html><br />
<div style="position:absolute; top:550px;"><br />
<p style="text-align:center"><br />
<span style="color:#4F8DDE; font-weight:bold;"><br />
With kind support of<br />
<br><br />
<br><br />
</span><br />
<A HREF="http://www.bioss.uni-freiburg.de/cms/index.php" target="_blank"><img class="thumbnail" img src="https://static.igem.org/mediawiki/2012/7/7b/Logo_bioss.gif" width= "200" /></A><br />
<A HREF="http://www.med.uni-freiburg.de/" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/uniklinik.png' width= "250"/></A><br />
<img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/metabion.png' width= "180"/><br />
<A HREF="http://www.genscript.com/" target="_blank"><img class="thumbnail" img src='https://static.igem.org/mediawiki/2012/0/0d/Genscript_logo.gif' width= "180"/></A><br />
<A HREF="http://eu.idtdna.com/site" target="_blank"><img class="thumbnail" img src='https://static.igem.org/mediawiki/2012/2/21/IDTLogo2010.png' width= "200"/></A><br />
<A HREF="http://www.lifetechnologies.com" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/life.png' width= "150"/></A><br />
<A HREF="http://www.eurofinsdna.com/home.html" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/eurofins.jpg' width= "150"/></A><br />
<img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/gatc.png' width= "150"/><br />
<A HREF="http://www.erasynbio.net/" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/erasynbio.png' width= "200"/></A><br />
</p><br />
</div><br />
</html><br />
<br />
<br />
<br />
<!--- The Mission, Experiments ---></div>Luboehttp://2012.igem.org/Team:FreiburgTeam:Freiburg2012-10-26T23:09:42Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<br />
<html><br />
<head><br />
<br />
<link rel="stylesheet" href="http://omnibus.uni-freiburg.de/~lb125/linking/css/global.css"><br />
<br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.5.1/jquery.min.js"></script><br />
<script src="http://omnibus.uni-freiburg.de/~lb125/linking/js/slides.min.jquery.js"></script><br />
<script><br />
$(function(){<br />
// Set starting slide to 1<br />
var startSlide = 1;<br />
// Get slide number if it exists<br />
if (window.location.hash) {<br />
startSlide = window.location.hash.replace('#','');<br />
}<br />
// Initialize Slides<br />
$('#slides').slides({<br />
preload: true,<br />
preloadImage: 'img/loading.gif',<br />
generatePagination: true,<br />
play: 0,<br />
pause: 2500,<br />
hoverPause: true,<br />
// Get the starting slide<br />
start: startSlide,<br />
animationComplete: function(current){<br />
// Set the slide number as a hash<br />
window.location.hash = '#' + current;<br />
}<br />
});<br />
});<br />
</script><br />
<br />
<br />
<br />
<br />
</head><br />
<body><br />
<br />
<div id="container"><br />
<div id="example"><br />
<div id="slides"><br />
<div class="slides_container"><br />
<br />
<br />
<div class="slide"><br />
<h1>Let us tell you a fabulous TALE...</h1><br />
Transactivator-Like Effectors (TALEs) are a brand-new technology that currently revolutionizes the way researchers manipulate DNA with exceptional site specificity. Originally derived from ''Xanthomonas spp.'', this type of protein comprizes an effector domain and a modular DNA binding domain that can be rationally designed to bind to virtually any target sequence of DNA. Over the past two years, universal endonucleases (TALENs) and transcription factors have been tested in various organisms ranging from bacteria to humans. According to existing protocols, TALE assembly requires several weeks of work and substantial lab skills. In order to bring this technology within reach for iGEM students, we invented an extremely fast and easy TALE assembly strategy and developed a TALE platform with expression plasmids and new classes of TALEs. With our so called GATE assembly kit, future iGEM students will be able to precisely manipulate genomic loci easier and faster than anyone else in the world.<br />
</div><br />
<br />
<div class="slide"><br />
<h1>European iGEM Jamboree 2012 Amsterdam:</h1><br />
Team freiGEM won a gold medal and a special prize for the 'Best New BioBrick Part or Device, Engineered'! Team freiGEM also advanced to World Championship in Boston!<br />
<p align="center"><A HREF="http://www.flickr.com/photos/igemeurope/8096765971/in/photostream/" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/won1.png' width="75%" height="75%"/></A></p><br />
</div><br />
<br />
<div class="slide"><br />
<h1><iframe style="margin-left:10px" align="right" width="300" height="250" src="http://player.vimeo.com/video/49902809" frameborder="0" webkitAllowFullScreen mozallowfullscreen allowFullScreen></iframe>Watch our freiGEM movie...<h1><br />
<br><br />
<h1>...or get some impressions in the freiGEM Photo Gallery:</h1><br />
<p><a style="font-weight:bold; font-size:1.3em;" href="/Team:Freiburg/gallery">FreiGEM 2012 Gallery</a></p><br />
</div><br />
<br />
<div class="slide"><br />
<h1><iframe style="margin-right:10px" align="left" width="300" height="250" src="http://player.vimeo.com/video/52254697?badge=0" frameborder="0" webkitAllowFullScreen mozallowfullscreen allowFullScreen></iframe>See how easy it is to get your own custom made TAL...</h1><br />
<br><br><br />
<h1>For further information visit our project page:</h1><br />
<p><a style="font-weight:bold; font-size:1.3em;" href="/Team:Freiburg/Project">Overview TAL Project</a></p><br />
</div><br />
<br />
<div class="slide"><br />
<h1>Check out our modeling</h1><br />
<p align="center"><A HREF="/Team:Freiburg/Modeling"><img class="thumbnail" img src='https://static.igem.org/mediawiki/2012/9/99/FreigemCompanelDNAlogo.png' width="60%" /></A></p><br />
Companel|DNA is dedicated to bringing biology closer to quantitative predictitive science. <br />
<p><a style="font-weight:bold; font-size:1.1em;" href="Team:Freiburg/Modeling">Let our application help you to clear up complicated or codepending effects in signaling or protein interaction for instance...</a></p><br />
</div><br />
<br />
</div><br />
<a href="#" class="prev"><img src="http://omnibus.uni-freiburg.de/~lb125/linking/img/arrow-prev.png" width="24" height="43" alt="Arrow Prev"></a><br />
<a href="#" class="next"><img src="http://omnibus.uni-freiburg.de/~lb125/linking/img/arrow-next.png" width="24" height="43" alt="Arrow Next"></a><br />
</div><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/linking/img/example-frame.png" width="739" height="420" alt="Example Frame" id="frame"><br />
</div><br />
</div><br />
</body><br />
</html><br />
<br />
<br />
<br />
<html><br />
<div style="position:absolute; top:550px;"><br />
<p style="text-align:center"><br />
<span style="color:#4F8DDE; font-weight:bold;"><br />
With kind support of<br />
<br><br />
<br><br />
</span><br />
<A HREF="http://www.bioss.uni-freiburg.de/cms/index.php" target="_blank"><img class="thumbnail" img src="https://static.igem.org/mediawiki/2012/7/7b/Logo_bioss.gif" width= "200" /></A><br />
<A HREF="http://www.med.uni-freiburg.de/" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/uniklinik.png' width= "250"/></A><br />
<img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/metabion.png' width= "180"/><br />
<A HREF="http://www.genscript.com/" target="_blank"><img class="thumbnail" img src='https://static.igem.org/mediawiki/2012/0/0d/Genscript_logo.gif' width= "180"/></A><br />
<A HREF="http://eu.idtdna.com/site" target="_blank"><img class="thumbnail" img src='https://static.igem.org/mediawiki/2012/2/21/IDTLogo2010.png' width= "200"/></A><br />
<A HREF="http://www.lifetechnologies.com" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/life.png' width= "150"/></A><br />
<A HREF="http://www.eurofinsdna.com/home.html" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/eurofins.jpg' width= "150"/></A><br />
<img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/gatc.png' width= "150"/><br />
<A HREF="http://www.erasynbio.net/" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/erasynbio.png' width= "200"/></A><br />
</p><br />
</div><br />
</html><br />
<br />
<br />
<br />
<!--- The Mission, Experiments ---></div>Luboehttp://2012.igem.org/Team:Freiburg/Project/IntroTeam:Freiburg/Project/Intro2012-10-26T23:02:38Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<html><br />
<head><br />
<!-- Timeline script adapted from http://www.csslab.cl/2011/08/18/jquery-timelinr/. Thanks!! --><br />
<br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8"/><br />
<br />
<link rel="stylesheet" href="<br />
http://omnibus.uni-freiburg.de/~lb125/css/style.css" type="text/css" media="screen" /><br />
<br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.6.2/jquery.min.js" type="text/javascript"></script><br />
<br />
<script src="http://omnibus.uni-freiburg.de/~lb125/js/jquery.timelinr-0.9.51.js" type="text/javascript"></script><br />
<br />
<script type="text/javascript"> <br />
<br />
$(function(){<br />
$().timelinr({<br />
orientation: 'horizontal',<br />
containerDiv: '#timeline',<br />
datesDiv: '#dates',<br />
datesSelectedClass: 'selected',<br />
datesSpeed: 'normal',<br />
issuesDiv : '#issues',<br />
issuesSelectedClass: 'selected',<br />
issuesSpeed: 'fast',<br />
issuesTransparency: 0.2,<br />
issuesTransparencySpeed: 500,<br />
prevButton: '#prev',<br />
nextButton: '#next',<br />
arrowKeys: 'false',<br />
startAt: 1,<br />
autoPlay: 'false',<br />
autoPlayDirection: 'forward',<br />
autoPlayPause: 2000<br />
});<br />
});<br />
<br />
</script><br />
<br />
<!-- End timeline --><br />
<br />
<br />
<style type="text/css"><br />
#ip_quote<br />
{<br />
margin-top:0px;<br />
margin-bottom:0px;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:75%;<br />
color:#C22227;<br />
font-size:140%;<br />
line-height:140%;<br />
text-align:justify;<br />
}<br />
</style><br />
</head><br />
</html><br />
<br />
__NOTOC__<br />
= Introduction =<br />
----<br />
<html><br />
<!-- BEGIN TIMELINE WHITEBOX HERE --><br />
<div name="talhistory"><br />
<div id="timeline"><br />
<br />
<ul id="dates"><br />
<li><a href="#" class="dateobject">2009</a></li><br />
<li><a href="#" class="dateobject">2010</a></li><br />
<li><a href="#" class="dateobject">02/11</a></li><br />
<li><a href="#" class="dateobject">10/11</a></li><br />
<li><a href="#" class="dateobject">12/11</a></li><br />
<li><a href="#" class="dateobject">02/12</a></li><br />
<li><a href="#" class="dateobject">04/12</a></li><br />
<li><a href="#" class="dateobject">iGEM'12</a></li><br />
</ul><br />
<br />
<br />
<div id="grad_left"></div><br />
<br />
<div id="grad_right"></div><br />
<br />
<a href="#" id="next">+</a><br />
<br />
<a href="#" id="prev">-</a><br />
<br />
<br />
<ul id="issues"><br />
<br />
<br />
<br />
<li id="#2009"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_09.png" width="256" height="170" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2009</div><br />
<br />
<p>Two research groups publish the TAL Effector codes in the same issue of Science: Amino acid 12 and 13 of every DNA binding module specifically binds to one nucleotide</p><br />
<br />
</li><br />
<br />
<br />
<li id="#2010"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_10.png" width="256" height="200" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2010</div><br />
<br />
<p>Voytas Lab develops TALENs. These fusion proteins of FokI and a TAL protein cut as dimers and allow researchers to cut virtually anywhere in the genome. Since double strand breaks increase efficiency of homologous recombination, TALENS are a powerful tool for genetic engineering and gene therapy</p><br />
<br />
</li><br />
<br />
<li id="#02/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/02_11.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">February 2011</div><br />
<br />
<p>Based on an exclusive licensing agreement with the University of Minnasota, Cellectis bioresearch launches its TAL effector product line. One TALEN pair currently costs 5000 Euro (6454 US$, 26.10.12).</p><br />
<br />
</li><br />
<br />
<br />
<li id="#10/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_11.png" width="210" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2011</div><br />
<br />
<p>The iGEM team from Harvard University employed fancy and expensive techniques to find up to 15 new zinc fingers (each of which binds to 3 bp). There has to be a better way…</p><br />
<br />
</li><br />
<br />
<br />
<li id="#12/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/12_11.png" width="210" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">December 2011</div><br />
<br />
<p>Nature chooses TALENs as the 2011 Method of the year.</p><br />
<br />
</li><br />
<br />
<li id="#02/2012"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/02_12.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">February 2012</div><br />
<br />
<p>The first two crystal structures of TALE modules bound to DNA published in the same issue of Science. The protein literally wraps itself around the DNA double helix and forms these beautiful symmetric shapes.</p><br />
<br />
</li><br />
<br />
<br />
<br />
<li id="#04/2012"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/04_12.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">April 2012</div><br />
<br />
<p>Joung lab publishes FLASH assembly in Nature Biotechnology. This first automatable TAL assembly platform facilitates assembly of 96 TAL DNA fragments in less than a day using a pipeting robot.</p><br />
<br />
</li><br />
<br />
<br />
<li id="freiGEM'12"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_12.png" width="200" height="130" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2012</div><br />
<br />
<p>The Freiburg iGEM team makes TALE technology available to everyone by introducing the GATE assembly kit. For TALEs targeting 14 bp, this platform is currently the fastest, cheapest and easiest method in the world.</p><br />
<br />
</li><br />
<br />
</ul><br />
<br />
<br />
</div><br />
</div><br />
<br />
<!-- END TIMELINE WHITEBOX HERE --><br />
<br />
<br />
<p><div align="justify">Originally, TAL proteins are virulence factors of the plant-pathogenic ''Xanthomonas spp.'' that are injected into plant cells via a type III secretion system in order to modulate transcription<sup>1</sup>. For this purpose, their c-terminal end contains a nuclear localisation signal (NLS) and an acidic activation domain. The central part of the TAL protein contains a number of almost similar repeats that mediate specific binding to target loci in the genome.<br />
In 2009, two groups have simultaneously pointed out that each of these repeats specifically binds to one base of the target DNA via two amino acids (aa 12 and 13), named the repeat variable diresidues (RVD)<sup>2</sup> (see figure 1). Moreover, it has been shown that DNA binding of these proteins is highly modular, i.e. the number of bases or sequence of the target DNA can be altered by adjusting the number or order of the repeats in the TAL protein, respectively.<br />
<br><br><img src="https://static.igem.org/mediawiki/2012/0/02/Schemetalprotein.png" width="500px" style="margin-left:130px"/><br><div align="center"><br>Figure 1: Scheme of a TAL protein</div><br><br><br />
The minimal condition for TALE activity is a thymine at the 5’ end of the target sequence. Further target sequence requirements that allow for one TALEN pair binding site every 35 bp (published by the Voytas lab in 2011<sup>3</sup>) have recently been questioned by Reyon et al.<sup>4</sup> In summary, it is very likely that you can find multiple potential TALE binding sites in any sequence you want to target.<br />
This, obviously, is very promising for biotechnological and clinical applications. Thus, two major classes of TAL Effectors have been created by replacing the natural acidic activation domain either by other transcription factors (TALE-TFs) <sup>5</sup> or by a monomer of the non-sequence specific nuclease FokI, resulting in TAL Effector Nucleases (TALENS).<sup>6</sup> A pair of TALENs can be designed to bind adjacent DNA sequences in a way that the two monomers are able to form a functional FokI dimer that produces a double strand break (DBS) within the spacer between the TAL-Effectors (see figure 2). <br><br><br />
<img src="https://static.igem.org/mediawiki/2012/9/9b/TAL-figure13T.png" width="500px" style="margin-left:130px"/><br><div align="center">Figure 2: Schematic drawings of a TAL-TF and a TALEN pair<sup>13</sup></div><br><br><br />
<br />
Subsequently, the cell repairs the DBS by either non-homologous end joining (NHEJ, which results in indels at the DSB-site) or homologous recombination of exogenously added genetic material. That way, TALENs allow researchers to introduce genes into a genome with much higher efficiency than before.<br />
In this context, TALENs and TALE-TF have successfully been applied for manipulation of a series of genes in different organisms such as yeast<sup>7</sup>, tobacco<sup>3</sup>, fruitflies<sup>6,8</sup>,worms<sup>6,9</sup>, zebrafish<sup>10</sup>, rats<sup>11</sup> and various human cell types, including human stem cells<sup>12</sup>. Moreover, TALENs are already applied for gene therapy in preclinical trials.<br><br><br />
<br />
<br />
<br><br><br><br><br />
<div style="color: #1C649F; font-size: 20px;font-family: Gill Sans MT">References</div><br><br />
1. Scholze, H. & Boch, J. TAL effectors are remote controls for gene activation. ''Current Opinion in Microbiology'' 14, 47–53 (2011).<br><br />
2. Moscou, M. J. & Bogdanove, A. J. A Simple Cipher Governs DNA Recognition by TAL Effectors. ''Science'' 326, 1501–1501 (2009).<br><br />
3. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucleic Acids Res'' 39, e82 (2011).<br><br />
4. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nature Biotechnology'' 30, 460–465 (2012).<br><br />
