Team:Potsdam Bioware/Lab/Labjournal/July

AID

2012-07-02

===

Topic: Overnight culture of CMV and polyA carrying cells

Investigators: Mario, Tom S.

Time: 2012-07-02

AIM: Preparation of wild type AID

Materials:
* LB medium
* Chloramphenicol 25 mg/mL stock solution in 70 % EtOH
* Plasmids: pSB1C3 with CMV; pSB1C3 with Poly-A
Method:
Inoculation of cell sample each in 5 ml LB medium
shaking over night at 37 °C, 300 rpm, approx. 16 hours

Further tasks:
* Miniprep

2012-07-03

===

Topic: Glycerolstocks, Miniprep and preparative digestion

Investigators: Basia, Tom S., Chris, Mario

Time: 2012-07-03

Aim: Preparation of wildtype AID

Materials:
* Glycerol
* Miniprep Kit
* overnight culture (pSB1C3 with CMV); overnight culture (pSB1C3 with Poly-A)* CMV: Restriction enzymes (SpeI, PstI); NEB buffer 2* Poly-A: Restriction enzymes (Poly A: PstI, XbaI); NEB buffer 3
Method:
Glycerol stock: 500 µL Glycerol 99,8 % + 500 µL overnight cultures --> put in -80 °C freezer
Miniprep (both over night culture (pSB1C3 with CMV) and over night culture (pSB1C3 with Poly-A)
preparative digestion: 25 µL DNA + 1 µL of each enzyme + 3 µL NEB (2 or 3) buffer

Results:
DNA - concentrations via nanodrop:
pcDNA5 (AG) = 642,9 ng/µL
pcDNA5 (good) = 729,1 ng/µL
pcDNA5 (bad) = 705,4 ng/µL
pSB1C3 with CMV = 311,9 ng/µL
pSB1C3 with Poly-A = 360,3 ng/µL

Topic: Separation of cut DNA fragments via gel electrophoresis

Investigators: Chris, Mario

Time: 2012-07-03

Aim Separation of cut DNA fragments via gel electrophoresis
Materials:
gel electrophoresis material
cut samples:* CMV: Restriction enzymes (SpeI, PstI); NEB buffer 2* Poly-A: Restriction enzymes (PstI, XbaI); NEB buffer 3
Method:
samples:
- 30 µL CMV cut with SpeI and PstI + 7,5 µL loading dye
- 30 µL polyA + 7,5 µL loading dye

gel electrophoresis conditions:
30 µL of each sample into one big slot
V = 120 V
duration roughly 50 minutes

Results:
[[file:UP12_digest_2012-07-03.jpg|300px]][[file:UP12_ladder.jpg|150px]]

Marked fragments were cut out of the gel and transferred into 1,5 mL Eppendorf tubes

Further Tasks:
Gel Extraction

2012-07-04

===

Gel Extraction of CMV and polyA

Investigators:Mario, Tom S.

Aim:Gel Extraction of CMV and polyA

Materials:centrifuge, Nucleo Spin and PCR clean up - Kit, thermo block, nanodrop
Molecular weight calculator online resource: http://www.encorbio.com/protocols/Nuc-MW.htm
multiplicate with factor 2 when DNA is double stranded
Method:extract DNA: according to the manual

Results:
DNA-concentrations via nanodrop:
CMV = 106,8 ng/µL -> 63,7 nM (with mass conc. of 1676525,6 Da)
polyA = 15,1 ng/µL -> 48,5 nM (with mass conc. of 311550 Da)
location: -20 °C freezer, topmost drawer
ready DNA for Ligation
Further tasks:
ligation of fragments

Topic: Overnight culture of AID carrying cells

Investigators: Sascha

Time: 2012-07-04

Materials:
LB medium
ampicillin 100 mg/ ml stock solution
glycerol stocks E. coli XL1 blue with plasmids: pSB1C3 with AID
Method:
Inoculation of cell sample in 5 ml LB medium
shaking overnight at 37°C, 300 rpm, approx. 16 hours

Further tasks:
Miniprep

2012-07-05

===

Topic: Miniprep and preparative digestion

Investigators: Chris

Time: 2012-07-05

Materials:
Miniprep Kit
over night culture (pSB1A3 with AID)AID: Restriction enzymes (XbaI, PstI); NEB buffer 3
Method:
Miniprep according to the manual
preparative digestion: 25 µL DNA + 1 µL of each enzyme + 3 µL NEB 3 buffer

Results:
DNA - concentrations via nanodrop:
pSB1A3 with AID = 85,5 ng/µL

Topic: Separation of cut DNA fragments via gel electrophoresis

Investigators: Mario, Tom S.

Time: 2012-07-05

Aim Separation of cut DNA fragments via gel electrophoresis
Materials:
gel electrophoresis material
cut samples:
AID: Restriction enzymes (XbaI, PstI); NEB buffer 3
Method:
samples:
- 30 µL AID cut with XbaI and PstI + 7,5 µL loading dye

gel electrophoresis conditions:
30 µL of each samples into one big slot converted
V = 120 V
duration roughly 65 minutes

Results:
[[file:UP12_digest_2012-07-05.jpg|300px]]

Marked fragment was cut out of the gel and transferred into 1,5 mL Eppendorf tube

Further Tasks:
Gel extraction

Gel extraction of AID

Investigators:Mario, Tom S.

Aim:Gel extraction of AID

Materials:centrifuge, Nucleo Spin and PCR clean up - Kit, thermo heater, nanodrop

Method:Gel extraction according to the manual

Results:
DNA-concentrations via nanodrop:
AID = 9,2 ng/µL -> 23,8 nM (with mass conc. of 386864,4 Da)
location: -20 °C freezer, topmost drawer
ready DNA for Ligation
Further tasks:
ligation of fragments

Ligation of CMV (Insert + backbone) and AID (insert)

Investigators:Mario, Tom S.

Aim:Ligation of CMV (Insert + backbone) and AID (insert)

Materials:T4 DNA-Ligase, samples(CMV + AID)

Method:DNA Fragment ligation: according to the manual
sample preparation:* 1 µL (CMV Fragment) c=106,8 ng/µL(63,9 nM) -> 6,4 nmol* 6 µL (AID Fragment) c=9,2 ng/µL(23,8 nM) -> 14,3 nmol* 1 µL (T4 DNA-Ligase)* 2 µL (DNase free water)
incubation of sample 1,5 h at 22 °C

Results:
location: -20 °C freezer, topmost drawer
ready DNA Transformation
Further tasks:
Transformation

2012-07-06

===

Topic: Transformation of ligated sample

Investigators: Mario, Tom S.

