Refactored Decaffeination Operon

From 2012.igem.org

(Difference between revisions)
(Experiment 2: Constructon of a refactored decaffeination operon)
(Experiment 2: Constructon of a refactored decaffeination operon)
Line 1: Line 1:
 +
{{Template:Austin_Texas/Stylesheet}}
 +
 +
<html>
 +
<ul class="cssmenu">
 +
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li>
 +
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li>
 +
<li class="official_team_profile"><a href="http://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li>
 +
<li class="project"><a href="/Team:Austin_Texas/Project" title="project"><span class="displace">Project</span></a></li>
 +
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li>
 +
<li class="modelling"><a href="/Team:Austin_Texas/Modeling" title="modeling"><span class="displace">Modeling</span></a></li>
 +
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" class="selected" title="notebook"><span class="displace">Notebook</span></a></li>
 +
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li>
 +
<li class="attributions"><a href="/Team:Austin_Texas/Attributions" title="attributions"><span class="displace">Attributions</span></a></li>
 +
</ul>
 +
</html>
 +
 +
==Experiment 2: Constructon of a refactored decaffeination operon==
==Experiment 2: Constructon of a refactored decaffeination operon==

Revision as of 18:35, 20 August 2012


Experiment 2: Constructon of a refactored decaffeination operon

2a. Phusion PCR

Primers:
EQ_pSB1c3_NdmA_for: TAGGTACAGTGCTAGCTACTAGAGAAATCAAATTAAGGAGGTAAGATAAATGGAACAGGCAATCATTAATGATGAACGGG
EQ_pBSC1C_NdmA_2: TGATTTCTGGAATTCGCGGCCGCTTCTAGAGATTAAGGAGGTAAGATAAATGGAACAGGCAATCATTAATGATGAACGGG
EQ_pSB1C3_Gib_rev: TTGATTTCTCTAGTAGCTAGCACTGTACCTAGGACTG
EQ_NdmA_rev: TTATATGTAGCTCCTATCGCTTTCAATGACTGGG
EQ_RBS_NdmB_for: gtCATTGAAAGCGATAGGAGCTACATATAATCTAGAGAAAGAGGAGAAATACTAGATGAAAGAACAGCTCAAGCCGCTG
EQ_NdmB_rev: ccggtctcgcTTACTGTTCTTCTTCAATAACATTCGTCAAGACG
EQ_RBS_NdmC_for: GAAGAAGAACAGTAAgcgagaccggTCTAGAGAAAGAGGAGAAATACTAGATGTCTACTGACCAAGTAATTTTTAACGactgg
EQ_NdmC_rev: TTAGTCCCGCAGAGCACCATATTGCac
EQ_RBS_NdmD for: GCAATATGGTGCTCTGCGGGACTAATCTAGAGAAAGAGGAGAAATACTAGATGAACAAACTTGACGTCAACCagtgg
EQ_NdmD_pBS1C_rev: TTATACAGCTCGTCCATACCGTGGGTGATGCCCGGCCTCACAGATCGAGAACGATT
EQ_pBS1C_Gib_for: GGGCATCACCCACGGTATGGACGAG
EQ_pBS1C_rev_2: CTCTAGAAGCGGCCGCGAATTCCAGAAATCA



10 uL 5x Phusion HF Buffer
1 uL 10mM dNTPs
5 uL 5uM forward primer
5 uL 5uM reverse primer
1 uL DMSO
1 uL template
26.5 uL H20
--
.5 uL phusion polymerase

rxns:

Vector PCRs
1. Bba_k515105 + EQ_pSB1C3_Gib_for + EQ_pSB1c3_gib_rev
2. Bba_k515105 + EQ_pSB1C3_Gib_for + EQ_pSB1c3_gib_rev_2

Insert PCRs
3. CBB5 cells + EQ_NdmA_for + EQ_NdmA_rev
4. CBB5 cells + EQ_pSB1C3_NdmA_2 + EQ_NdmA_rev
5. CBB5 cells + EQ_RBS_NdmB_for + EQ_NdmB_rev
6. CBB5 cells + EQ_RBS_NdmC_for + EQ_NdmC_rev
7. CBB5 cells + EQ_RBS_NdmD_for + EQ_NdmD_pSB1C_rev

PCR cycling:

98 deg x 3 min
--
98 deg x 30s
58 deg x 20s x30 cycles
72 deg x 2 min
--
72 deg x 10 min


Run 1 uL 2a1-7, 3.5 uL Fermentas 1kb Generuler ladder

2a.jpg


2b. PCR purification

Qiagen PCR purification protocol

Elute in 35 uL h20

nanodrop concentrations:

1. vector 1: 289.0 ng/uL
2. vector 2: 85.6 ng/uL
3. NdmA_1: 139.8 ng/uL
4. NdmA_2: 144.5 ngl/uL
5. NdmB: 144.6ng/uL
6. NdmC: 146.1 ng/uL
7. NdmD: 104.8ng/uL

2c: DpnI digest of vector PCRs

1.
15 uL vector 1
5 uL 10x NEB 4 Buffer
1 uL dpnI
29 uL H20
--
50 uL

2.
30 uL vector 2
5 uL 10x NEB 4 Buffer
1 uL dpnI
14 uL H20
--
50 uL

37 deg x 2 hrs

2e. Purification

Standard Qiagen PCR purification protocol. Elute in H20.


2F. Gibson cloning

pmols = weight(ng) x 1000 / (bp x 650 daltons)


Will use .05 pmol of vector, .1 pmol for each insert

Vec 1 (.05pmol) = need 68.57ng / (79.5ng/uL) = .86uL
Vec 2 (.05pmol) = need 68.57ng / (132.5ng/uL) = .52uL

NdmA1 (.1pmol) = need 71.5ng / (139.8ng/uL) = .51 uL
NdmA2 (.1pmol) = need 71.5ng / (144.5ng/uL) = .49 uL
NdmB (.1pmol) = need 73.4ng / (144.6ng/uL) = .50 uL
NdmC (.1pmol) = need 58.8ng / (146.1ng/uL) = .40 uL
NdmD (.1pmol) = need 120.ng / (104.8ng/uL) = 1.15 uL

rxns:

1.
.86 uL vec 1
.51 uL ndmA_1
.50 uL NdmB
.40 uL NdmC
1.15 uL NdmD
15 ul 1.33x Gibson Master Mix
1.58 uL H20
--
20 uL total

2.
.86 uL vec 1
15 uL 1.33x Gibson Master Mix
4.14 uL H20
--
20 uL total

3.
.52 uL Vec 2
.51 uL ndmA_1
.50 uL NdmB
.40 uL NdmC
1.15 uL NdmD
15 ul 1.33x Gibson Master Mix
1.94 uL H20
--
20 uL total

4.
.52 uL vec 1
15 uL 1.33x Gibson Master Mix
4.14 uL H20
--
20 uL total

50 deg thermocycler x 60 minutes

Run 5 uL each reaction (1-4)on .8% agarose gel + 3.5 ul Fermentas 1kb GeneRuler

2f.jpg


Desalted gibson reactions on .025uM Nitrocellulose membranes x 20 minutes

2g. Electroporation

Decided to not proceed with promoterless construct (2F3,4)

1 uL desalted gibson reaction (2F1,2) ->50 uL electrocompetent BW25113-GuaB -> 1mL SOC -> 1hr incubation @ 37 deg


2j. Selective growth in Caffeine/Theophylline

dilute 60 uL 2g transformations (1-2) -> 3mL Mineral M9 media + 34ug/mL chloramphenicol +/- 100mg Caffeine or Theophylline. Place on 30 deg shaker x 48 hrs

Results (growth):

2g1 (+operon) 2g2 (vector only) 1. M9 - - 2. M9 + caffeine - - 3. M9 + Theophylline + _

Result: construct enables growth (demethylation) on Theophylline. NdmC is not fuctional.

Streak 2j1 theophylline enriched culture onto LB-chloramphenicol plate for isolation of single colonies.

2K Plasmid Prep

Pick 2 colonies from theophylline enriched streak for plasmid prep. Prep 5mL culture.

2L Restriction Digest

Perform restriction digest to analyze insert size of plasmids

1 uL 2k1,2
1 uL 10x NEB 3
.5 uL NotI
6.5 uL H20
--
10 uL

37 deg x 1hr

Run 5 uL on .8% agarose gel

insert gel image (on darkroom computer?)

Result: both clones show anticipated ~5kB band corresponding to the complete operon.