5. Zhang, F. et al. Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. ''Nature biotechnology'' 29, 149–153 (2011).<br><br />
6. Miller, J. C. et al. A TALE nuclease architecture for efficient genome editing. ''Nature Biotechnology'' 29, 143–148 (2010).<br><br />
7. Boch, J. et al. Breaking the Code of DNA Binding Specificity of TAL-Type III Effectors. ''Science'' 326, 1509–1512 (2009).<br />
8. Liu, J. et al. Efficient and Specific Modifications of the Drosophila Genome by Means of an Easy TALEN Strategy. ''Journal of Genetics and Genomics'' 39, 209–215 (2012).<br><br />
9. Wood, A. J. et al. Targeted Genome Editing Across Species Using ZFNs and TALENs. ''Science'' 333, 307–307 (2011).<br><br />
10. Sander, J. D. et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. ''Nat Biotechnol'' 29, 697–698 (2011).<br><br />
11. Tesson, L. et al. Knockout rats generated by embryo microinjection of TALENs. ''Nature Biotechnology'' 29, 695–696 (2011).<br><br />
12. Hockemeyer, D. et al. Genetic engineering of human pluripotent cells using TALE nucleases. ''Nature Biotechnology'' 29, 731–734 (2011).<br><br />
13. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br />
<br />
<br><br><br />
</html><br />
[[#top|Back to top]]</div>Luboehttp://2012.igem.org/Team:Freiburg/Project/IntroTeam:Freiburg/Project/Intro2012-10-26T23:01:38Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<html><br />
<head><br />
<!-- Timeline script adapted from http://www.csslab.cl/2011/08/18/jquery-timelinr/. Thanks!! --><br />
<br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8"/><br />
<br />
<link rel="stylesheet" href="<br />
http://omnibus.uni-freiburg.de/~lb125/css/style.css" type="text/css" media="screen" /><br />
<br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.6.2/jquery.min.js" type="text/javascript"></script><br />
<br />
<script src="http://omnibus.uni-freiburg.de/~lb125/js/jquery.timelinr-0.9.51.js" type="text/javascript"></script><br />
<br />
<script type="text/javascript"> <br />
<br />
$(function(){<br />
$().timelinr({<br />
orientation: 'horizontal',<br />
containerDiv: '#timeline',<br />
datesDiv: '#dates',<br />
datesSelectedClass: 'selected',<br />
datesSpeed: 'normal',<br />
issuesDiv : '#issues',<br />
issuesSelectedClass: 'selected',<br />
issuesSpeed: 'fast',<br />
issuesTransparency: 0.2,<br />
issuesTransparencySpeed: 500,<br />
prevButton: '#prev',<br />
nextButton: '#next',<br />
arrowKeys: 'false',<br />
startAt: 1,<br />
autoPlay: 'false',<br />
autoPlayDirection: 'forward',<br />
autoPlayPause: 2000<br />
});<br />
});<br />
<br />
</script><br />
<br />
<!-- End timeline --><br />
<br />
<br />
<style type="text/css"><br />
#ip_quote<br />
{<br />
margin-top:0px;<br />
margin-bottom:0px;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:75%;<br />
color:#C22227;<br />
font-size:140%;<br />
line-height:140%;<br />
text-align:justify;<br />
}<br />
</style><br />
</head><br />
</html><br />
<br />
__NOTOC__<br />
= Introduction =<br />
----<br />
<html><br />
<!-- BEGIN TIMELINE WHITEBOX HERE --><br />
<div name="talhistory"><br />
<div id="timeline"><br />
<br />
<ul id="dates"><br />
<li><a href="#" class="dateobject">2009</a></li><br />
<li><a href="#" class="dateobject">2010</a></li><br />
<li><a href="#" class="dateobject">02/11</a></li><br />
<li><a href="#" class="dateobject">10/11</a></li><br />
<li><a href="#" class="dateobject">12/11</a></li><br />
<li><a href="#" class="dateobject">02/12</a></li><br />
<li><a href="#" class="dateobject">04/12</a></li><br />
<li><a href="#" class="dateobject">iGEM'12</a></li><br />
</ul><br />
<br />
<br />
<div id="grad_left"></div><br />
<br />
<div id="grad_right"></div><br />
<br />
<a href="#" id="next">+</a><br />
<br />
<a href="#" id="prev">-</a><br />
<br />
<br />
<ul id="issues"><br />
<br />
<br />
<br />
<li id="#2009"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_09.png" width="256" height="170" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2009</div><br />
<br />
<p>Two research groups publish the TAL Effector codes in the same issue of Science: Amino acid 12 and 13 of every DNA binding module specifically binds to one nucleotide</p><br />
<br />
</li><br />
<br />
<br />
<li id="#2010"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_10.png" width="256" height="200" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2010</div><br />
<br />
<p>Voytas Lab develops TALENs. These fusion proteins of FokI and a TAL protein cut as dimers and allow researchers to cut virtually anywhere in the genome. Since double strand breaks increase efficiency of homologous recombination, TALENS are a powerful tool for genetic engineering and gene therapy</p><br />
<br />
</li><br />
<br />
<li id="#02/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/02_11.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">February 2011</div><br />
<br />
<p>Based on an exclusive licensing agreement with the University of Minnasota, Cellectis bioresearch launches its TAL effector product line. One TALEN pair currently costs 5000 Euro (6454 US$, 26.10.12).</p><br />
<br />
</li><br />
<br />
<br />
<li id="#10/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_11.png" width="210" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2011</div><br />
<br />
<p>The iGEM team from Harvard University employed fancy and expensive techniques to find up to 15 new zinc fingers (each of which binds to 3 bp). There has to be a better way…</p><br />
<br />
</li><br />
<br />
<br />
<li id="#12/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/12_11.png" width="210" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">December 2011</div><br />
<br />
<p>Nature chooses TALENs as the 2011 Method of the year.</p><br />
<br />
</li><br />
<br />
<li id="#02/2012"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/02_12.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">February 2012</div><br />
<br />
<p>The first two crystal structures of TALE modules bound to DNA published in the same issue of Science. The protein literally wraps itself around the DNA double helix and forms these beautiful symmetric shapes.</p><br />
<br />
</li><br />
<br />
<br />
<br />
<li id="#04/2012"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/04_12.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">April 2012</div><br />
<br />
<p>Joung lab publishes FLASH assembly in Nature Biotechnology. This first automatable TAL assembly platform facilitates assembly of 96 TAL DNA fragments in less than a day using a pipeting robot.</p><br />
<br />
</li><br />
<br />
<br />
<li id="freiGEM'12"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_12.png" width="200" height="130" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2012</div><br />
<br />
<p>The Freiburg iGEM team makes TALE technology available to everyone by introducing the GATE assembly kit. For TALEs targeting 14 bp, this platform is currently the fastest, cheapest and easiest method in the world.</p><br />
<br />
</li><br />
<br />
</ul><br />
<br />
<br />
</div><br />
</div><br />
<br />
<!-- END TIMELINE WHITEBOX HERE --><br />
<br />
<br />
<p><div align="justify">Originally, TAL proteins are virulence factors of the plant-pathogenic ''Xanthomonas spp.'' that are injected into plant cells via a type III secretion system in order to modulate transcription<sup>1</sup>. For this purpose, their c-terminal end contains a nuclear localisation signal (NLS) and an acidic activation domain. The central part of the TAL protein contains a number of almost similar repeats that mediate specific binding to target loci in the genome.<br />
In 2009, two groups have simultaneously pointed out that each of these repeats specifically binds to one base of the target DNA via two amino acids (aa 12 and 13), named the repeat variable diresidues (RVD)<sup>2</sup> (see figure 1). Moreover, it has been shown that DNA binding of these proteins is highly modular, i.e. the number of bases or sequence of the target DNA can be altered by adjusting the number or order of the repeats in the TAL protein, respectively.<br />
<br><br><img src="https://static.igem.org/mediawiki/2012/0/02/Schemetalprotein.png" width="500px" style="margin-left:130px"/><br><div align="center"><br>Figure 1: Scheme of a TAL proteindiv><br><br><br />
The minimal condition for TALE activity is a thymine at the 5’ end of the target sequence. Further target sequence requirements that allow for one TALEN pair binding site every 35 bp (published by the Voytas lab in 2011<sup>3</sup>) have recently been questioned by Reyon et al.<sup>4</sup> In summary, it is very likely that you can find multiple potential TALE binding sites in any sequence you want to target.<br />
This, obviously, is very promising for biotechnological and clinical applications. Thus, two major classes of TAL Effectors have been created by replacing the natural acidic activation domain either by other transcription factors (TALE-TFs) <sup>5</sup> or by a monomer of the non-sequence specific nuclease FokI, resulting in TAL Effector Nucleases (TALENS).<sup>6</sup> A pair of TALENs can be designed to bind adjacent DNA sequences in a way that the two monomers are able to form a functional FokI dimer that produces a double strand break (DBS) within the spacer between the TAL-Effectors (see figure 2). <br><br><br />
<img src="https://static.igem.org/mediawiki/2012/9/9b/TAL-figure13T.png" width="500px" style="margin-left:130px"/><br><div align="center">Figure 2: Schematic drawings of a TAL-TF and a TALEN pair<sup>13</sup></div><br><br><br />
<br />
Subsequently, the cell repairs the DBS by either non-homologous end joining (NHEJ, which results in indels at the DSB-site) or homologous recombination of exogenously added genetic material. That way, TALENs allow researchers to introduce genes into a genome with much higher efficiency than before.<br />
In this context, TALENs and TALE-TF have successfully been applied for manipulation of a series of genes in different organisms such as yeast<sup>7</sup>, tobacco<sup>3</sup>, fruitflies<sup>6,8</sup>,worms<sup>6,9</sup>, zebrafish<sup>10</sup>, rats<sup>11</sup> and various human cell types, including human stem cells<sup>12</sup>. Moreover, TALENs are already applied for gene therapy in preclinical trials.<br><br><br />
<br />
<br />
<br><br><br><br><br />
<div style="color: #1C649F; font-size: 20px;font-family: Gill Sans MT">References</div><br><br />
1. Scholze, H. & Boch, J. TAL effectors are remote controls for gene activation. ''Current Opinion in Microbiology'' 14, 47–53 (2011).<br><br />
2. Moscou, M. J. & Bogdanove, A. J. A Simple Cipher Governs DNA Recognition by TAL Effectors. ''Science'' 326, 1501–1501 (2009).<br><br />
3. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucleic Acids Res'' 39, e82 (2011).<br><br />
4. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nature Biotechnology'' 30, 460–465 (2012).<br><br />
5. Zhang, F. et al. Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. ''Nature biotechnology'' 29, 149–153 (2011).<br><br />
6. Miller, J. C. et al. A TALE nuclease architecture for efficient genome editing. ''Nature Biotechnology'' 29, 143–148 (2010).<br><br />
7. Boch, J. et al. Breaking the Code of DNA Binding Specificity of TAL-Type III Effectors. ''Science'' 326, 1509–1512 (2009).<br />
8. Liu, J. et al. Efficient and Specific Modifications of the Drosophila Genome by Means of an Easy TALEN Strategy. ''Journal of Genetics and Genomics'' 39, 209–215 (2012).<br><br />
9. Wood, A. J. et al. Targeted Genome Editing Across Species Using ZFNs and TALENs. ''Science'' 333, 307–307 (2011).<br><br />
10. Sander, J. D. et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. ''Nat Biotechnol'' 29, 697–698 (2011).<br><br />
11. Tesson, L. et al. Knockout rats generated by embryo microinjection of TALENs. ''Nature Biotechnology'' 29, 695–696 (2011).<br><br />
12. Hockemeyer, D. et al. Genetic engineering of human pluripotent cells using TALE nucleases. ''Nature Biotechnology'' 29, 731–734 (2011).<br><br />
13. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br />
<br />
<br><br><br />
</html><br />
[[#top|Back to top]]</div>Luboehttp://2012.igem.org/Team:Freiburg/Project/IntroTeam:Freiburg/Project/Intro2012-10-26T23:00:06Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<html><br />
<head><br />
<!-- Timeline script adapted from http://www.csslab.cl/2011/08/18/jquery-timelinr/. Thanks!! --><br />
<br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8"/><br />
<br />
<link rel="stylesheet" href="<br />
http://omnibus.uni-freiburg.de/~lb125/css/style.css" type="text/css" media="screen" /><br />
<br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.6.2/jquery.min.js" type="text/javascript"></script><br />
<br />
<script src="http://omnibus.uni-freiburg.de/~lb125/js/jquery.timelinr-0.9.51.js" type="text/javascript"></script><br />
<br />
<script type="text/javascript"> <br />
<br />
$(function(){<br />
$().timelinr({<br />
orientation: 'horizontal',<br />
containerDiv: '#timeline',<br />
datesDiv: '#dates',<br />
datesSelectedClass: 'selected',<br />
datesSpeed: 'normal',<br />
issuesDiv : '#issues',<br />
issuesSelectedClass: 'selected',<br />
issuesSpeed: 'fast',<br />
issuesTransparency: 0.2,<br />
issuesTransparencySpeed: 500,<br />
prevButton: '#prev',<br />
nextButton: '#next',<br />
arrowKeys: 'false',<br />
startAt: 1,<br />
autoPlay: 'false',<br />
autoPlayDirection: 'forward',<br />
autoPlayPause: 2000<br />
});<br />
});<br />
<br />
</script><br />
<br />
<!-- End timeline --><br />
<br />
<br />
<style type="text/css"><br />
#ip_quote<br />
{<br />
margin-top:0px;<br />
margin-bottom:0px;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:75%;<br />
color:#C22227;<br />
font-size:140%;<br />
line-height:140%;<br />
text-align:justify;<br />
}<br />
</style><br />
</head><br />
</html><br />
<br />
__NOTOC__<br />
= Introduction =<br />
----<br />
<html><br />
<!-- BEGIN TIMELINE WHITEBOX HERE --><br />
<div name="talhistory"><br />
<div id="timeline"><br />
<br />
<ul id="dates"><br />
<li><a href="#" class="dateobject">2009</a></li><br />
<li><a href="#" class="dateobject">2010</a></li><br />
<li><a href="#" class="dateobject">02/11</a></li><br />
<li><a href="#" class="dateobject">10/11</a></li><br />
<li><a href="#" class="dateobject">12/11</a></li><br />
<li><a href="#" class="dateobject">02/12</a></li><br />
<li><a href="#" class="dateobject">04/12</a></li><br />
<li><a href="#" class="dateobject">iGEM'12</a></li><br />
</ul><br />
<br />
<br />
<div id="grad_left"></div><br />
<br />
<div id="grad_right"></div><br />
<br />
<a href="#" id="next">+</a><br />
<br />
<a href="#" id="prev">-</a><br />
<br />
<br />
<ul id="issues"><br />
<br />
<br />
<br />
<li id="#2009"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_09.png" width="256" height="170" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2009</div><br />
<br />
<p>Two research groups publish the TAL Effector codes in the same issue of Science: Amino acid 12 and 13 of every DNA binding module specifically binds to one nucleotide</p><br />
<br />
</li><br />
<br />
<br />
<li id="#2010"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_10.png" width="256" height="200" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2010</div><br />
<br />
<p>Voytas Lab develops TALENs. These fusion proteins of FokI and a TAL protein cut as dimers and allow researchers to cut virtually anywhere in the genome. Since double strand breaks increase efficiency of homologous recombination, TALENS are a powerful tool for genetic engineering and gene therapy</p><br />
<br />
</li><br />
<br />
<li id="#02/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/02_11.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">February 2011</div><br />
<br />
<p>Based on an exclusive licensing agreement with the University of Minnasota, Cellectis bioresearch launches its TAL effector product line. One TALEN pair currently costs 5000 Euro (6454 US$, 26.10.12).</p><br />
<br />
</li><br />
<br />
<br />
<li id="#10/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_11.png" width="210" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2011</div><br />
<br />
<p>The iGEM team from Harvard University employed fancy and expensive techniques to find up to 15 new zinc fingers (each of which binds to 3 bp). There has to be a better way…</p><br />
<br />
</li><br />
<br />
<br />
<li id="#12/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/12_11.png" width="210" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">December 2011</div><br />
<br />
<p>Nature chooses TALENs as the 2011 Method of the year.</p><br />
<br />
</li><br />
<br />
<li id="#02/2012"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/02_12.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">February 2012</div><br />
<br />
<p>The first two crystal structures of TALE modules bound to DNA published in the same issue of Science. The protein literally wraps itself around the DNA double helix and forms these beautiful symmetric shapes.</p><br />
<br />
</li><br />
<br />
<br />
<br />
<li id="#04/2012"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/04_12.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">April 2012</div><br />
<br />
<p>Joung lab publishes FLASH assembly in Nature Biotechnology. This first automatable TAL assembly platform facilitates assembly of 96 TAL DNA fragments in less than a day using a pipeting robot.</p><br />
<br />
</li><br />
<br />
<br />
<li id="freiGEM'12"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_12.png" width="200" height="130" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2012</div><br />
<br />