Time: 2012-07-06

Materials:
* Bunsen burner, Agar Plate with Chloramphenicol, 37 °C heat block, centrifuge
* ligated sample (compare last step 07-05-2012)* icebox* competent E. coli cells (XL 1)
Method:
Transformation via manual
Plate incubation start: 1:30 pm

Results:
grown colonies
Further tasks:
picking clones

2012-07-07

===

Overnight culture of pSB1C3+CMV+AID carrying cells

Investigators: Chris

Time: 2012-07-07 6pm

Materials:LB medium, chloramphenicol 25 mg/ ml stock solution, plates with E. coli XL1 blue with plasmids: pSB1C3+CMV+AID

Method: picking clones (2 per plate->Nr.1-6) and inoculation in 5 ml LB medium + 5µl chloramphenicol stock shaking over night at 37°C, 300 rpm, approx. 16 hours

Further tasks:
glycerolstocks & Miniprep

2012-07-08

===

Topic: Glycerol stocks, Miniprep

Investigators: Basia

Time: 2012-07-08 11:00am

Materials:
Glycerol
Miniprep Kit
6x overnight culture (pSB1C3 with CMV+AID);
Method:
Glycerol stock: 500 µL Glycerol 99,8 % + 500 µL overnight cultures --> put in -80 °C freezer
Miniprep (all 6 over night cultures (pSB1C3 with CMV+AID)

Results:
6 Cryostocks are stored in the igem box in the -80°C freezer and Plasmids are stored in -20°C in the 4th drawer on styrofoam rack

2012-07-09

===

Topic: Measuring DNA-concentration of plasmids from 2012-07-08

Investigators: Mario, Tom S.

Time: 2012-07-09

Materials:
* Plasmids: pSB1C3 with CMV+AID (samples: 1, 2, 3, 4, 5, 6)
* Nanodrop
* NE-buffer
Method:
2 µL of each DNA-sample onto nanodrop (Ne-buffer blank)

Results:
DNA-concentrations:
1 = 290 ng/µL
2 = 361,2 ng/µL
3 = 316,8 ng/µL
4 = 360,5 ng/µL
5 = 392,5 ng/µL
6 = 390 ng/µL

Further tasks:
* restriction enzyme digestion with XbaI und PstI

Topic: preparative digestion

Investigators: Mario, Tom S.

Time: 2012-07-09

Materials:
* Plasmids: pSB1C3 with CMV+AID (samples: 1, 2, 3, 4, 5, 6)
* Restriction enzymes (XbaI and PstI)
* NE3-buffer
Method:
heat block (37 °C)
sample preparation: each DNA 25 µL + 3 µL NE3-buffer + 1 µL XbaI + 1 µL PstI
incubation of samples for 4 h at 37 °C

Results:
none
Further tasks:
* gel electrophoresis

Topic: Separation of cut DNA fragments via gel electrophoresis

Investigators: Mario, Tom S.

Time: 2012-07-09

Aim Separation of cut DNA fragments via gel electrophoresis
Materials:
gel electrophoresis material
cut samples:AID: Restriction enzymes (XbaI, PstI); NEB buffer 3CMV: Restriction enzymes (XbaI, PstI); NEB buffer 3AID+CMV: Restriction enzymes (XbaI, PstI); NEB buffer 3
Method:
samples:
- 10 µL AID cut with XbaI and PstI + 2,5 µL loading dye

gel electrophoresis conditions:
10 µL of each sample into one big well
V = 120 V
duration roughly 95 minutes

Results:
[[file:UP12_digest_2012-07-09.jpg|500px]]


Further Tasks:
overnight culture with AID+CMV sample 1, 2 and 3

Topic: Overnight culture of AID+CMV carrying cells

Investigators: Basia, Tom S.

Time: 2012-07-09, 17:30

Materials:
LB medium
chloramphenicol 25 mg/ ml stock solution
glycerol stocks E. coli XL1 blue with Plasmids: pSB1C3 with AID+CMV of sample 1,2 and 3,
Method:
Inoculation of cell samples in 3 ml LB medium
shaking over night at 37°C, 300 rpm

Further tasks:
Miniprep, preparative digestion, Plasmid ligation with polyA

2012-07-10

===

Topic: Miniprep of CMV+AID carrying plasmids

Investigators: Tom S., Mario

Time: 2012-07-10

Materials:
* samples(CMV + AID: 1, 2, 3) - for detailed info check lab day 2012-07-09
* Miniprep Kit
* overnight culture (pSB1C3 with AID + CMV: samples 1, 2, 3,)
Method:
Plasmid isolation via Kit (check manual)concentration measurement via nanodrop (2 µL sample)


Results:
DNA - concentrations via nanodrop:
AID + CMV (1) = 303,2 ng/µL
AID + CMV (2) = 366,6 ng/µL
AID + CMV (3) = 378,5 ng/µL
Further Tasks:
preparative digestion ('''use sample #3;''' samples 1 and 2 for back up in -20 °C freezer topmost drawer)
fragment cut

2012-07-11

===

Topic: preparative digestion

Investigators: Tom S.

Time: 2012-07-11 09:00

Materials:
* pSB1C3 Vector with CMV+AID* Restriction enzymes (SpeI, PstI); Fast Digest Green Buffer
Method:
preparative digestion: 25 µL DNA + 1 µL of each enzyme + 3 µL Fast Digest Green Buffer (incubation for 2 h)

further tasks:
Gel electrophoresis

Topic: Gel electrophoresis of cut pSB1C3 (CMV + AID) fragments

Investigators: Tom S.

Time: 2012-07-11 11:00

Materials:
* cut sample (CMV + AID, PstI + SpeI)* Gel electrophoresis material
Method:
sample preparation: noneloading into wll: 30 µL
duration: 70 minutes

Results:
one band
Further Tasks:
Gel extraction

Topic: Gel extraction and measurement of DNA concentration

Investigators: Chris, Mario

Time: 2012-07-11 13:00 - 14:00

Materials:
* Analytic Jena gel extraction kit* measurement of DNA concentration via nanodrop
Method:
Gel extraction via manual


Results:
DNA concentration via nanodrop: 98.7 ng/µL
-->2051640 Da (2051,64 kDa)--> c=48.1 nM
Further Tasks:
Ligation of fragment with Poly-A

Topic: Ligation CMV+AID in pSB1C3 (cut:Spe1 and Pst1) with hGH-polyA (cut:Xba1 and Pst1)

Investigators: Chris, Mario

Time: 2012-07-11 16:45 - 17:30

Materials:
digested fragments: CMV+AID in pSB1C3 (cut:Spe1 and Pst1) c=48.1 nM , hGH-polyA (cut:Xba1 and Pst1) c= 15,1 ng/µL -> 48,5 nM
Method:
mix 1µL CMV+AID in pSB1C3 (cut:Spe1 Pst1) c=48.1 nM, 3µL hGH-polyA (cut:Xba1 Pst1) c=48.5 nM, 1µl T4 Ligase, 1µ 10x Buffer,4 µL H20
incubate 1.5 h

Results:
not visibleFurther Tasks:
Transformation

Topic: Transformation of XL1 Blue with CMV+AID+hGH-polyA in pSB1C3

Investigators: Chris

Time: 2012-07-11 finished:18 Uhr

Materials:
LB medium, E. coli XL1 Blue, ligation product (CMV+AID+hGH-polyA), agar-LB-paltes with 1:1000 chloramphenicol
Method:
transformation - standard operating procedures


Results:
two plates with transformed E. coli (CMV+AID+polyA)
Further Tasks:
picking colonies & inoculate 5 ml overnight culture

2012-07-12

===

Overnight culture of pSB1C3 CMV+AID+hGH-polyA, CMV+AID, CMV, hGH-polyA and pSB1A3 AID carrying cells

Investigators: Tom S.

