Refactored Decaffeination Operon

From 2012.igem.org

(Difference between revisions)
Line 1: Line 1:
-
{{Template:Austin_Texas/Stylesheet}}
+
==Experiment 2: Constructon of a refactored decaffeination operon==
-
<html>
+
2a. Phusion PCR<br/>
-
<ul class="cssmenu">
+
-
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li>
+
-
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li>
+
-
<li class="official_team_profile"><a href="http://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li>
+
-
<li class="project"><a href="/Team:Austin_Texas/Project" title="project"><span class="displace">Project</span></a></li>
+
-
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li>
+
-
<li class="modelling"><a href="/Team:Austin_Texas/Modeling" title="modeling"><span class="displace">Modeling</span></a></li>
+
-
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" class="selected" title="notebook"><span class="displace">Notebook</span></a></li>
+
-
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li>
+
-
<li class="attributions"><a href="/Team:Austin_Texas/Attributions" title="attributions"><span class="displace">Attributions</span></a></li>
+
-
</ul>
+
-
</html>
+
-
<html xmlns:v="urn:schemas-microsoft-com:vml"
+
Primers:<br/>
-
xmlns:o="urn:schemas-microsoft-com:office:office"
+
EQ_pSB1c3_NdmA_for: TAGGTACAGTGCTAGCTACTAGAGAAATCAAATTAAGGAGGTAAGATAAATGGAACAGGCAATCATTAATGATGAACGGG<br/>
-
xmlns:w="urn:schemas-microsoft-com:office:word"
+
EQ_pBSC1C_NdmA_2: TGATTTCTGGAATTCGCGGCCGCTTCTAGAGATTAAGGAGGTAAGATAAATGGAACAGGCAATCATTAATGATGAACGGG<br/>
-
xmlns:m="http://schemas.microsoft.com/office/2004/12/omml"
+
EQ_pSB1C3_Gib_rev: TTGATTTCTCTAGTAGCTAGCACTGTACCTAGGACTG<br/>
-
xmlns="http://www.w3.org/TR/REC-html40">
+
EQ_NdmA_rev: TTATATGTAGCTCCTATCGCTTTCAATGACTGGG<br/>
 +
EQ_RBS_NdmB_for: gtCATTGAAAGCGATAGGAGCTACATATAATCTAGAGAAAGAGGAGAAATACTAGATGAAAGAACAGCTCAAGCCGCTG<br/>
 +
EQ_NdmB_rev: ccggtctcgcTTACTGTTCTTCTTCAATAACATTCGTCAAGACG<br/>
 +
EQ_RBS_NdmC_for: GAAGAAGAACAGTAAgcgagaccggTCTAGAGAAAGAGGAGAAATACTAGATGTCTACTGACCAAGTAATTTTTAACGactgg<br/>
 +
EQ_NdmC_rev: TTAGTCCCGCAGAGCACCATATTGCac<br/>
 +
EQ_RBS_NdmD for: GCAATATGGTGCTCTGCGGGACTAATCTAGAGAAAGAGGAGAAATACTAGATGAACAAACTTGACGTCAACCagtgg<br/>
 +
EQ_NdmD_pBS1C_rev: TTATACAGCTCGTCCATACCGTGGGTGATGCCCGGCCTCACAGATCGAGAACGATT<br/>
 +
EQ_pBS1C_Gib_for: GGGCATCACCCACGGTATGGACGAG<br/>
 +
EQ_pBS1C_rev_2: CTCTAGAAGCGGCCGCGAATTCCAGAAATCA<br/>
-
<head>
 
-
<meta http-equiv=Content-Type content="text/html; charset=windows-1252">
 
-
<meta name=ProgId content=Word.Document>
 
-
<meta name=Generator content="Microsoft Word 14">
 
-
<meta name=Originator content="Microsoft Word 14">
 
-
<link rel=File-List href="p_files/filelist.xml">
 
-
<!--[if gte mso 9]><xml>
 
-
<o:DocumentProperties>
 
-
  <o:Author>Quandt, Erik M</o:Author>
 
-
  <o:Template>Normal</o:Template>
 
-
  <o:LastAuthor>Quandt, Erik M</o:LastAuthor>
 
-
  <o:Revision>1</o:Revision>
 
-
  <o:TotalTime>0</o:TotalTime>
 
-
  <o:Created>2012-08-20T17:46:00Z</o:Created>
 
-
  <o:LastSaved>2012-08-20T17:46:00Z</o:LastSaved>
 
-
  <o:Pages>5</o:Pages>
 
-
  <o:Words>654</o:Words>
 
-
  <o:Characters>3728</o:Characters>
 
-
  <o:Company>University of Texas at Austin</o:Company>
 
-
  <o:Lines>31</o:Lines>
 
-
  <o:Paragraphs>8</o:Paragraphs>
 
-
  <o:CharactersWithSpaces>4374</o:CharactersWithSpaces>
 
-
  <o:Version>14.00</o:Version>
 
-
</o:DocumentProperties>
 
-
<o:OfficeDocumentSettings>
 
-
  <o:AllowPNG/>
 
-
</o:OfficeDocumentSettings>
 
-
</xml><![endif]-->
 
-
<link rel=themeData href="p_files/themedata.thmx">
 
-
<link rel=colorSchemeMapping href="p_files/colorschememapping.xml">
 
-
<!--[if gte mso 9]><xml>
 
-
<w:WordDocument>
 
-
  <w:SpellingState>Clean</w:SpellingState>
 
-
  <w:GrammarState>Clean</w:GrammarState>
 
-
  <w:TrackMoves>false</w:TrackMoves>
 
-
  <w:TrackFormatting/>
 
-
  <w:PunctuationKerning/>
 
-
  <w:ValidateAgainstSchemas/>
 
-
  <w:SaveIfXMLInvalid>false</w:SaveIfXMLInvalid>
 
-
  <w:IgnoreMixedContent>false</w:IgnoreMixedContent>
 
-
  <w:AlwaysShowPlaceholderText>false</w:AlwaysShowPlaceholderText>
 
-
  <w:DoNotPromoteQF/>
 
-
  <w:LidThemeOther>EN-US</w:LidThemeOther>
 
-
  <w:LidThemeAsian>X-NONE</w:LidThemeAsian>
 
-
  <w:LidThemeComplexScript>X-NONE</w:LidThemeComplexScript>
 
-
  <w:Compatibility>
 
-
  <w:BreakWrappedTables/>
 
-
  <w:SnapToGridInCell/>
 
-
  <w:WrapTextWithPunct/>
 
-
  <w:UseAsianBreakRules/>
 
-
  <w:DontGrowAutofit/>
 
-
  <w:SplitPgBreakAndParaMark/>
 
-
  <w:EnableOpenTypeKerning/>
 
-
  <w:DontFlipMirrorIndents/>
 
-
  <w:OverrideTableStyleHps/>
 
-
  </w:Compatibility>
 
-
  <m:mathPr>
 
-
  <m:mathFont m:val="Cambria Math"/>
 
-
  <m:brkBin m:val="before"/>
 
-
  <m:brkBinSub m:val="&#45;-"/>
 
-
  <m:smallFrac m:val="off"/>
 
-
  <m:dispDef/>
 
-
  <m:lMargin m:val="0"/>
 
-
  <m:rMargin m:val="0"/>
 
-
  <m:defJc m:val="centerGroup"/>
 
-
  <m:wrapIndent m:val="1440"/>
 
-
  <m:intLim m:val="subSup"/>
 
-
  <m:naryLim m:val="undOvr"/>
 
-
  </m:mathPr></w:WordDocument>
 
-
</xml><![endif]--><!--[if gte mso 9]><xml>
 
-
<w:LatentStyles DefLockedState="false" DefUnhideWhenUsed="true"
 