<p>The Freiburg iGEM team makes TALE technology available to everyone by introducing the GATE assembly kit. For TALEs targeting 14 bp, this platform is currently the fastest, cheapest and easiest method in the world.</p><br />
<br />
</li><br />
<br />
</ul><br />
<br />
<br />
</div><br />
</div><br />
<br />
<!-- END TIMELINE WHITEBOX HERE --><br />
<br />
<br />
<p><div align="justify">Originally, TAL proteins are virulence factors of the plant-pathogenic ''Xanthomonas spp.'' that are injected into plant cells via a type III secretion system in order to modulate transcription<sup>1</sup>. For this purpose, their c-terminal end contains a nuclear localisation signal (NLS) and an acidic activation domain. The central part of the TAL protein contains a number of almost similar repeats that mediate specific binding to target loci in the genome.<br />
In 2009, two groups have simultaneously pointed out that each of these repeats specifically binds to one base of the target DNA via two amino acids (aa 12 and 13), named the repeat variable diresidues (RVD)<sup>2</sup> (see figure 1). Moreover, it has been shown that DNA binding of these proteins is highly modular, i.e. the number of bases or sequence of the target DNA can be altered by adjusting the number or order of the repeats in the TAL protein, respectively.<br />
<br><br><img src="https://static.igem.org/mediawiki/2012/0/02/Schemetalprotein.png" width="500px" style="margin-left:130px"/><br><div align="center"><br>Figure 1: Scheme of a TAL protein<sup>13</sup></div><br><br><br />
The minimal condition for TALE activity is a thymine at the 5’ end of the target sequence. Further target sequence requirements that allow for one TALEN pair binding site every 35 bp (published by the Voytas lab in 2011<sup>3</sup>) have recently been questioned by Reyon et al.<sup>4</sup> In summary, it is very likely that you can find multiple potential TALE binding sites in any sequence you want to target.<br />
This, obviously, is very promising for biotechnological and clinical applications. Thus, two major classes of TAL Effectors have been created by replacing the natural acidic activation domain either by other transcription factors (TALE-TFs) <sup>5</sup> or by a monomer of the non-sequence specific nuclease FokI, resulting in TAL Effector Nucleases (TALENS).<sup>6</sup> A pair of TALENs can be designed to bind adjacent DNA sequences in a way that the two monomers are able to form a functional FokI dimer that produces a double strand break (DBS) within the spacer between the TAL-Effectors (see figure 2). <br><br><br />
<img src="https://static.igem.org/mediawiki/2012/9/9b/TAL-figure13T.png" width="500px" style="margin-left:130px"/><br><div align="center">Figure 2: Schematic drawings of a TAL-TF and a TALEN pair<sup>13</sup></div><br><br><br />
<br />
Subsequently, the cell repairs the DBS by either non-homologous end joining (NHEJ, which results in indels at the DSB-site) or homologous recombination of exogenously added genetic material. That way, TALENs allow researchers to introduce genes into a genome with much higher efficiency than before.<br />
In this context, TALENs and TALE-TF have successfully been applied for manipulation of a series of genes in different organisms such as yeast<sup>7</sup>, tobacco<sup>3</sup>, fruitflies<sup>6,8</sup>,worms<sup>6,9</sup>, zebrafish<sup>10</sup>, rats<sup>11</sup> and various human cell types, including human stem cells<sup>12</sup>. Moreover, TALENs are already applied for gene therapy in preclinical trials.<br><br><br />
<br />
<br />
<br><br><br><br><br />
<div style="color: #1C649F; font-size: 20px;font-family: Gill Sans MT">References</div><br><br />
1. Scholze, H. & Boch, J. TAL effectors are remote controls for gene activation. ''Current Opinion in Microbiology'' 14, 47–53 (2011).<br><br />
2. Moscou, M. J. & Bogdanove, A. J. A Simple Cipher Governs DNA Recognition by TAL Effectors. ''Science'' 326, 1501–1501 (2009).<br><br />
3. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucleic Acids Res'' 39, e82 (2011).<br><br />
4. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nature Biotechnology'' 30, 460–465 (2012).<br><br />
5. Zhang, F. et al. Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. ''Nature biotechnology'' 29, 149–153 (2011).<br><br />
6. Miller, J. C. et al. A TALE nuclease architecture for efficient genome editing. ''Nature Biotechnology'' 29, 143–148 (2010).<br><br />
7. Boch, J. et al. Breaking the Code of DNA Binding Specificity of TAL-Type III Effectors. ''Science'' 326, 1509–1512 (2009).<br />
8. Liu, J. et al. Efficient and Specific Modifications of the Drosophila Genome by Means of an Easy TALEN Strategy. ''Journal of Genetics and Genomics'' 39, 209–215 (2012).<br><br />
9. Wood, A. J. et al. Targeted Genome Editing Across Species Using ZFNs and TALENs. ''Science'' 333, 307–307 (2011).<br><br />
10. Sander, J. D. et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. ''Nat Biotechnol'' 29, 697–698 (2011).<br><br />
11. Tesson, L. et al. Knockout rats generated by embryo microinjection of TALENs. ''Nature Biotechnology'' 29, 695–696 (2011).<br><br />
12. Hockemeyer, D. et al. Genetic engineering of human pluripotent cells using TALE nucleases. ''Nature Biotechnology'' 29, 731–734 (2011).<br><br />
13. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br />
<br />
<br><br><br />
</html><br />
[[#top|Back to top]]</div>Luboehttp://2012.igem.org/File:Schemetalprotein.pngFile:Schemetalprotein.png2012-10-26T22:58:22Z<p>Luboe: </p>
<hr />
<div></div>Luboehttp://2012.igem.org/File:Schematalprotein.pngFile:Schematalprotein.png2012-10-26T22:54:17Z<p>Luboe: </p>
<hr />
<div></div>Luboehttp://2012.igem.org/Team:Freiburg/Project/IntroTeam:Freiburg/Project/Intro2012-10-26T22:51:25Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<html><br />
<head><br />
<!-- Timeline script adapted from http://www.csslab.cl/2011/08/18/jquery-timelinr/. Thanks!! --><br />
<br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8"/><br />
<br />
<link rel="stylesheet" href="<br />
http://omnibus.uni-freiburg.de/~lb125/css/style.css" type="text/css" media="screen" /><br />
<br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.6.2/jquery.min.js" type="text/javascript"></script><br />
<br />
<script src="http://omnibus.uni-freiburg.de/~lb125/js/jquery.timelinr-0.9.51.js" type="text/javascript"></script><br />
<br />
<script type="text/javascript"> <br />
<br />
$(function(){<br />
$().timelinr({<br />
orientation: 'horizontal',<br />
containerDiv: '#timeline',<br />
datesDiv: '#dates',<br />
datesSelectedClass: 'selected',<br />
datesSpeed: 'normal',<br />
issuesDiv : '#issues',<br />
issuesSelectedClass: 'selected',<br />
issuesSpeed: 'fast',<br />
issuesTransparency: 0.2,<br />
issuesTransparencySpeed: 500,<br />
prevButton: '#prev',<br />
nextButton: '#next',<br />
arrowKeys: 'false',<br />
startAt: 1,<br />
autoPlay: 'false',<br />
autoPlayDirection: 'forward',<br />
autoPlayPause: 2000<br />
});<br />
});<br />
<br />
</script><br />
<br />
<!-- End timeline --><br />
<br />
<br />
<style type="text/css"><br />
#ip_quote<br />
{<br />
margin-top:0px;<br />
margin-bottom:0px;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:75%;<br />
color:#C22227;<br />
font-size:140%;<br />
line-height:140%;<br />
text-align:justify;<br />
}<br />
</style><br />
</head><br />
</html><br />
<br />
__NOTOC__<br />
= Introduction =<br />
----<br />
<html><br />
<!-- BEGIN TIMELINE WHITEBOX HERE --><br />
<div name="talhistory"><br />
<div id="timeline"><br />
<br />
<ul id="dates"><br />
<li><a href="#" class="dateobject">2009</a></li><br />
<li><a href="#" class="dateobject">2010</a></li><br />
<li><a href="#" class="dateobject">02/11</a></li><br />
<li><a href="#" class="dateobject">10/11</a></li><br />
<li><a href="#" class="dateobject">12/11</a></li><br />
<li><a href="#" class="dateobject">02/12</a></li><br />
<li><a href="#" class="dateobject">04/12</a></li><br />
<li><a href="#" class="dateobject">iGEM'12</a></li><br />
</ul><br />
<br />
<br />
<div id="grad_left"></div><br />
<br />
<div id="grad_right"></div><br />
<br />
<a href="#" id="next">+</a><br />
<br />
<a href="#" id="prev">-</a><br />
<br />
<br />
<ul id="issues"><br />
<br />
<br />
<br />
<li id="#2009"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_09.png" width="256" height="170" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2009</div><br />
<br />
<p>Two research groups publish the TAL Effector codes in the same issue of Science: Amino acid 12 and 13 of every DNA binding module specifically binds to one nucleotide</p><br />
<br />
</li><br />
<br />
<br />
<li id="#2010"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_10.png" width="256" height="200" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2010</div><br />
<br />
<p>Voytas Lab develops TALENs. These fusion proteins of FokI and a TAL protein cut as dimers and allow researchers to cut virtually anywhere in the genome. Since double strand breaks increase efficiency of homologous recombination, TALENS are a powerful tool for genetic engineering and gene therapy</p><br />
<br />
</li><br />
<br />
<li id="#02/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/02_11.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">February 2011</div><br />
<br />
<p>Based on an exclusive licensing agreement with the University of Minnasota, Cellectis bioresearch launches its TAL effector product line. One TALEN pair currently costs 5000 Euro (6454 US$, 26.10.12).</p><br />
<br />
</li><br />
<br />
<br />
<li id="#10/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_11.png" width="210" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2011</div><br />
<br />
<p>The iGEM team from Harvard University employed fancy and expensive techniques to find up to 15 new zinc fingers (each of which binds to 3 bp). There has to be a better way…</p><br />
<br />
</li><br />
<br />
<br />
<li id="#12/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/12_11.png" width="210" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">December 2011</div><br />
<br />
<p>Nature chooses TALENs as the 2011 Method of the year.</p><br />
<br />
</li><br />
<br />
<li id="#02/2012"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/02_12.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">February 2012</div><br />
<br />
<p>The first two crystal structures of TALE modules bound to DNA published in the same issue of Science. The protein literally wraps itself around the DNA double helix and forms these beautiful symmetric shapes.</p><br />
<br />
</li><br />
<br />
<br />
<br />
<li id="#04/2012"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/04_12.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">April 2012</div><br />
<br />
<p>Joung lab publishes FLASH assembly in Nature Biotechnology. This first automatable TAL assembly platform facilitates assembly of 96 TAL DNA fragments in less than a day using a pipeting robot.</p><br />
<br />
</li><br />
<br />
<br />
<li id="freiGEM'12"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_12.png" width="200" height="130" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2012</div><br />
<br />
<p>The Freiburg iGEM team makes TALE technology available to everyone by introducing the GATE assembly kit. For TALEs targeting 14 bp, this platform is currently the fastest, cheapest and easiest method in the world.</p><br />
<br />
</li><br />
<br />
</ul><br />
<br />
<br />
</div><br />
</div><br />
<br />
<!-- END TIMELINE WHITEBOX HERE --><br />
<br />
<br />
<p><div align="justify">Originally, TAL proteins are virulence factors of the plant-pathogenic ''Xanthomonas spp.'' that are injected into plant cells via a type III secretion system in order to modulate transcription<sup>1</sup>. For this purpose, their c-terminal end contains a nuclear localisation signal (NLS) and an acidic activation domain. The central part of the TAL protein contains a number of almost similar repeats that mediate specific binding to target loci in the genome.<br />
In 2009, two groups have simultaneously pointed out that each of these repeats specifically binds to one base of the target DNA via two amino acids (aa 12 and 13), named the repeat variable diresidues (RVD)<sup>2</sup>. Moreover, it has been shown that DNA binding of these proteins is highly modular, i.e. the number of bases or sequence of the target DNA can be altered by adjusting the number or order of the repeats in the TAL protein, respectively.<br />
<br><br><img src="https://static.igem.org/mediawiki/2012/7/7b/Schema_tal_protein.png" width="500px" style="margin-left:130px"/><br><div align="center"><br>Figure 1: Schema of a TAL protein<sup>13</sup></div><br><br><br />
The minimal condition for TALE activity is a thymine at the 5’ end of the target sequence. Further target sequence requirements that allow for one TALEN pair binding site every 35 bp (published by the Voytas lab in 2011<sup>3</sup>) have recently been questioned by Reyon et al.<sup>4</sup> In summary, it is very likely that you can find multiple potential TALE binding sites in any sequence you want to target.<br />
This, obviously, is very promising for biotechnological and clinical applications. Thus, two major classes of TAL Effectors have been created by replacing the natural acidic activation domain either by other transcription factors (TALE-TFs) <sup>5</sup> or by a monomer of the non-sequence specific nuclease FokI, resulting in TAL Effector Nucleases (TALENS).<sup>6</sup> A pair of TALENs can be designed to bind adjacent DNA sequences in a way that the two monomers are able to form a functional FokI dimer that produces a double strand break (DBS) within the spacer between the TAL-Effectors (see figure 2). <br><br><br />
<img src="https://static.igem.org/mediawiki/2012/9/9b/TAL-figure13T.png" width="500px" style="margin-left:130px"/><br><div align="center">Figure 2: Schematic drawings of a TAL-TF and a TALEN pair<sup>13</sup></div><br><br><br />
<br />
Subsequently, the cell repairs the DBS by either non-homologous end joining (NHEJ, which results in indels at the DSB-site) or homologous recombination of exogenously added genetic material. That way, TALENs allow researchers to introduce genes into a genome with much higher efficiency than before.<br />
In this context, TALENs and TALE-TF have successfully been applied for manipulation of a series of genes in different organisms such as yeast<sup>7</sup>, tobacco<sup>3</sup>, fruitflies<sup>6,8</sup>,worms<sup>6,9</sup>, zebrafish<sup>10</sup>, rats<sup>11</sup> and various human cell types, including human stem cells<sup>12</sup>. Moreover, TALENs are already applied for gene therapy in preclinical trials.<br><br><br />
<br />
<br />
<br><br><br><br><br />
<div style="color: #1C649F; font-size: 20px;font-family: Gill Sans MT">References</div><br><br />
1. Scholze, H. & Boch, J. TAL effectors are remote controls for gene activation. ''Current Opinion in Microbiology'' 14, 47–53 (2011).<br><br />
2. Moscou, M. J. & Bogdanove, A. J. A Simple Cipher Governs DNA Recognition by TAL Effectors. ''Science'' 326, 1501–1501 (2009).<br><br />
3. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucleic Acids Res'' 39, e82 (2011).<br><br />
4. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nature Biotechnology'' 30, 460–465 (2012).<br><br />
5. Zhang, F. et al. Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. ''Nature biotechnology'' 29, 149–153 (2011).<br><br />
6. Miller, J. C. et al. A TALE nuclease architecture for efficient genome editing. ''Nature Biotechnology'' 29, 143–148 (2010).<br><br />
7. Boch, J. et al. Breaking the Code of DNA Binding Specificity of TAL-Type III Effectors. ''Science'' 326, 1509–1512 (2009).<br />
8. Liu, J. et al. Efficient and Specific Modifications of the Drosophila Genome by Means of an Easy TALEN Strategy. ''Journal of Genetics and Genomics'' 39, 209–215 (2012).<br><br />
9. Wood, A. J. et al. Targeted Genome Editing Across Species Using ZFNs and TALENs. ''Science'' 333, 307–307 (2011).<br><br />
10. Sander, J. D. et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. ''Nat Biotechnol'' 29, 697–698 (2011).<br><br />
11. Tesson, L. et al. Knockout rats generated by embryo microinjection of TALENs. ''Nature Biotechnology'' 29, 695–696 (2011).<br><br />
12. Hockemeyer, D. et al. Genetic engineering of human pluripotent cells using TALE nucleases. ''Nature Biotechnology'' 29, 731–734 (2011)<br />
13. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br />
<br />
<br><br><br />
</html><br />
[[#top|Back to top]]</div>Luboehttp://2012.igem.org/Team:Freiburg/Project/IntroTeam:Freiburg/Project/Intro2012-10-26T22:50:47Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<html><br />
<head><br />
<!-- Timeline script adapted from http://www.csslab.cl/2011/08/18/jquery-timelinr/. Thanks!! --><br />
<br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8"/><br />
<br />
<link rel="stylesheet" href="<br />
http://omnibus.uni-freiburg.de/~lb125/css/style.css" type="text/css" media="screen" /><br />
<br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.6.2/jquery.min.js" type="text/javascript"></script><br />
<br />
<script src="http://omnibus.uni-freiburg.de/~lb125/js/jquery.timelinr-0.9.51.js" type="text/javascript"></script><br />
<br />
<script type="text/javascript"> <br />
<br />
$(function(){<br />
$().timelinr({<br />
orientation: 'horizontal',<br />
containerDiv: '#timeline',<br />
datesDiv: '#dates',<br />
datesSelectedClass: 'selected',<br />
datesSpeed: 'normal',<br />
issuesDiv : '#issues',<br />
issuesSelectedClass: 'selected',<br />
issuesSpeed: 'fast',<br />
issuesTransparency: 0.2,<br />
issuesTransparencySpeed: 500,<br />
prevButton: '#prev',<br />
nextButton: '#next',<br />