Time: 2012-07-12 6pm

Materials:LB medium, chloramphenicol 25 mg/ ml stock solution, plates with E. coli XL1 blue with plasmids: pSB1C3+CMV+AID, glycerol stocks: pSB1C3 with AID+CMV, CMV, hGH-polyA and pSB1A3 with AID

Method: picking clones(3 per plate->Nr.1-6) and inoculation in 5 ml LB medium + 5µl chloramphenicol stock shaking over night at 37°C, 300 rpm, approx. 16 hours, samples from glycerolstocks in 3 ml LB + 3 µL chloramphenicol or 3µL Amp

Further tasks:
glycerol stocks & Miniprep

Topic: Planing BBa_K929001

Investigators: Tom S., Chris, Basia, Rico, Mario, Kevin

Aim: planing how to digest and ligate the vectors for BBa_K929001

Material: Genious

'''Results:'''pSB1C3 with CMV -> (cut with SpeI and XbaI) 2072 bp (pSB1C3 backbone) + 662 bp (rest)PCR-amplificate -> (cut with SpeI and XbaI) 597 bp (modified AID insert)
'''Further tasks:'''design and ordering of primers, practical part[[File:UP12_BBa_K929001.JPG|700px]]

Primer design and ordering for BBa_K929001

Investigators: Tom S., Rico

Time: 2012-07-12 7pm

Primer (forward) with XbaI recognition site, kozak consensus sequence, NLS:ATCTAGAGCCGCCACCATGGGACCCAAGAAGAGGAAGGTGATGGACAGCCTCTTGATGAACCGGAGG

Primer (reverse, complement)with AgeI and SpeI recognition site:CCACTAGTATTAACCGGTGGGCAAAAGGATGCGCCGAAGC

2012-07-13

===

Mini Prep of WT Plasmids, nanodrop

Investigators: Tom S., Mario

Time: 2012-07-13 10am

Materials:Miniprep Kit
Overnight culture of AID-WT tranfected E. coli strains
Method: Kit via manual

Results:
DNA-concentrations via nanodrop:
WT-AID 1: 387,2 ng/µL
WT-AID 2: 453,0 ng/µL
WT-AID 3: 415,8 ng/µL
WT-AID 4: 445,5 ng/µL
WT-AID 5: 474,1 ng/µL
WT-AID 6: 645,1 ng/µL
AID: 393,5 ng/µL
CMV: 188,0 ng/µL
CMV+AID 221,9 ng/µL
hGH 318,2 ng/µL

Further tasks:
digestion and gelelectrophoresis

Topic: preparative digestion

Investigators: Tom S.

Time: 2012-07-11 09:00

Materials:
* pSB1C3 Vectors with CMV+AID+hGH-polyA, AID, CMV, hGH, CMV+AID* Restriction enzymes (SpeI, PstI); Fast Digest Green Buffer
Method:
preparative digestion: 25 µL DNA + 1 µL of each enzyme + 3 µL Fast Digest Green Buffer (incubation for 2 h)

further tasks:
Gel electrophoresis

===

2012-07-16

===

Gel electrophoresis of cut ligation samples (WT AID - CMV+AID+hGH-polyA)

Investigators: Tom S.

Time: 2012-07-16;

Materials:
gel electrophoresis equipment
samples

Method:
loading wells with 10 µL of each cut sample (ca. 600-800 ng DNA per sample)
gel ectrophoresis standard operating procedure

Results:
[[file:UP12_digest_2012-07-16.jpg|500px]]
Further tasks:
sequencing
===

2012-07-23

===

Topic: PCR of AID+NLS+Kozak sequence

Investigators:Basia, Tom S.
Aim:* amplification of the AID with inserted Kozak sequence and NLS sequence via PCR
Materials:* Phusion, template (AID insert), Primers designed by Tom S. and Rico on 12.07.2012, dNTPs, Polymerase)* PCR clean-up kitMethod:* polymerase chain reaction
'''Mastermix'''

'''reagent'''	'''volume [µL]'''
HF Phusion buffer 5x	10
dNTPs	1
Primer (Forward)	1,25
Primer (Reverse)	1,25
DNA (Plasmid)	1,0
Phusion Polymerase	0,5
water	35,0

'''Program'''

'''step'''	'''Temperature [°C]'''	'''duration [s]'''	'''cycles'''
denaturation	98	30	1
denaturation	98	5	17
annealing + elongation	72	45	17
denaturation	98	5	17
elongation	72	25	17
final elongation	72	600	1
cooling	4	∞	1

'''Results:'''
125ng/µl - 1st sample, 135ng/µl 2nd sample'''Further tasks:'''
* digestion + agarose gel electrophoresis

Primer design and ordering for sequencing BBa_K929001 and BBa_K929003

Investigators: Tom S., Rico

Time: 2012-07-23

Primer bind on pSB1C3-vector (left next to backbone-prefix):
GGCGTATCACGAGGCAG
Primer (reverse, complement) bind on pSB1C3-vector (right next to backbone-suffix):
CGAGTCAGTGAGCGAGG
===

2012-07-25

===

Topic: preparative digestion

Investigators: Tom S.

Time: 2012-07-25 08:30

Materials:
pSB1C3 Vector with CMV
2 PCR-products - AID without NES, with NLS+Kozak Sequence (theoretically the same) (SpeI, XbaI; Fast Digest); Fast Digest Green Buffer
Method:
preparative digestion: 25 µL DNA + 1 µL of each enzyme + 3 µL Fast Digest Green Buffer (incubation for 2 h)-> for the pSB1C3 backbone
preparative digestion: 18 µL DNA + 1 µL of each enzyme + 2 µL Fast Digest Green Buffer (incubation for 2 h)-> for the PCR-products

Topic: Separation of cut DNA fragments via gel electrophoresis

Investigators: Tom S.

Time: 2012-07-25

Aim Separation of cut DNA fragments via gel electrophoresis
Materials:
gel electrophoresis material

Method:
cut samples:* pSB1C3 backbone: Restriction enzymes (XbaI, SpeI; Fast Digest); Fast Digest buffer* PCR-products (AID without NES, with NLS+Kozak Sequence): Restriction enzymes (XbaI, SpeI; Fast Digest); Fast Digest buffer
wells loaded with 30 or 22 µL of digested samples via gel electrophoresis - standard operating procedure

gel electrophoresis conditions:
V = 120 V
duration roughly 50 minutes

Results:
[[file:UP12_digest_2012-07-25.jpg|300px]]

Marked fragment was cut out of the gel and transferred into 1,5 mL Eppendorf tube

Further Tasks:
Gel extraction

Gel extraction of pSB1C3 backbone and modified AID insert (AID without NES, with NLS+Kozak Sequence)

Investigators:Tom S.

