Team:Nanjing China Bio/index

From 2012.igem.org

(Difference between revisions)
Line 154: Line 154:
                                   </div>
                                   </div>
                                   <div class="txt1">
                                   <div class="txt1">
-
                                         <span class="w365">Salmonella selection:methods A </span>
+
                                         <span class="w365">Salmonella selection:abstract A </span>
                                         <span class="txt2">
                                         <span class="txt2">
-
                                        Using lambda red recombination method to have mutations
+
                                      <p>Salmonella typhimurium</p>VNP20009 (VNP) has unique characteristics of  
-
                                        The first step to knock out the genes of vnp20009 was to
+
                                      high tumor targeting and low toxicity. It can highly colonize central
-
                                        introduce pkd46 into the vnp20009 so that the three genes
+
                                      parts of tumor tissues.  Our project aims to decrease the influence
-
                                        γ,β,andexo can be expressed. Gam inhibits the host RecBCDexonuclease
+
                                      of the bacteria on normal tissues by enhancing the bacteria's ability
-
                                        v so that BET and EXO can gain access to DNA ends and to promote
+
                                      of tumor targeting through modifying the amino acid metabolism pathways.  
-
                                        recombination.We then designed the PCR primers which provide  the
+
                                         We also use VNP as a vector to express exogenous genes with anaerobic
-
                                        homology to the targeted  gene(s). Primers were 60bp in length
+
                                         promoters in the upper stream to further improve the effect of tumor  
-
                                        and were used to amplify a Kanamycin cassette from pKD4 with
+
                                         targeting.  Thus, it can be a efficient method of cancer treatment
-
                                        flanking DNA to the gene targeted for deletion. For the forward
+
                                        with the bacteria.
-
                                        primer (RF1), select 40bp from ATG backwards, then add 20bp
+
-
                                        from vector backbone (CATATGAATATCCTCCTTA). For the reverse
+
-
                                        primer (RR1), select 24bp from the last nucleotide (stop codon)
+
-
                                        of gene inwards and 16bp after stop codon (downstream. of gene).
+
-
                                         Reverse complement this sequence, then add 20bp of reverse-complemented
+
-
                                        vector backbone sequence (GTGTAGGCTGGAGCTGCTCC).To incorporate the linear
+
-
                                         DNA into the chromosome of salmonella, we electroporate the PCR product
+
-
                                        into the Salmonella harboring pKD46 by......<a href="/Team:Nanjing_China_Bio/method">learn more>></a>
+
-
                                        </span>
+
-
                                  </div>
+
-
                            </div>
+
-
                            <div class="w301">
+
-
                                  <div class="w274">
+
-
                                        <div class="w2741"></div>
+
-
                                        <div class="w2742">Tumor-Targeted:tumor-tergeting provides a high-performance manner in which we can treat we can treat cancer more ...</div>
+
-
                                        <div class="w2743">Salmonella:a kind of harmful bacterium may be the light to a harmful disease.</div>
+
-
                                        <div class="w2744">Anaerobic promoter:it can lead to the expression of some antitumor agents directly inside the tumor</div>
+
-
                                         <div class="w2745">auxotrophy the inability of the Salmo-nella to synthesize a particular organic compound required for it's growth</div>
+
-
                                        <div class="w2746">auxotrophy the inability of the Salmo-nella to synthesize a particular organic compound required for it's growth</div>
+
-
                                  </div>
+
-
                            </div>
+
-
                      </div>
+
-
                      <div class="h62"></div>
+
-
                      <div class="h60">
+
-
                            <div class="w130"></div>
+
-
                            <div class="more2"><a href='/Team:Nanjing_China_Bio/member'></a></div>
+
-
                      </div>
+
-
                      <ul class="ul1">
+
-
                          <li class="li1">
+
-
                          <div class="h27">An Hu</div>
+
-
                          <img src="https://static.igem.org/mediawiki/2012/9/98/140_245.jpg">
+
-
                          <div class="h56">
+
-
                          <span class="sh56">Here is a chinese's boy name is AnHu</span>
+
-
                          </div>
+
-
                          </li>
+
-
                          <li class="li1">
+
-
                          <div class="h27">An Hu</div>
+
-
                          <img src="https://static.igem.org/mediawiki/igem.org/9/98/140_245.jpg">
+
-
                          <div class="h56">
+
-
                          <span class="sh56">Here is a chinese's boy name is AnHu</span>
+
-
                          </div>
+
-
                          </li>
+
-
                          <li class="li1">
+
-
                          <div class="h27">An Hu</div>
+
-
                          <img src="https://static.igem.org/mediawiki/igem.org/9/98/140_245.jpg">
+
-
                          <div class="h56">
+
-
                            <span class="sh56">Here is a chinese's boy name is AnHu</span>
+
-
                          </div>
+
-
                          </li>
+
-
                          <li class="li1">
+
-
                          <div class="h27">An Hu</div>
+
-
                          <img src="https://static.igem.org/mediawiki/igem.org/9/98/140_245.jpg">
+
-
                          <div class="h56">
+
-
                          <span class="sh56">Here is a chinese's boy name is AnHu</span>
+
-
                          </div>
+
-
                          </li>
+
-
                          <li class="li1">
+
-
                          <div class="h27">An Hu</div>
+
-
                          <img src="https://static.igem.org/mediawiki/igem.org/9/98/140_245.jpg">
+
-
                          <div class="h56">
+
-
                          <span class="sh56">Here is a chinese's boy name is AnHu</span>
+
-
                          </div>
+
-
                          </li>
+
-
                            <li class="li1">
+
-
                          <div class="h27">An Hu</div>
+
-
                          <img src="https://static.igem.org/mediawiki/igem.org/9/98/140_245.jpg">
+
-
                          <div class="h56">
+
-
                          <span class="sh56">Here is a chinese's boy name is AnHu</span>
+
-
                          </div>
+
-
                          </li>
+
-
                         
+
-
                      </ul>
+
-
                     
+
-
                      <div class="h90">
+
-
                            <div class="h88"><img src="https://static.igem.org/mediawiki/igem.org/f/f5/194_88.jpg"></div>
+
-
                            <div class="w600">
+
-
                            Our team consists of senior and junior students from departments of Life Science, Computer
+
-
                            Science and Journalism and Communication.  We come together and work together for one common
+
-
                            goal.  Though there were difficulties and obstacles during the process, we didn't give up and
+
-
                            gave all our efforts.  Thanks to iGEM for giving us a chance for us to meet each other and
+
-
                            work together and we will do our best.
+
                             </div>
                             </div>
                       </div>
                       </div>

Revision as of 03:47, 26 September 2012

南京IGEM
Salmonella selection:abstract A

Salmonella typhimurium

VNP20009 (VNP) has unique characteristics of high tumor targeting and low toxicity. It can highly colonize central parts of tumor tissues. Our project aims to decrease the influence of the bacteria on normal tissues by enhancing the bacteria's ability of tumor targeting through modifying the amino acid metabolism pathways. We also use VNP as a vector to express exogenous genes with anaerobic promoters in the upper stream to further improve the effect of tumor targeting. Thus, it can be a efficient method of cancer treatment with the bacteria.
5.12(all) This is our first regular meeting since we formed our iGEM team. During this meeting, we introduced ourselves to each other, and learned more about our goal. Our team consists of sophomore and junior students from different departments.
The first section was given by Kevin about the general background of iGEM and the specific requirements of the competition. The techniques that could be used in our experiments were also introduced, and it's lucky to know that we have already learned the fundamental knowledge of these techniques.

Retrieved from "http://2012.igem.org/Team:Nanjing_China_Bio/index"