arrowKeys: 'false',<br />
startAt: 1,<br />
autoPlay: 'false',<br />
autoPlayDirection: 'forward',<br />
autoPlayPause: 2000<br />
});<br />
});<br />
<br />
</script><br />
<br />
<!-- End timeline --><br />
<br />
<br />
<style type="text/css"><br />
#ip_quote<br />
{<br />
margin-top:0px;<br />
margin-bottom:0px;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:75%;<br />
color:#C22227;<br />
font-size:140%;<br />
line-height:140%;<br />
text-align:justify;<br />
}<br />
</style><br />
</head><br />
</html><br />
<br />
__NOTOC__<br />
= Introduction =<br />
----<br />
<html><br />
<!-- BEGIN TIMELINE WHITEBOX HERE --><br />
<div name="talhistory"><br />
<div id="timeline"><br />
<br />
<ul id="dates"><br />
<li><a href="#" class="dateobject">2009</a></li><br />
<li><a href="#" class="dateobject">2010</a></li><br />
<li><a href="#" class="dateobject">02/11</a></li><br />
<li><a href="#" class="dateobject">10/11</a></li><br />
<li><a href="#" class="dateobject">12/11</a></li><br />
<li><a href="#" class="dateobject">02/12</a></li><br />
<li><a href="#" class="dateobject">04/12</a></li><br />
<li><a href="#" class="dateobject">iGEM'12</a></li><br />
</ul><br />
<br />
<br />
<div id="grad_left"></div><br />
<br />
<div id="grad_right"></div><br />
<br />
<a href="#" id="next">+</a><br />
<br />
<a href="#" id="prev">-</a><br />
<br />
<br />
<ul id="issues"><br />
<br />
<br />
<br />
<li id="#2009"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_09.png" width="256" height="170" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2009</div><br />
<br />
<p>Two research groups publish the TAL Effector codes in the same issue of Science: Amino acid 12 and 13 of every DNA binding module specifically binds to one nucleotide</p><br />
<br />
</li><br />
<br />
<br />
<li id="#2010"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_10.png" width="256" height="200" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2010</div><br />
<br />
<p>Voytas Lab develops TALENs. These fusion proteins of FokI and a TAL protein cut as dimers and allow researchers to cut virtually anywhere in the genome. Since double strand breaks increase efficiency of homologous recombination, TALENS are a powerful tool for genetic engineering and gene therapy</p><br />
<br />
</li><br />
<br />
<li id="#02/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/02_11.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">February 2011</div><br />
<br />
<p>Based on an exclusive licensing agreement with the University of Minnasota, Cellectis bioresearch launches its TAL effector product line. One TALEN pair currently costs 5000 Euro (6454 US$, 26.10.12).</p><br />
<br />
</li><br />
<br />
<br />
<li id="#10/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_11.png" width="210" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2011</div><br />
<br />
<p>The iGEM team from Harvard University employed fancy and expensive techniques to find up to 15 new zinc fingers (each of which binds to 3 bp). There has to be a better way…</p><br />
<br />
</li><br />
<br />
<br />
<li id="#12/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/12_11.png" width="210" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">December 2011</div><br />
<br />
<p>Nature chooses TALENs as the 2011 Method of the year.</p><br />
<br />
</li><br />
<br />
<li id="#02/2012"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/02_12.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">February 2012</div><br />
<br />
<p>The first two crystal structures of TALE modules bound to DNA published in the same issue of Science. The protein literally wraps itself around the DNA double helix and forms these beautiful symmetric shapes.</p><br />
<br />
</li><br />
<br />
<br />
<br />
<li id="#04/2012"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/04_12.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">April 2012</div><br />
<br />
<p>Joung lab publishes FLASH assembly in Nature Biotechnology. This first automatable TAL assembly platform facilitates assembly of 96 TAL DNA fragments in less than a day using a pipeting robot.</p><br />
<br />
</li><br />
<br />
<br />
<li id="freiGEM'12"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_12.png" width="200" height="130" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2012</div><br />
<br />
<p>The Freiburg iGEM team makes TALE technology available to everyone by introducing the GATE assembly kit. For TALEs targeting 14 bp, this platform is currently the fastest, cheapest and easiest method in the world.</p><br />
<br />
</li><br />
<br />
</ul><br />
<br />
<br />
</div><br />
</div><br />
<br />
<!-- END TIMELINE WHITEBOX HERE --><br />
<br />
<br />
<p><div align="justify">Originally, TAL proteins are virulence factors of the plant-pathogenic ''Xanthomonas spp.'' that are injected into plant cells via a type III secretion system in order to modulate transcription<sup>1</sup>. For this purpose, their c-terminal end contains a nuclear localisation signal (NLS) and an acidic activation domain. The central part of the TAL protein contains a number of almost similar repeats that mediate specific binding to target loci in the genome.<br />
In 2009, two groups have simultaneously pointed out that each of these repeats specifically binds to one base of the target DNA via two amino acids (aa 12 and 13), named the repeat variable diresidues (RVD)<sup>2</sup>. Moreover, it has been shown that DNA binding of these proteins is highly modular, i.e. the number of bases or sequence of the target DNA can be altered by adjusting the number or order of the repeats in the TAL protein, respectively.<br />
<br><br><img src="https://static.igem.org/mediawiki/2012/7/7b/Schema_tal_protein.png" width="500px" style="margin-left:130px"/><br><div align="center">Figure 1: Schema of a TAL protein<sup>13</sup></div><br><br><br />
The minimal condition for TALE activity is a thymine at the 5’ end of the target sequence. Further target sequence requirements that allow for one TALEN pair binding site every 35 bp (published by the Voytas lab in 2011<sup>3</sup>) have recently been questioned by Reyon et al.<sup>4</sup> In summary, it is very likely that you can find multiple potential TALE binding sites in any sequence you want to target.<br />
This, obviously, is very promising for biotechnological and clinical applications. Thus, two major classes of TAL Effectors have been created by replacing the natural acidic activation domain either by other transcription factors (TALE-TFs) <sup>5</sup> or by a monomer of the non-sequence specific nuclease FokI, resulting in TAL Effector Nucleases (TALENS).<sup>6</sup> A pair of TALENs can be designed to bind adjacent DNA sequences in a way that the two monomers are able to form a functional FokI dimer that produces a double strand break (DBS) within the spacer between the TAL-Effectors (see figure 2). <br><br><br />
<img src="https://static.igem.org/mediawiki/2012/9/9b/TAL-figure13T.png" width="500px" style="margin-left:130px"/><br><div align="center">Figure 2: Schematic drawings of a TAL-TF and a TALEN pair<sup>13</sup></div><br><br><br />
<br />
Subsequently, the cell repairs the DBS by either non-homologous end joining (NHEJ, which results in indels at the DSB-site) or homologous recombination of exogenously added genetic material. That way, TALENs allow researchers to introduce genes into a genome with much higher efficiency than before.<br />
In this context, TALENs and TALE-TF have successfully been applied for manipulation of a series of genes in different organisms such as yeast<sup>7</sup>, tobacco<sup>3</sup>, fruitflies<sup>6,8</sup>,worms<sup>6,9</sup>, zebrafish<sup>10</sup>, rats<sup>11</sup> and various human cell types, including human stem cells<sup>12</sup>. Moreover, TALENs are already applied for gene therapy in preclinical trials.<br><br><br />
<br />
<br />
<br><br><br><br><br />
<div style="color: #1C649F; font-size: 20px;font-family: Gill Sans MT">References</div><br><br />
1. Scholze, H. & Boch, J. TAL effectors are remote controls for gene activation. ''Current Opinion in Microbiology'' 14, 47–53 (2011).<br><br />
2. Moscou, M. J. & Bogdanove, A. J. A Simple Cipher Governs DNA Recognition by TAL Effectors. ''Science'' 326, 1501–1501 (2009).<br><br />
3. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucleic Acids Res'' 39, e82 (2011).<br><br />
4. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nature Biotechnology'' 30, 460–465 (2012).<br><br />
5. Zhang, F. et al. Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. ''Nature biotechnology'' 29, 149–153 (2011).<br><br />
6. Miller, J. C. et al. A TALE nuclease architecture for efficient genome editing. ''Nature Biotechnology'' 29, 143–148 (2010).<br><br />
7. Boch, J. et al. Breaking the Code of DNA Binding Specificity of TAL-Type III Effectors. ''Science'' 326, 1509–1512 (2009).<br />
8. Liu, J. et al. Efficient and Specific Modifications of the Drosophila Genome by Means of an Easy TALEN Strategy. ''Journal of Genetics and Genomics'' 39, 209–215 (2012).<br><br />
9. Wood, A. J. et al. Targeted Genome Editing Across Species Using ZFNs and TALENs. ''Science'' 333, 307–307 (2011).<br><br />
10. Sander, J. D. et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. ''Nat Biotechnol'' 29, 697–698 (2011).<br><br />
11. Tesson, L. et al. Knockout rats generated by embryo microinjection of TALENs. ''Nature Biotechnology'' 29, 695–696 (2011).<br><br />
12. Hockemeyer, D. et al. Genetic engineering of human pluripotent cells using TALE nucleases. ''Nature Biotechnology'' 29, 731–734 (2011)<br />
13. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br />
<br />
<br><br><br />
</html><br />
[[#top|Back to top]]</div>Luboehttp://2012.igem.org/Team:Freiburg/Project/IntroTeam:Freiburg/Project/Intro2012-10-26T22:49:11Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<html><br />
<head><br />
<!-- Timeline script adapted from http://www.csslab.cl/2011/08/18/jquery-timelinr/. Thanks!! --><br />
<br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8"/><br />
<br />
<link rel="stylesheet" href="<br />
http://omnibus.uni-freiburg.de/~lb125/css/style.css" type="text/css" media="screen" /><br />
<br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.6.2/jquery.min.js" type="text/javascript"></script><br />
<br />
<script src="http://omnibus.uni-freiburg.de/~lb125/js/jquery.timelinr-0.9.51.js" type="text/javascript"></script><br />
<br />
<script type="text/javascript"> <br />
<br />
$(function(){<br />
$().timelinr({<br />
orientation: 'horizontal',<br />
containerDiv: '#timeline',<br />
datesDiv: '#dates',<br />
datesSelectedClass: 'selected',<br />
datesSpeed: 'normal',<br />
issuesDiv : '#issues',<br />
issuesSelectedClass: 'selected',<br />
issuesSpeed: 'fast',<br />
issuesTransparency: 0.2,<br />
issuesTransparencySpeed: 500,<br />
prevButton: '#prev',<br />
nextButton: '#next',<br />
arrowKeys: 'false',<br />
startAt: 1,<br />
autoPlay: 'false',<br />
autoPlayDirection: 'forward',<br />
autoPlayPause: 2000<br />
});<br />
});<br />
<br />
</script><br />
<br />
<!-- End timeline --><br />
<br />
<br />
<style type="text/css"><br />
#ip_quote<br />
{<br />
margin-top:0px;<br />
margin-bottom:0px;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:75%;<br />
color:#C22227;<br />
font-size:140%;<br />
line-height:140%;<br />
text-align:justify;<br />
}<br />
</style><br />
</head><br />
</html><br />
<br />
__NOTOC__<br />
= Introduction =<br />
----<br />
<html><br />
<!-- BEGIN TIMELINE WHITEBOX HERE --><br />
<div name="talhistory"><br />
<div id="timeline"><br />
<br />
<ul id="dates"><br />
<li><a href="#" class="dateobject">2009</a></li><br />
<li><a href="#" class="dateobject">2010</a></li><br />
<li><a href="#" class="dateobject">02/11</a></li><br />
<li><a href="#" class="dateobject">10/11</a></li><br />
<li><a href="#" class="dateobject">12/11</a></li><br />
<li><a href="#" class="dateobject">02/12</a></li><br />
<li><a href="#" class="dateobject">04/12</a></li><br />
<li><a href="#" class="dateobject">iGEM'12</a></li><br />
</ul><br />
<br />
<br />
<div id="grad_left"></div><br />
<br />
<div id="grad_right"></div><br />
<br />
<a href="#" id="next">+</a><br />
<br />
<a href="#" id="prev">-</a><br />
<br />
<br />
<ul id="issues"><br />
<br />
<br />
<br />
<li id="#2009"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_09.png" width="256" height="170" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2009</div><br />
<br />
<p>Two research groups publish the TAL Effector codes in the same issue of Science: Amino acid 12 and 13 of every DNA binding module specifically binds to one nucleotide</p><br />
<br />
</li><br />
<br />
<br />
<li id="#2010"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_10.png" width="256" height="200" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2010</div><br />
<br />
<p>Voytas Lab develops TALENs. These fusion proteins of FokI and a TAL protein cut as dimers and allow researchers to cut virtually anywhere in the genome. Since double strand breaks increase efficiency of homologous recombination, TALENS are a powerful tool for genetic engineering and gene therapy</p><br />
<br />
</li><br />
<br />
<li id="#02/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/02_11.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">February 2011</div><br />
<br />
<p>Based on an exclusive licensing agreement with the University of Minnasota, Cellectis bioresearch launches its TAL effector product line. One TALEN pair currently costs 5000 Euro (6454 US$, 26.10.12).</p><br />
<br />
</li><br />
<br />
<br />
<li id="#10/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_11.png" width="210" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2011</div><br />
<br />
<p>The iGEM team from Harvard University employed fancy and expensive techniques to find up to 15 new zinc fingers (each of which binds to 3 bp). There has to be a better way…</p><br />
<br />
</li><br />
<br />
<br />
<li id="#12/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/12_11.png" width="210" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">December 2011</div><br />
<br />
<p>Nature chooses TALENs as the 2011 Method of the year.</p><br />
<br />
</li><br />
<br />
<li id="#02/2012"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/02_12.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">February 2012</div><br />
<br />
<p>The first two crystal structures of TALE modules bound to DNA published in the same issue of Science. The protein literally wraps itself around the DNA double helix and forms these beautiful symmetric shapes.</p><br />
<br />
</li><br />
<br />
<br />
<br />
<li id="#04/2012"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/04_12.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">April 2012</div><br />
<br />
<p>Joung lab publishes FLASH assembly in Nature Biotechnology. This first automatable TAL assembly platform facilitates assembly of 96 TAL DNA fragments in less than a day using a pipeting robot.</p><br />
<br />
</li><br />
<br />
<br />
<li id="freiGEM'12"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_12.png" width="200" height="130" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2012</div><br />
<br />
<p>The Freiburg iGEM team makes TALE technology available to everyone by introducing the GATE assembly kit. For TALEs targeting 14 bp, this platform is currently the fastest, cheapest and easiest method in the world.</p><br />
<br />
</li><br />
<br />
</ul><br />
<br />
<br />
</div><br />
</div><br />
<br />
<!-- END TIMELINE WHITEBOX HERE --><br />
<br />
<br />
<p><div align="justify">Originally, TAL proteins are virulence factors of the plant-pathogenic ''Xanthomonas spp.'' that are injected into plant cells via a type III secretion system in order to modulate transcription<sup>1</sup>. For this purpose, their c-terminal end contains a nuclear localisation signal (NLS) and an acidic activation domain. The central part of the TAL protein contains a number of almost similar repeats that mediate specific binding to target loci in the genome.<br />
In 2009, two groups have simultaneously pointed out that each of these repeats specifically binds to one base of the target DNA via two amino acids (aa 12 and 13), named the repeat variable diresidues (RVD)<sup>2</sup>. Moreover, it has been shown that DNA binding of these proteins is highly modular, i.e. the number of bases or sequence of the target DNA can be altered by adjusting the number or order of the repeats in the TAL protein, respectively.<br />
<img src="https://static.igem.org/mediawiki/2012/7/7b/Schema_tal_protein.png" width="500px" style="margin-left:130px"/><br><div align="center">Figure 2: Schematic drawings of a TAL-TF and a TALEN pair<sup>13</sup></div><br><br><br />
The minimal condition for TALE activity is a thymine at the 5’ end of the target sequence. Further target sequence requirements that allow for one TALEN pair binding site every 35 bp (published by the Voytas lab in 2011<sup>3</sup>) have recently been questioned by Reyon et al.<sup>4</sup> In summary, it is very likely that you can find multiple potential TALE binding sites in any sequence you want to target.<br />
This, obviously, is very promising for biotechnological and clinical applications. Thus, two major classes of TAL Effectors have been created by replacing the natural acidic activation domain either by other transcription factors (TALE-TFs) <sup>5</sup> or by a monomer of the non-sequence specific nuclease FokI, resulting in TAL Effector Nucleases (TALENS).<sup>6</sup> A pair of TALENs can be designed to bind adjacent DNA sequences in a way that the two monomers are able to form a functional FokI dimer that produces a double strand break (DBS) within the spacer between the TAL-Effectors (see figure 2). <br><br><br />