Aim:Gel extraction of pSB1C3 backbone and modified AID insert

Materials:centrifuge, Nucleo Spin and PCR clean up - Kit, thermo heater, nanodrop

Method:DNA extraction: according to the manual

Results:
DNA-concentrations via nanodrop:
pSB1C3 backbone = 83,6 ng/µL -> 65,7 nM (with mass conc. of 1273,3 kDa)
PCR-product 1 = 74,0 ng/µL -> 201,5 nM (with mass conc. of 367,18 kDa)
PCR-product 1 = 77,5 ng/µL -> 211,1 nM (with mass conc. of 367,18 kDa)
location: -20 °C freezer, topmost drawer
ready DNA for ligation
Further tasks:
ligation of fragments

Ligation of PCR-product (AID without NES, with NLS+Kozak Sequence) and pSB1C3 backbone

Investigators:Tom S.

Aim:Ligation of PCR-product and pSB1C3 backbone

Materials:T4 DNA-Ligase, samples(PCR-product 1 and 2 + pSB1C3 backbone)-> PCR products 1 and 2 are theoretically the same

Method:DNA Fragment ligation: according to the manual
sample preparation:* 2 µL (PCR-product) c=75,8 ng/µL(206,4 nM)-> 41,3 nM* 2 µL (pSB1C3 backbone) c=83,6 ng/µL(65,7 nM) -> 13,2 nM* 1 µL (T4 DNA-Ligase)* 1 µL 10x T4 DNA Ligase Buffer* 4 µL (DNase free water)
incubation of sample 1,5 h at 22°C

Results:
samples ligated
location: -20 °C freezer, topmost drawer
ready DNA for transformation
Further tasks:
Transformation

Topic: Transformation of ligated sample

Investigators: Tom S.

Time: 2012-07-25

Materials:
* Bunsen Burner, Agar Plate with Chloramphenicol, 37 °C heater, centrifuge
* ligated sample (compare last step 25-07-2012)* icebox* competent E. coli cells (XL 1)
Method:
Transformation via manual
Plate incubation start: 5:00 pm
Results:
ready for growing mutants to pick clones
Further tasks:
picking clones===

2012-07-26

===

picking clones & inoculation

Investigators: Sascha

Time: 2012-07-27 6 pm

Materials:LB medium, chloramphenicol 25 mg/ ml stock solution, plates with E. coli XL1 blue with plasmids: pSB1C3+pcr-products(AID with NLS,without NES+Kozak sequence), glycerol stocks: pSB1C3 with CMV

Method: picking clones(3 per plate) and inoculation in 5 ml LB medium + 5µl chloramphenicol stock shaking over night at 37°C, 300 rpm, approx. 16 hours, samples of glycerol stocks in 5 ml LB + 5 µL chloramphenicol

Further tasks:
glycerolstocks & Miniprep
===

2012-07-27

===

Miniprep

Investigators: Tom S.
Time:2012-07-03 8 amMaterials:Glycerol, Miniprep Kit, over night culture (pSB1C3 with CMV); overnight culture (pSB1C3 with modified AID)Method:Glycerol stock: 300 µL Glycerol 99,8 % + 700 µL over night cultures --> put in -80 °C freezerMiniprep (both overnight culture (pSB1C3 with CMV) and overnight cultures (pSB1C3 with PCR 1 colony 1-3 and PCR 2 colony 1-3)Results:DNA - concentrations via nanodrop:PCR1 C1= 163.7 ng/µL
PCR1 C2= 154.7 ng/µL
PCR1 C3= 165.5 ng/µL
PCR2 C1= 117.1 ng/µL
PCR2 C2= 164.7 ng/µL
PCR2 C3= 94,4 ng/µL
CMV= 144.2 ng/µL
Further tasks:
preparative digestion

Topic: preparative digestion

Investigators:Chris

Time: 2012-07-27 11:30

Materials:
pSB1C3 Vector with CMV (SpeI, PstI; Fast Digest); Fast Digest Green Buffer
PCR 1 C 3 and PCR 2 C 2 in pSB1C3 vector(PstI, XbaI; Fast Digest); Fast Digest Green Buffer
Method:
*preparative digestion: 25 µL DNA + 1 µL of each enzyme + 3 µL Fast Digest Green Buffer (incubation for 2,5 h)

Topic: Separation of cut DNA fragments via gel electrophoresis

Investigators: Tom S.

Time: 2012-07-27

Aim: Separation of cut DNA fragments via gel electrophoresis
Materials:
gel electrophoresis material
cut samples:* digested CMV: Restriction enzymes (SpeI, PstI; Fast Digest); Fast Digest buffer* digested PCR-products: Restriction enzymes (PstI, XbaI; Fast Digest); Fast Digest buffer
Method:
samples:
loading wells with 30µl of digested samples via gel electrophoresis, standard operating procedure

gel electrophoresis conditions:
30 µL of each samples into one big well
V = 120 V
duration 72 minutes

Results:
[[file:UP12_digest_2012-07-27.jpg|300px]]

Marked fragments were cut out of the gel and transferred into 1,5 mL Eppendorf tube for gel extraction

Further Tasks:
Gel extraction

Gel extraction of digested CMV+backbone and PCR-products (AID without NES, with NLS+Kozak sequence) insert

Investigators:Tom S.

Aim:Gel extraction of digested CMV+backbone and PCR-products insert

Materials:centrifuge, Nucleo Spin and PCR clean up - Kit, heat block, nanodrop

Method:extraction of DNA: according to the manual

Results:
DNA-concentrations via nanodrop:
CMV+backbone = 85,6 ng/µL -> 50,9 nM (with mass conc. of 1681,3 kDa)
PCR 1 C 3 = 33,7 ng/µL -> 89,1 nM (with mass conc. of 378,3 kDa)
PCR 2 C 2 = 29,4 ng/µL -> 77,7 nM (with mass conc. of 378,3 kDa)
location: -20 °C freezer, topmost drawer
ready DNA for Ligation
Further tasks:
ligation of fragments===

2012-07-28

===

Ligation of PCR-products(AID without NES, with NLS+Kozak sequence) and CMV+backbone

Investigators:Basia

Aim:Ligation of PCR-products and CMV+backbone

Materials:T4 DNA-Ligase, samples(PCR 1 C 3 or PCR 2 C 2 and CMV+backbone)

Method:DNA fragment ligation: according to the manual
sample preparation:* 4 µL PCR 1 C3 c=33,7 ng/µL(89,1 nM)-> 35,6 nM; (for the other sample 4µL PCR 2 C 2 c=29,4 ng/µL(77,7 nM)-> 31,1 nM* 2 µL (CMV+backbone) c=85,6 ng/µL(50,9 nM) -> 10,2 nM* 1 µL (T4 DNA-Ligase)* 1 µL 10x T4 DNA Ligase Buffer* 2 µL (DNase free water)
incubation of sample 1,5 h at 22°C

Results:
location: -20°C freezer, topmost drawer
ready DNA Transformation
Further tasks:
Transformation

Topic: Transformation of ligated sample

Investigators: Basia

Time: 2012-07-28 12:30

Materials:
* Bunsen Burner, Agar Plate with Chloramphenicol, 37°C heat block, centrifuge
* ligase sample (from last step 28.07.2012)* icebox* competent E. coli cells (XL 1 Blue)
Method:
Transformation according to the manual
Plate incubation start: 14:30 pm
Results:
ready mutants to pick clones
Further tasks:
picking clones===

