Team:Nanjing China Bio/index

From 2012.igem.org

(Difference between revisions)
Line 60: Line 60:
/* content begin*/
/* content begin*/
.con{width:976px; height:auto; margin:0 auto; background:url(https://static.igem.org/mediawiki/igem.org/8/81/976_727.jpg) repeat-y; padding-bottom:20px;}
.con{width:976px; height:auto; margin:0 auto; background:url(https://static.igem.org/mediawiki/igem.org/8/81/976_727.jpg) repeat-y; padding-bottom:20px;}
-
.mian{width:875px; min-height:1500px; height:auto; margin:0 auto;}
+
.mian{width:875px; height:auto; margin:0 auto;}
.w870{width:870px; height:214px; margin:0 auto; }
.w870{width:870px; height:214px; margin:0 auto; }
.h800{width:870px; height:490px; margin:0 auto; margin-top:30px;}
.h800{width:870px; height:490px; margin:0 auto; margin-top:30px;}
Line 142: Line 142:
        
        
    
    
-
                       
+
                <div class="mian ">
 +
                    <!-- <div class="w870"><img src="https://static.igem.org/mediawiki/igem.org/8/8d/870_214.jpg"/></div>
 +
                      <div class="h800">
 +
                            <div class="w530">
 +
                                  <div class="h6"></div>
 +
                                  <div class="h44">
 +
                                        <div class="w121"></div>
 +
                                        <div class="more"></div>
 +
                                  </div>
 +
                                  <div class="txt1">
 +
                                        <span class="w365">Salmonella selection:methods A </span>
 +
                                        <span class="txt2">
 +
                                        Using lambda red recombination method to have mutations
 +
                                        The first step to knock out the genes of vnp20009 was to
 +
                                        introduce pkd46 into the vnp20009 so that the three genes
 +
                                        γ,β,andexo can be expressed. Gam inhibits the host RecBCDexonuclease
 +
                                        v so that BET and EXO can gain access to DNA ends and to promote
 +
                                        recombination.We then designed the PCR primers which provide  the
 +
                                        homology  to  the  targeted  gene(s). Primers were 60bp in length
 +
                                        and were used to amplify a Kanamycin cassette from pKD4 with
 +
                                        flanking DNA to the gene targeted for deletion. For the forward
 +
                                        primer (RF1), select 40bp from ATG backwards, then add 20bp
 +
                                        from vector backbone (CATATGAATATCCTCCTTA). For the reverse
 +
                                        primer (RR1), select 24bp from the last nucleotide (stop codon)
 +
                                        of gene inwards and 16bp after stop codon (downstream. of gene).
 +
                                        Reverse complement this sequence, then add 20bp of reverse-complemented
 +
                                        vector backbone sequence (GTGTAGGCTGGAGCTGCTCC).To incorporate the linear
 +
                                        DNA into the chromosome of salmonella, we electroporate the PCR product
 +
                                        into the Salmonella harboring pKD46 by......<a>learn more>></a>
 +
                                        </span>
 +
                                  </div>
 +
                            </div>
 +
                            <div class="w301">
 +
                                  <div class="w274">
 +
                                        <div class="w2741"></div>
 +
                                        <div class="w2742">Tumor-Targeted:tumor-tergeting provides a high-performance manner in which we can treat we can treat cancer more ...</div>
 +
                                        <div class="w2743">Salmonella:a kind of harmful bacterium may be the light to a harmful disease.</div>
 +
                                        <div class="w2744">Anaerobic promoter:it can lead to the expression of some antitumor agents directly inside the tumor</div>
 +
                                        <div class="w2745">auxotrophy the inability of the Salmo-nella to synthesize a particular organic compound required for it's growth</div>
 +
                                        <div class="w2746">auxotrophy the inability of the Salmo-nella to synthesize a particular organic compound required for it's growth</div>
 +
                                  </div>
 +
                            </div>
 +
                      </div>
 +
                      <div class="h62"></div>
 +
                      <div class="h60">
 +
                            <div class="w130"></div>
 +
                            <div class="more2"></div>
 +
                      </div>
 +
                      <ul class="ul1">
 +
                          <li class="li1">
 +
                          <div class="h27">An Hu</div>
 +
                          <img src="https://static.igem.org/mediawiki/2012/9/98/140_245.jpg">
 +
                          <div class="h56">
 +
                          <span class="sh56">Here is a chinese's boy name is AnHu</span>
 +
                          </div>
 +
                          </li>
 +
                          <li class="li1">
 +
                          <div class="h27">An Hu</div>
 +
                          <img src="https://static.igem.org/mediawiki/igem.org/9/98/140_245.jpg">
 +
                          <div class="h56">
 +
                          <span class="sh56">Here is a chinese's boy name is AnHu</span>
 +
                          </div>
 +
                          </li>
 +
                          <li class="li1">
 +
                          <div class="h27">An Hu</div>
 +
                          <img src="https://static.igem.org/mediawiki/igem.org/9/98/140_245.jpg">
 +
                          <div class="h56">
 +
                            <span class="sh56">Here is a chinese's boy name is AnHu</span>
 +
                          </div>
 +
                          </li>
 +
                          <li class="li1">
 +
                          <div class="h27">An Hu</div>
 +
                          <img src="https://static.igem.org/mediawiki/igem.org/9/98/140_245.jpg">
 +
                          <div class="h56">
 +
                          <span class="sh56">Here is a chinese's boy name is AnHu</span>
 +
                          </div>
 +
                          </li>
 +
                          <li class="li1">
 +
                          <div class="h27">An Hu</div>
 +
                          <img src="https://static.igem.org/mediawiki/igem.org/9/98/140_245.jpg">
 +
                          <div class="h56">
 +
                          <span class="sh56">Here is a chinese's boy name is AnHu</span>
 +
                          </div>
 +
                          </li>
 +
                            <li class="li1">
 +
                          <div class="h27">An Hu</div>
 +
                          <img src="https://static.igem.org/mediawiki/igem.org/9/98/140_245.jpg">
 +
                          <div class="h56">
 +
                          <span class="sh56">Here is a chinese's boy name is AnHu</span>
 +
                          </div>
 +
                          </li>
 +
                         