<img src="https://static.igem.org/mediawiki/2012/9/9b/TAL-figure13T.png" width="500px" style="margin-left:130px"/><br><div align="center">Figure 2: Schematic drawings of a TAL-TF and a TALEN pair<sup>13</sup></div><br><br><br />
<br />
Subsequently, the cell repairs the DBS by either non-homologous end joining (NHEJ, which results in indels at the DSB-site) or homologous recombination of exogenously added genetic material. That way, TALENs allow researchers to introduce genes into a genome with much higher efficiency than before.<br />
In this context, TALENs and TALE-TF have successfully been applied for manipulation of a series of genes in different organisms such as yeast<sup>7</sup>, tobacco<sup>3</sup>, fruitflies<sup>6,8</sup>,worms<sup>6,9</sup>, zebrafish<sup>10</sup>, rats<sup>11</sup> and various human cell types, including human stem cells<sup>12</sup>. Moreover, TALENs are already applied for gene therapy in preclinical trials.<br><br><br />
<br />
<br />
<br><br><br><br><br />
<div style="color: #1C649F; font-size: 20px;font-family: Gill Sans MT">References</div><br><br />
1. Scholze, H. & Boch, J. TAL effectors are remote controls for gene activation. ''Current Opinion in Microbiology'' 14, 47–53 (2011).<br><br />
2. Moscou, M. J. & Bogdanove, A. J. A Simple Cipher Governs DNA Recognition by TAL Effectors. ''Science'' 326, 1501–1501 (2009).<br><br />
3. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucleic Acids Res'' 39, e82 (2011).<br><br />
4. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nature Biotechnology'' 30, 460–465 (2012).<br><br />
5. Zhang, F. et al. Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. ''Nature biotechnology'' 29, 149–153 (2011).<br><br />
6. Miller, J. C. et al. A TALE nuclease architecture for efficient genome editing. ''Nature Biotechnology'' 29, 143–148 (2010).<br><br />
7. Boch, J. et al. Breaking the Code of DNA Binding Specificity of TAL-Type III Effectors. ''Science'' 326, 1509–1512 (2009).<br />
8. Liu, J. et al. Efficient and Specific Modifications of the Drosophila Genome by Means of an Easy TALEN Strategy. ''Journal of Genetics and Genomics'' 39, 209–215 (2012).<br><br />
9. Wood, A. J. et al. Targeted Genome Editing Across Species Using ZFNs and TALENs. ''Science'' 333, 307–307 (2011).<br><br />
10. Sander, J. D. et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. ''Nat Biotechnol'' 29, 697–698 (2011).<br><br />
11. Tesson, L. et al. Knockout rats generated by embryo microinjection of TALENs. ''Nature Biotechnology'' 29, 695–696 (2011).<br><br />
12. Hockemeyer, D. et al. Genetic engineering of human pluripotent cells using TALE nucleases. ''Nature Biotechnology'' 29, 731–734 (2011)<br />
13. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br />
<br />
<br><br><br />
</html><br />
[[#top|Back to top]]</div>Luboehttp://2012.igem.org/Team:Freiburg/Project/IntroTeam:Freiburg/Project/Intro2012-10-26T22:47:54Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<html><br />
<head><br />
<!-- Timeline script adapted from http://www.csslab.cl/2011/08/18/jquery-timelinr/. Thanks!! --><br />
<br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8"/><br />
<br />
<link rel="stylesheet" href="<br />
http://omnibus.uni-freiburg.de/~lb125/css/style.css" type="text/css" media="screen" /><br />
<br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.6.2/jquery.min.js" type="text/javascript"></script><br />
<br />
<script src="http://omnibus.uni-freiburg.de/~lb125/js/jquery.timelinr-0.9.51.js" type="text/javascript"></script><br />
<br />
<script type="text/javascript"> <br />
<br />
$(function(){<br />
$().timelinr({<br />
orientation: 'horizontal',<br />
containerDiv: '#timeline',<br />
datesDiv: '#dates',<br />
datesSelectedClass: 'selected',<br />
datesSpeed: 'normal',<br />
issuesDiv : '#issues',<br />
issuesSelectedClass: 'selected',<br />
issuesSpeed: 'fast',<br />
issuesTransparency: 0.2,<br />
issuesTransparencySpeed: 500,<br />
prevButton: '#prev',<br />
nextButton: '#next',<br />
arrowKeys: 'false',<br />
startAt: 1,<br />
autoPlay: 'false',<br />
autoPlayDirection: 'forward',<br />
autoPlayPause: 2000<br />
});<br />
});<br />
<br />
</script><br />
<br />
<!-- End timeline --><br />
<br />
<br />
<style type="text/css"><br />
#ip_quote<br />
{<br />
margin-top:0px;<br />
margin-bottom:0px;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:75%;<br />
color:#C22227;<br />
font-size:140%;<br />
line-height:140%;<br />
text-align:justify;<br />
}<br />
</style><br />
</head><br />
</html><br />
<br />
__NOTOC__<br />
= Introduction =<br />
----<br />
<html><br />
<!-- BEGIN TIMELINE WHITEBOX HERE --><br />
<div name="talhistory"><br />
<div id="timeline"><br />
<br />
<ul id="dates"><br />
<li><a href="#" class="dateobject">2009</a></li><br />
<li><a href="#" class="dateobject">2010</a></li><br />
<li><a href="#" class="dateobject">02/11</a></li><br />
<li><a href="#" class="dateobject">10/11</a></li><br />
<li><a href="#" class="dateobject">12/11</a></li><br />
<li><a href="#" class="dateobject">02/12</a></li><br />
<li><a href="#" class="dateobject">04/12</a></li><br />
<li><a href="#" class="dateobject">iGEM'12</a></li><br />
</ul><br />
<br />
<br />
<div id="grad_left"></div><br />
<br />
<div id="grad_right"></div><br />
<br />
<a href="#" id="next">+</a><br />
<br />
<a href="#" id="prev">-</a><br />
<br />
<br />
<ul id="issues"><br />
<br />
<br />
<br />
<li id="#2009"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_09.png" width="256" height="170" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2009</div><br />
<br />
<p>Two research groups publish the TAL Effector codes in the same issue of Science: Amino acid 12 and 13 of every DNA binding module specifically binds to one nucleotide</p><br />
<br />
</li><br />
<br />
<br />
<li id="#2010"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_10.png" width="256" height="200" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2010</div><br />
<br />
<p>Voytas Lab develops TALENs. These fusion proteins of FokI and a TAL protein cut as dimers and allow researchers to cut virtually anywhere in the genome. Since double strand breaks increase efficiency of homologous recombination, TALENS are a powerful tool for genetic engineering and gene therapy</p><br />
<br />
</li><br />
<br />
<li id="#02/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/02_11.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">February 2011</div><br />
<br />
<p>Based on an exclusive licensing agreement with the University of Minnasota, Cellectis bioresearch launches its TAL effector product line. One TALEN pair currently costs 5000 Euro (6454 US$, 26.10.12).</p><br />
<br />
</li><br />
<br />
<br />
<li id="#10/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_11.png" width="210" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2011</div><br />
<br />
<p>The iGEM team from Harvard University employed fancy and expensive techniques to find up to 15 new zinc fingers (each of which binds to 3 bp). There has to be a better way…</p><br />
<br />
</li><br />
<br />
<br />
<li id="#12/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/12_11.png" width="210" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">December 2011</div><br />
<br />
<p>Nature chooses TALENs as the 2011 Method of the year.</p><br />
<br />
</li><br />
<br />
<li id="#02/2012"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/02_12.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">February 2012</div><br />
<br />
<p>The first two crystal structures of TALE modules bound to DNA published in the same issue of Science. The protein literally wraps itself around the DNA double helix and forms these beautiful symmetric shapes.</p><br />
<br />
</li><br />
<br />
<br />
<br />
<li id="#04/2012"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/04_12.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">April 2012</div><br />
<br />
<p>Joung lab publishes FLASH assembly in Nature Biotechnology. This first automatable TAL assembly platform facilitates assembly of 96 TAL DNA fragments in less than a day using a pipeting robot.</p><br />
<br />
</li><br />
<br />
<br />
<li id="freiGEM'12"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_12.png" width="200" height="130" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2012</div><br />
<br />
<p>The Freiburg iGEM team makes TALE technology available to everyone by introducing the GATE assembly kit. For TALEs targeting 14 bp, this platform is currently the fastest, cheapest and easiest method in the world.</p><br />
<br />
</li><br />
<br />
</ul><br />
<br />
<br />
</div><br />
</div><br />
<br />
<!-- END TIMELINE WHITEBOX HERE --><br />
<br />
<br />
<p><div align="justify">Originally, TAL proteins are virulence factors of the plant-pathogenic ''Xanthomonas spp.'' that are injected into plant cells via a type III secretion system in order to modulate transcription<sup>1</sup>. For this purpose, their c-terminal end contains a nuclear localisation signal (NLS) and an acidic activation domain. The central part of the TAL protein contains a number of almost similar repeats that mediate specific binding to target loci in the genome.<br />
In 2009, two groups have simultaneously pointed out that each of these repeats specifically binds to one base of the target DNA via two amino acids (aa 12 and 13), named the repeat variable diresidues (RVD)<sup>2</sup>. Moreover, it has been shown that DNA binding of these proteins is highly modular, i.e. the number of bases or sequence of the target DNA can be altered by adjusting the number or order of the repeats in the TAL protein, respectively.<br />
[[File:Schema_tal_protein.png]]<br />
The minimal condition for TALE activity is a thymine at the 5’ end of the target sequence. Further target sequence requirements that allow for one TALEN pair binding site every 35 bp (published by the Voytas lab in 2011<sup>3</sup>) have recently been questioned by Reyon et al.<sup>4</sup> In summary, it is very likely that you can find multiple potential TALE binding sites in any sequence you want to target.<br />
This, obviously, is very promising for biotechnological and clinical applications. Thus, two major classes of TAL Effectors have been created by replacing the natural acidic activation domain either by other transcription factors (TALE-TFs) <sup>5</sup> or by a monomer of the non-sequence specific nuclease FokI, resulting in TAL Effector Nucleases (TALENS).<sup>6</sup> A pair of TALENs can be designed to bind adjacent DNA sequences in a way that the two monomers are able to form a functional FokI dimer that produces a double strand break (DBS) within the spacer between the TAL-Effectors (see figure 2). <br><br><br />
<img src="https://static.igem.org/mediawiki/2012/9/9b/TAL-figure13T.png" width="500px" style="margin-left:130px"/><br><div align="center">Figure 2: Schematic drawings of a TAL-TF and a TALEN pair<sup>13</sup></div><br><br><br />
<br />
Subsequently, the cell repairs the DBS by either non-homologous end joining (NHEJ, which results in indels at the DSB-site) or homologous recombination of exogenously added genetic material. That way, TALENs allow researchers to introduce genes into a genome with much higher efficiency than before.<br />
In this context, TALENs and TALE-TF have successfully been applied for manipulation of a series of genes in different organisms such as yeast<sup>7</sup>, tobacco<sup>3</sup>, fruitflies<sup>6,8</sup>,worms<sup>6,9</sup>, zebrafish<sup>10</sup>, rats<sup>11</sup> and various human cell types, including human stem cells<sup>12</sup>. Moreover, TALENs are already applied for gene therapy in preclinical trials.<br><br><br />
<br />
<br />
<br><br><br><br><br />
<div style="color: #1C649F; font-size: 20px;font-family: Gill Sans MT">References</div><br><br />
1. Scholze, H. & Boch, J. TAL effectors are remote controls for gene activation. ''Current Opinion in Microbiology'' 14, 47–53 (2011).<br><br />
2. Moscou, M. J. & Bogdanove, A. J. A Simple Cipher Governs DNA Recognition by TAL Effectors. ''Science'' 326, 1501–1501 (2009).<br><br />
3. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucleic Acids Res'' 39, e82 (2011).<br><br />
4. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nature Biotechnology'' 30, 460–465 (2012).<br><br />
5. Zhang, F. et al. Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. ''Nature biotechnology'' 29, 149–153 (2011).<br><br />
6. Miller, J. C. et al. A TALE nuclease architecture for efficient genome editing. ''Nature Biotechnology'' 29, 143–148 (2010).<br><br />
7. Boch, J. et al. Breaking the Code of DNA Binding Specificity of TAL-Type III Effectors. ''Science'' 326, 1509–1512 (2009).<br />
8. Liu, J. et al. Efficient and Specific Modifications of the Drosophila Genome by Means of an Easy TALEN Strategy. ''Journal of Genetics and Genomics'' 39, 209–215 (2012).<br><br />
9. Wood, A. J. et al. Targeted Genome Editing Across Species Using ZFNs and TALENs. ''Science'' 333, 307–307 (2011).<br><br />
10. Sander, J. D. et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. ''Nat Biotechnol'' 29, 697–698 (2011).<br><br />
11. Tesson, L. et al. Knockout rats generated by embryo microinjection of TALENs. ''Nature Biotechnology'' 29, 695–696 (2011).<br><br />
12. Hockemeyer, D. et al. Genetic engineering of human pluripotent cells using TALE nucleases. ''Nature Biotechnology'' 29, 731–734 (2011)<br />
13. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br />
<br />
<br><br><br />
</html><br />
[[#top|Back to top]]</div>Luboehttp://2012.igem.org/Team:Freiburg/Project/IntroTeam:Freiburg/Project/Intro2012-10-26T22:46:40Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<html><br />
<head><br />
<!-- Timeline script adapted from http://www.csslab.cl/2011/08/18/jquery-timelinr/. Thanks!! --><br />
<br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8"/><br />
<br />
<link rel="stylesheet" href="<br />
http://omnibus.uni-freiburg.de/~lb125/css/style.css" type="text/css" media="screen" /><br />
<br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.6.2/jquery.min.js" type="text/javascript"></script><br />
<br />
<script src="http://omnibus.uni-freiburg.de/~lb125/js/jquery.timelinr-0.9.51.js" type="text/javascript"></script><br />
<br />
<script type="text/javascript"> <br />
<br />
$(function(){<br />
$().timelinr({<br />
orientation: 'horizontal',<br />
containerDiv: '#timeline',<br />
datesDiv: '#dates',<br />
datesSelectedClass: 'selected',<br />
datesSpeed: 'normal',<br />
issuesDiv : '#issues',<br />
issuesSelectedClass: 'selected',<br />
issuesSpeed: 'fast',<br />
issuesTransparency: 0.2,<br />
issuesTransparencySpeed: 500,<br />
prevButton: '#prev',<br />
nextButton: '#next',<br />
arrowKeys: 'false',<br />
startAt: 1,<br />
autoPlay: 'false',<br />
autoPlayDirection: 'forward',<br />
autoPlayPause: 2000<br />
});<br />
});<br />
<br />
</script><br />
<br />
<!-- End timeline --><br />
<br />
<br />
<style type="text/css"><br />
#ip_quote<br />
{<br />
margin-top:0px;<br />
margin-bottom:0px;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:75%;<br />
color:#C22227;<br />
font-size:140%;<br />
line-height:140%;<br />
text-align:justify;<br />
}<br />
</style><br />
</head><br />
</html><br />
<br />
__NOTOC__<br />
= Introduction =<br />
----<br />
<html><br />
<!-- BEGIN TIMELINE WHITEBOX HERE --><br />
<div name="talhistory"><br />
<div id="timeline"><br />
<br />
<ul id="dates"><br />
<li><a href="#" class="dateobject">2009</a></li><br />
<li><a href="#" class="dateobject">2010</a></li><br />
<li><a href="#" class="dateobject">02/11</a></li><br />
<li><a href="#" class="dateobject">10/11</a></li><br />
<li><a href="#" class="dateobject">12/11</a></li><br />
<li><a href="#" class="dateobject">02/12</a></li><br />
<li><a href="#" class="dateobject">04/12</a></li><br />
<li><a href="#" class="dateobject">iGEM'12</a></li><br />
</ul><br />
<br />
<br />
<div id="grad_left"></div><br />
<br />
<div id="grad_right"></div><br />
<br />
<a href="#" id="next">+</a><br />
<br />
<a href="#" id="prev">-</a><br />
<br />
<br />
<ul id="issues"><br />
<br />
<br />
<br />
<li id="#2009"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_09.png" width="256" height="170" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2009</div><br />
<br />
<p>Two research groups publish the TAL Effector codes in the same issue of Science: Amino acid 12 and 13 of every DNA binding module specifically binds to one nucleotide</p><br />
<br />
</li><br />
<br />
<br />
<li id="#2010"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_10.png" width="256" height="200" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2010</div><br />
<br />
<p>Voytas Lab develops TALENs. These fusion proteins of FokI and a TAL protein cut as dimers and allow researchers to cut virtually anywhere in the genome. Since double strand breaks increase efficiency of homologous recombination, TALENS are a powerful tool for genetic engineering and gene therapy</p><br />
<br />
</li><br />
<br />
<li id="#02/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/02_11.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">February 2011</div><br />
<br />
<p>Based on an exclusive licensing agreement with the University of Minnasota, Cellectis bioresearch launches its TAL effector product line. One TALEN pair currently costs 5000 Euro (6454 US$, 26.10.12).</p><br />
<br />
</li><br />
<br />
<br />
<li id="#10/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_11.png" width="210" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2011</div><br />
<br />