2012-07-29

===

Overnight culture of E. coli containing plasmids with PCR products (AID without NES, with NLS+Kozak sequence) and CMV promoter

Investigators: Basia

Time: 2012-07-29 7 pm

Materials:LB medium, chloramphenicol 25 mg/ ml stock solution, plates with E. coli XL1 blue with plasmids: CMV+PCR1C3 and CMV+PCR2C2

Method: picking clones(2 per plate) and inoculation in 5 ml LB medium + 5µl chloramphenicol stock shaking over night at 37°C, 300 rpm, approx. 16 hours

Further tasks:
glycerol stocks & Miniprep
===

2012-07-30

===

Topic: Transformation of BBa_E0040 (wild-type GFP) from Distribution Plate 1 Kit 2012

Investigators: Chris

Time: 2012-07-30 10:30

Materials:
Bunsen Burner, Agar Plate with ampicillin, icebox, competent E. coli cells (XL 1 Blue)
Method:
Transformation according to the manual
Plate incubation start: 13:30 pm
Results:
ready mutants to pick clones
Further tasks:
picking clones

Glycerol stocks & miniprep of CMV+AID without NES, with NLS+Kozak sequence containing plasmids

Investigators: Tom S.
Time:2012-07-03 8:30 amMaterials:Glycerol, Miniprep Kit, overnight cultures (CMV+PCR1C3C1-2; CMV+PCR2C2C1-2)Method:Glycerol stock: 300 µL Glycerol 99,8 % + 700 µL overnight cultures --> put in -80 °C freezerMiniprep overnight cultures (CMV+PCR1C3C1-2; CMV+PCR2C2C1-2) procedure according to the manualResults:DNA concentrations via nanodrop:
PCR1C3 C1= 389,5 ng/µL
PCR1C3 C2= 394,3 ng/µL
PCR2C2 C1= 409,8 ng/µL
PCR2C2 C2= 383,4 ng/µL

Further tasks:
preparative digestion with PCR1C3 C2 and PCR2C2 C1

Topic: preparative digestion

Investigators:Chris

Time: 2012-07-30 11:00

Materials:
pSB1C3 Vector with hGH-PolyA (XbaI, PstI; Fast Digest); Fast Digest Green Buffer
PCR1C3 C2 and PCR2C2 C1 in pSB1C3 vector - AID without NES, with NLS+Kozak sequence+CMV(PstI, SpeI; Fast Digest); Fast Digest Green Buffer
Method:
preparative digestion: 25 µL DNA + 1 µL of each enzyme + 3 µL Fast Digest Green Buffer (incubation for 2 h)

Topic: Separation of cut DNA fragments via gel electrophoresis & Gel extraction

Investigators: Chris

Time: 2012-07-30

Aim: Separation of cut DNA fragments via gel electrophoresis
Materials:
gel electrophoresis material
cut samples:digested hGH-PolyA: Restriction enzymes (XbaI, PstI; Fast Digest); Fast Digest buffer
digested PCR-products: Restriction enzymes (PstI, SpeI; Fast Digest); Fast Digest buffer
Method:
gel ectrophoresis - standard operating procedure

gel electrophoresis conditions:
30 µL of each samples into one big slot
V = 120 V
duration roughly 60 minutes

Results:
[[file:UP12_digest_2012-07-30.jpg|300px]]

Marked fragments were cut out of the gel and transferred into 1,5 mL Eppendorf tubes

Gel Extraction:
final concentrations:
CMV+PCR1C3C2(3318 nt, MW=2048.48 kDa) : 188.1 ng/µl (91.8 nM)
CMV+PCR2C2C1 : 182.2 ng/µl (88.9 nM)
hGH-polyA (495 nt, MW=305.4 kDa): 26.1 ng/µl (85 nM)
Further Tasks:
Ligation, transformation===

2012-07-31

===

Topic: Planing BBa_K929003

Investigators: Tom S., Chris, Basia, Rico, Mario, Kevin

'''Aim:''' planing how to digest and ligate the vectors for BBa_K929003

'''Material:''' Genious

'''Results:'''* pSB1C3 with CMV+ mod. AID (without NES, with NLS) -> cut with AgeI and SpeI, 3322 bp - pSB1C3 backbone with CMV + mod. AID, 14 bp - rest* eGFP -> cut with SpeI and NgoMIV, 731 bp - eGFP insert, 2074 bp - pSB1C3 backbone* pSB1C3 with CMV+ mod. AID + eGFP -> cut with Spe1 and Pst1, 4035 bp - pSB1C3 backbone with CMV + mod. AID+eGFP, 18 bp - rest* hGH-polyA -> cut with Xba1 and Pst1, 505 bp - hGH-polyA insert, 2053 - pSB1C3 backbone
'''Further tasks:'''* practical part[[File:UP12_BBa_K929003.JPG|500px]]

inoculation of GFP in pSB1A2 (BBa_E0040) & eGFP (from Sven eGFP in pSB1C3 in RFC 25-like [http://partsregistry.org/Part:BBa_K404316 BBa_K404316]

Investigators: Tom S., Chris

Time: 2012-07-31 3pm

Materials:LB medium, chloramphenicol 25 mg/ ml stock solution, ampicillin stock solution, plates with E. coli XL1 blue with plasmid: GFP in pSB1A2 (BBa_E0040), glycerol stock from Sven: eGFP in pSB1C3 in RFC 25

Method: picking clones (1 per plate from 2 plates) GFP in pSB1A2 (BBa_E0040) and inoculation in 5 ml LB medium + 5µl ampicillin stock, 2 times inoculation of glycerol stock (eGFP in pSB1C3 in RFC 25) in 5mL LB medium + 5µL chloramphenicol stock, shaking over night at 37°C, 300 rpm, approx. 16 hours

Further tasks:
glycerol stocks & Miniprep

preparation of WT-AID & modified AID (without NES, with NLS) in pSB1C3 for sequencing & send to GATC

Investigators: Tom S., Chris

Time: 2012-07-31 7pm

Materials:20 µl primer c=10µM for each sequencing, 20 µl sample with concentration around 70 ng/µl

Method: mark the samples with bar code stickers & order the sequencing from GATC, put the cups into the orange boxes

samples:

'''sample'''	'''barcode'''	'''primer'''	'''sample'''	'''barcode'''	'''primer'''
WT AID clone 1 (Cmv+WtAID+PolyA in pSB1C3)	CC0697	forward pSB1C3	WT AID clone 1	CC0709	reverse pSB1C3
WT AID clone 2	CC0698	forward pSB1C3	WT AID clone 2	CC0710	reverse pSB1C3
WT AID clone 3	CC0699	forward pSB1C3	WT AID clone 3	CC0711	reverse pSB1C3
WT AID clone 4	CC0700	forward pSB1C3	WT AID clone 4	CC0712	reverse pSB1C3
WT AID clone 5	CC0701	forward pSB1C3	WT AID clone 5	CC0713	reverse pSB1C3
WT AID clone 6	CC0702	forward pSB1C3	WT AID clone 6	CC0714	reverse pSB1C3
PCR1 C1 (modified AID- Kozak sequence+NLS+AID without NES+Age1-restriction site in pSB1C3)	CC0703	forward pSB1C3	PCR1 C1	CC0715	reverse pSB1C3
PCR1 C2	CC0704	forward pSB1C3	PCR1 C2	CC0716	reverse pSB1C3
PCR1 C3	CC0705	forward pSB1C3	PCR1 C3	CC0717	reverse pSB1C3
PCR2 C1	CC0706	forward pSB1C3	PCR2 C1	CC0718	reverse pSB1C3
PCR2 C2	CC0707	forward pSB1C3	PCR2 C2	CC0719	reverse pSB1C3
PCR2 C3	CC0708	forward pSB1C3	PCR2 C3	CC0720	reverse pSB1C3