-
  DefSemiHidden="true" DefQFormat="false" DefPriority="99"
 
-
  LatentStyleCount="267">
 
-
  <w:LsdException Locked="false" Priority="0" SemiHidden="false"
 
-
  UnhideWhenUsed="false" QFormat="true" Name="Normal"/>
 
-
  <w:LsdException Locked="false" Priority="9" SemiHidden="false"
 
-
  UnhideWhenUsed="false" QFormat="true" Name="heading 1"/>
 
-
  <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 2"/>
 
-
  <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 3"/>
 
-
  <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 4"/>
 
-
  <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 5"/>
 
-
  <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 6"/>
 
-
  <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 7"/>
 
-
  <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 8"/>
 
-
  <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 9"/>
 
-
  <w:LsdException Locked="false" Priority="39" Name="toc 1"/>
 
-
  <w:LsdException Locked="false" Priority="39" Name="toc 2"/>
 
-
  <w:LsdException Locked="false" Priority="39" Name="toc 3"/>
 
-
  <w:LsdException Locked="false" Priority="39" Name="toc 4"/>
 
-
  <w:LsdException Locked="false" Priority="39" Name="toc 5"/>
 
-
  <w:LsdException Locked="false" Priority="39" Name="toc 6"/>
 
-
  <w:LsdException Locked="false" Priority="39" Name="toc 7"/>
 
-
  <w:LsdException Locked="false" Priority="39" Name="toc 8"/>
 
-
  <w:LsdException Locked="false" Priority="39" Name="toc 9"/>
 
-
  <w:LsdException Locked="false" Priority="35" QFormat="true" Name="caption"/>
 
-
  <w:LsdException Locked="false" Priority="10" SemiHidden="false"
 
-
  UnhideWhenUsed="false" QFormat="true" Name="Title"/>
 
-
  <w:LsdException Locked="false" Priority="1" Name="Default Paragraph Font"/>
 
-
  <w:LsdException Locked="false" Priority="11" SemiHidden="false"
 
-
  UnhideWhenUsed="false" QFormat="true" Name="Subtitle"/>
 
-
  <w:LsdException Locked="false" Priority="22" SemiHidden="false"
 
-
  UnhideWhenUsed="false" QFormat="true" Name="Strong"/>
 
-
  <w:LsdException Locked="false" Priority="20" SemiHidden="false"
 
-
  UnhideWhenUsed="false" QFormat="true" Name="Emphasis"/>
 
-
  <w:LsdException Locked="false" Priority="59" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Table Grid"/>
 
-
  <w:LsdException Locked="false" UnhideWhenUsed="false" Name="Placeholder Text"/>
 
-
  <w:LsdException Locked="false" Priority="1" SemiHidden="false"
 
-
  UnhideWhenUsed="false" QFormat="true" Name="No Spacing"/>
 
-
  <w:LsdException Locked="false" Priority="60" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Light Shading"/>
 
-
  <w:LsdException Locked="false" Priority="61" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Light List"/>
 
-
  <w:LsdException Locked="false" Priority="62" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Light Grid"/>
 
-
  <w:LsdException Locked="false" Priority="63" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Shading 1"/>
 
-
  <w:LsdException Locked="false" Priority="64" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Shading 2"/>
 
-
  <w:LsdException Locked="false" Priority="65" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium List 1"/>
 
-
  <w:LsdException Locked="false" Priority="66" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium List 2"/>
 
-
  <w:LsdException Locked="false" Priority="67" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Grid 1"/>
 
-
  <w:LsdException Locked="false" Priority="68" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Grid 2"/>
 
-
  <w:LsdException Locked="false" Priority="69" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Grid 3"/>
 
-
  <w:LsdException Locked="false" Priority="70" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Dark List"/>
 
-
  <w:LsdException Locked="false" Priority="71" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Colorful Shading"/>
 
-
  <w:LsdException Locked="false" Priority="72" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Colorful List"/>
 
-
  <w:LsdException Locked="false" Priority="73" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Colorful Grid"/>
 
-
  <w:LsdException Locked="false" Priority="60" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Light Shading Accent 1"/>
 
-
  <w:LsdException Locked="false" Priority="61" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Light List Accent 1"/>
 
-
  <w:LsdException Locked="false" Priority="62" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Light Grid Accent 1"/>
 
-
  <w:LsdException Locked="false" Priority="63" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Shading 1 Accent 1"/>
 
-
  <w:LsdException Locked="false" Priority="64" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Shading 2 Accent 1"/>
 
-
  <w:LsdException Locked="false" Priority="65" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium List 1 Accent 1"/>
 
-
  <w:LsdException Locked="false" UnhideWhenUsed="false" Name="Revision"/>
 
-
  <w:LsdException Locked="false" Priority="34" SemiHidden="false"
 
-
  UnhideWhenUsed="false" QFormat="true" Name="List Paragraph"/>
 
-
  <w:LsdException Locked="false" Priority="29" SemiHidden="false"
 
-
  UnhideWhenUsed="false" QFormat="true" Name="Quote"/>
 
-
  <w:LsdException Locked="false" Priority="30" SemiHidden="false"
 
-
  UnhideWhenUsed="false" QFormat="true" Name="Intense Quote"/>
 
-
  <w:LsdException Locked="false" Priority="66" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium List 2 Accent 1"/>
 
-
  <w:LsdException Locked="false" Priority="67" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Grid 1 Accent 1"/>
 
-
  <w:LsdException Locked="false" Priority="68" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Grid 2 Accent 1"/>
 
-
  <w:LsdException Locked="false" Priority="69" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Grid 3 Accent 1"/>
 
-
  <w:LsdException Locked="false" Priority="70" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Dark List Accent 1"/>
 
-
  <w:LsdException Locked="false" Priority="71" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Colorful Shading Accent 1"/>
 
-
  <w:LsdException Locked="false" Priority="72" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Colorful List Accent 1"/>
 
-
  <w:LsdException Locked="false" Priority="73" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Colorful Grid Accent 1"/>
 
-
  <w:LsdException Locked="false" Priority="60" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Light Shading Accent 2"/>
 
-
  <w:LsdException Locked="false" Priority="61" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Light List Accent 2"/>
 
-
  <w:LsdException Locked="false" Priority="62" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Light Grid Accent 2"/>
 
-
  <w:LsdException Locked="false" Priority="63" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Shading 1 Accent 2"/>
 
-
  <w:LsdException Locked="false" Priority="64" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Shading 2 Accent 2"/>
 
-
  <w:LsdException Locked="false" Priority="65" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium List 1 Accent 2"/>
 
-
  <w:LsdException Locked="false" Priority="66" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium List 2 Accent 2"/>
 
-
  <w:LsdException Locked="false" Priority="67" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Grid 1 Accent 2"/>
 
-
  <w:LsdException Locked="false" Priority="68" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Grid 2 Accent 2"/>
 
-
  <w:LsdException Locked="false" Priority="69" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Grid 3 Accent 2"/>
 
-
  <w:LsdException Locked="false" Priority="70" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Dark List Accent 2"/>
 
-
  <w:LsdException Locked="false" Priority="71" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Colorful Shading Accent 2"/>
 
-
  <w:LsdException Locked="false" Priority="72" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Colorful List Accent 2"/>
 
-
  <w:LsdException Locked="false" Priority="73" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Colorful Grid Accent 2"/>
 
-
  <w:LsdException Locked="false" Priority="60" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Light Shading Accent 3"/>
 
-
  <w:LsdException Locked="false" Priority="61" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Light List Accent 3"/>
 
-
  <w:LsdException Locked="false" Priority="62" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Light Grid Accent 3"/>
 
-
  <w:LsdException Locked="false" Priority="63" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Shading 1 Accent 3"/>
 
-
  <w:LsdException Locked="false" Priority="64" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Shading 2 Accent 3"/>
 
-
  <w:LsdException Locked="false" Priority="65" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium List 1 Accent 3"/>
 
-
  <w:LsdException Locked="false" Priority="66" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium List 2 Accent 3"/>
 
-
  <w:LsdException Locked="false" Priority="67" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Grid 1 Accent 3"/>
 
-
  <w:LsdException Locked="false" Priority="68" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Grid 2 Accent 3"/>
 
-
  <w:LsdException Locked="false" Priority="69" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Grid 3 Accent 3"/>
 
-
  <w:LsdException Locked="false" Priority="70" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Dark List Accent 3"/>
 
-
  <w:LsdException Locked="false" Priority="71" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Colorful Shading Accent 3"/>
 
-
  <w:LsdException Locked="false" Priority="72" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Colorful List Accent 3"/>
 
-
  <w:LsdException Locked="false" Priority="73" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Colorful Grid Accent 3"/>
 
-
  <w:LsdException Locked="false" Priority="60" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Light Shading Accent 4"/>
 
-
  <w:LsdException Locked="false" Priority="61" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Light List Accent 4"/>
 
-
  <w:LsdException Locked="false" Priority="62" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Light Grid Accent 4"/>
 
-
  <w:LsdException Locked="false" Priority="63" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Shading 1 Accent 4"/>
 
-
  <w:LsdException Locked="false" Priority="64" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Shading 2 Accent 4"/>
 
-
  <w:LsdException Locked="false" Priority="65" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium List 1 Accent 4"/>
 
-
  <w:LsdException Locked="false" Priority="66" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium List 2 Accent 4"/>
 
-
  <w:LsdException Locked="false" Priority="67" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Grid 1 Accent 4"/>
 
-
  <w:LsdException Locked="false" Priority="68" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Grid 2 Accent 4"/>
 
-
  <w:LsdException Locked="false" Priority="69" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Grid 3 Accent 4"/>
 
-
  <w:LsdException Locked="false" Priority="70" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Dark List Accent 4"/>
 
-
  <w:LsdException Locked="false" Priority="71" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Colorful Shading Accent 4"/>
 
-
  <w:LsdException Locked="false" Priority="72" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Colorful List Accent 4"/>
 
-
  <w:LsdException Locked="false" Priority="73" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Colorful Grid Accent 4"/>
 
-
  <w:LsdException Locked="false" Priority="60" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Light Shading Accent 5"/>
 
-
  <w:LsdException Locked="false" Priority="61" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Light List Accent 5"/>
 
-
  <w:LsdException Locked="false" Priority="62" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Light Grid Accent 5"/>
 
-
  <w:LsdException Locked="false" Priority="63" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Shading 1 Accent 5"/>
 
-
  <w:LsdException Locked="false" Priority="64" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Shading 2 Accent 5"/>
 
-
  <w:LsdException Locked="false" Priority="65" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium List 1 Accent 5"/>
 
-
  <w:LsdException Locked="false" Priority="66" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium List 2 Accent 5"/>
 
-
  <w:LsdException Locked="false" Priority="67" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Grid 1 Accent 5"/>
 
-
  <w:LsdException Locked="false" Priority="68" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Grid 2 Accent 5"/>
 
-
  <w:LsdException Locked="false" Priority="69" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Grid 3 Accent 5"/>
 
-
  <w:LsdException Locked="false" Priority="70" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Dark List Accent 5"/>
 
-
  <w:LsdException Locked="false" Priority="71" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Colorful Shading Accent 5"/>
 
-
  <w:LsdException Locked="false" Priority="72" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Colorful List Accent 5"/>
 
-
  <w:LsdException Locked="false" Priority="73" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Colorful Grid Accent 5"/>
 
-
  <w:LsdException Locked="false" Priority="60" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Light Shading Accent 6"/>
 
-
  <w:LsdException Locked="false" Priority="61" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Light List Accent 6"/>
 
-
  <w:LsdException Locked="false" Priority="62" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Light Grid Accent 6"/>
 
-
  <w:LsdException Locked="false" Priority="63" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Shading 1 Accent 6"/>
 
-
  <w:LsdException Locked="false" Priority="64" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Shading 2 Accent 6"/>
 
-
  <w:LsdException Locked="false" Priority="65" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium List 1 Accent 6"/>
 
-
  <w:LsdException Locked="false" Priority="66" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium List 2 Accent 6"/>
 
-
  <w:LsdException Locked="false" Priority="67" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Grid 1 Accent 6"/>
 
-
  <w:LsdException Locked="false" Priority="68" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Grid 2 Accent 6"/>
 
-
  <w:LsdException Locked="false" Priority="69" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Medium Grid 3 Accent 6"/>
 
-
  <w:LsdException Locked="false" Priority="70" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Dark List Accent 6"/>
 
-
  <w:LsdException Locked="false" Priority="71" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Colorful Shading Accent 6"/>
 
-
  <w:LsdException Locked="false" Priority="72" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Colorful List Accent 6"/>
 
-
  <w:LsdException Locked="false" Priority="73" SemiHidden="false"
 
-
  UnhideWhenUsed="false" Name="Colorful Grid Accent 6"/>
 
-
  <w:LsdException Locked="false" Priority="19" SemiHidden="false"
 
-
  UnhideWhenUsed="false" QFormat="true" Name="Subtle Emphasis"/>
 
-
  <w:LsdException Locked="false" Priority="21" SemiHidden="false"
 
-
  UnhideWhenUsed="false" QFormat="true" Name="Intense Emphasis"/>
 
-
  <w:LsdException Locked="false" Priority="31" SemiHidden="false"
 
-
  UnhideWhenUsed="false" QFormat="true" Name="Subtle Reference"/>
 
-
  <w:LsdException Locked="false" Priority="32" SemiHidden="false"
 
-
  UnhideWhenUsed="false" QFormat="true" Name="Intense Reference"/>
 
-
  <w:LsdException Locked="false" Priority="33" SemiHidden="false"
 
-
  UnhideWhenUsed="false" QFormat="true" Name="Book Title"/>
 
-
  <w:LsdException Locked="false" Priority="37" Name="Bibliography"/>
 
-
  <w:LsdException Locked="false" Priority="39" QFormat="true" Name="TOC Heading"/>
 
-
</w:LatentStyles>
 
-
</xml><![endif]-->
 
-
<style>
 
-
<!--
 
-
/* Font Definitions */
 
-
@font-face
 
-
{font-family:Calibri;
 
-
panose-1:2 15 5 2 2 2 4 3 2 4;
 
-
mso-font-charset:0;
 
-
mso-generic-font-family:swiss;
 
-
mso-font-pitch:variable;
 
-
mso-font-signature:-520092929 1073786111 9 0 415 0;}
 
-
/* Style Definitions */
 
-
p.MsoNormal, li.MsoNormal, div.MsoNormal
 
-
{mso-style-unhide:no;
 
-
mso-style-qformat:yes;
 
-
mso-style-parent:"";
 
-
margin:0in;
 
-
margin-bottom:.0001pt;
 
-
mso-pagination:widow-orphan;
 
-
font-size:11.0pt;
 
-
font-family:"Calibri","sans-serif";
 
-
mso-ascii-font-family:Calibri;
 
-
mso-ascii-theme-font:minor-latin;
 
-
mso-fareast-font-family:Calibri;
 
-
mso-fareast-theme-font:minor-latin;
 
-
mso-hansi-font-family:Calibri;
 
-
mso-hansi-theme-font:minor-latin;
 
-
mso-bidi-font-family:"Times New Roman";
 
-
mso-bidi-theme-font:minor-bidi;}
 
-
span.SpellE
 
-
{mso-style-name:"";
 
-
mso-spl-e:yes;}
 
-
span.GramE
 
-
{mso-style-name:"";
 
-
mso-gram-e:yes;}
 
-
.MsoChpDefault
 
-
{mso-style-type:export-only;
 
-
mso-default-props:yes;
 
-
font-family:"Calibri","sans-serif";
 
-
mso-ascii-font-family:Calibri;
 
-
mso-ascii-theme-font:minor-latin;
 
-
mso-fareast-font-family:Calibri;
 
-
mso-fareast-theme-font:minor-latin;
 
-
mso-hansi-font-family:Calibri;
 
-
mso-hansi-theme-font:minor-latin;
 
-
mso-bidi-font-family:"Times New Roman";
 
-
mso-bidi-theme-font:minor-bidi;}
 
-
@page WordSection1
 
-
{size:8.5in 11.0in;
 
-
margin:1.0in 1.0in 1.0in 1.0in;
 
-
mso-header-margin:.5in;
 
-
mso-footer-margin:.5in;
 
-
mso-paper-source:0;}
 
-
div.WordSection1
 
-
{page:WordSection1;}
 
-
-->
 
-
</style>
 
-
<!--[if gte mso 10]>
 
-
<style>
 
-
/* Style Definitions */
 
-
table.MsoNormalTable
 
-
{mso-style-name:"Table Normal";
 
-
mso-tstyle-rowband-size:0;
 
-
mso-tstyle-colband-size:0;
 
-
mso-style-noshow:yes;
 
-
mso-style-priority:99;
 
-
mso-style-parent:"";
 
-
mso-padding-alt:0in 5.4pt 0in 5.4pt;
 
-
mso-para-margin:0in;
 
-
mso-para-margin-bottom:.0001pt;
 
-
mso-pagination:widow-orphan;
 
-
font-size:11.0pt;
 
-
font-family:"Calibri","sans-serif";
 
-
mso-ascii-font-family:Calibri;
 
-
mso-ascii-theme-font:minor-latin;
 
-
mso-hansi-font-family:Calibri;
 
-
mso-hansi-theme-font:minor-latin;
 
-
mso-bidi-font-family:"Times New Roman";
 
-
mso-bidi-theme-font:minor-bidi;}
 
-
</style>
 
-
<![endif]--><!--[if gte mso 9]><xml>
 
-
<o:shapedefaults v:ext="edit" spidmax="1026"/>
 
-
</xml><![endif]--><!--[if gte mso 9]><xml>
 
-
<o:shapelayout v:ext="edit">
 
-
  <o:idmap v:ext="edit" data="1"/>
 
-
</o:shapelayout></xml><![endif]-->
 
-
</head>
 
-
<body lang=EN-US style='tab-interval:.5in'>
 
-
<div class=WordSection1>
 
-
<p class=MsoNormal>&lt;p&gt;<o:p></o:p></p>
+
10 uL 5x Phusion HF Buffer<br/>
 +
1 uL 10mM dNTPs<br/>
 +
5 uL 5uM forward primer<br/>
 +
5 uL 5uM reverse primer<br/>
 +
1 uL DMSO<br/>
 +
1 uL template<br/>
 +
26.5 uL H20<br/>
 +
--<br/>
 +
.5 uL phusion polymerase<br/>
-
<p class=MsoNormal>Experiment 2: <span class=SpellE>Constructon</span> of a
+
rxns:<br/>
-
refactored decaffeination operon<o:p></o:p></p>
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
Vector PCRs<br/>
 +
1. Bba_k515105  + EQ_pSB1C3_Gib_for + EQ_pSB1c3_gib_rev<br/>
 +
2. Bba_k515105  + EQ_pSB1C3_Gib_for + EQ_pSB1c3_gib_rev_2<br/>
-
<p class=MsoNormal>2a<span class=GramE>.<span style='mso-spacerun:yes'>  
+
Insert PCRs<br/>
-
</span><span class=SpellE>Phusion</span></span> PCR<o:p></o:p></p>
+
3. CBB5 cells + EQ_NdmA_for + EQ_NdmA_rev<br/>
 +
4. CBB5 cells + EQ_pSB1C3_NdmA_2 + EQ_NdmA_rev<br/>
 +
5. CBB5 cells + EQ_RBS_NdmB_for + EQ_NdmB_rev<br/>
 +
6. CBB5 cells + EQ_RBS_NdmC_for + EQ_NdmC_rev<br/>
 +
7. CBB5 cells + EQ_RBS_NdmD_for + EQ_NdmD_pSB1C_rev<br/>
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
PCR cycling:<br/>
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
98 deg x 3 min<br/>
 +
--<br/>
 +
98 deg x 30s<br/>
 +
58 deg x 20s      x30 cycles<br/>
 +
72 deg x 2 min<br/>
 +
--<br/>
 +
72 deg x 10 min<br/>
-
<p class=MsoNormal>Primers:<o:p></o:p></p>
 
-
<p class=MsoNormal>EQ_pSB1c3_NdmA_for:
+
Gel igm2a<br/>
-
TAGGTACAGTGCTAGCTACTAGAGAAATCAAATTAAGGAGGTAAGATAAATGGAACAGGCAATCATTAATGATGAACGGG<o:p></o:p></p>
+
-
<p class=MsoNormal>EQ_pBSC1C_NdmA_2:
 
-
TGATTTCTGGAATTCGCGGCCGCTTCTAGAGATTAAGGAGGTAAGATAAATGGAACAGGCAATCATTAATGATGAACGGG<o:p></o:p></p>
 
-
<p class=MsoNormal>EQ_pSB1C3_Gib_rev: TTGATTTCTCTAGTAGCTAGCACTGTACCTAGGACTG<o:p></o:p></p>
 
-
<p class=MsoNormal><span class=SpellE>EQ_NdmA_rev</span>:
+
2b. PCR purification<br/>
-
TTATATGTAGCTCCTATCGCTTTCAATGACTGGG<o:p></o:p></p>
+
-
<p class=MsoNormal><span class=SpellE>EQ_RBS_NdmB_for</span>:
+
Qiagen PCR purification protocol<br/>
-
gtCATTGAAAGCGATAGGAGCTACATATAATCTAGAGAAAGAGGAGAAATACTAGATGAAAGAACAGCTCAAGCCGCTG<o:p></o:p></p>
+
-
<p class=MsoNormal><span class=SpellE>EQ_NdmB_rev</span>: <span class=SpellE>ccggtctcgcTTACTGTTCTTCTTCAATAACATTCGTCAAGACG</span><o:p></o:p></p>
+
Elute in 35 uL h20<br/>
-
<p class=MsoNormal><span class=SpellE>EQ_RBS_NdmC_for</span>:
+
nanodrop concentrations:<br/>
-
GAAGAAGAACAGTAAgcgagaccggTCTAGAGAAAGAGGAGAAATACTAGATGTCTACTGACCAAGTAATTTTTAACGactgg<o:p></o:p></p>
+
-
<p class=MsoNormal><span class=SpellE>EQ_NdmC_rev</span>: <span class=SpellE>TTAGTCCCGCAGAGCACCATATTGCac</span><o:p></o:p></p>
+
1. vector 1: 289.0 ng/uL<br/>
 +
2. vector 2: 85.6 ng/uL<br/>
 +
3. NdmA_1: 139.8 ng/uL<br/>
 +
4. NdmA_2: 144.5 ngl/uL<br/>
 +
5. NdmB: 144.6ng/uL<br/>
 +
6. NdmC: 146.1 ng/uL<br/>
 +
7. NdmD: 104.8ng/uL<br/>
-
<p class=MsoNormal><span class=SpellE>EQ_RBS_NdmD</span> for:
+
2c: DpnI digest of vector PCRs<br/>
-
GCAATATGGTGCTCTGCGGGACTAATCTAGAGAAAGAGGAGAAATACTAGATGAACAAACTTGACGTCAACCagtgg<o:p></o:p></p>
+
-
<p class=MsoNormal>EQ_NdmD_pBS1C_rev:
+
1.<br/>
-
TTATACAGCTCGTCCATACCGTGGGTGATGCCCGGCCTCACAGATCGAGAACGATT<o:p></o:p></p>
+
15 uL vector 1<br/>
 +
5 uL 10x NEB 4 Buffer<br/>
 +
1 uL dpnI<br/>
 +
29 uL H20<br/>
 +
--<br/>
 +
50 uL <br/>
-
<p class=MsoNormal>EQ_pBS1C_Gib_for: GGGCATCACCCACGGTATGGACGAG<o:p></o:p></p>
+
2.<br/>
 +
30 uL vector 2<br/>
 +
5 uL 10x NEB 4 Buffer<br/>
 +
1 uL dpnI<br/>
 +
14 uL H20<br/>
 +
--<br/>
 +
50 uL<br/>
-
<p class=MsoNormal>EQ_pBS1C_rev_2: CTCTAGAAGCGGCCGCGAATTCCAGAAATCA<o:p></o:p></p>
+
37 deg x 2 hrs<br/>
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
2e. Purification<br/>
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
Standard Qiagen PCR purification protocol.  Elute in H20.<br/>
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
 
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
 
-
<p class=MsoNormal>10 <span class=SpellE>uL</span> 5x <span class=SpellE>Phusion</span>
+
2F. Gibson cloning<br/>
-
HF Buffer<o:p></o:p></p>
+
-
<p class=MsoNormal>1 <span class=SpellE>uL</span> 10mM <span class=SpellE>dNTPs</span><o:p></o:p></p>
+
pmols = weight(ng) x 1000 / (bp x 650 daltons)<br/>
-
<p class=MsoNormal>5 <span class=SpellE>uL</span> 5uM forward primer<o:p></o:p></p>
 
-
<p class=MsoNormal>5 <span class=SpellE>uL</span> 5uM reverse primer<o:p></o:p></p>
+
Will use .05 pmol of vector, .1 pmol for each insert<br/>
-
<p class=MsoNormal>1 <span class=SpellE>uL</span> DMSO<o:p></o:p></p>
+
Vec 1 (.05pmol) = need 68.57ng / (79.5ng/uL) = .86uL<br/>
 +
Vec 2 (.05pmol) = need 68.57ng / (132.5ng/uL) = .52uL<br/>
-
<p class=MsoNormal>1 <span class=SpellE>uL</span> template<o:p></o:p></p>
+
NdmA1 (.1pmol) = need 71.5ng / (139.8ng/uL) = .51 uL<br/>
 +
NdmA2 (.1pmol) = need 71.5ng / (144.5ng/uL) = .49 uL<br/>
 +
NdmB  (.1pmol) = need 73.4ng / (144.6ng/uL) = .50 uL<br/>
 +
NdmC  (.1pmol) = need 58.8ng / (146.1ng/uL) = .40 uL<br/>
 +
NdmD  (.1pmol) = need 120.ng / (104.8ng/uL) = 1.15 uL<br/>
-
<p class=MsoNormal>26.5 <span class=SpellE>uL</span> H20<o:p></o:p></p>
+
rxns:<br/>
-
<p class=MsoNormal>--<o:p></o:p></p>
+
1.<br/>
 +
.86 uL vec 1<br/>
 +
.51 uL ndmA_1<br/>
 +
.50 uL NdmB<br/>
 +
.40 uL NdmC<br/>
 +
1.15 uL NdmD<br/>
 +
15 ul 1.33x Gibson Master Mix<br/>
 +
1.58 uL H20<br/>
 +
--<br/>
 +
20 uL total<br/>
-
<p class=MsoNormal>.5 <span class=SpellE>uL</span> <span class=SpellE>phusion</span>
+
2.<br/>
-
polymerase<o:p></o:p></p>
+
.86 uL vec 1<br/>
 +
15 uL 1.33x Gibson Master Mix<br/>
 +
4.14 uL H20<br/>
 +
--<br/>
 +
20 uL total<br/>
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
3.<br/>
 +
.52 uL Vec 2<br/>
 +
.51 uL ndmA_1<br/>
 +
.50 uL NdmB<br/>
 +
.40 uL NdmC<br/>
 +
1.15 uL NdmD<br/>
 +
15 ul 1.33x Gibson Master Mix<br/>
 +
1.94 uL H20<br/>
 +
--<br/>
 +
20 uL total<br/>
-
<p class=MsoNormal><span class=SpellE><span class=GramE>rxns</span></span>:<o:p></o:p></p>
+
4.<br/>
 +
.52 uL vec 1<br/>
 +
15 uL 1.33x Gibson Master Mix<br/>
 +
4.14 uL H20<br/>
 +
--<br/>
 +
20 uL total<br/>
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
50 deg thermocycler x 60 minutes<br/>
-
<p class=MsoNormal>Vector PCRs<o:p></o:p></p>
+
Run 5 uL each reaction on .8% agarose gel<br/>
-
<p class=MsoNormal>1. Bba_<span class=GramE>k515105<span
+
insert igm2f.jpeg<br/>
-
style='mso-spacerun:yes'>  </span>+</span> EQ_pSB1C3_Gib_for +
+
-
EQ_pSB1c3_gib_rev<o:p></o:p></p>
+
-
<p class=MsoNormal>2. Bba_<span class=GramE>k515105<span
+
Desalted gibson reactions on .025uM Nitrocellulose membranes x 20 minutes<br/>
-
style='mso-spacerun:yes'>  </span>+</span> EQ_pSB1C3_Gib_for +
+
-
EQ_pSB1c3_gib_rev_2<o:p></o:p></p>
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
2g.  Electroporation<br/>
-
<p class=MsoNormal>Insert PCRs<o:p></o:p></p>
+
Decided to not proceed with promoterless construct (2F3,4)<br/>
-
<p class=MsoNormal>3. CBB5 cells + <span class=SpellE>EQ_NdmA_for</span> + <span
+
1 uL desalted gibson reaction (2F1,2) ->50 uL electrocompetent BW25113-GuaB -> 1mL SOC -> 1hr incubation @ 37 deg<br/>
-
class=SpellE>EQ_NdmA_rev</span><o:p></o:p></p>
+
-
<p class=MsoNormal>4. CBB5 cells + EQ_pSB1C3_NdmA_2 + <span class=SpellE>EQ_NdmA_rev</span><o:p></o:p></p>
 
-
<p class=MsoNormal>5. CBB5 cells + <span class=SpellE>EQ_RBS_NdmB_for</span> + <span
+
2j. Selective growth in Caffeine/Theophylline<br/>
-
class=SpellE>EQ_NdmB_rev</span><o:p></o:p></p>
+
-
<p class=MsoNormal>6. CBB5 cells + <span class=SpellE>EQ_RBS_NdmC_for</span> + <span
+
dilute 60 uL 2g transformations (1-2) -> 3mL Mineral M9 media + 34ug/mL chloramphenicol +/- 100mg Caffeine or Theophylline.  Place on 30 deg shaker x 48 hrs<br/>
-
class=SpellE>EQ_NdmC_rev</span><o:p></o:p></p>
+
-
<p class=MsoNormal>7. CBB5 cells + <span class=SpellE>EQ_RBS_NdmD_for</span> +
+
Results (growth):<br/>
-
EQ_NdmD_pSB1C_rev<o:p></o:p></p>
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
2g1 (+operon) 2g2 (vector only)
 +
1. M9 - -
 +
2. M9 + caffeine - -
 +
3. M9 + Theophylline + _
-
<p class=MsoNormal>PCR cycling:<o:p></o:p></p>
+
Result: construct enables growth (demethylation) on Theophylline.  NdmC is not fuctional.<br/>
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
Streak 2j1 theophylline enriched culture onto LB-chloramphenicol plate for isolation of single colonies.<br/>
-
<p class=MsoNormal>98 <span class=SpellE>deg</span> x 3 min<o:p></o:p></p>
+
2K Plasmid Prep<br/>
-
<p class=MsoNormal>--<o:p></o:p></p>
+
Pick 2 colonies from theophylline enriched streak for plasmid prep.  Prep 5mL culture.<br/>
-
<p class=MsoNormal>98 <span class=SpellE>deg</span> x 30s<o:p></o:p></p>
+
2L Restriction Digest<br/>
-
<p class=MsoNormal>58 <span class=SpellE>deg</span> x 20s<span
+
Perform restriction digest to analyze insert size of plasmids<br/>
-
style='mso-spacerun:yes'>      </span>x30 cycles<o:p></o:p></p>
+
-
<p class=MsoNormal>72 <span class=SpellE>deg</span> x 2 min<o:p></o:p></p>
+
1 uL 2k1,2<br/>
 +
1 uL 10x NEB 3<br/>
 +
.5 uL NotI<br/>
 +
6.5 uL H20<br/>
 +
--<br/>
 +
10 uL<br/>
-
<p class=MsoNormal>--<o:p></o:p></p>
+
37 deg x 1hr<br/>
-
<p class=MsoNormal>72 <span class=SpellE>deg</span> x 10 min<o:p></o:p></p>
+
Run 5 uL on .8% agarose gel<br/>
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
insert gel image (on darkroom computer?)<br/>
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
Result:  both clones show anticipated ~5kB band corresponding to the complete operon.<br/>
-
 
+
-
<p class=MsoNormal>Gel igm2a<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>2b. PCR purification<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal><span class=SpellE>Qiagen</span> PCR purification protocol<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>Elute in 35 <span class=SpellE>uL</span> h20<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal><span class=SpellE><span class=GramE>nanodrop</span></span>
+
-
concentrations:<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>1. <span class=GramE>vector</span> 1: 289.0 <span
+
-
class=SpellE>ng</span>/<span class=SpellE>uL</span><o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>2. <span class=GramE>vector</span> 2: 85.6 <span
+
-
class=SpellE>ng</span>/<span class=SpellE>uL</span><o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>3. NdmA_1: <span class=GramE>139.8 <span class=SpellE>ng</span>/<span
+
-
class=SpellE>uL</span></span><o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>4. NdmA_2: <span class=GramE>144.5 <span class=SpellE>ngl</span>/<span
+
-
class=SpellE>uL</span></span><o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>5. <span class=SpellE>NdmB</span>: 144.6ng/<span
+
-
class=SpellE>uL</span><o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>6. <span class=SpellE>NdmC</span>: <span class=GramE>146.1 <span
+
-
class=SpellE>ng</span>/<span class=SpellE>uL</span></span><o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>7. <span class=SpellE>NdmD</span>: 104.8ng/<span
+
-
class=SpellE>uL</span><o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>2c: <span class=SpellE>DpnI</span> digest of vector PCRs<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>1.<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>15 <span class=SpellE>uL</span> vector 1<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>5 <span class=SpellE>uL</span> 10x NEB 4 Buffer<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>1 <span class=SpellE>uL</span> <span class=SpellE>dpnI</span><o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>29 <span class=SpellE>uL</span> H20<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>--<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>50 <span class=SpellE>uL</span> <o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>2.<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>30 <span class=SpellE>uL</span> vector 2<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>5 <span class=SpellE>uL</span> 10x NEB 4 Buffer<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>1 <span class=SpellE>uL</span> <span class=SpellE>dpnI</span><o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>14 <span class=SpellE>uL</span> H20<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>--<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>50 <span class=SpellE>uL</span><o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>37 <span class=SpellE>deg</span> x 2 <span class=SpellE>hrs</span><o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>2e. Purification<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal><span class=GramE>Standard <span class=SpellE>Qiagen</span>
+
-
PCR purification protocol.</span><span style='mso-spacerun:yes'>  </span>Elute
+
-
in H20.<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>2F. Gibson cloning<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal><span class=SpellE><span class=GramE>pmols</span></span> =
+
-
weight(<span class=SpellE>ng</span>) x 1000 / (<span class=SpellE>bp</span> x
+
-
650 <span class=SpellE>daltons</span>)<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>Will use .05 <span class=SpellE>pmol</span> of vector, .1 <span
+
-
class=SpellE>pmol</span> for each insert<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal><span class=SpellE>Vec</span> 1 (.05pmol) = need 68.57ng /
+
-
(79.5ng/<span class=SpellE>uL</span>) = .86uL<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><span class=SpellE>Vec</span> 2 (.05pmol) = need 68.57ng /
+
-
(132.5ng/<span class=SpellE>uL</span>) = .52uL<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>NdmA1 (.1pmol) = need 71.5ng / (139.8ng/<span class=SpellE>uL</span>)
+
-
= .51 <span class=SpellE>uL</span><o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>NdmA2 (.1pmol) = need 71.5ng / (144.5ng/<span class=SpellE>uL</span>)
+
-
= .49 <span class=SpellE>uL</span><o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><span class=SpellE><span class=GramE>NdmB</span></span><span
+
-
class=GramE><span style='mso-spacerun:yes'>  </span>(</span>.1pmol) = need
+
-
73.4ng / (144.6ng/<span class=SpellE>uL</span>) = .50 <span class=SpellE>uL</span><o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><span class=SpellE><span class=GramE>NdmC</span></span><span
+
-
class=GramE><span style='mso-spacerun:yes'>  </span>(</span>.1pmol) = need
+
-
58.8ng / (146.1ng/<span class=SpellE>uL</span>) = .40 <span class=SpellE>uL</span><o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><span class=SpellE><span class=GramE>NdmD</span></span><span
+
-
class=GramE><span style='mso-spacerun:yes'>  </span>(</span>.1pmol) = need
+
-
120.ng / (104.8ng/<span class=SpellE>uL</span>) = 1.15 <span class=SpellE>uL</span><o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal><span class=SpellE><span class=GramE>rxns</span></span>:<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>1.<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>.86 <span class=SpellE>uL</span> <span class=SpellE>vec</span>
+
-
1<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>.51 <span class=SpellE>uL</span> ndmA_1<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>.50 <span class=SpellE>uL</span> <span class=SpellE>NdmB</span><o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>.40 <span class=SpellE>uL</span> <span class=SpellE>NdmC</span><o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>1.15 <span class=SpellE>uL</span> <span class=SpellE>NdmD</span><o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>15 <span class=SpellE>ul</span> 1.33x Gibson Master Mix<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>1.58 <span class=SpellE>uL</span> H20<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>--<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>20 <span class=SpellE>uL</span> total<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>2.<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>.86 <span class=SpellE>uL</span> <span class=SpellE>vec</span>
+
-
1<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>15 <span class=SpellE>uL</span> 1.33x Gibson Master Mix<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>4.14 <span class=SpellE>uL</span> H20<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>--<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>20 <span class=SpellE>uL</span> total<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>3.<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>.52 <span class=SpellE>uL</span> <span class=SpellE>Vec</span>
+
-
2<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>.51 <span class=SpellE>uL</span> ndmA_1<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>.50 <span class=SpellE>uL</span> <span class=SpellE>NdmB</span><o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>.40 <span class=SpellE>uL</span> <span class=SpellE>NdmC</span><o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>1.15 <span class=SpellE>uL</span> <span class=SpellE>NdmD</span><o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>15 <span class=SpellE>ul</span> 1.33x Gibson Master Mix<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>1.94 <span class=SpellE>uL</span> H20<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>--<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>20 <span class=SpellE>uL</span> total<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>4.<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>.52 <span class=SpellE>uL</span> <span class=SpellE>vec</span>
+
-
1<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>15 <span class=SpellE>uL</span> 1.33x Gibson Master Mix<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>4.14 <span class=SpellE>uL</span> H20<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>--<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>20 <span class=SpellE>uL</span> total<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>50 <span class=SpellE>deg</span> <span class=SpellE>thermocycler</span>
+
-
x 60 minutes<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>Run 5 <span class=SpellE>uL</span> each reaction on .8% <span
+
-
class=SpellE>agarose</span> gel<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal><span class=GramE>insert</span> igm2f.jpeg<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>Desalted <span class=SpellE><span class=GramE>gibson</span></span>
+
-
reactions on .025uM Nitrocellulose membranes x 20 minutes<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>2g<span class=GramE>.<span style='mso-spacerun:yes'>
+
-
</span>Electroporation</span><o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>Decided to not proceed with <span class=SpellE>promoterless</span>
+
-
construct (2F3<span class=GramE>,4</span>)<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>1 <span class=SpellE>uL</span> desalted <span class=SpellE>gibson</span>
+
-
reaction (2F1<span class=GramE>,2</span>) -&gt;50 <span class=SpellE>uL</span> <span
+
-
class=SpellE>electrocompetent</span> BW25113-GuaB -&gt; 1mL SOC -&gt; 1hr
+
-
incubation @ 37 <span class=SpellE>deg</span><o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>2j<span class=GramE>.<span style='mso-spacerun:yes'>
+
-
</span>Selective</span> growth in Caffeine/Theophylline<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>dilute 60 <span class=SpellE>uL</span> 2g transformations
+
-
(1-2) -&gt; 3mL Mineral M9 media + 34ug/mL chloramphenicol +/- 100mg Caffeine
+
-
or Theophylline.<span style='mso-spacerun:yes'>  </span>Place on 30 <span
+
-
class=SpellE>deg</span> shaker x 48 <span class=SpellE>hrs</span><o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>Results (growth):<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal><span style='mso-tab-count:3'>                                                </span>2g1
+
-
(+operon)<span style='mso-tab-count:2'>                  </span>2g2 (vector
+
-
only)<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>1. M9<span style='mso-tab-count:3'>                                    </span>-<span
+
-
style='mso-tab-count:3'>                                              </span>-<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>2. M9 + caffeine<span style='mso-tab-count:1'>              </span>-<span
+
-
style='mso-tab-count:3'>                                              </span>-<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>3. M9 + Theophylline<span style='mso-tab-count:1'>      </span>+<span
+
-
style='mso-tab-count:3'>                                            </span>_<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>Result: construct enables growth (<span class=SpellE>demethylation</span>)
+
-
on Theophylline.<span style='mso-spacerun:yes'> </span><span class=SpellE>NdmC</span>
+
-
is not <span class=SpellE>fuctional</span>.<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>Streak 2j1 theophylline enriched culture onto
+
-
LB-chloramphenicol plate for isolation of single colonies.<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>2K Plasmid Prep<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>Pick 2 colonies from theophylline enriched streak for
+
-
plasmid prep.<span style='mso-spacerun:yes'>  </span>Prep 5mL culture.<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>2L Restriction Digest<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>Perform restriction digest to analyze insert size of
+
-
plasmids<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>1 <span class=SpellE>uL</span> 2k1<span class=GramE>,2</span><o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>1 <span class=SpellE>uL</span> 10x NEB 3<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>.5 <span class=SpellE>uL</span> <span class=SpellE>NotI</span><o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>6.5 <span class=SpellE>uL</span> H20<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>--<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal>10 <span class=SpellE>uL</span><o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>37 <span class=SpellE>deg</span> x 1hr<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>Run 5 <span class=SpellE>uL</span> on .8% <span
+
-
class=SpellE>agarose</span> gel<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal><span class=GramE>insert</span> gel image (on darkroom
+
-
computer?)<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>Result:<span style='mso-spacerun:yes'>  </span>both clones
+
-
show anticipated ~5kB band corresponding to the complete operon.<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal>&lt;/p&gt;<o:p></o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
<p class=MsoNormal><o:p>&nbsp;</o:p></p>
+
-
 
+
-
</div>
+
-
 
+
-
</body>
+
-
 
+
-
</html>
+

Revision as of 18:28, 20 August 2012

Experiment 2: Constructon of a refactored decaffeination operon

2a. Phusion PCR

Primers:
EQ_pSB1c3_NdmA_for: TAGGTACAGTGCTAGCTACTAGAGAAATCAAATTAAGGAGGTAAGATAAATGGAACAGGCAATCATTAATGATGAACGGG
EQ_pBSC1C_NdmA_2: TGATTTCTGGAATTCGCGGCCGCTTCTAGAGATTAAGGAGGTAAGATAAATGGAACAGGCAATCATTAATGATGAACGGG
EQ_pSB1C3_Gib_rev: TTGATTTCTCTAGTAGCTAGCACTGTACCTAGGACTG
EQ_NdmA_rev: TTATATGTAGCTCCTATCGCTTTCAATGACTGGG
EQ_RBS_NdmB_for: gtCATTGAAAGCGATAGGAGCTACATATAATCTAGAGAAAGAGGAGAAATACTAGATGAAAGAACAGCTCAAGCCGCTG
EQ_NdmB_rev: ccggtctcgcTTACTGTTCTTCTTCAATAACATTCGTCAAGACG
EQ_RBS_NdmC_for: GAAGAAGAACAGTAAgcgagaccggTCTAGAGAAAGAGGAGAAATACTAGATGTCTACTGACCAAGTAATTTTTAACGactgg
EQ_NdmC_rev: TTAGTCCCGCAGAGCACCATATTGCac
EQ_RBS_NdmD for: GCAATATGGTGCTCTGCGGGACTAATCTAGAGAAAGAGGAGAAATACTAGATGAACAAACTTGACGTCAACCagtgg
EQ_NdmD_pBS1C_rev: TTATACAGCTCGTCCATACCGTGGGTGATGCCCGGCCTCACAGATCGAGAACGATT
EQ_pBS1C_Gib_for: GGGCATCACCCACGGTATGGACGAG
EQ_pBS1C_rev_2: CTCTAGAAGCGGCCGCGAATTCCAGAAATCA



10 uL 5x Phusion HF Buffer
1 uL 10mM dNTPs
5 uL 5uM forward primer
5 uL 5uM reverse primer
1 uL DMSO
1 uL template
26.5 uL H20
--
.5 uL phusion polymerase

rxns:

Vector PCRs
1. Bba_k515105 + EQ_pSB1C3_Gib_for + EQ_pSB1c3_gib_rev
2. Bba_k515105 + EQ_pSB1C3_Gib_for + EQ_pSB1c3_gib_rev_2

Insert PCRs
3. CBB5 cells + EQ_NdmA_for + EQ_NdmA_rev
4. CBB5 cells + EQ_pSB1C3_NdmA_2 + EQ_NdmA_rev
5. CBB5 cells + EQ_RBS_NdmB_for + EQ_NdmB_rev
6. CBB5 cells + EQ_RBS_NdmC_for + EQ_NdmC_rev
7. CBB5 cells + EQ_RBS_NdmD_for + EQ_NdmD_pSB1C_rev

PCR cycling:

98 deg x 3 min
--
98 deg x 30s
58 deg x 20s x30 cycles
72 deg x 2 min
--
72 deg x 10 min


Gel igm2a


2b. PCR purification

Qiagen PCR purification protocol

Elute in 35 uL h20

nanodrop concentrations:

1. vector 1: 289.0 ng/uL
2. vector 2: 85.6 ng/uL
3. NdmA_1: 139.8 ng/uL
4. NdmA_2: 144.5 ngl/uL
5. NdmB: 144.6ng/uL
6. NdmC: 146.1 ng/uL
7. NdmD: 104.8ng/uL

2c: DpnI digest of vector PCRs

1.
15 uL vector 1
5 uL 10x NEB 4 Buffer
1 uL dpnI
29 uL H20
--
50 uL

2.
30 uL vector 2
5 uL 10x NEB 4 Buffer
1 uL dpnI
14 uL H20
--
50 uL

37 deg x 2 hrs

2e. Purification

Standard Qiagen PCR purification protocol. Elute in H20.


2F. Gibson cloning

pmols = weight(ng) x 1000 / (bp x 650 daltons)


Will use .05 pmol of vector, .1 pmol for each insert

Vec 1 (.05pmol) = need 68.57ng / (79.5ng/uL) = .86uL
Vec 2 (.05pmol) = need 68.57ng / (132.5ng/uL) = .52uL

NdmA1 (.1pmol) = need 71.5ng / (139.8ng/uL) = .51 uL
NdmA2 (.1pmol) = need 71.5ng / (144.5ng/uL) = .49 uL
NdmB (.1pmol) = need 73.4ng / (144.6ng/uL) = .50 uL
NdmC (.1pmol) = need 58.8ng / (146.1ng/uL) = .40 uL
NdmD (.1pmol) = need 120.ng / (104.8ng/uL) = 1.15 uL

rxns:

1.
.86 uL vec 1
.51 uL ndmA_1
.50 uL NdmB
.40 uL NdmC
1.15 uL NdmD
15 ul 1.33x Gibson Master Mix
1.58 uL H20
--
20 uL total

2.
.86 uL vec 1
15 uL 1.33x Gibson Master Mix
4.14 uL H20
--
20 uL total

3.
.52 uL Vec 2
.51 uL ndmA_1
.50 uL NdmB
.40 uL NdmC
1.15 uL NdmD
15 ul 1.33x Gibson Master Mix
1.94 uL H20
--
20 uL total

4.
.52 uL vec 1
15 uL 1.33x Gibson Master Mix
4.14 uL H20
--
20 uL total

50 deg thermocycler x 60 minutes

Run 5 uL each reaction on .8% agarose gel

insert igm2f.jpeg

Desalted gibson reactions on .025uM Nitrocellulose membranes x 20 minutes

2g. Electroporation

Decided to not proceed with promoterless construct (2F3,4)

1 uL desalted gibson reaction (2F1,2) ->50 uL electrocompetent BW25113-GuaB -> 1mL SOC -> 1hr incubation @ 37 deg


2j. Selective growth in Caffeine/Theophylline

dilute 60 uL 2g transformations (1-2) -> 3mL Mineral M9 media + 34ug/mL chloramphenicol +/- 100mg Caffeine or Theophylline. Place on 30 deg shaker x 48 hrs

Results (growth):

2g1 (+operon) 2g2 (vector only) 1. M9 - - 2. M9 + caffeine - - 3. M9 + Theophylline + _

Result: construct enables growth (demethylation) on Theophylline. NdmC is not fuctional.

Streak 2j1 theophylline enriched culture onto LB-chloramphenicol plate for isolation of single colonies.

2K Plasmid Prep

Pick 2 colonies from theophylline enriched streak for plasmid prep. Prep 5mL culture.

2L Restriction Digest

Perform restriction digest to analyze insert size of plasmids

1 uL 2k1,2
1 uL 10x NEB 3
.5 uL NotI
6.5 uL H20
--
10 uL

37 deg x 1hr

Run 5 uL on .8% agarose gel

insert gel image (on darkroom computer?)

Result: both clones show anticipated ~5kB band corresponding to the complete operon.