<p>The iGEM team from Harvard University employed fancy and expensive techniques to find up to 15 new zinc fingers (each of which binds to 3 bp). There has to be a better way…</p><br />
<br />
</li><br />
<br />
<br />
<li id="#12/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/12_11.png" width="210" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">December 2011</div><br />
<br />
<p>Nature chooses TALENs as the 2011 Method of the year.</p><br />
<br />
</li><br />
<br />
<li id="#02/2012"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/02_12.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">February 2012</div><br />
<br />
<p>The first two crystal structures of TALE modules bound to DNA published in the same issue of Science. The protein literally wraps itself around the DNA double helix and forms these beautiful symmetric shapes.</p><br />
<br />
</li><br />
<br />
<br />
<br />
<li id="#04/2012"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/04_12.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">April 2012</div><br />
<br />
<p>Joung lab publishes FLASH assembly in Nature Biotechnology. This first automatable TAL assembly platform facilitates assembly of 96 TAL DNA fragments in less than a day using a pipeting robot.</p><br />
<br />
</li><br />
<br />
<br />
<li id="freiGEM'12"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_12.png" width="200" height="130" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2012</div><br />
<br />
<p>The Freiburg iGEM team makes TALE technology available to everyone by introducing the GATE assembly kit. For TALEs targeting 14 bp, this platform is currently the fastest, cheapest and easiest method in the world.</p><br />
<br />
</li><br />
<br />
</ul><br />
<br />
<br />
</div><br />
</div><br />
<br />
<!-- END TIMELINE WHITEBOX HERE --><br />
<br />
<br />
<p><div align="justify">Originally, TAL proteins are virulence factors of the plant-pathogenic ''Xanthomonas spp.'' that are injected into plant cells via a type III secretion system in order to modulate transcription<sup>1</sup>. For this purpose, their c-terminal end contains a nuclear localisation signal (NLS) and an acidic activation domain. The central part of the TAL protein contains a number of almost similar repeats that mediate specific binding to target loci in the genome.<br />
In 2009, two groups have simultaneously pointed out that each of these repeats specifically binds to one base of the target DNA via two amino acids (aa 12 and 13), named the repeat variable diresidues (RVD)<sup>2</sup>. Moreover, it has been shown that DNA binding of these proteins is highly modular, i.e. the number of bases or sequence of the target DNA can be altered by adjusting the number or order of the repeats in the TAL protein, respectively.<br />
The minimal condition for TALE activity is a thymine at the 5’ end of the target sequence. Further target sequence requirements that allow for one TALEN pair binding site every 35 bp (published by the Voytas lab in 2011<sup>3</sup>) have recently been questioned by Reyon et al.<sup>4</sup> In summary, it is very likely that you can find multiple potential TALE binding sites in any sequence you want to target.<br />
This, obviously, is very promising for biotechnological and clinical applications. Thus, two major classes of TAL Effectors have been created by replacing the natural acidic activation domain either by other transcription factors (TALE-TFs) <sup>5</sup> or by a monomer of the non-sequence specific nuclease FokI, resulting in TAL Effector Nucleases (TALENS).<sup>6</sup> A pair of TALENs can be designed to bind adjacent DNA sequences in a way that the two monomers are able to form a functional FokI dimer that produces a double strand break (DBS) within the spacer between the TAL-Effectors (see figure 2). <br><br><br />
<img src="https://static.igem.org/mediawiki/2012/9/9b/TAL-figure13T.png" width="500px" style="margin-left:130px"/><br><div align="center">Figure 2: Schematic drawings of a TAL-TF and a TALEN pair<sup>13</sup></div><br><br><br />
<br />
Subsequently, the cell repairs the DBS by either non-homologous end joining (NHEJ, which results in indels at the DSB-site) or homologous recombination of exogenously added genetic material. That way, TALENs allow researchers to introduce genes into a genome with much higher efficiency than before.<br />
In this context, TALENs and TALE-TF have successfully been applied for manipulation of a series of genes in different organisms such as yeast<sup>7</sup>, tobacco<sup>3</sup>, fruitflies<sup>6,8</sup>,worms<sup>6,9</sup>, zebrafish<sup>10</sup>, rats<sup>11</sup> and various human cell types, including human stem cells<sup>12</sup>. Moreover, TALENs are already applied for gene therapy in preclinical trials.<br><br><br />
<br />
<br />
<br><br><br><br><br />
<div style="color: #1C649F; font-size: 20px;font-family: Gill Sans MT">References</div><br><br />
1. Scholze, H. & Boch, J. TAL effectors are remote controls for gene activation. ''Current Opinion in Microbiology'' 14, 47–53 (2011).<br><br />
2. Moscou, M. J. & Bogdanove, A. J. A Simple Cipher Governs DNA Recognition by TAL Effectors. ''Science'' 326, 1501–1501 (2009).<br><br />
3. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucleic Acids Res'' 39, e82 (2011).<br><br />
4. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nature Biotechnology'' 30, 460–465 (2012).<br><br />
5. Zhang, F. et al. Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. ''Nature biotechnology'' 29, 149–153 (2011).<br><br />
6. Miller, J. C. et al. A TALE nuclease architecture for efficient genome editing. ''Nature Biotechnology'' 29, 143–148 (2010).<br><br />
7. Boch, J. et al. Breaking the Code of DNA Binding Specificity of TAL-Type III Effectors. ''Science'' 326, 1509–1512 (2009).<br />
8. Liu, J. et al. Efficient and Specific Modifications of the Drosophila Genome by Means of an Easy TALEN Strategy. ''Journal of Genetics and Genomics'' 39, 209–215 (2012).<br><br />
9. Wood, A. J. et al. Targeted Genome Editing Across Species Using ZFNs and TALENs. ''Science'' 333, 307–307 (2011).<br><br />
10. Sander, J. D. et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. ''Nat Biotechnol'' 29, 697–698 (2011).<br><br />
11. Tesson, L. et al. Knockout rats generated by embryo microinjection of TALENs. ''Nature Biotechnology'' 29, 695–696 (2011).<br><br />
12. Hockemeyer, D. et al. Genetic engineering of human pluripotent cells using TALE nucleases. ''Nature Biotechnology'' 29, 731–734 (2011)<br />
13. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br />
<br />
<br><br><br />
</html><br />
[[#top|Back to top]]</div>Luboehttp://2012.igem.org/Team:Freiburg/Project/IntroTeam:Freiburg/Project/Intro2012-10-26T22:46:23Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<html><br />
<head><br />
<!-- Timeline script adapted from http://www.csslab.cl/2011/08/18/jquery-timelinr/. Thanks!! --><br />
<br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8"/><br />
<br />
<link rel="stylesheet" href="<br />
http://omnibus.uni-freiburg.de/~lb125/css/style.css" type="text/css" media="screen" /><br />
<br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.6.2/jquery.min.js" type="text/javascript"></script><br />
<br />
<script src="http://omnibus.uni-freiburg.de/~lb125/js/jquery.timelinr-0.9.51.js" type="text/javascript"></script><br />
<br />
<script type="text/javascript"> <br />
<br />
$(function(){<br />
$().timelinr({<br />
orientation: 'horizontal',<br />
containerDiv: '#timeline',<br />
datesDiv: '#dates',<br />
datesSelectedClass: 'selected',<br />
datesSpeed: 'normal',<br />
issuesDiv : '#issues',<br />
issuesSelectedClass: 'selected',<br />
issuesSpeed: 'fast',<br />
issuesTransparency: 0.2,<br />
issuesTransparencySpeed: 500,<br />
prevButton: '#prev',<br />
nextButton: '#next',<br />
arrowKeys: 'false',<br />
startAt: 1,<br />
autoPlay: 'false',<br />
autoPlayDirection: 'forward',<br />
autoPlayPause: 2000<br />
});<br />
});<br />
<br />
</script><br />
<br />
<!-- End timeline --><br />
<br />
<br />
<style type="text/css"><br />
#ip_quote<br />
{<br />
margin-top:0px;<br />
margin-bottom:0px;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:75%;<br />
color:#C22227;<br />
font-size:140%;<br />
line-height:140%;<br />
text-align:justify;<br />
}<br />
</style><br />
</head><br />
</html><br />
<br />
__NOTOC__<br />
= Introduction =<br />
----<br />
<html><br />
<!-- BEGIN TIMELINE WHITEBOX HERE --><br />
<div name="talhistory"><br />
<div id="timeline"><br />
<br />
<ul id="dates"><br />
<li><a href="#" class="dateobject">2009</a></li><br />
<li><a href="#" class="dateobject">2010</a></li><br />
<li><a href="#" class="dateobject">02/11</a></li><br />
<li><a href="#" class="dateobject">10/11</a></li><br />
<li><a href="#" class="dateobject">12/11</a></li><br />
<li><a href="#" class="dateobject">02/12</a></li><br />
<li><a href="#" class="dateobject">04/12</a></li><br />
<li><a href="#" class="dateobject">iGEM'12</a></li><br />
</ul><br />
<br />
<br />
<div id="grad_left"></div><br />
<br />
<div id="grad_right"></div><br />
<br />
<a href="#" id="next">+</a><br />
<br />
<a href="#" id="prev">-</a><br />
<br />
<br />
<ul id="issues"><br />
<br />
<br />
<br />
<li id="#2009"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_09.png" width="256" height="170" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2009</div><br />
<br />
<p>Two research groups publish the TAL Effector codes in the same issue of Science: Amino acid 12 and 13 of every DNA binding module specifically binds to one nucleotide</p><br />
<br />
</li><br />
<br />
<br />
<li id="#2010"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_10.png" width="256" height="200" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2010</div><br />
<br />
<p>Voytas Lab develops TALENs. These fusion proteins of FokI and a TAL protein cut as dimers and allow researchers to cut virtually anywhere in the genome. Since double strand breaks increase efficiency of homologous recombination, TALENS are a powerful tool for genetic engineering and gene therapy</p><br />
<br />
</li><br />
<br />
<li id="#02/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/02_11.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">February 2011</div><br />
<br />
<p>Based on an exclusive licensing agreement with the University of Minnasota, Cellectis bioresearch launches its TAL effector product line. One TALEN pair currently costs 5000 Euro (6454 US$, 26.10.12).</p><br />
<br />
</li><br />
<br />
<br />
<li id="#10/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_11.png" width="210" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2011</div><br />
<br />
<p>The iGEM team from Harvard University employed fancy and expensive techniques to find up to 15 new zinc fingers (each of which binds to 3 bp). There has to be a better way…</p><br />
<br />
</li><br />
<br />
<br />
<li id="#12/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/12_11.png" width="210" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">December 2011</div><br />
<br />
<p>Nature chooses TALENs as the 2011 Method of the year.</p><br />
<br />
</li><br />
<br />
<li id="#02/2012"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/02_12.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">February 2012</div><br />
<br />
<p>The first two crystal structures of TALE modules bound to DNA published in the same issue of Science. The protein literally wraps itself around the DNA double helix and forms these beautiful symmetric shapes.</p><br />
<br />
</li><br />
<br />
<br />
<br />
<li id="#04/2012"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/04_12.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">April 2012</div><br />
<br />
<p>Joung lab publishes FLASH assembly in Nature Biotechnology. This first automatable TAL assembly platform facilitates assembly of 96 TAL DNA fragments in less than a day using a pipeting robot.</p><br />
<br />
</li><br />
<br />
<br />
<li id="freiGEM'12"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_12.png" width="200" height="130" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2012</div><br />
<br />
<p>The Freiburg iGEM team makes TALE technology available to everyone by introducing the GATE assembly kit. For TALEs targeting 14 bp, this platform is currently the fastest, cheapest and easiest method in the world.</p><br />
<br />
</li><br />
<br />
</ul><br />
<br />
<br />
</div><br />
</div><br />
<br />
<!-- END TIMELINE WHITEBOX HERE --><br />
<br />
<br />
<p><div align="justify">Originally, TAL proteins are virulence factors of the plant-pathogenic ''Xanthomonas spp.'' that are injected into plant cells via a type III secretion system in order to modulate transcription<sup>1</sup>. For this purpose, their c-terminal end contains a nuclear localisation signal (NLS) and an acidic activation domain. The central part of the TAL protein contains a number of almost similar repeats that mediate specific binding to target loci in the genome.<br />
In 2009, two groups have simultaneously pointed out that each of these repeats specifically binds to one base of the target DNA via two amino acids (aa 12 and 13), named the repeat variable diresidues (RVD)<sup>2</sup>. Moreover, it has been shown that DNA binding of these proteins is highly modular, i.e. the number of bases or sequence of the target DNA can be altered by adjusting the number or order of the repeats in the TAL protein, respectively.<br />
The minimal condition for TALE activity is a thymine at the 5’ end of the target sequence. Further target sequence requirements that allow for one TALEN pair binding site every 35 bp (published by the Voytas lab in 2011<sup>3</sup>) have recently been questioned by Reyon et al.<sup>4</sup> In summary, it is very likely that you can find multiple potential TALE binding sites in any sequence you want to target.<br />
This, obviously, is very promising for biotechnological and clinical applications. Thus, two major classes of TAL Effectors have been created by replacing the natural acidic activation domain either by other transcription factors (TALE-TFs) <sup>5</sup> or by a monomer of the non-sequence specific nuclease FokI, resulting in TAL Effector Nucleases (TALENS).<sup>6</sup> A pair of TALENs can be designed to bind adjacent DNA sequences in a way that the two monomers are able to form a functional FokI dimer that produces a double strand break (DBS) within the spacer between the TAL-Effectors (see figure 2). <br><br><br />
<img src="https://static.igem.org/mediawiki/2012/9/9b/TAL-figure13T.png" width="500px" style="margin-left:130px"/><br><div align="center">Figure 2: Schematic drawings of a TAL-TF and a TALEN pair<sup>13</sup></div><br><br><br />
<br />
Subsequently, the cell repairs the DBS by either non-homologous end joining (NHEJ, which results in indels at the DSB-site) or homologous recombination of exogenously added genetic material. That way, TALENs allow researchers to introduce genes into a genome with much higher efficiency than before.<br />
In this context, TALENs and TALE-TF have successfully been applied for manipulation of a series of genes in different organisms such as yeast<sup>7</sup>, tobacco<sup>3</sup>, fruitflies<sup>6,8</sup>,worms<sup>6,9</sup>, zebrafish<sup>10</sup>, rats<sup>11</sup> and various human cell types, including human stem cells<sup>12</sup>. Moreover, TALENs are already applied for gene therapy in preclinical trials.<br><br><br />
<br />
<br />
<br><br><br><br />
<div style="color: #1C649F; font-size: 20px;font-family: Gill Sans MT">References</div><br><br />
1. Scholze, H. & Boch, J. TAL effectors are remote controls for gene activation. ''Current Opinion in Microbiology'' 14, 47–53 (2011).<br><br />
2. Moscou, M. J. & Bogdanove, A. J. A Simple Cipher Governs DNA Recognition by TAL Effectors. ''Science'' 326, 1501–1501 (2009).<br><br />
3. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucleic Acids Res'' 39, e82 (2011).<br><br />
4. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nature Biotechnology'' 30, 460–465 (2012).<br><br />
5. Zhang, F. et al. Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. ''Nature biotechnology'' 29, 149–153 (2011).<br><br />
6. Miller, J. C. et al. A TALE nuclease architecture for efficient genome editing. ''Nature Biotechnology'' 29, 143–148 (2010).<br><br />
7. Boch, J. et al. Breaking the Code of DNA Binding Specificity of TAL-Type III Effectors. ''Science'' 326, 1509–1512 (2009).<br />
8. Liu, J. et al. Efficient and Specific Modifications of the Drosophila Genome by Means of an Easy TALEN Strategy. ''Journal of Genetics and Genomics'' 39, 209–215 (2012).<br><br />
9. Wood, A. J. et al. Targeted Genome Editing Across Species Using ZFNs and TALENs. ''Science'' 333, 307–307 (2011).<br><br />
10. Sander, J. D. et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. ''Nat Biotechnol'' 29, 697–698 (2011).<br><br />
11. Tesson, L. et al. Knockout rats generated by embryo microinjection of TALENs. ''Nature Biotechnology'' 29, 695–696 (2011).<br><br />
12. Hockemeyer, D. et al. Genetic engineering of human pluripotent cells using TALE nucleases. ''Nature Biotechnology'' 29, 731–734 (2011)<br />
13. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br />
<br />
<br><br><br />
</html><br />
[[#top|Back to top]]</div>Luboehttp://2012.igem.org/File:Schema_tal_protein.pngFile:Schema tal protein.png2012-10-26T22:45:19Z<p>Luboe: </p>
<hr />
<div></div>Luboehttp://2012.igem.org/Team:FreiburgTeam:Freiburg2012-10-26T22:38:44Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<br />
<html><br />
<head><br />
<br />
<link rel="stylesheet" href="http://omnibus.uni-freiburg.de/~lb125/linking/css/global.css"><br />
<br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.5.1/jquery.min.js"></script><br />