Further tasks:
alignment

Antibody-Group

===

2012-07-06

===

Sequencing of pcDNA5-FRT and pOG44 by GATC

Investigators: Sascha

Aim: Sequencing of invitrogen vectors pcDNA5-FRT and pOG44

Materials:* Geneious* Lablife Sequences of pcDNA5-FRT and pOG44* GATC

Method: forward sequencing using GATC-CMV-forward-primer
* pcdna5frt_cmv_forward-CMV-F
* pog44_cmv_forward-CMV-F

Further tasks: checking sequences

Primer-design for assembly-PCR, generating geneconstruct: scFv-TEV-TMD-EYFP

Investigators: Sascha

Aim: Design of primer for assembly-pcr of geneconstruct scFv-TEV-TMD-EYFP

Materials:* Lablife Sequences of pcDNA5-FRT and pOG44* Databases* Oligocalc* WordpadMethod:
* P1_Signalp_N-term
* P2_Signalp_C-term
* P3_TMD-N-term
* P4_TMD-C-term/N-YFP
* P5_YFP-N-term/TMD-C-term
* P6_YFP-C-term
* P7_Gesamtanfang
* P8_Gesamtende

Further tasks:
* checking primer with Geneious* adapt primer to NEB-Phusion-polymerase conditions
===

2012-07-07

===

Primer-design for assembly-PCR, generating geneconstruct: scFv-TEV-TMD-EYFP

Investigators: Sascha

Aim: Design of primer for assembly-pcr of geneconstruct scFv-TEV-TMD-EYFP

Materials:* Lablife Sequences of pcDNA5-FRT and pOG44* Databases* Oligocalc* Wordpad
Method: forward sequencing using GATC-CMV-forward-primer
* P1_Signalp_N-term
* P2_Signalp_C-term
* P3_TMD-N-term
* P4_TMD-C-term/N-YFP
* P5_YFP-N-term/TMD-C-term
* P6_YFP-C-term
* P7_Gesamtanfang
* P8_Gesamtende

Further tasks:
* checking primer with Geneious* adapt primer to NEB-Phusion-polymerase conditions
===

2012-07-10

===

Checking of Sequencing of GATC-results of pcDNA5-FRT and pOG44

Investigators: Sascha

Aim: Control of pcDNA5-FRT- and pOG44-sequences

Materials:* Geneious* Lablife Sequences of pcDNA5-FRT and pOG44* GATC-viewer* NCBI BLASTn

Results:* sequences are correct===

2012-07-12

===

ordering of primer for assembly-PCR, generating geneconstruct: scFv-TEV-TMD-EYFP

Investigators: Sascha, Maria

Aim: ordering of primer for assembly-pcr of geneconstruct scFv-TEV-TMD-EYFP

Materials:* Lablife Sequences of pcDNA5-FRT and pOG44* Databases* Oligocalc* Wordpad* Geneious* NEB-Calculator for high-fidelity Phusion-polymerase
Method: forward sequencing using GATC-CMV-forward-primer
* P1_Signalp_N-term
* P2_Signalp_C-term
* P3_TMD-N-term
* P4_TMD-C-term/N-YFP
* P5_YFP-N-term/TMD-C-term
* P6_YFP-C-term
* P7_Gesamtanfang
* P8_Gesamtende

Further tasks:
* extension-assembly-pcr
===

2012-07-15

===

Retransformation with scFv, transmembrane domain and YFP

Investigators: Maria

Aim: Retransformation with scFv anti-EGFR, transmembrane domain BBa_KI157010, YFP BBa_E0030

Date/Time: 15th July 2012, 2:30 – 4:30 pm

Materials: competent E. coli cells XL1 Blue, Biobricks BBa_K157010 and BBa_E0030, scFv anti-EGFR, 42°/37° C shaker, centrifuge

Method: see transformation protocol

Results: colonies on Amp plates with scFv-, transmembrane domain- and YFP- plasmid

Further tasks: picking clones and overnight culture (16th July)

===

2012-07-16

===

Topic: Overnight culture of scFv, YFP and transmembrane domain carrying cells

Investigators: Maria

Time: 2012-07-16; 6:30 - 7 pm

Materials:
* LB medium
* Amp. 25 mg/ ml stock solution
* Plasmids: scFv; BBa-KI57000 with transmembrane domain; pSB1AK3 with YFP
Method:
Inoculation of cell sample each in 5 ml LB medium with Amp
shaking over night at 37°C, 300 rpm, approx. 17 hours

Further tasks:
* Miniprep
===

2012-07-17

===

Topic: Mini Prep of YFP and transmembrane domain

Investigators: Stefan, Tarek, Kerstin

Time: 2012-07-17; 2 - 3.30 pm

Materials:
* overnight cultures from 2012-07-16
* GeneJET Plasmid Miniprep Kit (Thermo Scientific)
* Plasmids: BBa-KI57000 with transmembrane domain; pSB1AK3 with YFP
Method:
Miniprep according to Kit

Note:
overnight culture of retransformation of scFv did not grow --> Resistance was not known in scFv vector, screening was done with ampicillin
Further Tasks:
PCR to produce sp-scFv-tmd-yfp construct
===

2012-07-20

===

Topic: extension-assembly-pcr of scFv-TEV-TMD-EYFP geneconstruct

Investigators: Stefan, Sascha

Materials:
Materials:
scFv anti-EGFR, BBa-KI57000 with transmembrane domain; BBa_E0030 with EYFP
* P1_Signalp_N-term
* P2_Signalp_C-term
* P3_TMD-N-term
* P4_TMD-C-term/N-YFP
* P5_YFP-N-term/TMD-C-term
* P6_YFP-C-term
* P7_Gesamtanfang
* P8_Gesamtende
* Phusion -polymerase, dNTPs (10mM), Phusion HF-BufferMethod:
* 50µl PCR mix of each plasmid= 10µl HF-Buffer; 1µl dNTPs(10mM); forward and reverse primer each 2,5µl (10µM); template DNA: 1µl of 200ng/µl scFv --> 200ng, 5µl of BBa_E0030 with EYFP (46,3ng/µl--> ca. 230ng),5µl of BBa-KI57000 with transmembrane domain (43,9ng/µl --> ca. 230ng); Phusion DNA polymerase 0,5µl; nclease-free water ad to 50µl
* PCR-program: initial Denat. 40´´ at 98°C; Denat 12´´ at 98°C; Annealing 15´´ at 55°C; Elongation 11´´ at 72°C; final-Elongation 10´at 72°C; 30 cycles
Further Tasks:
* gelextraction* assembly-pcr
===