 +
                      </ul>
 +
                     
 +
                      <div class="h90">
 +
                            <div class="h88"><img src="https://static.igem.org/mediawiki/igem.org/f/f5/194_88.jpg"></div>
 +
                            <div class="w600">
 +
                            Our team consists of senior and junior students from departments of Life Science, Computer
 +
                            Science and Journalism and Communication.  We come together and work together for one common
 +
                            goal.  Though there were difficulties and obstacles during the process, we didn't give up and
 +
                            gave all our efforts.  Thanks to iGEM for giving us a chance for us to meet each other and
 +
                            work together and we will do our best.
 +
                            </div>
 +
                      </div>
 +
                      <div class="h63"></div>
 +
                      <div class="w527">
 +
                            <div class="w389"></div>
 +
                            <ul class="ul2">
 +
                                <li><a href="https://2012.igem.org/Team:Nanjing_China_Bio/notebook"class="li1">May</a></li>
 +
                                <li><a href="https://2012.igem.org/Team:Nanjing_China_Bio/notebook6
 +
">June</a></li>
 +
                                <li><a href="https://2012.igem.org/Team:Nanjing_China_Bio/notebook7
 +
">July</a></li>
 +
                                <li><a href="https://2012.igem.org/Team:Nanjing_China_Bio/notebook8
 +
">Auagust</a></li>
 +
                                <li><a href="https://2012.igem.org/Team:Nanjing_China_Bio/notebook9
 +
 
 +
">September</a></li>
 +
                            </ul>
 +
                            <div class="w200">
 +
                                <div class="w180">
 +
                            5.12(all)
 +
This is our first regular meeting since we formed our iGEM team.  During this meeting, we introduced ourselves to each other, and learned more about our goal.  Our team consists of sophomore and junior students from different departments.
 +
<br/>
 +
The first section was given by Kevin about the general background of iGEM and the specific requirements of the competition.  The techniques that could be used in our experiments were also introduced, and it's lucky to know that we have already learned the fundamental knowledge of these techniques.
 +
                                </div>
 +
                            </div>
 +
                      </div>
 +
                      <div class="w300">
 +
                            <div class="w37"></div>
 +
                            <div class="h250">
 +
                                  <div class="m2721"><img src="https://static.igem.org/mediawiki/igem.org/e/e2/272_60.gif"></div>
 +
                                  <div class="m2722"><img src="https://static.igem.org/mediawiki/igem.org/a/ac/272_68.gif"></div>
 +
                                  <div class="m2723"><img src="https://static.igem.org/mediawiki/igem.org/5/5f/272_69.gif"></div>
 +
                            </div>
 +
                      </div>-->
 +
                </div>
 +
       

Revision as of 08:24, 25 September 2012

南京IGEM

Retrieved from "http://2012.igem.org/Team:Nanjing_China_Bio/index"