<script src="http://omnibus.uni-freiburg.de/~lb125/linking/js/slides.min.jquery.js"></script><br />
<script><br />
$(function(){<br />
// Set starting slide to 1<br />
var startSlide = 1;<br />
// Get slide number if it exists<br />
if (window.location.hash) {<br />
startSlide = window.location.hash.replace('#','');<br />
}<br />
// Initialize Slides<br />
$('#slides').slides({<br />
preload: true,<br />
preloadImage: 'img/loading.gif',<br />
generatePagination: true,<br />
play: 0,<br />
pause: 2500,<br />
hoverPause: true,<br />
// Get the starting slide<br />
start: startSlide,<br />
animationComplete: function(current){<br />
// Set the slide number as a hash<br />
window.location.hash = '#' + current;<br />
}<br />
});<br />
});<br />
</script><br />
<br />
<br />
<br />
<br />
</head><br />
<body><br />
<br />
<div id="container"><br />
<div id="example"><br />
<div id="slides"><br />
<div class="slides_container"><br />
<br />
<br />
<div class="slide"><br />
<h1>Let us tell you a fabulous TALE...</h1><br />
Transactivator-Like Effectors (TALEs) are a brand-new technology that currently revolutionizes the way researchers manipulate DNA with exceptional site specificity. Originally derived from ''Xanthomonas spp.'', this type of protein comprizes an effector domain and a modular DNA binding domain that can be rationally designed to bind to virtually any target sequence of DNA. Over the past two years, universal endonucleases (TALENs) and transcription factors have been tested in various organisms ranging from bacteria to humans. According to existing protocols, TALE assembly requires several weeks of work and substantial lab skills. In order to bring this technology within reach for iGEM students, we invented an extremely fast and easy TALE assembly strategy and developed a TALE platform with expression plasmids and new classes of TALEs. With our so called GATE assembly kit, future iGEM students will be able to precisely manipulate genomic loci easier and faster than anyone else in the world.<br />
</div><br />
<br />
<div class="slide"><br />
<h1>European iGEM Jamboree 2012 Amsterdam:</h1><br />
Team freiGEM won a gold medal and a special prize for the 'Best New BioBrick Part or Device, Engineered'! Team freiGEM also advanced to World Championship in Boston!<br />
<p align="center"><A HREF="http://www.flickr.com/photos/igemeurope/8096765971/in/photostream/" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/won1.png' width="75%" height="75%"/></A></p><br />
</div><br />
<br />
<div class="slide"><br />
<h1><iframe style="margin-left:10px" align="right" width="300" height="250" src="http://player.vimeo.com/video/49902809" frameborder="0" webkitAllowFullScreen mozallowfullscreen allowFullScreen></iframe>Watch our freiGEM movie...<h1><br />
<br><br />
<h1>...or get some impressions in the freiGEM Photo Gallery:</h1><br />
<p><a style="font-weight:bold; font-size:1.3em;" href="/Team:Freiburg/gallery">FreiGEM 2012 Gallery</a></p><br />
</div><br />
<br />
<div class="slide"><br />
<h1><iframe style="margin-right:10px" align="left" width="300" height="250" src="http://player.vimeo.com/video/52254697?badge=0" frameborder="0" webkitAllowFullScreen mozallowfullscreen allowFullScreen></iframe>See how easy it is to get your own custom made TAL...</h1><br />
<br><br><br />
<h1>For further information visit our project page:</h1><br />
<p><a style="font-weight:bold; font-size:1.3em;" href="/Team:Freiburg/Project">Overview TAL Project</a></p><br />
</div><br />
<br />
</div><br />
<a href="#" class="prev"><img src="http://omnibus.uni-freiburg.de/~lb125/linking/img/arrow-prev.png" width="24" height="43" alt="Arrow Prev"></a><br />
<a href="#" class="next"><img src="http://omnibus.uni-freiburg.de/~lb125/linking/img/arrow-next.png" width="24" height="43" alt="Arrow Next"></a><br />
</div><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/linking/img/example-frame.png" width="739" height="420" alt="Example Frame" id="frame"><br />
</div><br />
</div><br />
</body><br />
</html><br />
<br />
<br />
<br />
<html><br />
<div style="position:absolute; top:550px;"><br />
<p style="text-align:center"><br />
<span style="color:#4F8DDE; font-weight:bold;"><br />
With kind support of<br />
<br><br />
<br><br />
</span><br />
<A HREF="http://www.bioss.uni-freiburg.de/cms/index.php" target="_blank"><img class="thumbnail" img src="https://static.igem.org/mediawiki/2012/7/7b/Logo_bioss.gif" width= "200" /></A><br />
<A HREF="http://www.med.uni-freiburg.de/" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/uniklinik.png' width= "250"/></A><br />
<img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/metabion.png' width= "180"/><br />
<A HREF="http://www.genscript.com/" target="_blank"><img class="thumbnail" img src='https://static.igem.org/mediawiki/2012/0/0d/Genscript_logo.gif' width= "180"/></A><br />
<A HREF="http://eu.idtdna.com/site" target="_blank"><img class="thumbnail" img src='https://static.igem.org/mediawiki/2012/2/21/IDTLogo2010.png' width= "200"/></A><br />
<A HREF="http://www.lifetechnologies.com" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/life.png' width= "150"/></A><br />
<A HREF="http://www.eurofinsdna.com/home.html" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/eurofins.jpg' width= "150"/></A><br />
<img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/gatc.png' width= "150"/><br />
<A HREF="http://www.erasynbio.net/" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/erasynbio.png' width= "200"/></A><br />
</p><br />
</div><br />
</html><br />
<br />
<br />
<br />
<!--- The Mission, Experiments ---></div>Luboehttp://2012.igem.org/Team:FreiburgTeam:Freiburg2012-10-26T22:33:37Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<br />
<html><br />
<head><br />
<br />
<link rel="stylesheet" href="http://omnibus.uni-freiburg.de/~lb125/linking/css/global.css"><br />
<br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.5.1/jquery.min.js"></script><br />
<script src="http://omnibus.uni-freiburg.de/~lb125/linking/js/slides.min.jquery.js"></script><br />
<script><br />
$(function(){<br />
// Set starting slide to 1<br />
var startSlide = 1;<br />
// Get slide number if it exists<br />
if (window.location.hash) {<br />
startSlide = window.location.hash.replace('#','');<br />
}<br />
// Initialize Slides<br />
$('#slides').slides({<br />
preload: true,<br />
preloadImage: 'img/loading.gif',<br />
generatePagination: true,<br />
play: 0,<br />
pause: 2500,<br />
hoverPause: true,<br />
// Get the starting slide<br />
start: startSlide,<br />
animationComplete: function(current){<br />
// Set the slide number as a hash<br />
window.location.hash = '#' + current;<br />
}<br />
});<br />
});<br />
</script><br />
<br />
<br />
<br />
<br />
</head><br />
<body><br />
<br />
<div id="container"><br />
<div id="example"><br />
<div id="slides"><br />
<div class="slides_container"><br />
<br />
<br />
<div class="slide"><br />
<h1>Let us tell you a fabulous TALE...</h1><br />
Transactivator-Like Effectors (TALEs) are a brand-new technology that currently revolutionizes the way researchers manipulate DNA with exceptional site specificity. Originally derived from ''Xanthomonas spp.'', this type of protein comprizes an effector domain and a modular DNA binding domain that can be rationally designed to bind to virtually any target sequence of DNA. Over the past two years, universal endonucleases (TALENs) and transcription factors have been tested in various organisms ranging from bacteria to humans. According to existing protocols, TALE assembly requires several weeks of work and substantial lab skills. In order to bring this technology within reach for iGEM students, we invented an extremely fast and easy TALE assembly strategy and developed a TALE platform with expression plasmids and new classes of TALEs. With our so called GATE assembly kit, future iGEM students will be able to precisely manipulate genomic loci easier and faster than anyone else in the world.<br />
</div><br />
<br />
<div class="slide"><br />
<h1>European iGEM Jamboree 2012 Amsterdam:</h1><br />
Team freiGEM won a gold medal and a special prize for the 'Best New BioBrick Part or Device, Engineered'! Team freiGEM also advanced to World Championship in Boston!<br />
<p align="center"><A HREF="http://www.flickr.com/photos/igemeurope/8096765971/in/photostream/" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/won1.png' width="75%" height="75%"/></A></p><br />
</div><br />
<br />
<div class="slide"><br />
<h1><iframe align="right" width="300" height="250" vspace="10" hspace="20" src="http://player.vimeo.com/video/49902809" frameborder="0" webkitAllowFullScreen mozallowfullscreen allowFullScreen></iframe>Watch our freiGEM movie...<h1><br />
<br><br />
<h1>...or get some impressions in the freiGEM Photo Gallery:</h1><br />
<p><a style="font-weight:bold; font-size:1.3em;" href="/Team:Freiburg/gallery">FreiGEM 2012 Gallery</a></p><br />
</div><br />
<br />
<div class="slide"><br />
<h1><iframe style="margin-right:10px" align="left" width="300" height="250" src="http://player.vimeo.com/video/52254697?badge=0" frameborder="0" webkitAllowFullScreen mozallowfullscreen allowFullScreen></iframe>See how easy it is to get your own custom made TAL...</h1><br />
<br><br><br />
<h1>For further information visit our project page:</h1><br />
<p><a style="font-weight:bold; font-size:1.3em;" href="/Team:Freiburg/Project">Overview TAL Project</a></p><br />
</div><br />
<br />
</div><br />
<a href="#" class="prev"><img src="http://omnibus.uni-freiburg.de/~lb125/linking/img/arrow-prev.png" width="24" height="43" alt="Arrow Prev"></a><br />
<a href="#" class="next"><img src="http://omnibus.uni-freiburg.de/~lb125/linking/img/arrow-next.png" width="24" height="43" alt="Arrow Next"></a><br />
</div><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/linking/img/example-frame.png" width="739" height="420" alt="Example Frame" id="frame"><br />
</div><br />
</div><br />
</body><br />
</html><br />
<br />
<br />
<br />
<html><br />
<div style="position:absolute; top:550px;"><br />
<p style="text-align:center"><br />
<span style="color:#4F8DDE; font-weight:bold;"><br />
With kind support of<br />
<br><br />
<br><br />
</span><br />
<A HREF="http://www.bioss.uni-freiburg.de/cms/index.php" target="_blank"><img class="thumbnail" img src="https://static.igem.org/mediawiki/2012/7/7b/Logo_bioss.gif" width= "200" /></A><br />
<A HREF="http://www.med.uni-freiburg.de/" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/uniklinik.png' width= "250"/></A><br />
<img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/metabion.png' width= "180"/><br />
<A HREF="http://www.genscript.com/" target="_blank"><img class="thumbnail" img src='https://static.igem.org/mediawiki/2012/0/0d/Genscript_logo.gif' width= "180"/></A><br />
<A HREF="http://eu.idtdna.com/site" target="_blank"><img class="thumbnail" img src='https://static.igem.org/mediawiki/2012/2/21/IDTLogo2010.png' width= "200"/></A><br />
<A HREF="http://www.lifetechnologies.com" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/life.png' width= "150"/></A><br />
<A HREF="http://www.eurofinsdna.com/home.html" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/eurofins.jpg' width= "150"/></A><br />
<img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/gatc.png' width= "150"/><br />
<A HREF="http://www.erasynbio.net/" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/erasynbio.png' width= "200"/></A><br />
</p><br />
</div><br />
</html><br />
<br />
<br />
<br />
<!--- The Mission, Experiments ---></div>Luboehttp://2012.igem.org/Team:FreiburgTeam:Freiburg2012-10-26T22:33:14Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<br />
<html><br />
<head><br />
<br />
<link rel="stylesheet" href="http://omnibus.uni-freiburg.de/~lb125/linking/css/global.css"><br />
<br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.5.1/jquery.min.js"></script><br />
<script src="http://omnibus.uni-freiburg.de/~lb125/linking/js/slides.min.jquery.js"></script><br />
<script><br />
$(function(){<br />
// Set starting slide to 1<br />
var startSlide = 1;<br />
// Get slide number if it exists<br />
if (window.location.hash) {<br />
startSlide = window.location.hash.replace('#','');<br />
}<br />
// Initialize Slides<br />
$('#slides').slides({<br />
preload: true,<br />
preloadImage: 'img/loading.gif',<br />
generatePagination: true,<br />
play: 0,<br />
pause: 2500,<br />
hoverPause: true,<br />
// Get the starting slide<br />
start: startSlide,<br />
animationComplete: function(current){<br />
// Set the slide number as a hash<br />
window.location.hash = '#' + current;<br />
}<br />
});<br />
});<br />
</script><br />
<br />
<br />
<br />
<br />
</head><br />
<body><br />
<br />
<div id="container"><br />
<div id="example"><br />
<div id="slides"><br />
<div class="slides_container"><br />
<br />
<br />
<div class="slide"><br />
<h1>Let us tell you a fabulous TALE...</h1><br />
Transactivator-Like Effectors (TALEs) are a brand-new technology that currently revolutionizes the way researchers manipulate DNA with exceptional site specificity. Originally derived from ''Xanthomonas spp.'', this type of protein comprizes an effector domain and a modular DNA binding domain that can be rationally designed to bind to virtually any target sequence of DNA. Over the past two years, universal endonucleases (TALENs) and transcription factors have been tested in various organisms ranging from bacteria to humans. According to existing protocols, TALE assembly requires several weeks of work and substantial lab skills. In order to bring this technology within reach for iGEM students, we invented an extremely fast and easy TALE assembly strategy and developed a TALE platform with expression plasmids and new classes of TALEs. With our so called GATE assembly kit, future iGEM students will be able to precisely manipulate genomic loci easier and faster than anyone else in the world.<br />
</div><br />
<br />
<div class="slide"><br />
<h1>European iGEM Jamboree 2012 Amsterdam:</h1><br />
Team freiGEM won a gold medal and a special prize for the 'Best New BioBrick Part or Device, Engineered'! Team freiGEM also advanced to World Championship in Boston!<br />
<p align="center"><A HREF="http://www.flickr.com/photos/igemeurope/8096765971/in/photostream/" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/won1.png' width="75%" height="75%"/></A></p><br />
</div><br />
<br />
<div class="slide"><br />
<h1><iframe align="right" width="300" height="250" vspace="10" hspace="20" src="http://player.vimeo.com/video/49902809" frameborder="0" webkitAllowFullScreen mozallowfullscreen allowFullScreen></iframe>Watch our freiGEM movie...<h1><br />
<br><br />
<h1>...or get some impressions in the freiGEM Photo Gallery:</h1><br />
<p><a style="font-weight:bold; font-size:1.3em;" href="/Team:Freiburg/gallery">FreiGEM 2012 Gallery</a></p><br />
</div><br />
<br />
<div class="slide"><br />
<h1><iframe style="margin-right:10px" align="left" width="300" height="250" src="http://player.vimeo.com/video/52254697?badge=0" frameborder="0" webkitAllowFullScreen mozallowfullscreen allowFullScreen></iframe>See how easy it is to get your own custom made TAL...</h1><br />
<br><br />
<h1>For further information visit our project page:</h1><br />
<p><a style="font-weight:bold; font-size:1.3em;" href="/Team:Freiburg/Project">Overview TAL Project</a></p><br />
</div><br />
<br />
</div><br />
<a href="#" class="prev"><img src="http://omnibus.uni-freiburg.de/~lb125/linking/img/arrow-prev.png" width="24" height="43" alt="Arrow Prev"></a><br />
<a href="#" class="next"><img src="http://omnibus.uni-freiburg.de/~lb125/linking/img/arrow-next.png" width="24" height="43" alt="Arrow Next"></a><br />
</div><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/linking/img/example-frame.png" width="739" height="420" alt="Example Frame" id="frame"><br />
</div><br />
</div><br />
</body><br />
</html><br />
<br />
<br />
<br />
<html><br />
<div style="position:absolute; top:550px;"><br />
<p style="text-align:center"><br />
<span style="color:#4F8DDE; font-weight:bold;"><br />
With kind support of<br />
<br><br />
<br><br />
</span><br />
<A HREF="http://www.bioss.uni-freiburg.de/cms/index.php" target="_blank"><img class="thumbnail" img src="https://static.igem.org/mediawiki/2012/7/7b/Logo_bioss.gif" width= "200" /></A><br />
<A HREF="http://www.med.uni-freiburg.de/" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/uniklinik.png' width= "250"/></A><br />
<img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/metabion.png' width= "180"/><br />
<A HREF="http://www.genscript.com/" target="_blank"><img class="thumbnail" img src='https://static.igem.org/mediawiki/2012/0/0d/Genscript_logo.gif' width= "180"/></A><br />
<A HREF="http://eu.idtdna.com/site" target="_blank"><img class="thumbnail" img src='https://static.igem.org/mediawiki/2012/2/21/IDTLogo2010.png' width= "200"/></A><br />
<A HREF="http://www.lifetechnologies.com" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/life.png' width= "150"/></A><br />
<A HREF="http://www.eurofinsdna.com/home.html" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/eurofins.jpg' width= "150"/></A><br />
<img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/gatc.png' width= "150"/><br />
<A HREF="http://www.erasynbio.net/" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/erasynbio.png' width= "200"/></A><br />
</p><br />
</div><br />
</html><br />
<br />
<br />
<br />
<!--- The Mission, Experiments ---></div>Luboehttp://2012.igem.org/Team:FreiburgTeam:Freiburg2012-10-26T22:32:30Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<br />
<html><br />
<head><br />
<br />
<link rel="stylesheet" href="http://omnibus.uni-freiburg.de/~lb125/linking/css/global.css"><br />