2012-07-26

===

Planning the antibody construct for genesynthesis

Investigators: Maria

Aim: construct with scFv 425bla, LoxP and TEV recognition site, E-YFP

Date/Time: 26th July 2012, 2 - 5 pm

Materials: Geneious

Results: antibody construct RCF25

Topic: extension-pcr of scFv-TEV-TMD-EYFP geneconstruct

Investigators: Sascha

Materials:
scFv anti-EGFR, BBa-KI57000 with transmembrane domain; BBa_E0030 with EYFP
* P1_Signalp_N-term
* P2_Signalp_C-term
* P3_TMD-N-term
* P4_TMD-C-term/N-YFP
* P5_YFP-N-term/TMD-C-term
* P6_YFP-C-term
* Phusion -polymerase, dNTPs (10mM), Phusion HF-BufferMethod:
* 50µl PCR mix of each plasmid= 10µl HF-Buffer; 1µl dNTPs(10mM); forward and reverse primer each 2,5µl (10µM); template DNA: 1µl of 200ng/µl scFv--> 200ng, 5µl of BBa_E0030 with EYFP (46,3ng/µl--> ca. 230ng),5µl of BBa-KI57000 with transmembrane domain (43,9ng/µl --> ca. 230ng); Phusion DNA polymerase 0,5µl; nclease-free water ad to 50µl
* PCR-program: initial Denat. 40´´ at 98°C; Denat 12´´ at 98°C; Annealing 15´´ at 55°C; Elongation 11´´ at 72°C; final-Elongation 10´at 72°C; 30 cycles
Further Tasks:
* gelelectrophoresis

Topic: gelelectrophoresis of extended genes after extension-pcr

Investigators: Sascha

Aim: separation of extended genes scFv-TEV, TEV-TMD, EYFP in 1% agarosegel
Materials:
* agarose* 1xTAE-buffer* 10xFD Green Buffer* extended genes
Method:
* 1% agarosegel* 70 min at 105VResults:
Further Tasks:
* gelextraction

Topic: gelextraction of extended genes after extension-pcr

Investigators: Sascha

Aim: gelextraction of extended genes(scFv-TEV, TEV-TMD, EYFP) out of 1% agarosegel
Method:
* DNA extracted according to the manualResults: concentration measuremnt using nanodrop
* concentrations of extended scFv:* concentrations of extended TMD:* concentrations of extended EYFP:Further Tasks:
* assembly-pcr

Topic: assembly-pcr with extended genes to scFv-TEV-TMD-EYFP geneconstruct

Investigators: Sascha

Aim: assembly-pcr with extended genes to scFv-TEV-TMD-EYFP geneconstruct
Materials:
scFv anti-EGFR, BBa-KI57000 with transmembrane domain; BBa_E0030 with EYFP
* P7_Gesamtanfang (forward-primer)
* P8_Gesamtende (reverse-primer)
* Phusion -polymerase, dNTPs (10mM), Phusion HF-BufferMethod:
* first assembly-pcr-mix--> 150:50: 10µl HF-Buffer; 1µl dNTPs(10mM); 5µl of extended TMD (30ng/µl --> 150ng), 5µl of extended EYFP (10ng/µl --> 50ng), 2µl of extended scFv (25ng/µl --> 50ng); nuclease-free water ad to 45µl; 0,5µl Phusion-polymerase
* second assembly-pcr-mix--> 90:30: 10µl HF-Buffer; 1µl dNTPs(10mM); 2,5µl of extended TMD (30ng/µl --> 90ng), 3µl of extended EYFP (10ng/µl --> 30ng), 1µl of extended scFv (25ng/µl --> 25ng); nuclease-free water ad to 45µl; 0,5µl Phusion-polymerase
* PCR-program to let the extended genes prime each other: initial Denat. 40´´ at 98°C; Denat 12´´ at 98°C; Annealing 15´´ at 55°C; Elongation 27´´ at 72°C; final-Elongation 10´at 72°C; 15 cycles
* after annealing of extended genes to each other 2,5µl of primer forw_P7_Gesamtanfang and primer rev_P8_Gesamtende were added* PCR-prgram with end-primers: initial Denat. 40´´ at 98°C; Denat 12´´ at 98°C; Annealing 15´´ at 57°C; Elongation 27´´ at 72°C; final-Elongation 10´at 72°C; 27 cycles

* Gelelectrophoresis at 105V for 75`Results:
* extraction of wrong 1100bp DNA-bondFurther Tasks:
* assembly-pcr* extraction of correct DNA (1701bp)
===

2012-07-28

===

Topic: assembly-pcr with extended genes to scFv-TEV-TMD-EYFP geneconstruct

Investigators: Sascha, Tarek

Aim: assembly-pcr with extended genes to scFv-TEV-TMD-EYFP geneconstruct
Materials:
scFv anti-EGFR, BBa-KI57000 with transmembrane domain; BBa_E0030 with EYFP
* P7_Gesamtanfang (forward-primer)
* P8_Gesamtende (reverse-primer)
* Phusion -polymerase, dNTPs (10mM), Phusion HF-BufferMethod:
* first assembly-pcr-mix--> 90:30: 10µl HF-Buffer; 1µl dNTPs(10mM); 2,5µl of extended TMD (30ng/µl --> 90ng), 3µl of extended EYFP (10ng/µl --> 30ng), 1µl of extended scFv (25ng/µl --> 25ng); nuclease-free water ad to 45µl; 0,5µl Phusion-polymerase
* second assembly-pcr-mix--> 140:20: 10µl HF-Buffer; 1µl dNTPs(10mM); 1µl of extended TMD (140ng/µl --> 140ng), 12,5µl of extended EYFP (1,6ng/µl --> 20ng), 4,8µl of extended scFv (4,2ng/µl --> ca. 20ng); nuclease-free water ad to 45µl; 0,5µl Phusion-polymerase
* PCR-program to let the extended genes prime each other: initial Denat. 40´´ at 98°C; Denat 12´´ at 98°C; Annealing 15´´ at 55°C; Elongation 27´´ at 72°C; final-Elongation 10´at 72°C; 15 cycles
* after annealing of extended genes to each other 2,5µl of primer forw_P7_Gesamtanfang and primer rev_P8_Gesamtende were added* PCR-prgram with end-primers: initial Denat. 40´´ at 98°C; Denat 12´´ at 98°C; Annealing 15´´ at 57°C; Elongation 27´´ at 72°C; final-Elongation 10´at 72°C; 27 cycles

* Gelelectrophoresis at 105V for 85`Results:
* extraction of correct DNA (1701bp)Further Tasks:
* digestion of pcDNA5-FRT and geneconstruct scFv-TEV-TMD-EYFP* ligation of plasmid and insert
===

