Refactored Decaffeination Operon

From 2012.igem.org

(Difference between revisions)
Line 1: Line 1:
{{Template:Austin_Texas/Stylesheet}}
{{Template:Austin_Texas/Stylesheet}}
 +
 +
<html>
 +
<ul class="cssmenu">
 +
<li class="home"><a href="/Team:Austin_Texas" title="home"><span class="displace">Home</span></a></li>
 +
<li class="team"><a href="/Team:Austin_Texas/Team" title="team"><span class="displace">Team</span></a></li>
 +
<li class="official_team_profile"><a href="http://igem.org/Team.cgi?year=2012&team_name=Austin_Texas" title="official_team_profile"><span class="displace">Official Team Profile</span></a></li>
 +
<li class="project"><a href="/Team:Austin_Texas/Project" title="project"><span class="displace">Project</span></a></li>
 +
<li class="parts_submitted"><a href="/Team:Austin_Texas/Parts" title="parts_submitted"><span class="displace">Parts Submitted</span></a></li>
 +
<li class="modelling"><a href="/Team:Austin_Texas/Modeling" title="modeling"><span class="displace">Modeling</span></a></li>
 +
<li class="notebook"><a href="/Team:Austin_Texas/Notebook" class="selected" title="notebook"><span class="displace">Notebook</span></a></li>
 +
<li class="safety"><a href="/Team:Austin_Texas/Safety" title="safety"><span class="displace">Safety</span></a></li>
 +
<li class="attributions"><a href="/Team:Austin_Texas/Attributions" title="attributions"><span class="displace">Attributions</span></a></li>
 +
</ul>
 +
</html>
<html xmlns:v="urn:schemas-microsoft-com:vml"
<html xmlns:v="urn:schemas-microsoft-com:vml"

Revision as of 17:52, 20 August 2012

<p>

Experiment 2: Constructon of a refactored decaffeination operon

 

2a. Phusion PCR

 

 

Primers:

EQ_pSB1c3_NdmA_for: TAGGTACAGTGCTAGCTACTAGAGAAATCAAATTAAGGAGGTAAGATAAATGGAACAGGCAATCATTAATGATGAACGGG

EQ_pBSC1C_NdmA_2: TGATTTCTGGAATTCGCGGCCGCTTCTAGAGATTAAGGAGGTAAGATAAATGGAACAGGCAATCATTAATGATGAACGGG

EQ_pSB1C3_Gib_rev: TTGATTTCTCTAGTAGCTAGCACTGTACCTAGGACTG

EQ_NdmA_rev: TTATATGTAGCTCCTATCGCTTTCAATGACTGGG

EQ_RBS_NdmB_for: gtCATTGAAAGCGATAGGAGCTACATATAATCTAGAGAAAGAGGAGAAATACTAGATGAAAGAACAGCTCAAGCCGCTG

EQ_NdmB_rev: ccggtctcgcTTACTGTTCTTCTTCAATAACATTCGTCAAGACG

EQ_RBS_NdmC_for: GAAGAAGAACAGTAAgcgagaccggTCTAGAGAAAGAGGAGAAATACTAGATGTCTACTGACCAAGTAATTTTTAACGactgg

EQ_NdmC_rev: TTAGTCCCGCAGAGCACCATATTGCac

EQ_RBS_NdmD for: GCAATATGGTGCTCTGCGGGACTAATCTAGAGAAAGAGGAGAAATACTAGATGAACAAACTTGACGTCAACCagtgg

EQ_NdmD_pBS1C_rev: TTATACAGCTCGTCCATACCGTGGGTGATGCCCGGCCTCACAGATCGAGAACGATT

EQ_pBS1C_Gib_for: GGGCATCACCCACGGTATGGACGAG

EQ_pBS1C_rev_2: CTCTAGAAGCGGCCGCGAATTCCAGAAATCA

 

 

 

 

10 uL 5x Phusion HF Buffer

1 uL 10mM dNTPs

5 uL 5uM forward primer

5 uL 5uM reverse primer

1 uL DMSO

1 uL template

26.5 uL H20

--

.5 uL phusion polymerase

 

rxns:

 

Vector PCRs

1. Bba_k515105 + EQ_pSB1C3_Gib_for + EQ_pSB1c3_gib_rev

2. Bba_k515105 + EQ_pSB1C3_Gib_for + EQ_pSB1c3_gib_rev_2

 

Insert PCRs

3. CBB5 cells + EQ_NdmA_for + EQ_NdmA_rev

4. CBB5 cells + EQ_pSB1C3_NdmA_2 + EQ_NdmA_rev

5. CBB5 cells + EQ_RBS_NdmB_for + EQ_NdmB_rev

6. CBB5 cells + EQ_RBS_NdmC_for + EQ_NdmC_rev

7. CBB5 cells + EQ_RBS_NdmD_for + EQ_NdmD_pSB1C_rev

 

PCR cycling:

 

98 deg x 3 min

--

98 deg x 30s

58 deg x 20s x30 cycles

72 deg x 2 min

--

72 deg x 10 min

 

 

Gel igm2a

 

 

 

2b. PCR purification

 

Qiagen PCR purification protocol

 

Elute in 35 uL h20

 

nanodrop concentrations:

 

1. vector 1: 289.0 ng/uL

2. vector 2: 85.6 ng/uL

3. NdmA_1: 139.8 ng/uL

4. NdmA_2: 144.5 ngl/uL

5. NdmB: 144.6ng/uL

6. NdmC: 146.1 ng/uL

7. NdmD: 104.8ng/uL

 

2c: DpnI digest of vector PCRs

 

1.

15 uL vector 1

5 uL 10x NEB 4 Buffer

1 uL dpnI

29 uL H20

--

50 uL

 

2.

30 uL vector 2

5 uL 10x NEB 4 Buffer

1 uL dpnI

14 uL H20

--

50 uL

 

37 deg x 2 hrs

 

2e. Purification

 

Standard Qiagen PCR purification protocol. Elute in H20.

 

 

 

2F. Gibson cloning

 

pmols = weight(ng) x 1000 / (bp x 650 daltons)

 

 

Will use .05 pmol of vector, .1 pmol for each insert

 

Vec 1 (.05pmol) = need 68.57ng / (79.5ng/uL) = .86uL

Vec 2 (.05pmol) = need 68.57ng / (132.5ng/uL) = .52uL

 

NdmA1 (.1pmol) = need 71.5ng / (139.8ng/uL) = .51 uL

NdmA2 (.1pmol) = need 71.5ng / (144.5ng/uL) = .49 uL

NdmB (.1pmol) = need 73.4ng / (144.6ng/uL) = .50 uL

NdmC (.1pmol) = need 58.8ng / (146.1ng/uL) = .40 uL

NdmD (.1pmol) = need 120.ng / (104.8ng/uL) = 1.15 uL

 

rxns:

 

1.

.86 uL vec 1

.51 uL ndmA_1

.50 uL NdmB

.40 uL NdmC

1.15 uL NdmD

15 ul 1.33x Gibson Master Mix

1.58 uL H20

--

20 uL total

 

2.

.86 uL vec 1

15 uL 1.33x Gibson Master Mix

4.14 uL H20

--

20 uL total

 

3.

.52 uL Vec 2

.51 uL ndmA_1

.50 uL NdmB

.40 uL NdmC

1.15 uL NdmD

15 ul 1.33x Gibson Master Mix

1.94 uL H20

--

20 uL total

 

4.

.52 uL vec 1

15 uL 1.33x Gibson Master Mix

4.14 uL H20

--

20 uL total

 

50 deg thermocycler x 60 minutes

 

Run 5 uL each reaction on .8% agarose gel

 

insert igm2f.jpeg

 

Desalted gibson reactions on .025uM Nitrocellulose membranes x 20 minutes

 

2g. Electroporation

 

Decided to not proceed with promoterless construct (2F3,4)

 

1 uL desalted gibson reaction (2F1,2) ->50 uL electrocompetent BW25113-GuaB -> 1mL SOC -> 1hr incubation @ 37 deg

 

 

2j. Selective growth in Caffeine/Theophylline

 

dilute 60 uL 2g transformations (1-2) -> 3mL Mineral M9 media + 34ug/mL chloramphenicol +/- 100mg Caffeine or Theophylline. Place on 30 deg shaker x 48 hrs

 

Results (growth):

 

2g1 (+operon) 2g2 (vector only)

1. M9 - -

2. M9 + caffeine - -

3. M9 + Theophylline + _

 

Result: construct enables growth (demethylation) on Theophylline. NdmC is not fuctional.

 

Streak 2j1 theophylline enriched culture onto LB-chloramphenicol plate for isolation of single colonies.

 

2K Plasmid Prep

 

Pick 2 colonies from theophylline enriched streak for plasmid prep. Prep 5mL culture.

 

2L Restriction Digest

 

Perform restriction digest to analyze insert size of plasmids

 

1 uL 2k1,2

1 uL 10x NEB 3

.5 uL NotI

6.5 uL H20

--

10 uL

 

37 deg x 1hr

 

Run 5 uL on .8% agarose gel

 

insert gel image (on darkroom computer?)

 

Result: both clones show anticipated ~5kB band corresponding to the complete operon.

 

 

</p>