<br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.5.1/jquery.min.js"></script><br />
<script src="http://omnibus.uni-freiburg.de/~lb125/linking/js/slides.min.jquery.js"></script><br />
<script><br />
$(function(){<br />
// Set starting slide to 1<br />
var startSlide = 1;<br />
// Get slide number if it exists<br />
if (window.location.hash) {<br />
startSlide = window.location.hash.replace('#','');<br />
}<br />
// Initialize Slides<br />
$('#slides').slides({<br />
preload: true,<br />
preloadImage: 'img/loading.gif',<br />
generatePagination: true,<br />
play: 0,<br />
pause: 2500,<br />
hoverPause: true,<br />
// Get the starting slide<br />
start: startSlide,<br />
animationComplete: function(current){<br />
// Set the slide number as a hash<br />
window.location.hash = '#' + current;<br />
}<br />
});<br />
});<br />
</script><br />
<br />
<br />
<br />
<br />
</head><br />
<body><br />
<br />
<div id="container"><br />
<div id="example"><br />
<div id="slides"><br />
<div class="slides_container"><br />
<br />
<br />
<div class="slide"><br />
<h1>Let us tell you a fabulous TALE...</h1><br />
Transactivator-Like Effectors (TALEs) are a brand-new technology that currently revolutionizes the way researchers manipulate DNA with exceptional site specificity. Originally derived from ''Xanthomonas spp.'', this type of protein comprizes an effector domain and a modular DNA binding domain that can be rationally designed to bind to virtually any target sequence of DNA. Over the past two years, universal endonucleases (TALENs) and transcription factors have been tested in various organisms ranging from bacteria to humans. According to existing protocols, TALE assembly requires several weeks of work and substantial lab skills. In order to bring this technology within reach for iGEM students, we invented an extremely fast and easy TALE assembly strategy and developed a TALE platform with expression plasmids and new classes of TALEs. With our so called GATE assembly kit, future iGEM students will be able to precisely manipulate genomic loci easier and faster than anyone else in the world.<br />
</div><br />
<br />
<div class="slide"><br />
<h1>European iGEM Jamboree 2012 Amsterdam:</h1><br />
Team freiGEM won a gold medal and a special prize for the 'Best New BioBrick Part or Device, Engineered'! Team freiGEM also advanced to World Championship in Boston!<br />
<p align="center"><A HREF="http://www.flickr.com/photos/igemeurope/8096765971/in/photostream/" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/won1.png' width="75%" height="75%"/></A></p><br />
</div><br />
<br />
<div class="slide"><br />
<h1><iframe align="right" width="300" height="250" vspace="10" hspace="20" src="http://player.vimeo.com/video/49902809" frameborder="0" webkitAllowFullScreen mozallowfullscreen allowFullScreen></iframe>Watch our freiGEM movie...<h1><br />
<br><br />
<h1>...or get some impressions in the freiGEM Photo Gallery:</h1><br />
<p><a style="font-weight:bold; font-size:1.3em;" href="/Team:Freiburg/gallery">FreiGEM 2012 Gallery</a></p><br />
</div><br />
<br />
<div class="slide"><br />
<h1><iframe style="margin-right:10px" marginwidth="0px" marginheight="0px" align="left" width="300" height="250" src="http://player.vimeo.com/video/52254697?badge=0" frameborder="0" webkitAllowFullScreen mozallowfullscreen allowFullScreen></iframe>See how easy it is to get your own custom made TAL...</h1><br />
<br><br><br><br />
<h1>For further information visit our project page:</h1><br />
<p><a style="font-weight:bold; font-size:1.3em;" href="/Team:Freiburg/Project">Overview TAL Project</a></p><br />
</div><br />
<br />
</div><br />
<a href="#" class="prev"><img src="http://omnibus.uni-freiburg.de/~lb125/linking/img/arrow-prev.png" width="24" height="43" alt="Arrow Prev"></a><br />
<a href="#" class="next"><img src="http://omnibus.uni-freiburg.de/~lb125/linking/img/arrow-next.png" width="24" height="43" alt="Arrow Next"></a><br />
</div><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/linking/img/example-frame.png" width="739" height="420" alt="Example Frame" id="frame"><br />
</div><br />
</div><br />
</body><br />
</html><br />
<br />
<br />
<br />
<html><br />
<div style="position:absolute; top:550px;"><br />
<p style="text-align:center"><br />
<span style="color:#4F8DDE; font-weight:bold;"><br />
With kind support of<br />
<br><br />
<br><br />
</span><br />
<A HREF="http://www.bioss.uni-freiburg.de/cms/index.php" target="_blank"><img class="thumbnail" img src="https://static.igem.org/mediawiki/2012/7/7b/Logo_bioss.gif" width= "200" /></A><br />
<A HREF="http://www.med.uni-freiburg.de/" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/uniklinik.png' width= "250"/></A><br />
<img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/metabion.png' width= "180"/><br />
<A HREF="http://www.genscript.com/" target="_blank"><img class="thumbnail" img src='https://static.igem.org/mediawiki/2012/0/0d/Genscript_logo.gif' width= "180"/></A><br />
<A HREF="http://eu.idtdna.com/site" target="_blank"><img class="thumbnail" img src='https://static.igem.org/mediawiki/2012/2/21/IDTLogo2010.png' width= "200"/></A><br />
<A HREF="http://www.lifetechnologies.com" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/life.png' width= "150"/></A><br />
<A HREF="http://www.eurofinsdna.com/home.html" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/eurofins.jpg' width= "150"/></A><br />
<img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/gatc.png' width= "150"/><br />
<A HREF="http://www.erasynbio.net/" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/erasynbio.png' width= "200"/></A><br />
</p><br />
</div><br />
</html><br />
<br />
<br />
<br />
<!--- The Mission, Experiments ---></div>Luboehttp://2012.igem.org/Team:FreiburgTeam:Freiburg2012-10-26T22:31:09Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<br />
<html><br />
<head><br />
<br />
<link rel="stylesheet" href="http://omnibus.uni-freiburg.de/~lb125/linking/css/global.css"><br />
<br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.5.1/jquery.min.js"></script><br />
<script src="http://omnibus.uni-freiburg.de/~lb125/linking/js/slides.min.jquery.js"></script><br />
<script><br />
$(function(){<br />
// Set starting slide to 1<br />
var startSlide = 1;<br />
// Get slide number if it exists<br />
if (window.location.hash) {<br />
startSlide = window.location.hash.replace('#','');<br />
}<br />
// Initialize Slides<br />
$('#slides').slides({<br />
preload: true,<br />
preloadImage: 'img/loading.gif',<br />
generatePagination: true,<br />
play: 0,<br />
pause: 2500,<br />
hoverPause: true,<br />
// Get the starting slide<br />
start: startSlide,<br />
animationComplete: function(current){<br />
// Set the slide number as a hash<br />
window.location.hash = '#' + current;<br />
}<br />
});<br />
});<br />
</script><br />
<br />
<br />
<br />
<br />
</head><br />
<body><br />
<br />
<div id="container"><br />
<div id="example"><br />
<div id="slides"><br />
<div class="slides_container"><br />
<br />
<br />
<div class="slide"><br />
<h1>Let us tell you a fabulous TALE...</h1><br />
Transactivator-Like Effectors (TALEs) are a brand-new technology that currently revolutionizes the way researchers manipulate DNA with exceptional site specificity. Originally derived from ''Xanthomonas spp.'', this type of protein comprizes an effector domain and a modular DNA binding domain that can be rationally designed to bind to virtually any target sequence of DNA. Over the past two years, universal endonucleases (TALENs) and transcription factors have been tested in various organisms ranging from bacteria to humans. According to existing protocols, TALE assembly requires several weeks of work and substantial lab skills. In order to bring this technology within reach for iGEM students, we invented an extremely fast and easy TALE assembly strategy and developed a TALE platform with expression plasmids and new classes of TALEs. With our so called GATE assembly kit, future iGEM students will be able to precisely manipulate genomic loci easier and faster than anyone else in the world.<br />
</div><br />
<br />
<div class="slide"><br />
<h1>European iGEM Jamboree 2012 Amsterdam:</h1><br />
Team freiGEM won a gold medal and a special prize for the 'Best New BioBrick Part or Device, Engineered'! Team freiGEM also advanced to World Championship in Boston!<br />
<p align="center"><A HREF="http://www.flickr.com/photos/igemeurope/8096765971/in/photostream/" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/won1.png' width="75%" height="75%"/></A></p><br />
</div><br />
<br />
<div class="slide"><br />
<h1><iframe align="right" width="300" height="250" vspace="10" hspace="20" src="http://player.vimeo.com/video/49902809" frameborder="0" webkitAllowFullScreen mozallowfullscreen allowFullScreen></iframe>Watch our freiGEM movie...<h1><br />
<br><br />
<h1>...or get some impressions in the freiGEM Photo Gallery:</h1><br />
<p><a style="font-weight:bold; font-size:1.3em;" href="/Team:Freiburg/gallery">FreiGEM 2012 Gallery</a></p><br />
</div><br />
<br />
<div class="slide"><br />
<h1><iframe style="margin:10px" marginwidth="0px" marginheight="0px" align="left" width="300" height="250" src="http://player.vimeo.com/video/52254697?badge=0" frameborder="0" webkitAllowFullScreen mozallowfullscreen allowFullScreen></iframe>See how easy it is to get your own custom made TAL...</h1><br />
<br><br><br><br />
<h1>For further information visit our project page:</h1><br />
<p><a style="font-weight:bold; font-size:1.3em;" href="/Team:Freiburg/Project">Overview TAL Project</a></p><br />
</div><br />
<br />
</div><br />
<a href="#" class="prev"><img src="http://omnibus.uni-freiburg.de/~lb125/linking/img/arrow-prev.png" width="24" height="43" alt="Arrow Prev"></a><br />
<a href="#" class="next"><img src="http://omnibus.uni-freiburg.de/~lb125/linking/img/arrow-next.png" width="24" height="43" alt="Arrow Next"></a><br />
</div><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/linking/img/example-frame.png" width="739" height="420" alt="Example Frame" id="frame"><br />
</div><br />
</div><br />
</body><br />
</html><br />
<br />
<br />
<br />
<html><br />
<div style="position:absolute; top:550px;"><br />
<p style="text-align:center"><br />
<span style="color:#4F8DDE; font-weight:bold;"><br />
With kind support of<br />
<br><br />
<br><br />
</span><br />
<A HREF="http://www.bioss.uni-freiburg.de/cms/index.php" target="_blank"><img class="thumbnail" img src="https://static.igem.org/mediawiki/2012/7/7b/Logo_bioss.gif" width= "200" /></A><br />
<A HREF="http://www.med.uni-freiburg.de/" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/uniklinik.png' width= "250"/></A><br />
<img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/metabion.png' width= "180"/><br />
<A HREF="http://www.genscript.com/" target="_blank"><img class="thumbnail" img src='https://static.igem.org/mediawiki/2012/0/0d/Genscript_logo.gif' width= "180"/></A><br />
<A HREF="http://eu.idtdna.com/site" target="_blank"><img class="thumbnail" img src='https://static.igem.org/mediawiki/2012/2/21/IDTLogo2010.png' width= "200"/></A><br />
<A HREF="http://www.lifetechnologies.com" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/life.png' width= "150"/></A><br />
<A HREF="http://www.eurofinsdna.com/home.html" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/eurofins.jpg' width= "150"/></A><br />
<img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/gatc.png' width= "150"/><br />
<A HREF="http://www.erasynbio.net/" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/erasynbio.png' width= "200"/></A><br />
</p><br />
</div><br />
</html><br />
<br />
<br />
<br />
<!--- The Mission, Experiments ---></div>Luboehttp://2012.igem.org/Team:FreiburgTeam:Freiburg2012-10-26T22:30:16Z<p>Luboe: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<br />
<html><br />
<head><br />
<br />
<link rel="stylesheet" href="http://omnibus.uni-freiburg.de/~lb125/linking/css/global.css"><br />
<br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.5.1/jquery.min.js"></script><br />
<script src="http://omnibus.uni-freiburg.de/~lb125/linking/js/slides.min.jquery.js"></script><br />
<script><br />
$(function(){<br />
// Set starting slide to 1<br />
var startSlide = 1;<br />
// Get slide number if it exists<br />
if (window.location.hash) {<br />
startSlide = window.location.hash.replace('#','');<br />
}<br />
// Initialize Slides<br />
$('#slides').slides({<br />
preload: true,<br />
preloadImage: 'img/loading.gif',<br />
generatePagination: true,<br />
play: 0,<br />
pause: 2500,<br />
hoverPause: true,<br />
// Get the starting slide<br />
start: startSlide,<br />
animationComplete: function(current){<br />
// Set the slide number as a hash<br />
window.location.hash = '#' + current;<br />
}<br />
});<br />
});<br />
</script><br />
<br />
<br />
<br />
<br />
</head><br />
<body><br />
<br />
<div id="container"><br />
<div id="example"><br />
<div id="slides"><br />
<div class="slides_container"><br />
<br />
<br />
<div class="slide"><br />
<h1>Let us tell you a fabulous TALE...</h1><br />
Transactivator-Like Effectors (TALEs) are a brand-new technology that currently revolutionizes the way researchers manipulate DNA with exceptional site specificity. Originally derived from ''Xanthomonas spp.'', this type of protein comprizes an effector domain and a modular DNA binding domain that can be rationally designed to bind to virtually any target sequence of DNA. Over the past two years, universal endonucleases (TALENs) and transcription factors have been tested in various organisms ranging from bacteria to humans. According to existing protocols, TALE assembly requires several weeks of work and substantial lab skills. In order to bring this technology within reach for iGEM students, we invented an extremely fast and easy TALE assembly strategy and developed a TALE platform with expression plasmids and new classes of TALEs. With our so called GATE assembly kit, future iGEM students will be able to precisely manipulate genomic loci easier and faster than anyone else in the world.<br />
</div><br />
<br />
<div class="slide"><br />
<h1>European iGEM Jamboree 2012 Amsterdam:</h1><br />
Team freiGEM won a gold medal and a special prize for the 'Best New BioBrick Part or Device, Engineered'! Team freiGEM also advanced to World Championship in Boston!<br />
<p align="center"><A HREF="http://www.flickr.com/photos/igemeurope/8096765971/in/photostream/" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/won1.png' width="75%" height="75%"/></A></p><br />
</div><br />
<br />
<div class="slide"><br />
<h1><iframe align="right" width="300" height="250" vspace="10" hspace="20" src="http://player.vimeo.com/video/49902809" frameborder="0" webkitAllowFullScreen mozallowfullscreen allowFullScreen></iframe>Watch our freiGEM movie...<h1><br />
<br><br />
<h1>...or get some impressions in the freiGEM Photo Gallery:</h1><br />
<p><a style="font-weight:bold; font-size:1.3em;" href="/Team:Freiburg/gallery">FreiGEM 2012 Gallery</a></p><br />
</div><br />
<br />
<div class="slide"><br />
<h1><iframe style="margin:10px" align="left" width="300" height="250" src="http://player.vimeo.com/video/52254697?badge=0" frameborder="0" webkitAllowFullScreen mozallowfullscreen allowFullScreen></iframe>See how easy it is to get your own custom made TAL...</h1><br />
<br><br><br><br />
<h1>For further information visit our project page:</h1><br />
<p><a style="font-weight:bold; font-size:1.3em;" href="/Team:Freiburg/Project">Overview TAL Project</a></p><br />
</div><br />
<br />
</div><br />
<a href="#" class="prev"><img src="http://omnibus.uni-freiburg.de/~lb125/linking/img/arrow-prev.png" width="24" height="43" alt="Arrow Prev"></a><br />
<a href="#" class="next"><img src="http://omnibus.uni-freiburg.de/~lb125/linking/img/arrow-next.png" width="24" height="43" alt="Arrow Next"></a><br />
</div><br />
<img src="http://omnibus.uni-freiburg.de/~lb125/linking/img/example-frame.png" width="739" height="420" alt="Example Frame" id="frame"><br />
</div><br />
</div><br />
</body><br />
</html><br />
<br />
<br />
<br />
<html><br />
<div style="position:absolute; top:550px;"><br />
<p style="text-align:center"><br />
<span style="color:#4F8DDE; font-weight:bold;"><br />
With kind support of<br />
<br><br />
<br><br />
</span><br />
<A HREF="http://www.bioss.uni-freiburg.de/cms/index.php" target="_blank"><img class="thumbnail" img src="https://static.igem.org/mediawiki/2012/7/7b/Logo_bioss.gif" width= "200" /></A><br />
<A HREF="http://www.med.uni-freiburg.de/" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/uniklinik.png' width= "250"/></A><br />
<img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/metabion.png' width= "180"/><br />
<A HREF="http://www.genscript.com/" target="_blank"><img class="thumbnail" img src='https://static.igem.org/mediawiki/2012/0/0d/Genscript_logo.gif' width= "180"/></A><br />
<A HREF="http://eu.idtdna.com/site" target="_blank"><img class="thumbnail" img src='https://static.igem.org/mediawiki/2012/2/21/IDTLogo2010.png' width= "200"/></A><br />
<A HREF="http://www.lifetechnologies.com" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/life.png' width= "150"/></A><br />
<A HREF="http://www.eurofinsdna.com/home.html" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/eurofins.jpg' width= "150"/></A><br />
<img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/gatc.png' width= "150"/><br />
<A HREF="http://www.erasynbio.net/" target="_blank"><img class="thumbnail" img src='http://omnibus.uni-freiburg.de/~lb125/erasynbio.png' width= "200"/></A><br />
</p><br />
</div><br />
</html><br />
<br />
<br />
<br />
<!--- The Mission, Experiments ---></div>Luboe