2012-07-31

===

Planning and reviewing the antibody construct for genesynthesis

Investigators: Maria

Aim: construct with scFv 425bla, LoxP and TEV recognition site, mVenus

Date/Time: 27th July 2012, 3 - 5 pm

Materials: Geneious

Results: antibody construct RCF25


===

2012-07-31

===

Construct for genesynthesis with human scFv 425-72000

Investigators: Maria

Aim: construct with human scFv 425-72000, LoxP and TEV recognition site, mVenus

Date/Time: 27th July 2012, 3 - 5 pm

Materials: Geneious

Results: antibody construct RCF25

Virus

===

02.07.2012

===

Topic: PCR

Investigators: Xenia and Kathi
Aim:* to test the primer* amplification of the cap and VP-region, insertion of kozak-, Sortasemotive-, mycTag- and restiction sites Sequence
Materials:* new primer combination (prr_VP2_pstI_Temp68 and prf_XbaI_kozak_So rtlN_myc_VP2 [c= 10 µM])
Method:* polymerase chain reaction
'''Mastermix'''

'''reagenz'''	'''volumen [µL]'''
HE buffer	5
dNTPs (NEB)	1.25
Primer (prr_VP2_pstI_Temp68)	1.0
Primer (prf_XbaI_kozak_So rtlN_myc_VP2)	1.0
DNA (Plasmid)	1.0
Phusion polymerase	1.0
water	33.75

program

'''step'''	'''temperature [°C]'''	'''duration [s]'''	'''cycles'''
denaturation	95	120	1
denaturation	95	30	30
annealing	68	60	30
elongation	72	60	30
final elongation	72	60	1
cooling	4	∞	1

Results:
Further tasks:
* agarose gel electrophoresis===

04.07.2012

===

Topic: gel electrophoresis

Investigator: Laura
Aim:* measurement of DNA-concentration of pcr product and DARPin+cmv plasmid* test pcr product and DRAPin+cmv plasmid
Materials:* pcr product (02.07.) and DARPin+cmv Plasmid (Sven)Method:* agarose gel electrophoresis
* nanodropResults:* DNA-concentrations:** pcr-prduct: 266.1 ng/µL** plasmid: 441.4 ng/µL* gel electrophoresis** pcr product present but concentration too high --> next time better: serial dilution of pcr product!
IMPORTANT!: Our primer is wrong! we have put the C-terminal sortase-motiv into our primer, but we just need the N-terminal sortase-tag (glycin-rests)further tasks:
design new primer===

04.07.2012

===

Topic: Primer design - Cloning: Change the C-terminal Sortase-Tag against the N-terminal

Investigators:Tobias and Xenia
Aim:* Change the C-terminal sortase-tag against the N-terminal
Materials:
* prf_XbaI_kozak_SortaseMotivN_myc_VP2Method: Geneious
Results:* prf_Xba1 koz_GGGGG_VP2 (forward primer)* prf_XbaI_koz_GGGGG_myc_VP2 (forward primer)the sortase-tag was changed in both primers and prf_Xba1 koz_GGGGG_VP2 contain no myc-tag
Further tasks:
PCR===

11.07.2012

===

Topic: PCR - Cloning: PCR using the new forward primers

Investigators: Kathi and Laura
Aim:* PCR using the both new forward primer (prf_Xba1 koz_GGGGG_VP2 and prf_XbaI_koz_GGGGG_myc_VP2)* gel electrophoresis
Materials:
* prf_Xba1 koz_GGGGG_VP2 (FP 1)--> myc-* prf_XbaI_koz_GGGGG_myc_VP2(FP2)--> myc+* prr_VP2_pstI_Temp68 (RP)
Method:* PCR (PCR protocol: 02.07.2012)* gel electropohoresis: : 2.1 and 0.5 µL pcr product of primer pair myc+ and myc- loaded on gel
Results:
* gel electrophoresis: pcr product at 2000 bp present, primer dimer obvious
Further tasks:
* ligation===

12.07.2012

===

Topic: PCR

Investigators: Xenia and Laura
Aim:* test the primer using different annealing temperatures to get the right sequence of 2000 bp
Materials:primer combination:* prr_VP2_pstI_Temp68 and prf_XbaI_koz_GGGGG_VP2 (FP1)-> myc-* prr_VP2_pstI_Temp68 (RP) and prf_XbaI_koz_GGGGG_myc_VP2(FP2)--> myc+Method:* polymerase chain reaction
'''Mastermix'''

'''reagenz'''	'''volumen [µL]'''
HF buffer	5
dNTPs (NEB)	1.25
Primer (prr_VP2_pstI_Temp68)	1.0
Primer (prf_XbaI_kozak_So rtlN_myc_VP2)	1.0
DNA (Plasmid)	1.0
Phusion Polymerase	1.0
water	33.75

'''Program'''

'''step'''	'''Temperature [°C]'''	'''duration [s]'''	'''cycles'''
denaturation	98	30	1
denaturation	98	10	30
annealing	64; 68; 70; 72	40	30
elongation	72	40	30
final elongation	72	300	1
cooling	4	∞	1

Results:
Further tasks:* agarose gel electrophoresis===

13.07.2012

===

Topic: gel electrophoresis of the pcr product

Investigators:Xenia and Mario
Aim:gel electrophoresis of the pcr product (12.07.2012)
material and method:
* gel electrophoresis*samples:** 4 µL dest. Wasser + 1 µL pcr sample + 1 µL loading dye
Results:
[[file:UP12_13.07.2012_PCR_Produkt.jpg‎|350 px]][[file:UP12_ladder.jpg|150px]]
The fragment should have the size of 2000 bp, but the band is by 3000 bp
Further Tasks:* test digestion===

2012-17-07

===

Topic: test digestion

Investigators: Tobias
Materials:
* pcr products of 02-07 and 12-07-2012 (Ta= 70°C)* restriction enzymes (FastDigest XbaI, PstI)
Method:digestion: 10 µL DNA + 1 µL of each enzyme + 2 µL green-buffer + 17 µL water
Results:
[[file:UP12_17072012_digestion.png|350 px]][[file:UP12_ladder.jpg|150px]]===

2012-18-07

===

Topic: preperative digestion an gel extraction of pcr fragments

Investigators: Tobias and Laura
Materials:
* pcr-products of 02-07-2012 and 12-07-2012 (Ta= 64 °C and 68 °C)* restriction enzymes (FastDigest XbaI, PstI)
Method:
digestion: 10 µL DNA + 1 µL of each enzyme + 2 µL Green-buffer + 17 µL water
Results:
[[file:UP12_17072012_preperative digestion.jpg|350 px]][[file:UP12_ladder.jpg|150px]]===

2012-27-07

===

Topic: digestion of pcr fragments and plasmid

Investigators: Tobias
Materials:
* pcr-products of 12-07-2012* plasmid (P10_pSB1C3_001_CMV_DARPin_ML_VP2/3_587KO_6xHis)* restriction enzymes (FastDigest XbaI, PstI, SpeI)
Method:
digestion: 10 µL DNA + 1 µL of each enzyme + 2 µL Green-buffer + 17 µL water
Results:
[[file:UP12_27072012_digestion.jpg|350 px]][[file:UP12_ladder.jpg|150px]]===

2012-01-08

===

Topic: Sequencing of pcr-pruducts

Investigator: Tobias
Materials:
* PCR-products of 12-07-2012 (+myc and-myc)* Primer: prr_VP2_pstI_Temp68
Method:GATC
Results: