Team:Potsdam Bioware/Lab/Labjournal/August

Contents 1 AID 1.1 2012-08-01 1.2 2012-08-02 1.3 2012-08-03 1.4 2012-08-04 1.5 2012-08-06 1.6 2012-08-07 1.7 2012-08-08 1.8 2012-08-09 1.9 2012-08-10 1.10 2012-08-11 1.11 2012-08-13 1.12 2012-08-14 1.13 2012-08-15 1.14 2012-08-16 1.15 2012-08-17 1.16 2012-08-20 1.17 2012-08-21 1.18 2012-08-22 1.19 2012-08-23 1.20 2012-08-24 1.21 2012-08-27 1.22 2012-08-28 1.23 2012-08-29 1.24 2012-08-30 1.25 2012-08-31 2 Antibody 2.1 2012-08-02 2.2 2012-08-03 2.3 2012-08-05 2.4 2012-08-06 2.5 2012-08-07 2.6 2012-08-08 2.7 2012-08-10 2.8 2012-08-13 2.9 2012-08-14 2.10 2012-08-15 2.11 2012-08-16 2.12 2012-08-17 2.13 2012-08-18 2.14 2012-08-19 2.15 2012-08-20 2.16 2012-08-21 2.17 2012-08-25 2.18 2012-08-27 2.19 2012-08-28 2.20 2012-08-27 2.21 2012-08-29 2.22 2012-08-31 2.23 2012-08-30 2.24 2012-08-29 2.25 2012-08-30 2.26 2012-08-31 3 Virus 3.1 2012-08-13 3.2 2012-08-14 3.3 2012-08-15 3.4 2012-08-17 3.5 2012-08-28 3.6 2012-08-29 3.7 2012-08-30

AID

2012-08-01

glycerol stocks & miniprep of eGFP and GFP

Investigators: Tom S.

Time:

2012-07-03 7:30 am

Materials:

Glycerol, Miniprep Kit, overnight cultures (eGFP; GFP)

Method:

Glycerol stock: 300 µL Glycerol 99,8 % + 700 µL over night cultures --> put in -80 °C freezer

Miniprep of overnight cultures (eGFP in pSB1C3 (BBa_K404316); 2 clones of GFP in pSB1A2 (BBa_E0040))

Results:

DNA concentrations via nanodrop:

eGFP = 335,6 ng/µL

GFP 1 = 291,5 ng/µL

GFP 2 = 261,7 ng/µL

Further tasks:

preparative digestion with eGFP and CMV+mod. AID (without NES, with NLS)

Topic: Ligation CMV & modified AID (without NES, with NLS) in pSB1C3 with hGH-PolyA

Investigators:

Chris

Aim:

Ligation of CMV & modified AID in pSB1C3(backbone) and hGH-polyA (insert)

Materials:

T4 DNA-Ligase, T4-Ligase-buffer,
samples:

CMV+PCR1C3C2(3318 nt, MW=2048.48 kDa) : 188.1 ng/µl (91.8 nM)

CMV+PCR2C2C1 : 182.2 ng/µl (88.9 nM)

hGH-polyA (495 nt, MW=305.4 kDa): 26.1 ng/µl (85 nM)

Method:

DNA fragment ligation: according to the manual

sample preparation 1:

• 2 µL CMV+PCR1C3C2 c=188.1 ng/µl (91.8 nM) ->

• 6 µL hGH-polyA c=26.1 ng/µl (85 nM) ->

• 1 µL T4 DNA-ligase

• 1 µL T4 DNA-ligase buffer

sample preparation 2:

• 2 µL CMV+PCR2C2C1 c=182.2 ng/µl (88.9 nM) ->

• 6 µL hGH-polyA c=26.1 ng/µl (85 nM) ->

• 1 µL T4 DNA-ligase

• 1 µL T4 DNA-ligase buffer

incubation of samples for 1,5 h at room temperature

Results:

ligated plasmids(final construct mod.-AID (CMV+AID without NES, with NLS+Kozak sequence+hGH-polyA, without eGFP) for transformation

Further tasks:

Transformation

Topic: transformation of ligated samples (CMV+AID without NES, with NLS+Kozak sequence+hGH-polyA, without eGFP)

Investigators: Chris

Time: 2012-08-01 3 pm

Materials:

• Bunsen Burner, Agar Plates with chloramphenicol

• icebox

• competent E. coli cells (XL 1 Blue)

Method:

Transformation via manual, 10 µl of ligation samples were used

Plate incubation start: 13:30 pm

Results:

ready mutants to pick clones

Further tasks:

picking clones

Topic: preparative digestion

Investigators: Chris

Time: 2012-08-01

Materials:

• Plasmids: pSB1C3 with CMV+PCR1C3C2 and CMV+PCR2C2C1 and eGFP
  

• Restriction enzymes (SpeI, NgoMIV and AgeI)
  

• NE4-buffer
  

Method:

sample preparation: each DNA 25 µL + 3 µL NE4-buffer + 1 µL SpeI + 1 µL AgeI (for CMV+AID+Kozak sequence) or 1µL NgoMIV (for eGFP)

incubation of samples for 3,5 h at 37 °C

Further tasks:

gel electrophoresis

Topic: Separation of cut DNA fragments via gel electrophoresis

Investigators: Tom S.

Time: 2012-08-01

Aim: Separation of cut DNA fragments via gel electrophoresis

Materials:

gel electrophoresis material

cut samples:

• CMV+PCR1C3C2: Restriction enzymes (AgeI, SpeI); NEB buffer 4

• CMV+PCR2C2C1: Restriction enzymes (AgeI, SpeI); NEB buffer 4

• eGFP: Restriction enzymes (NgoMIV, SpeI); NEB buffer 4

Method:

samples:

- 30 µL AID cut with XbaI and PstI + 7,5 µL loading dye

gelelectrophoresis conditions:

30 µL of each samples into one big well

V = 90 V

duration roughly 75 minutes

Results:

Marked fragments were cut out of the gel and transferred into 1,5 mL Eppendorf tubes

Further Tasks:

Gel extraction

Gel extraction

Investigators:

Tom S.

Aim:

Gel extraction of CMV + mod. AID + backbone and eGFP-insert

Materials:

centrifuge, Nucleo Spin and PCR clean up - Kit, heat block, nanodrop

Method:

DNA extraction: according to the manual

Results:

DNA concentrations via nanodrop:

CMV+PCR1C3C2+backbone = 158,1 ng/µL -> 77,1 nM (with mass conc. of 2050,94 kDa)

CMV+PCR2C2C1+backbone = 232,0 ng/µL -> 113,1 nM (with mass conc. of 2050,94 kDa)

eGFP = 55,8 ng/µL -> 123,4 nM (with mass conc. of 452,3 kDa)

location: -20 °C freezer, topmost drawer

ready DNA for ligation

Further tasks:

ligation of fragments

2012-08-02

Ligation of CMV+AID without NES, with NLS+Kozak sequence+backbone and eGFP

Investigators:

Tom S.

Aim:

Ligation of CMV+AID without NES, with NLS+Kozak sequence+backbone and eGFP

Materials:

T4 DNA-Ligase, samples(CMV+PCR1C3C2+backbone, CMV+PCR2C2C1+backbone,eGFP)

Method:

DNA fragment ligation: according to the manual

1st sample preparation:

• 4 µL (eGFP) c=55,8 ng/µL(123,4 nM)-> 49,4 nM

• 2 µL (CMV+PCR1C3C2+backbone) c=158,1 ng/µL(77,1 nM) -> 15,4 nM

• 1 µL (T4 DNA-Ligase)

• 1 µL 10x T4 DNA Ligase Buffer

• 2 µL (DNase free water)

2nd sample preparation:

• 4 µL (eGFP) c=55,8 ng/µL(123,4 nM)-> 49,4 nM

• 2 µL (CMV+PCR2C2C1+backbone) c=232,0 ng/µL(113,1 nM) -> 22,6 nM

• 1 µL (T4 DNA-Ligase)

• 1 µL 10x T4 DNA Ligase Buffer

• 2 µL (DNase free water)

incubation of sample for 1,5 h at 22°C

Results:

ready DNA for transformation

location: -20 °C freezer, topmost drawer

Further tasks:

Transformation

Topic: Transformation of ligated samples - CMV+AID without NES, with NLS+Kozak sequence+eGFP

Investigators: Tom S. , Chris

Time: 2012-08-02 3 pm

Materials:

• Bunsen Burner, Agar Plates with chloramphenicol

• icebox

• competent E. coli cells (XL 1 Blue)

• ligated samples (CMV+PCR1C3C2+eGFP in pSB1C3, same consruct with PCR2C2C1)

Method:

Transformation via manual, 10 µl of ligation samples were used

Plate incubation start: 14:00 pm

Results:

ready for growing mutants to pick clones

Further tasks:

picking clones

Topic: picking clones & inoculation in 5 mL LB of CMV+AID without NES, with NLS+hGH-PolyA in pSB1C3

Investigators: Chris

Method:
picking clones (1 per plate -->4) CMV + modified AID(PCR1C3C2&PCR2C2C1) +hGH(PolyA)in pSB1C3 and inoculation in 5 ml LB medium + 5µl chloramphenicol stock, shaking over night at 37°C, 300 rpm, approx. 16 hours

Further tasks:

glycerol stocks & Miniprep

2012-08-03

glycerol stocks & miniprep of CMV+AID without NES, with NLS+Kozak sequence+hGH-polyA, without eGFP plasmids

Investigators: Chris

Time:

2012-08-03 8:00 am

Materials:

Glycerol, Miniprep Kit, (CMV+PCR1C3C2/PCR2C2C1+polyA)

Method:

Glycerol stock: 300 µL Glycerol 99,8 % + 700 µL over night cultures --> put in -80 °C freezer

Mini Prep over night cultures (CMV+PCR1C3C2-Nr1+polyA in pSB1C3,same construct with PCR1C3C2-Nr2, PCR2C2C1-Nr1,PCR2C2C1-Nr2)

Results:

transfection ready biobricks: CMW+ modified AID+hGH-polyA

DNA - concentrations via nanodrop:

CMV+PCR1C3C2-Nr1+polyA in pSB1C3= 628 ng/µL

CMV+PCR1C3C2-Nr2+polyA in pSB1C3= 577.5 ng/µL

CMV+PCR2C2C1-Nr1+polyA in pSB1C3= 590.8 ng/µL

CMV+PCR2C2C1-Nr2+polyA in pSB1C3= 571.4 ng/µL

Further tasks:

sequencing

Overnight culture of CMV+AID without NES, with NLS+Kozak sequence+eGFP

Investigators: Chris, Tom S.

Time: 2012-08-03 5 pm

Materials:

LB medium, chloramphenicol 25 mg/ ml stock solution, plates with E. coli XL1 blue with plasmids: CMV+PCR1C3C2C1-2+eGFP and CMV+PCR2C2C1C1-2+eGFP

Method: picking clones(1 per plate) and inoculation in 5 ml LB medium + 5µl chloramphenicol stock shaking over night at 37°C, 300 rpm, approx. 16 hours

Further tasks:

glycerol stocks & Miniprep

2012-08-04

glycerol stocks & miniprep

Investigators: Basia

Time:

2012-08-04 10:00 am

Materials:

Glycerol, Miniprep Kit, overnight culture

Method:

Glycerol stock: 300 µL Glycerol 99,8 % + 700 µL overnight cultures --> put in -80 °C freezer

Miniprep overnight cultures (CMV+PCR1C3C2-Nr1+eGFP in pSB1C3,same construct with PCR1C3C2-Nr2, PCR2C2C1-Nr1,PCR2C2C1-Nr2)

Results:

transfection ready biobricks: CMV+ AID without NES, with NLS+Kozak sequence+ eGFP

DNA - concentrations via nanodrop:

CMV+ AID+eGFP 1 in pSB1C3= 386,8 ng/µL

CMV+ AID+eGFP 2 in pSB1C3= 404,9 ng/µL

CMV+ AID+eGFP 3 in pSB1C3= 442,6 ng/µL

CMV+ AID+eGFP 4 in pSB1C3= 377,4 ng/µL

Further tasks:

digestion

2012-08-06

Topic: preparative digestion

Investigators:Tom S.

Time: 2012-08-06

Materials:

• pSB1C3 Vector with CMV+AID without NES, with NLS+Kozak sequence+eGFP (SpeI, PstI; Fast Digest); Fast Digest Green Buffer

Method:

• preparative digestion: 25 µL DNA + 1 µL of each enzyme + 3 µL Fast Digest Green Buffer (incubation for 2,5 h)

Gel electrophoresis & Gel extraction

Investigators: Rico, Tom S., Chris

Gel extraction:
final concentrations:
CMV+PCR???1+eGFP-cutS+P(4035 nt, MW=2492 kDa) : 246 ng/µl (98.7 nM)

CMV+PCR???2+eGFP-cutSCMV-cutS+P: 255 ng/µl (102.3 nM)

CMV+PCR???3+eGFP-cutSCMV-cutS+P: 187.6 ng/µl (75.3 nM)

CMV+PCR???4+eGFP-cutSCMV-cutS+P: 178.6 ng/µl (71.7 nM)

Further Tasks: Ligation, Transformation

2012-08-07

Ligation

Investigators: Chris

Aim:

Ligation of CMV + AID without NES, with NLS+Kozak sequence+eGFP in pSB1C3(backbone) and hGH-polyA (insert)

Materials:

T4 DNA-Ligase, T4-Ligase-buffer,
samples:

CMV+PCR???1+eGFP-cut S+P(4035 nt, MW=2492 kDa) : 246 ng/µl (98.7 nM

CMV+PCR???2+eGFP-cut S+P (4035 nt, MW=2492 kDa) : 182.2 ng/µl (88.9 nM)

CMV+PCR???3+eGFP-cut S+P: 187.6 ng/µl (75.3 nM)

CMV+PCR???4+eGFP-cut S+P: 178.6 ng/µl (71.7 nM)

hGH-polyA (495 nt, MW=305.4 kDa): 26.1 ng/µl (85 nM)

hGH-polyA (cut:Xba1 and Pst1) c=48.5 nM

Method:

DNA Fragment ligation: according to the manual

sample preparation 1-4:

• 1 µL CMV+PCR1C3C2 c=188.1 ng/µl (91.8 nM) ->

• 3 µL hGH(polyA) c=26.1 ng/µl (85 nM) ->

• 1 µL T4 DNA-ligase

• 1 µL T4 DNA-ligase buffer

• 4 µL H₂0

incubation of samples for 1,5 h at room temperature

Results:

ligated plasmids(CMV + AID without NES, with NLS+Kozak sequence+eGFP+hGH-polyA) for transformation

Further tasks:

Transformation

alignment of the complete WT AID and Sequencing

Investigators: Rico, Tom S.

Aim:

alignment of the complete WT AID and Sequencing (checking the quality of the clones)

Materials:

6 forward sequences of WT AID from GATC and 6 reverse sequences of the same fragment,

draft sequences, Geneious

Results:

• 1., 3., 5. and 6. clone: mutation of the 3rd nucleotide in front of the AID startcodon (is good);

• 2. and 4. clone: frameshift (loss of the 155th nucleotide (2nd clone) or loss of the 239th nucleotide (4th clone))

Further tasks:

discard the mutated clones and preparation for transfection of the final BioBrick BBa_K929000

alignment of the mod. AID PCR-product and Sequencing

Investigators: Rico, Tom S.

Aim:

alignment of the mod. AID PCR-product and Sequencing (checking the quality of the clones)

Material:

6 forward sequences of mod. AID PCR-product from GATC and 6 reverse sequences of the same fragment,draft sequences, Geneious

Results:

• all vectors have no PCR-insert in the backbone (instead CMV)

Further tasks:

discard all samples and clones, made a eGFP and PCR-insert fusion with XbaI, NgeMIV and AgeI digestion, design new primer with PstI recognition site

2012-08-08

Planing cooperation -> Fusion of AID without NES with TAL-Protein, primer design

Investigators: Chris, Rico,

AID will be fused to the TAL-protein (N--TAL-AID--C) with BpiI.We will get the fusion protein in an eukaryotic expression-vektor (with CMV promoter or hopefully a weaker one, depending on Team-Freiburg).

The 14 bp sequence for the TAL-protein has to have the following properties: (done by Antibody team)

5' positon 0- must be T,
positon 1- no T ,
Position 2- no A,
Position 13- no G, position 14- must be G

There are two of these sequences in the VH-region of the sc-FV-anti EGFR 425 but not in the direct neighborhood of CDR3.

Planing BBa_K929001 and BBa_K929003

Investigators: Tom S., Chris, Basia, Rico, Mario, Kevin

Aim: planing how to digest and ligate the vectors for BBa_K929001 and BBa_K929003

Material: Geneious

Results 1:

• pSB1C3 with eGFP -> cut with NgoMIV and XbaI, 2793 bp - pSB1C3 backbone+eGFP, 12 bp - rest

• PCR-amplificate (without PstI restriction site) -> cut with AgeI and XbaI, 589 bp - modified AID insert (AID without NES, with NLS+Kozak sequence)

Results 2:

• pSB1C3 with CMV -> cut with PstI and XbaI, 2061 bp - pSB1C3 backbone, 680 bp - rest

• PCR-amplificate (with PstI restriction site) -> cut with PstI and XbaI, 613 bp - modified AID insert (AID without NES, with NLS+Kozak sequence)

Further tasks:

• design and ordering of primers, practical part

500px

Primer design and ordering for BBa_K929001

Investigators: Tom S., Rico

Time: 2012-08-08

Primer (reverse, complement)with AgeI, SpeI and PstI recognition site:

GCCTGCAGCGGCCGCTACTAGTATTAACCGGTGGGCAAAAGGATGCGCCGAAGC

Primer design and ordering for sequencing BBa_K929003

Investigators: Tom S., Rico

Time: 2012-08-08

Primer bind on mod. AID Sequence:

TTTCAAAGCCTGGGAAGG

Primer (reverse, complement)bind on eGFP sequence:

GTGCCCATTAACATCACC

PCR of AID without NES, with NLS+ Kozak sequence

Investigators:

Rico

Aim:

• amplification of the AID and insertion of Kozak sequence and NLS sequence

Materials:

• Phusion, template (AID insert), Primers designed by Tom S. and Rico on 12.07.2012 , dNTPs, Polymerase)

• PCR clean-up kit

Method:

• polymerase chain reaction
  

Mastermix

reagent	volume [µL]
HF Phusion buffer 5x	10
dNTPs	1
Primer (Forward)	1,25
Primer (Reverse)	1,25
DNA (Plasmid)	1,0
Phusion Polymerase	0,5
water	35,0

Program

step	Temperature [°C]	duration [s]	cycles
denaturation	98	30	1
denaturation	98	5	17
annealing + elongation	72	45	17
denaturation	98	5	17
elongation	72	25	17
final elongation	72	600	1
cooling	4	∞	1

Results:
112 ng/µl - 1st sample, 113,8ng/µl 2nd sample, 22,1 negative control

Further tasks:

• digestion + agarose gel electrophoresis

Digestion of amplified AID without NES, with NLS+Kozak sequence and GFP and separation with gel electrophoresis

Investigators:Rico

Aim: digestion of mod.-AID with XbaI and AgeI and GFP with NgoMIV and XbaI and separation via gel electrophoresis

Results:

Gel extraction of eGFP + pSB1C3 backbone and AID without NES, with NLS+Kozak sequence insert

Investigators:

Tom S.

Aim:

Gel extraction of eGFP + pSB1C3 backbone and AID without NES, with NLS+Kozak sequence insert

Materials:

centrifuge, Nucleo Spin and PCR clean up - Kit, heat block, nanodrop

Method:

extract DNA: according to the manual

Results:

DNA-concentrations via nanodrop:

eGFP + pSB1C3 backbone = 59,1 ng/µL -> 34 nM

AID without NES, with NLS+Kozak sequence 1 = 22,8 ng/µL -> 62 nM

AID without NES, with NLS+Kozak sequence 2 = 25,2 ng/µL -> 69.3 nM

location: -20 °C freezer, topmost drawer

ready DNA for ligation

Further tasks:

ligation of fragments

2012-08-09

Ligation of insert: PCR-Product (AID without NES, with NLS+Kozak sequence cut: XbaI, AgeI) & backbone: eGFP in pSB1C3 (cut: NgoMIV, Xba1)

Investigators:

Chris

Aim:

Ligation of insert: PCR-Product (AID without NES, with NLS+Kozak sequence cut: XbaI, AgeI) & backbone: eGFP in pSB1C3 (cut: NgoMIV, Xba1)

Materials:

T4 DNA-Ligase, T4-Ligase-buffer,
samples:

eGFP + pSB1C3 backbone(2793bp, MW=1725.2 kDA) = 59,1 ng/µL -> 34 nM

PCR-product 1 (598 bp, MW=363.4 kDA)= 22,8 ng/µL -> 62 nM

PCR-product 2 (598 bp, MW=363.4 kDA)= 25,2 ng/µL -> 69.3 nM

Method:

DNA Fragment ligation: according to the manual

sample preparation (same for both samples):

• 1 µL eGFP + pSB1C3 backbone 59,1 ng/µL -> 34 nM

• 2 µL PCR-product 22,8 ng/µL -> 62 nM

• 5 µl wather

• 1 µL T4 DNA-ligase

• 1 µL T4 DNA-ligase buffer

incubation of samples for 1,5 h at room temperature

Results:

ligated plasmids(final construct AID without NES, with NLS+Kozak sequence+eGFP) for transformation

Further tasks:

Transformation

Topic: transformation of ligated samples (AID without NES, with NLS+Kozak sequence+eGFP)

Investigators: Chris

Time: 2012-08-09 5 pm

Materials:

• samples: ligated AID without NES, with NLS+Kozak sequence 1+eGFP in pSB1C3, ligated AID without NES, with NLS+Kozak sequence 2+eGFP in pSB1C3
  

• Bunsen Burner, Agar Plates with chloramphenicol

• icebox

• competent E. coli cells (XL 1 Blue)

Method:

Transformation via manual, 10 µl of ligated samples were used

Plate incubation start: 5:00 pm

Results:

ready mutants to pick clones

Further tasks:

picking clones

2012-08-10

PCR of AID to create AID without NES, with NLS+Kozak sequence

Investigators:

Tom S.

Time: 2012-08-10 8 am

Aim:

PCR of AID to create AID without NES, with NLS+Kozak sequence

Method:

Mastermix

reagent	volume [µL]
HF Phusion buffer 5x	10
dNTPs	1
Primer (Forward)	1,25
Primer (Reverse)	1,25
DNA (Plasmid)	1,0
Phusion Polymerase	0,5
water	35,0

Program

step	Temperature [°C]	duration [s]	cycles
denaturation	98	30	1
denaturation	98	5	17
annealing + elongation	72	45	17
denaturation	98	5	17
elongation	72	25	17
final elongation	72	600	1
cooling	4	∞	1

PCR-clean up, final concentrations: spektra inconsistent, A260/280 very low(maybe contamination, problem with clean up):

negativ control 1: 97.4 ng/µL (spektrum inconsistent)

negativ control 2: 108.3 ng/µL (spektrum inconsistent)

PCR product 1-1: 73.1 ng/µL (spektrum inconsistent but somehow looked like a DNA curve)

PCR product 1-2: 141.5 ng/µL (spektrum inconsistent)

PCR product 2-1: 222 ng/µL (spektrum inconsistent)

PCR product 2-2: 162.2 ng/µL (spektrum inconsistent)

test digestion of PCR product(AID without NES, with NLS+Kozak sequence) with PmlI

Investigators: Rico, Chris

Materials:

• samples: negative control and PCR1-1 (AID without NES, with NLS+Kozak sequence)

• FastDigest PmlI

• 10x FD Green Buffer

• sterile water

Method:

• 30 µl mix: 1 µL negative control, 1µL PmlI, 3µL 10x FD Green Buffer, 25 µL sterile water

• 30 µl mix: 2 µL negative control, 1µL PmlI, 3µL 10x FD Green Buffer, 24 µL sterile water

• 30 µl mix: 2 µL PCR product 1, 1µL PmlI, 3µL 10x FD Green Buffer, 24 µL sterile water

• 30 µl mix: 3 µL PCR product 1, 1µL PmlI, 3µL 10x FD Green Buffer, 23 µL sterile water

• digestion incubated at 37°C for 2 h 30 min

further tasks:

• gel electrophoresis

Gel electrophoresis to control the test digestion of the PCR-product (AID without NES, with NLS+Kozak sequence)

Investigators: Rico

Time: 2012-08-11;

Materials:

gel electrophoresis equipment

digested samples

Method:

loading slots with 30 µL digested sample (digested samples and 7,5 µL Loading dye)

standard gel electrophoresis procedure

Results:

(sizes were calculated with ImageJ)

Further tasks:

sequencing

planing the AID phage display project

Investigators: Tom S.,Rico , Chris

Inoculation of AID without NES, with NLS+Kozak sequence+eGFP in pSB1C3, pBAD-mYFP Venus (phage display: arabinose promoter-vector), CREB-PYP UT156- sSD-pAK100 (phage display: vector for antibody-P3-fusion)

Investigators: Chris

Time: 2012-08-10

Materials:

LB medium

Chloramphenicol 25 mg/ ml stock solution

Plasmids: pSB1C3 with AID without NES, with NLS+Kozak sequence(PCR1&2)+eGFP-chloramphenicol resistance, pBAD-mYFP Venus-ampicillin resistance, CREB-PYP UT156- sSD-pAK100-chloramphenicol resistance

Method:

Inoculation of:

1 culture pSB1C3 with AID without NES, with NLS+Kozak sequence(PCR1)+eGFP from plate in 5 ml LB medium + 5µL chloramphenicol

1 culture pSB1C3 with AID without NES, with NLS+Kozak sequence(PCR2)+eGFP from plate in 5 ml LB medium + 5µL chloramphenicol

2 cultures pBAD-mYFP Venus from cryostock in 5 ml LB medium + 5µL ampicillin

2 CREB-PYP UT156- sSD-pAK100 from cryostock in 5 ml LB medium + 5µL chloramphenicol

shaking over night at 37°C, 300 rpm, approx. 16 hours

Further tasks:

Miniprep

2012-08-11

glycerolstocks & miniprep of AID without NES, with NLS+Kozak sequence+eGFP

Investigators: Basia

Time:

2012-08-11 10:30 am

Materials:

Glycerol, Miniprep Kit, overnight culture

Method:

Glycerol stock: 300 µL Glycerol 80 % + 700 µL overnight cultures --> put in -80 °C freezer

Miniprep of overnight cultures (pAK 100, PCR1+eGFP im PSB1C3, PCR2+eGFP im PSB1C3, Arabinose promoter in pBad)

Results:

DNA concentrations via nanodrop:

pak 100 = 187,7ng/µl

PCR1+eGFP im PSB1C3 = 12,5ng/µl

PCR2+eGFP im PSB1C3 = 227,2 ng/µl

Arabinose promoter im pbad = 341,2 ng/µl

Further tasks:

test digestion

2012-08-13

PCR of AID to create AID without NES, with NLS+Kozak sequence with PstI

Investigators:

Tom S.

Time: 2012-08-13 11 am

Aim:

PCR of AID to create AID without NES, with NLS+Kozak sequence with PstI (in the next step the PCR-product will be digested to find out whether the PCR was successful or not)

Method:

Mastermix

reagent	volume [µL]
HF Phusion buffer 5x	10
dNTPs	1
Primer (Forward)	1,25
Primer (Reverse)	1,25
DNA (Plasmid)	1,0
Phusion Polymerase	0,5
water	35,0

Program

step	Temperature [°C]	duration [s]	cycles
denaturation	98	30	1
denaturation	98	5	17
annealing + elongation	72	45	17
denaturation	98	5	17
elongation	72	25	17
final elongation	72	600	1
cooling	4	∞	1

PCR-clean up, final concentrations:

PCR 1: 20,9 ng/µL

PCR 2: 145,1 ng/µL

PCR 3: 71,6 ng/µL

PCR 4: 32,4 ng/µL

preparative digestion, test digestion and gel electrophoresis

Investigators:Rico, Tom S., Chris

Materials:

• samples: AID without NES, with NLS+Kozak sequence+eGFP in pSB1C3, AID in pSB1C3, pBAD-mYFP Venus, CMV in pSB1C3, AID without NES, with NLS+Kozak sequence

• FastDigest PmlI, XbaI, PstI, SpeI

• 10x FD Green Buffer

• sterile water

Method:

• 30 µl mix: 2µL test digestion sample, 1µL PmlI, 3µL 10x FD Green Buffer, 24 µL sterile water

• 30 µl mix: 25 µL sample, 1µL each Enzyme, 3µL 10x FD Green Buffer

sample	Enzyme 1	Enzyme 2
pBAD-YFP Venus	XbaI	PstI
AID	XbaI	PstI
AID+eGFP	PmlI	-
AID-PCR-product AID without NES, with NLS+Kozak sequence	PmlI	-
AID-PCR-product	XbaI	PstI
CMV	XbaI	PstI
AID+eGFP	XbaI	PstI
CMV	SpeI	PstI

• digestion incubated at 37°C for 2,5-5 h

results:

further tasks:

• gel extraction

gel extraction

Investigators:Chris, Tom S.

Materials:

centrifuge, Nucleo Spin and PCR clean up Kit, heat block, nanodrop

Method:

extract DNA: according to the manual

Results:

sample	mass concentration	molecular weight	molar concentration
pBAD cut X+P	50.4 ng/µL	2484.7 kDA	20.28 nM
CMV cut: S+P	18.9 ng/µL	1681.32 kDA	11.24 nM
mod. AID1(with P) cut: X+P	65.4 ng/µL	378.3 kDA	172.9 nM
mod. AID4(with P) cut: X+P	14.8 ng/µL	378.3 kDA	39.1 nM
wt AID cut: X+P	7.0 ng/µL	386.28 kDA	18 nM
CMV cut: X+P	52.1 ng/µL	1272.52 kDA	40.9 nM

the samples could be confounded? we`ll have to control it via gel electrophoresis

Further tasks:

ligation of fragments

inoculation of 4 further cultures of AID without NES, with NLS+Kozak sequence+ eGFP in pSB1C3

Investigators: Chris

Time: 2012-08-13 5 pm

Materials:

LB medium

Chloramphenicol 25 mg/ ml stock solution

plates with cultures: AID without NES, with NLS+Kozak sequence+eGFP in pSB1C3 (from 2012.08.09)

Method:

Inoculation of:

2 cultures pSB1C3 with AID without NES, with NLS+Kozak sequence(PCR1)+eGFP per plate in 5 ml LB medium + 5µL chloramphenicol

(--> 4 cultures)

Further tasks:

Miniprep

2012-08-14

Plasmid isolation of AID without NES, with NLS+Kozak sequence+eGFP in pSB1C3

Investigators:

Rico

Time: 2012-08-14 8 am

Aim:

Isolation of AID without NES, with NLS+Kozak sequence+eGFP in pSB1C3

Method:

Miniprep: according to the manual

Results:

• AID without NES, with NLS+Kozak sequence+eGFP in pSB1C3 1: 183.3 ng/µL
  

• AID without NES, with NLS+Kozak sequence+eGFP in pSB1C3 3: 257.5 ng/µL
  

• AID without NES, with NLS+Kozak sequence+eGFP in pSB1C3 4: 180.6 ng/µL
  

Further Tasks:

• Digestion with PstI, XbaI (preparative digestion) and PmlI (test digestion)

• Gel electrophoresis

Preparative digestion of isolated AID without NES, with NLS+Kozak sequence+eGFP with XbaI and PstI and test digestion of AID without NES, with NLS+Kozak sequence+eGFP with PmlI and gel electrophoresis

Investigators:

Chris, Rico

Time: 2012-08-14 8 am

Aim:

preparative and test digestion of AID without NES, with NLS+Kozak sequence+eGFP in pSB1C3

Method:

Digestion with XbaI, PstI and PmlI, gel electrophoresis

Results:

Gel extraction of digested AID without NES, with NLS+Kozak sequence+eGFP

Investigators:

Rico

Method:

Gel extraction kit

Results:

• AID without NES, with NLS+Kozak sequence+eGFP (digested with X and P): 135.2 ng/µL

Further Tasks:

• Ligation of AID without NES, with NLS+Kozak sequence+eGFP with CMV-Promotor

Ligation of CMV and AID without NES, with NLS+Kozak sequence(+P)+eGFP1&4, pSB1C3 + AID without NES, with NLS+Kozak sequence(+P)+eGFP1&4 ,pBAD +wtAID

Investigators:

Chris

Materials:

T4 DNA-Ligase, T4-Ligase buffer, water, samples

Method:

DNA Fragment ligation: according to the manual

sample preparation:

Fragment 1(BB)	Fragment 2(insert)	T4 DNA-Ligase	T4 DNA-Ligase buffer	water
pBAD cut X+P (20.28 nM)	wt AID cut: X+P (18 nM)
2 µL	6 µL	1 µL	1 µL	0 µL
CMV cut: S+P (11.24 nM)	mod. AID1(with P)+eGFP cut: X+P (172.9 nM)
5 µL	1 µL	1 µL	1 µL	2 µL
CMV cut: S+P (11.24 nM)	mod. AID4(with P)+eGFP cut: X+P (39.1 nM)
4 µL	4 µL	1 µL	1 µL	0 µL
pSB1C3 cut: X+P (40.9 nM)	mod. AID1(with P)+eGFP cut: X+P (172.9 nM)
3 µL	2 µL	1 µL	1 µL	3 µL
pSB1C3 cut: X+P (40.9 nM)	mod. AID4(with P)+eGFP cut: X+P (39.1 nM)
2 µL	6 µL	1 µL	1 µL	0 µL

incubation of samples for 1,5 h at room temperature

Results:

ligated plasmids ready for transformation

Further tasks:

Transformation

Topic: Transformation of ligated samples AID without NES, with NLS+Kozak sequence(+P)+eGFP+CMV and pBad + wtAID

Investigators: Chris

Materials:

• samples (see above): ligated pBAD +wtAID (ampR), BB+CMV+modAID(+P) from PCR 1&4 (chlR), pSB1C+ modAID(+P) from PCR 1&4 (chlR)
  

-> 2 plates per ligated sample +2 extra plates pBAD +wtAID (condensed water from the lid dripped on the plated cultures in the first two plates), all in all 12 plates

• Bunsen Burner, Agar Plates with chloramphenicol & ampicillin (for pBAD +wtAID)

• icebox

• competent E. coli cells (XL 1 Blue)

Method:

Transformation via manual, 10 µl of ligated samples were used

Plate incubation start: 4 pm

Results:

ready mutants to pick clones

Further tasks:

picking clones

2012-08-15

Ligation and transformation of CMV (Insert + backbone) and AID without NES, with NLS+Kozak sequence+eGFP (insert)

Investigators:

Rico, Tom S.

Aim:

Ligation of CMV (Insert + backbone) and AID without NES, with NLS+Kozak sequence+eGFP (insert), later transformation in XL-1

Materials:

• T4 DNA-Ligase, samples(CMV and AID)
  

• Bunsen Burner, Agar Plate with Chloramphenicol, 37 °C heater, centrifuge, spoon for weight
  

• ligated sample (compare last step 14.08-2012)

• icebox

• competent E. coli cells (XL 1)

Method:

DNA Fragment ligation: according to the manual

sample preparation:

• 5 µL (CMV Fragment)(MW: 1681,3 kDa) c=18,9 ng/µL(11,2 nM) -> 5,6 nM

• 1 µL (mod. AID+eGFP Fragment) (MW: 821,92 kDa) c=135,2 ng/µL(164,5 nM) -> 16,5 nM

• 1 µL (T4 DNA-Ligase)

• 1 µL (T4 DNA-Ligase Buffer)

• 2 µL (DNase free water)

Transformation via manual

Plate incubation start: 5 pm

incubation of sample for 1,5 h at 22 °C

Results:

location: -20 °C freezer, topmost drawer

Further tasks:

picking clones

inoculation of AID without NES, with NLS+Kozak sequence in pSB1C3, AID without NES, with NLS+Kozak sequence+CMV and pBAD+WT AID

Investigators: Tom S.

Time: 2012-08-15 5 pm

Materials:

• LB medium
  

• Chloramphenicol 25 mg/ ml stock solution
  

• Ampicillin 100 mg/ ml stock solution
  

• plates with cultures: AID without NES, with NLS+Kozak sequence+CMV in pSB1C3 (from 2012-08-14), AID without NES, with NLS+Kozak sequence in pSB1C3 and pBAD+WT AID

Method:

Inoculation of:

2 clones of every plate

Further tasks:

Miniprep and cryo stocks

Topic: Transformation of pKMEF425bla

Investigators: Chris

Materials:

• 1 µL pKMEF425bla Plasmid

• Bunsen Burner, Agar Plates with chloramphenicol

• icebox

• competent E. coli cells (XL 1 Blue)

Method:

Transformation via manual, 1 µl of pKMEF425bla Plasmid was used

Plate incubation start: 3:30 pm

Results:

2 plates (Chloramphenicol) with XL1 blue E. coli colonies carrying pKMEF425bla

Further tasks:

picking clones & inoculation (for our group and the antibody group)

PCR of AID to create AID with BpiI-restriction sides for TAL-AID fusion, cooperation with team Freiburg

Investigators:

Chris, Rico

Aim:

PCR of AID to create AID with BpiI-restriction sides for TAL-AID fusion, cooperation with team Freiburg

Method:

Mastermix

reagent	volume [µL]
HF Phusion buffer 5x	10
dNTPs	1
Primer (Forward)	1,25
Primer (Reverse)	1,25
DNA (BBa_K103001 AID in pSB1A2 10 ng/µl)	1,0
Phusion Polymerase	0,5
water	35,0

Program

step	Temperature [°C]	duration [s]	cycles
denaturation	98	30	1
denaturation	98	5	17
annealing	50	20	17
elongation	72	18	17
denaturation	98	5	17
annealing+elongation	72	18	17
final elongation	72	600	1
cooling	4	∞	1

PCR-clean up, final concentrations:

PCR TAL-AID1: 80.7 ng/µL, inconsistent curve- no DNA (also see gels below), can be discarded

PCR TAL-AID2: 202.6 ng/µL

PCR TAL-AID3: 123.3 ng/µL

PCR TAL-AID4: 124 ng/µL, inconsistent curve- no DNA (also see gels below), can be discarded

• PCR TAL-AID ist just 5` XbaI BpiI AID (without NES) BpiI(reversed) PstI 3`(but will be fused with TAL-therefore this PCR-product is called PCR TAL-AID)

Position: -20°C freezer-extrabox "phagedisplay, cooperation"

test digestion of PCR TAL-AID 1-4 with PmlI and uncut PCR TAL-AID 1-4, Gelelectrophoresis

Investigators:

Chris, Tom S., Rico

Aim:

check whether the PCR worked

Method:

Gel electrophoresis of PCR TAL-AID 1-4 uncut & PCR TAL-AID 1-4 cut with PmlI

Results:

the lowest lane could be primer dimers, therefore, PCR TAL-AID 2 & 3 will be used for further cloning. 1 and 4 can be discarded. The Location is the box phagedisplay and cooperation (-20 °C freezer).

2012-08-16

Miniprep of overnight cultures of AID without NES, with NLS+Kozak sequence in pSB1C3, pBAD-wt AID and CMV-AID without NES, with NLS+Kozak sequence

Investigators:

Rico, Tom S.

Aim:

Miniprep of AID without NES, with NLS+Kozak sequence in pSB1C3, pBAD-wt AID and CMV-AID without NES, with NLS+Kozak sequence

Method:

Miniprep Thermo Scientific according to the manual

Results:

Concentrations

Sample	Concentration [ng/µL]
AID without NES, with NLS+Kozak sequence in pSB1C3 4-1-1	224.3
AID without NES, with NLS+Kozak sequence in pSB1C3 1-2-2	297.0
AID without NES, with NLS+Kozak sequence in pSB1C3 4-1-2	210.4
AID without NES, with NLS+Kozak sequence in pSB1C3 1-2-1	246.7
AID without NES, with NLS+Kozak sequence in pSB1C3 4-2-2	271.4
AID without NES, with NLS+Kozak sequence in pSB1C3 4-2-1	229.1
AID without NES, with NLS+Kozak sequence in pSB1C3 1-1-2	193.4
AID without NES, with NLS+Kozak sequence in pSB1C3 1-1-1	233.5
pBAD wt AID 2-1	143.7
pBAD wt AID 3-1	140.9
pBAD wt AID 4-2	211.6
pBAD wt AID 1-1	164.9
pBAD wt AID 3-2	156.6
pBAD wt AID 4-1	145.3
pBAD wt AID 2-2	114.6
pBAD wt AID 1-2	114.6
CMV + AID without NES, with NLS+Kozak sequence 4-1-2	254.3
CMV + AID without NES, with NLS+Kozak sequence 1-1-2	334.8
CMV + AID without NES, with NLS+Kozak sequence 1-2-1	228.7
CMV + AID without NES, with NLS+Kozak sequence 1-2-2	311.9
CMV + AID without NES, with NLS+Kozak sequence 1-1-1	352.9
CMV + AID without NES, with NLS+Kozak sequence 4-2-2	241.2
CMV + AID without NES, with NLS+Kozak sequence 4-1-1	346.5
CMV + AID without NES, with NLS+Kozak sequence 4-2-1	318.2

Further Tasks:

Test digestion of AID without NES, with NLS+Kozak sequence in pSB1C3 with PmlI, XpaI and PstI, and test digestion of CMV-AID without NES, with NLS+Kozak sequence with XbaI and PstI

test digestion of CMV+AID without NES, with NLS+Kozak sequence with XbaI and PstI and test digestion of pBAD+WT AID and AID without NES, with NLS+Kozak sequence in pSB1C3 with XbaI, PstI and PmlI, Gel electrophoresis

Investigators:

Tom S.

Aim:

check which clone is the right one

Method:

Gel electrophoresis of all cut samples

Results:

We chose 1-1-2, 4-2-1 and 4-2-2 of AID without NES, with NLS+Kozak sequence in pSB1C3; all pBAD+WT AID and nothing of CMV + AID without NES, with NLS+Kozak sequence for further preparation.

Further Tasks:

sequencing and further cloning of the complete constructs

inoculation of CMV+AID without NES, with NLS+Kozak sequence+eGFP

Investigators: Tom S.

Time: 2012-08-16 5 pm

Materials:

• LB medium
  

• Chloramphenicol 25 mg/ ml stock solution
  

• plates with cultures: CMV+AID without NES, with NLS+Kozak sequence+eGFP in pSB1C3 (from 2012.08.15.)

Method:

Inoculation of:

2 clones of every plate

(--> 4 cultures)

Further tasks:

• Miniprep and cryo stocks
  

2012-08-17

Miniprep of overnight cultures of CMV+AID without NES, with NLS+Kozak sequence+eGFP in pSB1C3

Investigators:

Tom S.

Aim:

Miniprep of overnight cultures of CMV+AID without NES, with NLS+Kozak sequence+eGFP in pSB1C3

Method:

Miniprep Thermo Scientific: according to the manual

Results:

1-1 = 391,3 ng/µL

1-2 = 372,1 ng/µL

2-1 = 409,7 ng/µL

2-2 = 422,7 ng/µL

Further Tasks:

Test digestion of these samples PmlI, XpaI and PstI

test digestion of CMV+AID without NES, with NLS+Kozak sequence+eGFP with XbaI, PmlI and PstI, Gel electrophoresis

Investigators:

Tom S.

Aim:

check which clone is the right one

Method:

digestion for 4h

Gel electrophoresis of all cut samples

Results:

We chose 2-1 and 2-2 of CMV+AID without NES, with NLS+Kozak sequence+eGFP in pSB1C3 for further preparation.

Further Tasks:

sequencing and further cloning of the complete constructs

2012-08-20

Preparative digestion of isolated CMV+AID without NES, with NLS+Kozak sequence+eGFP and AID without NES, with NLS+Kozak sequence with SpeI and PstI and TAL-Dom. with XbaI and PstI and Gelelectrophoresis

Investigators:

Tom S.

Time: 2012-08-20 8 am

Aim:

preparative digestion

Method:

Digestion with XbaI, PstI and SpeI, Gel electrophoresis

Results:

Gel extraction of digested samples from 20.08.2012

Investigators:

Chris

Method:

Gel extraction kit

Results:

• CMV+AID without NES, with NLS+Kozak sequence+eGFP 2-1 (in pSB1C3)(digested with S and P): 236.2 ng/µL (96.6 nM)

• CMV+AID without NES, with NLS+Kozak sequence+eGFP 2-2 (in pSB1C3)(digested with S and P): 37.0 ng/µL (15.1 nM)

• AID without NES, with NLS+Kozak sequence 1-1-2 (in pSB1C3)(digested with S and P): 135.1 ng/µL (82.7)

• AID without NES, with NLS+Kozak sequence 4-2-1 (in pSB1C3)(digested with S and P): 171.2 ng/µL (104.8 nM)

• AID without NES, with NLS+Kozak sequence 4-2-2 (in pSB1C3)(digested with S and P): 96 ng/µL (58.7 nM)

• AID for Fusion with TAL 2 (digested with X and P):51.1 ng/µL (136.6 nM)

• AID for Fusion with TAL 3 (digested with X and P):35.8 ng/µL (95.5 nM)

Further Tasks:

Ligation

Ligation of CMV+AID without NES, with NLS+Kozak sequence+eGFP in pSB1C3 (S+P) & hGH poly A (X+P), AID without NES, with NLS+Kozak sequence in pSB1C3 (S+P) & hGH poly A (X+P), AID for Fusion with TAL (X+P) & pSB1C3 (X+P)

Investigators:

Chris

Materials:

T4 DNA-Ligase, T4-Ligase-buffer, water, samples

Method:

DNA Fragment ligation: according to the manual

sample preparation:

Fragment 1(BB)	Fragment 2(insert)	T4 DNA-Ligase	T4 DNA-Ligase Buffer	water
CMV+AID without NES, with NLS+Kozak sequence +eGFP 2-1 in pSB1C3 cut:S+P (96.6 nM)	hGH poly A cut: X+P (48.5 nM)
0.5 µL	2 µL	1 µL	1 µL	5.5 µL
CMV+AID without NES, with NLS+Kozak sequence +eGFP 2-2 in pSB1C3 cut:S+P (15.1 nM)	hGH poly A cut: X+P (48.5 nM)
7 µL	1 µL	1 µL	1 µL	0 µL
AID without NES, with NLS+Kozak sequence 4-2-1 in pSB1C3 cut S+P (82.7 nM)	hGH poly A cut: X+P (48.5 nM)
0.5 µL	2 µL	1 µL	1 µL	5.5 µL
AID without NES, with NLS+Kozak sequence 4-2-2 in pSB1C3 cut S+P (104.8 nM)	hGH poly A cut: X+P (48.5 nM)
0.5 µL	2 µL	1 µL	1 µL	5.5 µL
AID without NES, with NLS+Kozak sequence 1-1-2 in pSB1C3 cut S+P (58.7 nM)	AID without NES, with NLS+Kozak sequence 4(with P) cut: X+P (39.1 nM)
0.5 µL	2 µL	1 µL	1 µL	5.5 µL
AID for Fusion with TAL 2 cut: X+P (136.6 nM)	pSB1C3 cut: X+P (40.9 nM)
1 µL	1 µL	1 µL	1 µL	6 µL
AID for Fusion with TAL 3 cut: X+P (95.5 nM)	pSB1C3 cut: X+P (40.9 nM)
2 µL	1 µL	1 µL	1 µL	5 µL

incubation of samples for 1,5 h at room temperature

Results:

ligated plasmids ready for transformation

Further tasks:

Transformation

Topic: Transformation of ligated samples

Investigators: Chris

Materials:

• samples (see above): ligated CMV+AID without NES, with NLS+Kozak sequence +eGFP +hGH poly A in pSB1C3, AID without NES, with NLS+Kozak sequence + hGH-polyA pSB1C3 , AID for Fusion with TAL in pSB1C3 (all chlR)
  

->1 plate per ligated sample, all in all 7 plates

• Bunsen Burner, Agar Plates with chloramphenicol

• icebox

• competent E. coli cells (XL 1 Blue)

Method:

Transformation via manual, 10 µl of ligation samples were used

Plate incubation start: 9.20 pm

Results:

ready mutants to pick clones

Further tasks:

picking clones

inoculation of pKMEF425bla, CMV in pSB1C3, CMV+wtAID+hGH-polyA in pSB1C3

Investigators: Chris

Time: 2012-08-16 7 pm

Materials:

• LB medium
  

• Chloramphenicol 25 mg/ ml stock solution
  

• plates with cultures of pKMEF425bla (from 2012.08.16.)

• cryo sotocks of CMV in pSB1C3 & CMV+wtAID+hGH-polyA in pSB1C3 Nr. 3

Method:

Inoculation of:

2 clones of pKMEF425bla in 5 ml LB,

1 tip of cryo stock from CMV in pSB1C3 (in 5 ml LB + Chloramph) and of CMV+wtAID+hGH-polyA in pSB1C3 Nr. 3 (in 50 ml LB + Chloramph)

(--> 4 cultures)

Further tasks:

• Miniprep(pKMEF425bla, CMV in pSB1C3) and endotoxinfree mediprep (CMV+wtAID+hGH-polyA in pSB1C3) and cryo stocks
  

2012-08-21

Miniprep of pKMEF425bla & CMV in pSB1C3 CMV+wtAID+hGH-polyA in pSB1C3

Investigators: Chris

Materials:

Miniprep Kit

overnight cultures (5 mL) of pKMEF425bla and CMV in pSB1C3

Method:

according to manual

Results: concentrations:

• CMV in pSB1C3 = 247.5 ng/µL

• pKMEF425bla= 100 ng/µL

Further tasks:

preperative digestion of CMV with SpeI and PstI

test digestion of pKEF425bla with XbaI and AgeI

preperative digestion of pKEF425bla AscI and SfiI

endotoxin free mediprep CMV+wtAID+hGH-polyA in pSB1C3 for transfection in CHO

Investigators: Chris

Materials:

• endotoxin free Mediprep Kit

• overnight cultures (50 mL) of CMV+wtAID+hGH-polyA in pSB1C3
  

Method:

• according to manual

Results: concentrations:

• CMV+wtAID+hGH-polyA in pSB1C3(200 µL)=513.8 ng/µL

Further tasks:

Transfection into CHO cells

analytical digestion pKEF425bla (XbaI& AgeI) and preparative digestion of CMV-SpeI & PstI (with high and low DNA amount)

Investigators: Chris

Materials:

preparative CMV High:

• 25 µL CMV in pSB1C3 (247,5 ng/µL)

• 3 µL FD-Green Buffer

• 1 µL SpeI

• 1 µL PstI
  

preparative CMV Low:

• 6 µL CMV in pSB1C3 (247,5 ng/µL)

• 19 µL water

• 3 µL FD-Green Buffer

• 1 µL SpeI

• 1 µL PstI
  

test digestion pKEF425bla (NEB-Method)

• 2 µL pKMEF425bla (100 ng/µL)

• 23 µL water

• 3 µL NEB4 Buffer

• 1 µL XbaI

• 1µL AgeI
  

• digestion incubated at 37°C for 2h 30 min

further tasks:

• gel electrophoresis

gel electrophoresis (test digestion pKMEF425bla - XbaI & AgeI, preparative digestion CMV in pSB1C3- SpeI & PstI) and gel extraction of CMV in pSB1C3

concentrations after gel extraction:

pSB1C3+CMV high= 191.8 ng/µL

pSB1C3+CMV low= 55.4 ng/µL

inoculation of CMV+AID without NES, with NLS+Kozak sequence +eGFP+hGH, AID without NES, with NLS+Kozak sequence+hGH and TAL-AID in pSB1C3

Investigators: Chris, Tom S.

Time: 2012-08-16 7 pm

Materials:

• LB medium
  

• Chloramphenicol 25 mg/ml stock solution
  

• plates with cultures of TAL-AID in pSB1C3 (from 2012.08.20.)

• plates with cultures of CMV+AID without NES, with NLS+Kozak sequence+eGFP+hGH (from 2012.08.20.)

• plates with cultures of AID without NES, with NLS+Kozak sequence+hGH (from 2012.08.20.)

Method:

Inoculation of:

2 clones per plate

(--> 14 cultures)

Further tasks:

• Miniprep and cryo stocks
  

2012-08-22

Miniprep of overnight cultures of CMV+AID without NES, with NLS+Kozak sequence+eGFP+hGH, AID without NES, with NLS+Kozak sequence+hGH and TAL-AID in pSB1C3

Investigators:

Chris, Tom S.

Aim:

Miniprep of overnight cultures of CMV+AID without NES, with NLS+Kozak sequence+eGFP+hGH, AID without NES, with NLS+Kozak sequence+hGH and TAL-AID in pSB1C3

Method:

Miniprep Thermo Scientific: according to the manual

Results:

Concentrations

Sample	Concentration [ng/µL]
CMV+AID without NES, with NLS+Kozak sequence+eGFP+hGH 2-1-1	397.6
CMV+AID without NES, with NLS+Kozak sequence+eGFP+hGH 2-1-2	446.1
CMV+AID without NES, with NLS+Kozak sequence+eGFP+hGH 2-2-1	418.9
CMV+AID without NES, with NLS+Kozak sequence+eGFP+hGH 2-2-2	266.6
AID without NES, with NLS+Kozak sequence+hGH 1-2-2-1	319.3
AID without NES, with NLS+Kozak sequence+hGH 1-2-2-2	377.8
AID without NES, with NLS+Kozak sequence+hGH 4-2-1-1	415.0
AID without NES, with NLS+Kozak sequence+hGH 4-2-1-2	317.0
AID without NES, with NLS+Kozak sequence+hGH 4-2-2-1	307.0
AID without NES, with NLS+Kozak sequence+hGH 4-2-2-2	317.0
pBAD wt AID 4-2	211.6
TAL-AID in pSB1C3 2-1	291.1
TAL-AID in pSB1C3 2-2	305.4
TAL-AID in pSB1C3 3-1	460.5
TAL-AID in pSB1C3 3-2	292.2

Further Tasks:

Test digestion of all with PmlI, XbaI and PstI, and preparative digestion of AID without NES, with NLS+Kozak sequence+hGH with XbaI and PstI

test digestion of AID without NES, with NLS+Kozak sequence+hGH, CMV+AID without NES, with NLS+Kozak sequence+eGFP+hGH and TAL-Dom. in pSB1C3 with XbaI, PstI and PmlI, Gelelectrophoresis

Investigators:

Chris, Tom S.

Aim:

check which clone is the right one

Method:

Gel electrophoresis of all cut samples

Results:

we need to repeat the test digestion of CMV+AID without NES, with NLS+Kozak sequence+eGFP+hGH and AID without NES, with NLS+Kozak sequence+hGH;

Further Tasks:

sequencing and further cloning of the complete constructs; repeat the digestion

Preparative digestion of isolated AID without NES, with NLS+Kozak sequence+hGH-polyA with XbaI and PstI and gel extraction after gel electrophoresis

Investigators:

Chris, Tom S.

Time: 2012-08-22

Aim:

preparative digestion

Method:

Digestion with XbaI, PstI, SfiI and AscI, gel electrophoresis and gel extraction

Results:

• AID without NES, with NLS+Kozak sequence+hGH-polyA 1-2-2-1 (in pSB1C3)(digested with X and P): 25.9 ng/µL -> 38.2 nM (MW: 678,7 kDa)

• AID without NES, with NLS+Kozak sequence+hGH-polyA 1-2-2-2 (in pSB1C3)(digested with X and P): 18.2 ng/µL -> 26.8 nM

• AID without NES, with NLS+Kozak sequence+hGH-polyA 4-2-2-1 (in pSB1C3)(digested with X and P): 39.4 ng/µL -> 58.1 nM

• AID without NES, with NLS+Kozak sequence+hGH-polyA 4-2-2-2 (in pSB1C3)(digested with X and P): 38.7 ng/µL -> 57.0 nM

Further Tasks:

Ligation

2012-08-23

repetition of test digestion of AID without NES, with NLS+Kozak sequence+hGH-polyA and CMV+AID without NES, with NLS+Kozak sequence+hGH-polyA+eGFP with XbaI, PstI and PmlI, gel electrophoresis

Investigators:

Chris

Aim:

check which clone is the right one

Method:

Gel electrophoresis of all digested samples

Results:

Further Tasks:

sequencing and further cloning of the complete constructs

Ligation of AID without NES, with NLS+Kozak sequence+hGH-polyA (X+P) with pSB1C3+CMV (S+P)

Investigators:

Chris

Materials:

T4 DNA-Ligase, T4-Ligase-buffer, water, samples

Method:

DNA Fragment ligation: according to the manual

sample preparation:

Fragment 1(BB)	Fragment 2(insert)	T4 DNA-Ligase	T4 DNA-Ligase Buffer	water
pSB1C3+CMV S+P low(32 nM)	AID without NES, with NLS+Kozak sequence+hGH-polyA 1-2-2-1 cut: X+P (38.2 nM)
1 µL	3 µL	1 µL	1 µL	4 µL
pSB1C3+CMV S+P high(191 nM)	AID without NES, with NLS+Kozak sequence+hGH-polyA 1-2-2-1 cut: X+P (38.2 nM)
0.5 µL	7.5 µL	1 µL	1 µL	0 µL
pSB1C3+CMV S+P low(32 nM)	AID without NES, with NLS+Kozak sequence+hGH-polyA 1-2-2-2 cut: X+P (26.8 nM)
1 µL	4 µL	1 µL	1 µL	3 µL
pSB1C3+CMV S+P high(191 nM)	AID without NES, with NLS+Kozak sequence+hGH-polyA 1-2-2-2 cut: X+P (26.8 nM)
0.5 µL	7.5 µL	1 µL	1 µL	0 µL
pSB1C3+CMV S+P low(32 nM)	AID without NES, with NLS+Kozak sequence+hGH-polyA 4-2-2-1 cut: X+P (58.1 nM)
2 µL	4 µL	1 µL	1 µL	2 µL
pSB1C3+CMV S+P high(191 nM)	AID without NES, with NLS+Kozak sequence+hGH-polyA 4-2-2-1 cut: X+P (58.1 nM)
0.5 µL	6 µL	1 µL	1 µL	1.5 µL
pSB1C3+CMV S+P low(32 nM)	AID without NES, with NLS+Kozak sequence+hGH-polyA 4-2-2-2 cut: X+P (57 nM)
2 µL	4 µL	1 µL	1 µL	2 µL
pSB1C3+CMV S+P high(191 nM)	AID without NES, with NLS+Kozak sequence+hGH-polyA 4-2-2-2 cut: X+P (57 nM)
0.5 µL	6 µL	1 µL	1 µL	1.5 µL

incubation of samples for 1,5 h at room temperature

Results:

ligated plasmids for transformation

Further tasks:

Transformation

Topic: Transformation of ligated samples

Investigators: Chris

Materials:

• samples (see above): AID without NES, with NLS+Kozak sequence+hGH-polyA (X+P) with pSB1C3+CMV (S+P) (chlR)
  

-> 1 plates per ligated sample, 8 plates

• Bunsen Burner, Agar Plates with chloramphenicol

• icebox

• competent E. coli cells (XL 1 Blue)

Method:

Transformation via manual, 10 µl of ligation samples were used

Plate incubation start: 6 pm

Results:

ready mutants to pick clones

Further tasks:

picking clones

preparing ligated pcdna5frt-scfv-tev-tmd-eyfp-construct from 2012-08-21 for ordering sequencing by GATC

Investigators: Kerstin/Stefan/Sascha

Materials/Methods:

• dilute DNA (clons 4,8) according to GATC requirements
• Geneious
  
• Using GATC standard-primer pcdna3.1FP.1 and pcdna3.1RP.1
  

Further Tasks:

• analysis of sequencing results

2012-08-24

send the DNA to sequencing

Investigators:

Tom S.

mod.AID = AID without NES, with NLS+Kozak sequence

sample	GATC number	Seq. Primer	GATC number
mod. AID 1-1-2 Forward	II3282	pSB1C3 Forward	919656
mod. AID 1-1-2 Reverse	II3294	pSB1C3 Reverse	919657
mod. AID 4-2-1 Forward	II3283	pSB1C3 Forward	919656
mod. AID 4-2-1 Reverse	II3295	pSB1C3 Reverse	919657
mod. AID 4-2-2 Forward	II3284	pSB1C3 Forward	919656
mod. AID 4-2-2 Reverse	II3296	pSB1C3 Reverse	919657
mod. AID+eGFP 3 Forward	II3285	pSB1C3 Forward	919656
mod. AID+eGFP 3 Reverse	II3297	pSB1C3 Reverse	919657
CMV+mod. AID+eGFP+hGH 2-1-1 Forward	II3286	pSB1C3 Forward	919658
CMV+mod. AID+eGFP+hGH 2-1-1 Reverse	II3298	pSB1C3 Reverse	919659
CMV+mod. AID+eGFP+hGH 2-1-1 AID	II3299	AID-C-Term Forward	919660
CMV+mod. AID+eGFP+hGH 2-1-1 eGFP	II3300	eGFP-N-Term Reverse	919661
CMV+mod. AID+eGFP+hGH 2-1-2 Forward	II3287	pSB1C3 Forward	919658
CMV+mod. AID+eGFP+hGH 2-1-2 Reverse	II3301	pSB1C3 Reverse	919659
CMV+mod. AID+eGFP+hGH 2-1-2 AID	II3302	AID-C-Term Forward	919660
CMV+mod. AID+eGFP+hGH 2-1-2 eGFP	II3303	eGFP-N-Term Reverse	919661
CMV+mod. AID+eGFP+hGH 2-2-1 Forward	II3288	pSB1C3 Forward	919658
CMV+mod. AID+eGFP+hGH 2-2-1 Reverse	II3304	pSB1C3 Reverse	919659
CMV+mod. AID+eGFP+hGH 2-2-1 AID	II3305	AID-C-Term Forward	919660
CMV+mod. AID+eGFP+hGH 2-2-1 eGFP	II3306	eGFP-N-Term Reverse	919661
CMV+mod. AID+eGFP+hGH 2-2-2 Forward	II3289	pSB1C3 Forward	919658
CMV+mod. AID+eGFP+hGH 2-2-2 Reverse	II3307	pSB1C3 Reverse	919659
CMV+mod. AID+eGFP+hGH 2-2-2 AID	II3308	AID-C-Term Forward	919660
CMV+mod. AID+eGFP+hGH 2-2-2 eGFP	II3309	eGFP-N-Term Reverse	919661
TAL-Dom. 2-1 Forward	II3290	pSB1C3 Forward	919662
TAL-Dom. 2-1 Reverse	II3310	pSB1C3 Reverse	919663
TAL-Dom. 2-2 Forward	II3291	pSB1C3 Forward	919662
TAL-Dom. 2-2 Reverse	II3311	pSB1C3 Reverse	919663
TAL-Dom. 3-1 Forward	II3292	pSB1C3 Forward	919662
TAL-Dom. 3-1 Reverse	II3312	pSB1C3 Reverse	919663
TAL-Dom. 3-2 Forward	II3293	pSB1C3 Forward	919662
TAL-Dom. 3-2 Reverse	II3313	pSB1C3 Reverse	919663

Preparative digestion of pAK 100 and scFV with AscI and SfiI

Investigators:

Rico

Aim:

digest pAK 100 and scFV into fragments

Method:

• 3 µL NEB4 buffer, 1 µL AscI, 25 µL DNA, water

• 4 h -> 37 °C

• ad 1 µL SfiI, 4 h -> 50 °C

2012-08-27

gel electrophoresis of pAK100 (SfiI & AscI) & pKMEF425bla (AscI+SfiI) and gel extraction of pKMEF425bla (AscI+SfiI)

Investigators:

Basia

Results:

final concentration pKMEF425bla (AscI+SfiI):3.4 ng/µL

send the DNA to sequencing

Investigators:

Rico, Chris

</tr>

sample	GATC number	Seq. Primer	GATC number
pBad+WtAID 4-2	II3321	pBAD-FP	10199242
pBad+WtAID 4-2	II3322	pTrcHis-RP	10199243
pBad+WtAID 4-1	II3323	pBAD-FP	10199244
pBad+WtAID 4-1	II3324	pTrcHis-RP	10199245
pBad+WtAID 1-1	II3325	pBAD-FP	10199246
pBad+WtAID 1-1	II3326	pTrcHis-RP	10199247

inoculation of cryo stocks of pAK100 and pKMEF425bla; CMV+AID without NES, with NLS+Kozak sequence+hGH-polyA

Investigators: Chris, Rico

Time: 2012-08-16 7 pm

Materials:

• LB medium
  

• Chloramphenicol 25 mg/ ml stock solution
  

• plates with cultures CMV+AID without NES, with NLS+Kozak sequence+hGH-polyA: 4-2-2-1 L, 4-2-2-1 H, 4-2-2-2 L, 4-2-2-2 H, 1-2-2-1 L, 1-2-2-1 H, 1-2-2-2 L, 1-2-2-2 H

• cryostocks of pAK100 and pKMEF425bla

Method:

Inoculation of:

1 clones per plate

(--> 8 cultures)

Further tasks:

• Miniprep and cryo stocks
  

2012-08-28

Miniprep and cryostocks of overnight cultures

Investigators: Rico

Aim: purification of the CMV+AID without NES, with NLS+Kozak sequence+hGH in pSB1C3 construct

Method:

Miniprep Thermo Scientific

Results:

pAK 100 = 414.8 ng/µL

1-2-2-1-H = 311,3 ng/µL

1-2-2-1-L = 249,4 ng/µL

1-2-2-2-H = 303,5 ng/µL

1-2-2-2-L = 230,9 ng/µL

4-2-2-1-H = 259,3 ng/µL

4-2-2-1-L = 288,3 ng/µL

4-2-2-2-H = 513,8 ng/µL

4-2-2-2-L = 325,7 ng/µL

Further Tasks:

Test digestion of these samples with PmlI, XpaI and PstI

Test digestion of CMV+AID without NES, with NLS+Kozak sequence+hGH-polyA with PmlI, XpaI and PstI

Investigators: Basia, Rico

Aim: Test digestion of CMV+AID without NES, with NLS+Kozak sequence+hGH-polyA construct with PmlI, XpaI and PstI

Method:

• 1 µL DNA, 1 µL PmlI, 1 µL PstI, 1 µL XbaI, 3 µL FD Buffer, 23 µL water
  

• incubation for 1,5 h at 37 °C
  

Results:

300px

Checking the sequencing data

Investigators: Tom S.

Aim: choose the right constructs

Results:

AID without NES, with NLS+Kozak sequence in pSB1C3 1-1-2 -> construct not the right one

AID without NES, with NLS+Kozak sequence in pSB1C3 4-2-1 -> mutation of the 4th nt in the Kozak sequence (impact can't estimate)

AID without NES, with NLS+Kozak sequence in pSB1C3 4-2-2 -> is good

TAL-Dom. in pSB1C -> all ok

CMV+AID without NES, with NLS+Kozak sequence+eGFP+hGH -> the flanking sequences are good, but the middle primers were wrong and must be repeated

2012-08-29

Preparative digestion of pAK 100 with AscI and SfiI

Investigators:

Rico

Aim:

Preparative digestion of pAK 100 with AscI and SfiI for Phage Display

Method:

• 10 µL DNA, 15 µL water, 3 µL 10x FD Buffer, 1 µL AscI 6 h @ 37 °C

• add 1 µL SfiI 5 h @ 50 °C
  

Further Tasks:

gel electrophoresis

Test digestion of CMV+AID without NES, with NLS+Kozak sequence+hGH construct with PmlI, PstI and XbaI

Investigators:

Basia, Rico

Aim:

Test digestion of CMV+AID without NES, with NLS+Kozak sequence+hGH 4-2-2-2 L, 4-2-2-2 H, 4-2-2-1 L, 4-2-2-1 H

Method:

• 0.5 µL DNA, 0.5 µL PmlI, 0.5 µL PstI, 0.5 µL XbaI, 1 µL 10x FD Buffer, 7 µL water
  

Results:

send the DNA to sequencing

Investigators:

Tom S.

sample	GATC number	Seq. Primer	GATC number
CMV+AID without NES, with NLS+Kozak sequence+eGFP+hGH-polyA 2-1-1	II3331	AID-C-Term. Forward	919664
CMV+AID without NES, with NLS+Kozak sequence+eGFP-hGH-polyA 2-1-1	II3332	eGFP-N-Term. Reverse	919665
CMV+AID without NES, with NLS+Kozak sequence+hGH-polyA 4-2-2-1-L	II3333	pSB1C3 Forward	919666
CMV+AID without NES, with NLS+Kozak sequence+hGH 4-2-2-1-L	II3334	pSB1C3 Reverse	919667

2012-08-30

Endotoxin-free mediprep of CMV+AID without NES, with NLS+Kozak sequence+eGFP+hGH-polyA construct

Investigators:

Rico, Tom,

Method:

Midiprep

Result:

CMV+AID without NES, with NLS+Kozak sequence+eGFP+hGH-polyA 2-1-2 = 1546.7 ng/µL

CMV+AID without NES, with NLS+Kozak sequence+eGFP+hGH-polyA 2-2-1 = 1115.0 ng/µL

CMV+AID without NES, with NLS+Kozak sequence+eGFP+hGH-polyA 2-1-1 = 1358.4 ng/µL

CMV+AID without NES, with NLS+Kozak sequence+eGFP+hGH-polyA 2-2-2 = 1518.9 ng/µL

POG 4 = 1518.9 ng/µL

Clone 4 = 1239.0 ng/µL

Further Tasks:

construct is ready for transfection

Miniprep of YFP-construct from transfected CHO-Cells

Investigators:

Rico, Tom

Aim:

• Miniprep of YFP-construct from transfected CHO cells to proof whether it is possible to transform E. coli with the purified construct for sequencing

Method:

• harvesting of the CHO-cells with 0.3 mL Trypsin/EDTA and 0.5 mL medium Ham's F-12 (2.5 * 10^5 cells were seeded 3 day before)

• Miniprep of cells

• Elution with 20 µL

Results:

1 µg DNA with 1 µL PEI = 33.3 ng/µL

1 µg DNA with 1.5 µL PEI = 55.2 ng/µL

1 µg DNA with 2 µL PEI = 30.9 ng/µL

1 µg DNA with 2.5 µL PEI = 29.4 ng/µL

1 µg DNA with 3 µL PEI = 40.2 ng/µL

1 µg DNA with 3.5 µL PEI = 63.4 ng/µL

Topic: transformation of Venus vector

Investigators: Basia

Time: 2012-08-30

Materials:

• Bunsen Burner, Agar Plates with chloramphenicol

• icebox

• competent E. coli cells (XL 1 Blue)

• Venus plasmid - sample 1

Method:

Transformation via manual, 2 µl of Venus plasmid was used

Plate incubation start: 7:30 pm

Results:

ready mutants to pick clones

Further tasks:

picking clones

Preparative digestion of pAK 100 with AscI and SfiI and gel extraction

Investigators:

Chris, Rico

Results:

c(pAK 100 cut:AscI and SfiI) from left lane:9 ng/µL

c(pAK 100 cut:AscI and SfiI) from right lane: 19 ng/µL

because the fragments where not separated well we repeated the digestion (simultanously going on with ligation & transformation)

Ligation & transformation of pAK 100(AscI and SfiI) & scFV425bla(AscI and SfiI)

Ligation:

Fragment 1(BB)	Fragment 2(insert)	T4 DNA-Ligase	T4 DNA-Ligase Buffer	water
pAK 100-left lane(9 ng/µL)	425bla (3 ng/µL)
1/3 µL	3 µL	1 µL	1 µL	4,6 µL
pAK 100-right lane(50% diluted->9.5 ng/µL)	425bla (3 ng/µL)
1 µL	3 µL	1 µL	1 µL	6 µL
pAK 100-right lane(50% diluted->9.5 ng/µL)	425bla (3 ng/µL)
0.1 µL	4.5 µL	1 µL	1 µL	3 µL

Transformation:

Transformation via protocol, 10 µL of ligated samples were used

Results:
plates with transformed E. coli

Further Tasks:
picking clones

repetition of preparative digestion of pAK 100 with AscI and SfiI

sample:

2.4 µL(~1000 ng) pAK 100

3 µL 10x NEB 4 Buffer

2 µL AscI

22.6 µL water

incubation at 37 °C for 5 h and heat inactivation for 20 min at 65°C, freeze at - 20°C

Further Tasks:
digestion with SfiI

Checking the sequencing data

Investigators: Chris, Tom S.

Aim: choose the right constructs

Results:

CMV+AID without NES, with NLS+Kozak sequence+eGFP+hGH-polyA 2-1-1 -> is good

CMV+AID without NES, with NLS+Kozak sequence+hGH-polyA 4-2-2-1-L -> is good

pBAD+WT AID 1-1 -> 3 bp in front of start codon and direct after the stop codon are mutations

pBAD+WT AID 4-1 -> 3 bp in front of start codon and direct after the stop codon are mutations

pBAD+WT AID 4-2 -> 3 bp in front of start codon and direct after the stop codon are mutations

Topic: Preparation of overnight culture of E. coli strain XL-1 Blue

Investigators:

Basia

Aim:

preparation of competent cells of E. coli strain XL-1 Blue

Materials:

LB Medium, Tetracycline, XL-1 Blue stock

Method:

Competent E. coli -> Standard protocols

Results:

culture grew

Further tasks:

further preparation of competent cells with CaCl2.

2012-08-31

Topic: preparation of competent XL1 Blue E. coli

Investigators:Basia

Aim:

get competent E. coli Xl1 Blue

Materials:

CaCl2, overnight culture of E. coli XL1 Blue, Eppendorf tubes

Method:

Competent E. coli -> Standard protocols

Results:

• ca. 80 (100 µl) Stocks frozen competent E. coli XL1 Blue
  

• location: 2 paper boxes with competent E. coli Xl1 Blue in -80°C Freezer (middle shelf, most right)

Further tasks:

• testing ability for transformation of competent cells

Topic: picking clones &inoculation in 5 mL LB of retransformed Venus out of CHO cells

Investigators: Tom S.

Method: picking clone (and inoculation in 5 ml LB medium + 5µl chloramphenicol stock, shaking over night at 37°C, 300 rpm, approx. 16 hours

Further tasks:

Miniprep

Topic: picking clones &inoculation in 5 mL LB of pAK 100(AscI and SfiI) & scFV425bla(AscI and SfiI)

Investigators: Chris

Method: picking clones (and inoculation in 5 ml LB medium + 5µl chloramphenicol stock, shaking over night at 37°C, 300 rpm, approx. 16 hours

Further tasks:

Miniprep

Antibody

2012-08-02

Planning the antibody construct with new antibody (GCN4) and optimizing the old ones

Investigators: Maria

Time: 2012-08-02 9- 15 pm

Materials: Geneious

Results: optimized constructs with scFv 425bla, scFv425-72000, scFv GCN4

miniprep of ligated pcDNA5-FRT-scFv-TEV-TMD-EYFP genecostruct from 2012-07-31

Investigators: Sascha

Materials:

• Miniprep Kit

• o.n. cultures of 2 clones from each ligation (1:2, 1:3, 1:4)
  

Method:

• according to manual

Results: concentration measurement of preped ligated geneconstrcuts

• clone 1 from 1:2 ligation=

• clone 2 from 1:2 ligation=

• clone 1 from 1:3 ligation=

• clone 2 from 1:3 ligation=

• clone 1 from 1:4 ligation=

• clone 2 from 1:4 ligation=

further tasks:

• analytical digestion

analytical digestion of ligated pcDNA5-FRT-scFv-TEV-TMD-EYFP genecostruct from 2012-07-31

Investigators: Sascha

Materials:

• all 6 preped ligated pcDNA5-FRT-scFv-TEV-TMD-EYFP genecostruct from 2012-07-31

• FastDigest NheI

• 10x FD Green Buffer

• steril water

Method:

• 10µl mix: 1µl NheI, 1µl 10x FD Green Buffer, 1µl of each clone (approximately 850ng DNA), steril water ad to 10µl

• digestion incubated at 37°C for 30´

further tasks:

• gelelectrophoresis

Topic: gelelectrophoresis of analytical digested pcDNA5-FRT-scFv-TEV-TMD-EYFP genecostruct from 2012-07-31

Investigators: Sascha

Aim: checking plasmid-size after ligation of pcDNA5-FRT-scFv-TEV-TMD-EYFP in 1% agarosegel

Materials:

• agarose

• 1xTAE-buffer

• 10xFD Green Buffer

Method:

• 1% agarosegel, 90ml

• 70 min at 115V

Results:

• ligation failed
  

Further Tasks:

• amplifying new scFv-TEV-TMD-EYFP geneconstruct

• preparative digestion of pcDNA5-FRT and scFv-TEV-TMD-EYFP geneconstruct

• ligation of pcDNA5-FRT and scFv-TEV-TMD-EYFP geneconstruct

2012-08-03

Reviewing old antibody constructs and planning construct with new anti-GFP nanobody

Investigators: Maria

Time: 2012-08-03 10 - 17 pm

Materials: Geneious

Results: optimized constructs with anti-GFP nanobody and mcherry

amplifying of scFv-TEV-TMD-EYFP geneconstruct

Investigators: Sascha

Aim: amplifying of scFv-TEV-TMD-EYFP geneconstruct

Materials:

• final assembeld scFv-TEV-TMD-EYFP geneconstruct from 2012-07-28

• P7_Gesamtanfang (forward-primer)
  

• P8_Gesamtende (reverse-primer)
  

• Phusion -polymerase, dNTPs (10mM), Phusion HF-Buffer

Method:

pcr-mix: 10µl HF-Buffer; 1µl dNTPs(10mM); 2µl of final assembeled scFv-TEV-TMD-EYFP geneconstruct from 2012-07-28;2,5µl of P7_Gesamtanfang (forward-primer); 2,5µl of P8_Gesamtende (reverse-primer); nuclease-free water ad to 50µl; 0,5µl Phusion-polymerase

• PCR-prgram with end-primers: initial Denat. 40´´ at 98°C; Denat 12´´ at 98°C; Annealing 15´´ at 57°C; Elongation 27´´ at 72°C; final-Elongation 10´at 72°C; 32 cycles

further Tasks:

• PCR-Clean-Up

• analytical gelelectrophoresis of cleaned and amplifyied scFv-TEV-TMD-EYFP genecostruct

• digestion of cleaned and amplifyied scFv-TEV-TMD-EYFP geneconstruct

PCR-Clean-Up of scFv-TEV-TMD-EYFP geneconstruct

Investigators: Sascha

Aim: cleaning of scFv-TEV-TMD-EYFP genecostruct

Materials:

• PCR-Clean-Up Kit

Method:

• according to manual

Results: concentration measurement via nanodrop

• concentration of cleaned scFv-TEV-TMD-EYFP genecostruct=

analytical gelelectrophoresis of cleaned and amplifyied scFv-TEV-TMD-EYFP geneconstruct

Investigators: Sascha

Aim: analytical gelelectrophoresis to check size of amplifyied scFv-TEV-TMD-EYFP geneconstruct in 1% agarosegel

Materials:

• agarose

• 1xTAE-buffer

• 10xFD Green Buffer

Method:

• 1µl 10x FD Green, 1µl of amplifyied scFv-TEV-TMD-EYFP geneconstruct, water add to 10µl

• 1% agarosegel, 90ml

• 70 min at 120V

Results:

• amplification worked --> DNA-bond at 1701bp
  

Further Tasks:

• preparative digestion of pcDNA5-FRT and scFv-TEV-TMD-EYFPv geneconstruct

• ligation of pcDNA5-FRT and scFv-TEV-TMD-EYFPv geneconstruct

preparative digestion of pcDNA5-FRT from

Investigators: Sascha

Aim: digestion of pcDNA5-FRT with NheI and ApaI to generate sticky ends for ligation with scFv-TEV-TMD-EYFPv geneconstruct

Materials:

• Fast Digest NheI

• Fast Digest ApaI

• 10x FD Green Buffer

• pcDNA5-FRT(gut) from

• steril water

Method:

• 2,5µl pcDNA5-FRT/gut (729,ng/µl) --> 1822ng

• 2µl NheI

• 2µl ApaI

• 3µl 10x FD Green Buffer

• water add to 30µl

• digestion for 2,5h at 37°C

Further Tasks:

• dephosphorylation

• gelelectrophoresis

• gelextraction

dephosphorylation of pcDNA5FRT digested with NheI and ApaI

Investigators: Sascha

Aim:dephosphorylation of digestd pcDNA5-FRT to prevent religation

Materials:

• Antarctic Phosphatase

• 10x Antarctic Phosphatase Reaction Buffer

• digested pcDNA5-FRT

Method:

• 3,3µl 10x Antarctic Phosphatase Reaction Buffer

• 1µl Antarctic Phosphatase

• incubation for 30min at 37°C to dephosphorylate 5´-ends of pcDNA5-FRT

• heat inactivation of Phosphatase for 5min at 65°C

• store at -20°C

Further Tasks:

• gelelectrophoresis

• gelextraction

• digestion of scFv-TEV-TMD-EYFP geneconstruct

2012-08-05

preparative digestion of scFv-TEV-TMD-EYFPv geneconstruct

Investigators: Kerstin

Aim: digestion of scFv-TEV-TMD-EYFPv geneconstructwith NheI and ApaI to generate sticky ends for ligation with digested pcDNA5-FRT

Materials:

• Fast Digest NheI

• Fast Digest ApaI

• 10x FD Green Buffer

• scFv-TEV-TMD-EYFPv geneconstruct

• steril water

Method:

• 26µl final assembled scFv-TEV-TMD-EYFP geneconstruct(76,4µng/µl) --> 1986,4ng

• 1µl NheI

• 1µl ApaI

• 3,1µl 10x FD Green Buffer

• water add to 31µl

• digestion for 2,5h at 37°C

• heat inactivation of NheI and ApaI --> 5min at 65°C

• store at -20°C

Further Tasks:

• gelelectrophoresis

• gelextraction

• ligation with digested pcDNA5-FRT

2012-08-06

Reviewing new construct with anti-GFP nanobody and contacting IDT and GeneArt

Investigators: Maria

Time: 2012-08-06 12 - 14 pm

Materials: Geneious

Results: final construct with anti-GFP nanobody and mcherry

preparative gelelectrophoresis of digested scFv-TEV-TMD-EYFP geneconstruct and digested + dephosporylated pcDNA5-FRT

Investigators: Sascha

Aim: preparative gelelectrophoresis to separate digested scFv-TEV-TMD-EYFP geneconstruct and pcDNA5-FRT in 1% agarosegel

Materials:

• agarose

• 1xTAE-buffer

• digested DNA

Method:

• 30µl mix of digested and dephosphorylated pcDNA5-FRT

• 31µl mix of digested scFv-TEV-TMD-EYFP geneconstruct

• 1% agarosegel, 100ml

• 90 min at 95V

Results:

Further Tasks:

• gelextraction

• ligation

gelextracton of digested scFv-TEV-TMD-EYFP geneconstruct and digested + dephosporylated pcDNA5-FRT out of 1% agarosegel

Investigators: Sascha

Aim: extract of digested scFv-TEV-TMD-EYFP geneconstruct and pcDNA5-FRT

Materials:

• Gel-Clean-Up Kit

Method:

• according to manual

• failure at elution step

Further Tasks:

pcr-Clean-up of digested scFv-TEV-TMD-EYFP geneconstruct and pcDNA5-FRT

PCR-Clean-Up of digested scFv-TEV-TMD-EYFP geneconstruct and digested + dephosporylated pcDNA5-FRT after gelextraction

Investigators: Sascha

Aim: cleaning and eluting of digested scFv-TEV-TMD-EYFP geneconstruct and pcDNA5-FRT

Materials:

• PCR/Gel-Clean-Up Kit

Method:

• according to manual

Results: concentration measurement using nanodrop

• concentration of cleaned-up pcDNA5-FRT= 8,4ng/µl
  

• concentration of celaned-up scFv-TEV-TMD-EYFP geneconstruct= 10,4ng/µl
  

Further Tasks:

• ligation of pcDNA5-FRT and scFv-TEV-TMD-EYFP geneconstruct

ligation of digested scFv-TEV-TMD-EYFP geneconstruct and digested + dephosporylated pcDNA5-FRT

Investigators: Sascha

Aim: ligation of digested scFv-TEV-TMD-EYFP geneconstruct and pcDNA5-FRT

Materials:

• ligation calculator: http://www.insilico.uni-duesseldorf.de/Lig_Input.html

• T4 DNA ligae

• ligase buffer

• digested scFv-TEV-TMD-EYFP geneconstruct

• digested + dephosporylated pcDNA5-FRT

Method: ligation-ratio--> 1:3

• 1µl T4 DNA ligase

• 2,5µl T4 DNA-ligase buffer

• 11,9µl digested + dephosporylated pcDNA5-FRT (8,4ng/µl) --> 100ng

• 9,67µl digested scFv-TEV-TMD-EYFP geneconstruct (10,4ng/µl) --> 100,66ng

• no religation-copntrol

• incubation for 1h at RT

Further Tasks:

• transformation of ligation mix into XL1-blue competente E. coli cells

Transformation of ligated pcDNA5-FRT_scFv-TEV-TMD-EYFP into XL1-blue competente E. coli cells

Investigators: Sascha

Materials:

• Bunsen Burner, Agar Plate with Ampicilin, 37 °C heater, centrifuge,
  

• ligase sample

• icebox

• competent E. coli cells (XL 1)

Method:

• Transformation via manual

• 50µl of resuspended cell-suspension were plated on a LB-Amp-plate

• incubation o.n. at 37°C

Further Tasks:

• picking clones

2012-08-07

Preparing GeneArt order of nanobody construct

Investigators: Maria

Time: 2012-08-07 09 - 11 am

Materials: Geneious

Results: Analysis and quotation by GeneArt (24h processing time)

colony-pcr of ligated pcDNA5-FRT_scFv-TEV-TMD-EYFP clones

Investigators: Sascha

AIM: identifying correct ligated pcDNA5-FRT_scFv-TEV-TMD-EYFP clones

Materials:

• Taq DNA-polymerase 1kb/1min

• 10x Taq DNA-polymerase buffer
  

• dNTPs (10mM)

• forward primer in C-terminus of CMV of pcDNA5-FRT-backbone: fp_qRT-CMV_rev (Tm=55°C)

• reverse primer in C-terminus in EYFP: ps_mcherry_rev_BamHI (Tm= 59,31°C)

• Thermocycler

Methods:

• 20µl colony-pcr mix for one clone: 2µl 10x Standard Taq-DNA-Polymerase Buffer; 0,4µl dNTPs (10mM), 0,4µl fp_qRT-CMV_rev(10µM), 0,4µl ps_mcherry_rev_BamHI (10µM); 0,1µl Taq-DNA-Polymerase; nuclease-free water add to 20µl

• colony-pcr mix were adapted to 26 clones

• after transferation of clone into 20µl colony-pcr mix, the rest of clone at the tip was plated on a LB-AMP-plate
  

• LB-AMP-plate were incubated o.n. at 37°C
  

• negative control: clon #24 from relagtion-control (ligation-ratio 1:0) from 2012-07-31

• program of colony-pcr: initial Denaturation:5´at 95°C; Denaturation: 25´´ at 95°C, Annealing: 25´´ at 51°C; Elongation: 114´´ (1845bp) at 68°C; final Elongation: 5´at 86°C; 30 cycles; store at 8°C

further Taks:

• gelelectrophoresis

• picking positiv clones for o.n.-culture

gelelectrophoresis of colony-pcr

Investigators: Sascha

AIM: identifying correct ligated pcDNA5-FRT_scFv-TEV-TMD-EYFP clones

Materials:

• 1 100 ml 1%agarosegel with 20 slots

• 1 90 ml 1% agarosegel with 9 slots

• 1x TAE-buffer

• agarose

Method:

• 90 ml 1% agarosegel for 80 min at 110V

• 100 ml 1% agarosegel for 100 min at 110V
  

Results:

• (positive) clones 3, 4, 5, 8, 21, 23 were chosen for o.n.-culture because of desired DNA-bond at appropriate 1845bp

further Tasks:

• o.n.-culture of positive clones

o.n.-culture of positive ligated pcDNA5-FRT_scFv-TEV-TMD-EYFP clones

Investigators: Tom S.

Materials:

• 8x 15 ml Falcons

• LB-Medium

• Ampicilin

• bunsen burner

Method:

• 2x o.n.-culture of clones 8 and 23

• 1x o.n.-culture of clones 3,4,5,21

• each o.n.-culture 5ml LB-Medium + 5µl Ampicilin

• incubation o.n. at 37°C

further Tasks:

• miniprep of o.n.-cultures

2012-08-08

Ordering nanobody construct from GeneArt

Investigators: Maria

Time: 2012-08-08 10 - 11 am

Materials: Geneious

Results: Final nanobody construct, estimated producing time aprox. 16 days

miniprep of o.n.-culture of positive ligated pcDNA5-FRT_scFv-TEV-TMD-EYFP clones

Investigators: Stefan

Materials:

• Miniprep-Kit

Method:

• according to manual

Results: concentration measurement via nanodrop

• pcDNA5-FRT_scFv-TEV-TMD-EYFP_clone3=

• pcDNA5-FRT_scFv-TEV-TMD-EYFP_clone4=

• pcDNA5-FRT_scFv-TEV-TMD-EYFP_clone5=

• pcDNA5-FRT_scFv-TEV-TMD-EYFP_clone8=

• pcDNA5-FRT_scFv-TEV-TMD-EYFP_clone21=

• pcDNA5-FRT_scFv-TEV-TMD-EYFP_clone23=

further Tasks:

• looking for primer for GATC-sequencing of positive pcDNA5-FRT_scFv-TEV-TMD-EYFP_clones

2012-08-10

preparing ligated pcdna5frt-scfv-tev-tmd-eyfp-construct for ordering sequencing by GATC

Investigators: Sascha

Materials:

• dilute DNA (clons 3,8,21) according to GATC requirements
• Geneious
  
• Using GATC standard-primer pcdna3.1FP.1 and pcdna3.1RP.1
  

Further Tasks:

• analysis of sequencing results

2012-08-13

Cell culture

Investigators: Kerstin

Time: 2012-08-13 3 pm

Materials: culture flasks (75cm²), 6-Well Plates, Trypsin/EDTA, PBS, Ham's F12 Medium

Method:

• passage of CHO Flp-In cells, 1:10 dilution
  

• Preparation for Transfection: seeding of CHO Flp-In cells in 6-Well plates (1*10^5, 1,5*10^5, 2*10^5,..., 3,5*10^5 cells/well)

• Incubation for 2 days

analyzing sequencing results of ligated pcdna5frt-scfv-tev-tmd-eyfp-construct

Investigators: Sascha
Materials:

• sequencing results of GATC from pcdna5frt-scfv-tev-temd-eyfp-construct (clons 3,8,21)
• Blastn
• Wordpad
  

Results:

• all clones lacked approximately 500bp into the eyfp-sequence
  

Further Tasks:

• new assembly PCR
  

2012-08-14

analyzing sequencing results of ligated pcdna5frt-scfv-tev-tmd-eyfp-construct

Investigators: Sascha
Materials:

• sequencing results of GATC from pcdna5frt-scfv-tev-tmd-eyfp-construct (clons 3,8,21)
• GeneiousBlastn
  

Results:

• all clones lacked approximately 500bp into the eyfp-sequence
  

Further Tasks:

• new assembly PCR
  

2012-08-15

Transfection of CHO cells with WildTyp AID and CMV_mVenus_construct

Investigators: Kerstin, Stefan

Time: 2012-08-15 11 am

Materials: cells in 6-Well Plates, DNA WildTyp AID, CMV_mVenus_construct, Opti-MEM, PEI Transfection Reagent

Method:

• wells with 80% confluence were chosen for transfection (2,5*10^5cells/well seeded on 13.08.12)
  

protocol 1:

• 4,8fold PEI transfection reagent according to DNA amount

• 2,5µg CMV_mVenus_construct DNA + 2,5µg WildTYp AID DNA, add to 200µl with Opti-MEM

• 24µl PEI + 176µl Opti-MEM

• vortex 3 times for 10 sec

• incubate for 2 min

• mix solutions (always add PEI mix to DNA mix)

• incubation for 15 min

• spread on cells and mix gently

protocol 2:

• 2,5fold PEI transfection reagent according to DNA amount

• 1µg CMV_mVenus_construct DNA + 1µg WildTYp AID DNA, add to 200µl with Opti-MEM

• 5µl PEI + 195µl Opti-MEM

• vortex 3 times for 10 sec

• incubate for 2 min

• mix solutions (always add PEI mix to DNA mix)

• incubation for 15 min

• spread on cells and mix gently

Results:

fluorescence image of protocol 1 treated cells

File:UP 12 Transfection 16.08 prot1.tiff

analyzing sequencing results of ligated pcdna5frt-scfv-tev-tmd-eyfp-construct

Investigators: Sascha
Methods/Materials:

• calling GATC and asking to repeat sequencing reaction of clon3 pcdna5frt-scfv-tev-tmd-eyfp-construct with pcdna3.1-RP.1 primer
  

Results: Further Tasks:

• analyze repeated sequencing
  

2012-08-16

Retransformation with scFv, transmembrane domain and YFP

<b>Investigators: Kerstin/Stefan

Aim: Retransformation with scFv anti-EGFR

Date/Time: 15th August 2012, 2:30 – 4:30 pm

Materials: competent E. coli cells XL1 Blue, scFv anti-EGFR, 42°/37° C shaker, centrifuge

Method: see transformation protocol

Results: colonies on Chloramphenicol plates with scFv

Further tasks: picking clones and overnight culture (16th August)

analyzing sequencing results of clon3 pcdna5frt-scfv-tev-tmd-eyfp-construct with pcdna3.1-RP.1 primer

Investigators: Sascha
Materials:

• sequencing results of GATC from pcdna5frt-scfv-tev-temd-eyfp-construct clons 3
• Blastn
• Wordpad
  

Results:

• clone 3 lacks approximately 500bp into the eyfp-sequence
  

Further Tasks:

• troubleshooting
• new assembly PCR
  

2012-08-17

extension-pcr of scFv-TEV-TMD-EYFP geneconstruct

Investigators: Kerstin/Stefan

Materials:
scFv anti-EGFR, BBa-KI57000 with transmembrane domain; BBa_E0030 with EYFP

• P1_Signalp_N-term
  

• P2_Signalp_C-term
  

• P3_TMD-N-term
  

• P4_TMD-C-term/N-YFP
  

• P5_YFP-N-term/TMD-C-term
  

• P6_YFP-C-term
  

• Phusion -polymerase, dNTPs (10mM), Phusion HF-Buffer

Method:

• 50µl PCR mix of each plasmid= 10µl HF-Buffer; 1µl dNTPs(10mM); forward and reverse primer each 2,5µl (10µM); template DNA: 1µl of 200ng/µl scFv--> 200ng, 5µl of BBa_E0030 with EYFP (46,3ng/µl--> ca. 230ng),5µl of BBa-KI57000 with transmembrane domain (43,9ng/µl --> ca. 230ng); Phusion DNA polymerase 0,5µl; nclease-free water ad to 50µl
  

• PCR-program: initial Denat. 40´´ at 98°C; Denat 12´´ at 98°C; Annealing 15´´ at 55°C; Elongation 11´´ at 72°C; final-Elongation 10´at 72°C; 30 cycles

Further Tasks:

• gelelectrophoresis

gelelectrophoresis of extended genes after extension-pcr

Investigators: Kerstin/Stefan

Aim: separation of extended genes scFv-TEV, TEV-TMD, EYFP in 1% agarosegel

Materials:

• agarose

• 1xTAE-buffer

• 10xFD Green Buffer

• extended genes

Method:

• 1% agarosegel

• 70 min at 105V

Results:

Further Tasks:

• gelextraction

gelextraction of extended genes after extension-pcr

Investigators: Kerstin/Stefan

Aim: gelextraction of extended genes(scFv-TEV, TEV-TMD, EYFP) out of 1% agarosegel

Method:

• DNA extracted according to the manual

Further Tasks:

• assembly-pcr

assembly-pcr with extended genes to scFv-TEV-TMD-EYFP geneconstruct

Investigators: Kerstin/Stefan

Aim: assembly-pcr with extended genes to scFv-TEV-TMD-EYFP geneconstruct

Materials:
scFv anti-EGFR, BBa-KI57000 with transmembrane domain; BBa_E0030 with EYFP

• P7_Gesamtanfang (forward-primer)
  

• P8_Gesamtende (reverse-primer)
  

• Phusion -polymerase, dNTPs (10mM), Phusion HF-Buffer

Method:

• assembly-pcr-mix--> 3:1:3 10µl HF-Buffer; 1µl dNTPs(10mM); extended TMD (1ng), extended EYFP (2,75ng), extended scFv (2,75ng); nuclease-free water ad to 45µl; 0,5µl Phusion-polymerase
  

• PCR-program to let the extended genes prime each other: initial Denat. 40´´ at 95°C; Denat 12´´ at 95°C; Annealing 15´´ at 68°C; Elongation 27´´ at 72°C; final-Elongation 10´at 72°C; 35 cycles

• after annealing of extended genes to each other 2,5µl of primer forw_P7_Gesamtanfang and primer rev_P8_Gesamtende were added

• PCR-prgram with end-primers: initial Denat. 40´´ at 95°C; Denat 12´´ at 95°C; Annealing 15´´ at 55°C; Elongation 27´´ at 72°C; final-Elongation 10´at 72°C; 30 cycles

• Gelelectrophoresis at 105V for 75`

Results:

• extraction of DNA (1701bp)

Further Tasks:

• Amplification of assembly pcr-Product

analyzing sequencing results of clon3 pcdna5frt-scfv-tev-tmd-eyfp-construct with pcdna3.1-RP.1 primer

Investigators: Sascha
Materials:

• sequencing results of GATC from pcdna5frt-scfv-tev-tmd-eyfp-construct clons 3
• Geneious
  

Results:

• clone 3 lacks approximately 500bp into the eyfp-sequence
  

Further Tasks:

• troubleshooting
• new assembly PCR
  

2012-08-18

amplifying of scFv-TEV-TMD-EYFP geneconstruct

Investigators: Kerstin/Stefan

Aim: amplifying of scFv-TEV-TMD-EYFP geneconstruct

Materials:

• final assembeld scFv-TEV-TMD-EYFP geneconstruct from 2012-07-28

• P7_Gesamtanfang (forward-primer)
  

• P8_Gesamtende (reverse-primer)
  

• Phusion -polymerase, dNTPs (10mM), Phusion HF-Buffer

Method:

pcr-mix: 10µl HF-Buffer; 1µl dNTPs(10mM); 2µl of final assembeled scFv-TEV-TMD-EYFP geneconstruct from 2012-07-28;2,5µl of P7_Gesamtanfang (forward-primer); 2,5µl of P8_Gesamtende (reverse-primer); nuclease-free water ad to 50µl; 0,5µl Phusion-polymerase

• PCR-program with end-primers: initial Denat. 40´´ at 98°C; Denat 12´´ at 98°C; Annealing 15´´ at 57°C; Elongation 27´´ at 72°C; final-Elongation 10´at 72°C; 32 cycles

further Tasks:

• PCR-Clean-Up

• analytical gelelectrophoresis of cleaned and amplifyied scFv-TEV-TMD-EYFP genecostruct

• digestion of cleaned and amplifyied scFv-TEV-TMD-EYFP geneconstruct

PCR-Clean-Up of scFv-TEV-TMD-EYFP geneconstruct

Investigators: Kerstin/Stefan

Aim: cleaning of scFv-TEV-TMD-EYFP genecostruct

Materials:

• PCR-Clean-Up Kit

Method:

• according to manual

analytical gelelectrophoresis of cleaned and amplifyied scFv-TEV-TMD-EYFP geneconstruct

Investigators: Kerstin/Stefan

Aim: analytical gelelectrophoresis to check size of amplifyied scFv-TEV-TMD-EYFP geneconstruct in 1% agarosegel

Materials:

• agarose

• 1xTAE-buffer

• 10xFD Green Buffer

Method:

• 1µl 10x FD Green, 1µl of amplifyied scFv-TEV-TMD-EYFP geneconstruct, water add to 10µl

• 1% agarosegel, 90ml

• 70 min at 120V

Results:

• amplification worked --> DNA-bond at 1701bp
  

Further Tasks:

• preparative digestion of pcDNA5-FRT and scFv-TEV-TMD-EYFPv geneconstruct

• ligation of pcDNA5-FRT and scFv-TEV-TMD-EYFPv geneconstruct

preparative digestion of pcDNA5-FRT from

Investigators: Kerstin/Stefan

Aim: digestion of pcDNA5-FRT with NheI and ApaI to generate sticky ends for ligation with scFv-TEV-TMD-EYFPv geneconstruct

Materials:

• Fast Digest NheI

• Fast Digest ApaI

• 10x FD Green Buffer

• pcDNA5-FRT(gut) from

• steril water

Method:

• 2,5µl pcDNA5-FRT/gut (729,ng/µl) --> 1822ng

• 2µl NheI

• 2µl ApaI

• 3µl 10x FD Green Buffer

• water add to 30µl

• digestion for 2,5h at 37°C

Further Tasks:

• dephosphorylation

• gelelectrophoresis

• gelextraction

dephosphorylation of pcDNA5FRT digested with NheI and ApaI

Investigators: Kerstin/Stefan

Aim:dephosphorylation of digestd pcDNA5-FRT to prevent religation

Materials:

• Antarctic Phosphatase

• 10x Antarctic Phosphatase Reaction Buffer

• digested pcDNA5-FRT

Method:

• 3,3µl 10x Antarctic Phosphatase Reaction Buffer

• 1µl Antarctic Phosphatase

• incubation for 30min at 37°C to dephosphorylate 5´-ends of pcDNA5-FRT

• heat inactivation of Phosphatase for 5min at 65°C

• store at -20°C

Further Tasks:

• gelelectrophoresis

• gelextraction

• digestion of scFv-TEV-TMD-EYFP geneconstruct

2012-08-19

ligation of digested scFv-TEV-TMD-EYFP geneconstruct and digested + dephosporylated pcDNA5-FRT

Investigators: Kerstin/Stefan

Aim: ligation of digested scFv-TEV-TMD-EYFP geneconstruct and pcDNA5-FRT

Materials:

• ligation calculator: http://www.insilico.uni-duesseldorf.de/Lig_Input.html

• T4 DNA ligae

• ligase buffer

• digested scFv-TEV-TMD-EYFP geneconstruct

• digested + dephosporylated pcDNA5-FRT

Method: ligation-ratio--> 1:3

• 1µl T4 DNA ligase

• 2,5µl T4 DNA-ligase buffer

• 11,9µl digested + dephosporylated pcDNA5-FRT (8,4ng/µl) --> 100ng

• 9,67µl digested scFv-TEV-TMD-EYFP geneconstruct (10,4ng/µl) --> 100,66ng

• religation-control

• incubation for 1h at RT

Further Tasks:

• transformation of ligation mix into XL1-blue competente E. coli cells

Transformation of ligated pcDNA5-FRT_scFv-TEV-TMD-EYFP into XL1-blue competente E. coli cells

Investigators: Kerstin/Stefan

Materials:

• Bunsen Burner, Agar Plate with Ampicilin, 37 °C heater, centrifuge,
  

• ligase sample

• icebox

• competent E. coli cells (XL 1)

Method:

• Transformation via manual

• 50µl of resuspended cell-suspension were plated on a LB-Amp-plate

• incubation o.n. at 37°C

Further Tasks:

• picking clones

2012-08-20

colony-pcr of ligated pcDNA5-FRT_scFv-TEV-TMD-EYFP clones

Investigators: Kerstin/Stefan

AIM: identifying correct ligated pcDNA5-FRT_scFv-TEV-TMD-EYFP clones

Materials:

• Taq DNA-polymerase 1kb/1min

• 10x Taq DNA-polymerase buffer
  

• dNTPs (10mM)

• forward primer in C-terminus of CMV of pcDNA5-FRT-backbone: fp_qRT-CMV_rev (Tm=55°C)

• reverse primer in C-terminus in EYFP: ps_mcherry_rev_BamHI (Tm= 59,31°C)

• Thermocycler

Methods:

• 20µl colony-pcr mix for one clone: 2µl 10x Standard Taq-DNA-Polymerase Buffer; 0,4µl dNTPs (10mM), 0,4µl fp_qRT-CMV_rev(10µM), 0,4µl ps_mcherry_rev_BamHI (10µM); 0,1µl Taq-DNA-Polymerase; nuclease-free water add to 20µl

• colony-pcr mix were adapted to 26 clones

• after transferation of clone into 20µl colony-pcr mix, the rest of clone at the tip was plated on a LB-AMP-plate
  

• LB-AMP-plate were incubated o.n. at 37°C
  

• negative control: clon #24 from relagtion-control (ligation-ratio 1:0) from 2012-07-31

• program of colony-pcr: initial Denaturation:5´at 95°C; Denaturation: 25´´ at 95°C, Annealing: 25´´ at 51°C; Elongation: 114´´ (1845bp) at 68°C; final Elongation: 5´at 86°C; 30 cycles; store at 8°C

further Taks:

• gelelectrophoresis

• picking positiv clones for o.n.-culture

gelelectrophoresis of colony-pcr

Investigators: Kerstin/Stefan

AIM: identifying correct ligated pcDNA5-FRT_scFv-TEV-TMD-EYFP clones

Materials:

• 1 100 ml 1%agarosegel with 20 slots

• 1 90 ml 1% agarosegel with 9 slots

• 1x TAE-buffer

• agarose

Method:

• 90 ml 1% agarosegel for 80 min at 110V

• 100 ml 1% agarosegel for 100 min at 110V
  

Results:

• (positive) clones 4, 8, 12, 16 were chosen for o.n.-culture because of desired DNA-bond at appropriate 1845bp

further Tasks:

• o.n.-culture of positive clones

o.n.-culture of positive ligated pcDNA5-FRT_scFv-TEV-TMD-EYFP clones

Investigators: Kerstin/Stefan.

Materials:

• 4x 15 ml Falcons

• LB-Medium

• Ampicilin

• bunsen burner

further Tasks:

• miniprep of o.n.-cultures

2012-08-21

miniprep of o.n.-culture of positive ligated pcDNA5-FRT_scFv-TEV-TMD-EYFP clones

Investigators: Kerstin/Stefan

Materials:

• Miniprep-Kit

Method:

• according to manual

Results: concentration measurement via nanodrop

• pcDNA5-FRT_scFv-TEV-TMD-EYFP_clone4= 540 ng/µl

• pcDNA5-FRT_scFv-TEV-TMD-EYFP_clone8= 663 ng/µl

• pcDNA5-FRT_scFv-TEV-TMD-EYFP_clone12=572ng/µl

• pcDNA5-FRT_scFv-TEV-TMD-EYFP_clone16=580ng/µl

further Tasks:

• sequencing of the clones 4 and 8

• if they are correct ===> stable transfection

2012-08-25

analyzing sequencing results of clon3 pcdna5frt-scfv-tev-tmd-eyfp-construct with pcdna3.1-RP.1 primer

Investigators: Sascha
Materials:

• sequencing results of GATC from pcdna5frt-scfv-tev-temd-eyfp-construct clons 4,8
• Geneious
  

Results:

• clon4 with pcdna3.1-FP.1 shows accordance with theoretical pcdna5frt-scfv-tev-tmd-eyfp-construct
  

Further Tasks:

• transformation of clon4 for endotoxin free preparation
  

2012-08-27

Transformation of Clon4 (scFv425+TEV+TMD+YFP in pcDNA5/FRT) and Pog44 (Flp recombinase vector)

Investigator:Maria

Time: 2012-08-27 5:00pm

Materials: competent E. coli cells (XL1 blue), icebox, Bunsen burner, agar plate with ampicillin

Methods: Transformation according to manual, 2µl of Clon4 and Pog44 were used, plate incubation started 6:30pm

Results: colonies ready for picking and overnight culture

Further tasks: Picking colonies

Overnight culture of CMV-Venus

Investigator:Maria

Time: 2012-08-27 5:00pm

Materials: glycerol stock CMV-Venus, 50ml LB media with chloramphenicol

Methods: inoculation of LB-chloramphenicol

Results: overnight culture for endotoxin free DNA preparation

Further tasks: endotoxin free preparation

2012-08-28

Endotoxin free preparation of CMV-venus

Investigator:Maria

Time: 2012-08-28 11:00 am

Materials: endotoxin free Mediprep kit, overnight culture CMV-Venus

Methods: according to manual

Results: CMV-Venus with --- ng/µl

Further tasks: transient transfection of CHO cells

Overnight culture Clon4 and Pog44

Investigator:Maria

Time: 2012-08-28 5:00 am

Materials: colonies of Clon4 and Pog44, 5ml LB media with ampicillin

Methods: inoculation of LB-ampicillin

Results: overnight culture for endotoxin free DNA preparation

Further tasks: endotoxin free preparation

2012-08-27

cell culture;

Investigator:Kerstin/Stefan

Time: 2012-08-29 11:00 am

Topic: cell culture

Materials: 6-well plates;

• transfection of 6-well plate with different PEI amounts

• • well 1) 1 fold PEI; 2) 1,5 fold PEI; 3) 2 fold PEI; 4) 2,5 fold PEI; 5) 3 fold PEI; 6) 3,5 fold PEI of DNA amount

• NOTE: due to not conclusive experiments, it was decided to keep the original protocol with 2,5 fold PEI

analyzing sequencing results of clon3 pcdna5frt-scfv-tev-tmd-eyfp-construct with pcdna3.1-RP.1 primer

Investigators: Sascha
Materials:

• sequencing results of GATC from pcdna5frt-scfv-tev-tmd-eyfp-construct clons 4,8
• Geneious
  

Results:

• clon4 with pcdna3.1-RP.1 shows accordance with theoretical pcdna5frt-scfv-tev-tmd-eyfp-construct
  

Further Tasks:

• transformation of clon4 for endotoxin free preparation
  

2012-08-29

cell culture;

Investigator:Kerstin/Stefan

Time: 2012-08-29 11:00 am

Materials: cell-culture flask (75cm^2); 6-well plates; ibidi-dishes

Topic: cell culture;

• thowing CHO cells, cultured w/o zeocin

• passaging (1:10) of CHO’s one flask w/ and one w/o zeocin

• seeding CHO’s in 6-well 2*10^5 cells/well

• seeding CHO’s in ibidi dishes 5*10^4 cells/well

• transfection of clon 4 (540ng/µl) (small construct) of CHO’s in ibidi dishes, 1µg(DNA):2,5µl(PEI) = 0,25µg DNA:0,625µl PEI

• transfection of 6-well plate with different DNA amounts

• • well 1) 1µg(0.5µgmVenus+0,5µg AID) DNA; 2) 1,5µg DNA; 3) 2µg DNA; 4) 3µg DNA; 5) 4µg DNA; 6) 5µg DNA with 2,5 fold PEI

2012-08-31

cell culture;

Investigator:Kerstin/Stefan

Time: 2012-08-31 09:00 am

Topic: cell-culture

Methods:

• passaging of thawed CHO’s w/ and w/o zeocin (of 29.08.2012 seeded cells)

• imaging (longtime imaging over 48 hours) of the transfected cells (30.08.2012) CHO’s in ibidi dishes with m-Venus+wild Type AID

2012-08-30

cell culture;

Investigator:Kerstin/Stefan

Time: 2012-08-30 09:00 am

Topic: cell-culture

• change of medium of thawed CHO’s w/ zeocin

• transfection of seeded (29.08.2012) CHO’s in ibidi dishes with m-Venus (250ng) and wild type AID (250ng)

• z-stack of clon 4(small construct)

2012-08-29

Endotoxin free preparation of Clon4 and Pog44

Investigator:Rico, Tom, Chris

Time: 2012-08-29

Materials: endotoxin free Mediprep kit, overnight culture Clon4, Pog44

Methods: according to manual

Results: Clon 4 with --- ng/µl, Pog44 with ----ng/µl

Further tasks: stable transfection of CHO cells

2012-08-30

Primer design for Biobricks with RCF 25 standard

Investigator:Maria

Time: 2012-08-30 6:30 am

Materials: Geneious

Results: Primer big construct

• Primer 1.1 and 1.2: Signal peptide-Nanobody-Fc

• Primer 2.1 and 2.2: TEV-LoxP-TMD-mcherry-LoxP

• Primer 3.1 and 3.2: Nanobody

• Primer 4.1 and 4.2(=1.2): Fc

• Primer5.1 and 5.2: TMD-mcherry

small construct, mutagenese PCR

• Primer 1.RCF25 and 2.mut: RCF25 prefix and 1st mutation PstI in scFV

• Primer 3.mut and 4.mut: 1st and 2nd mutation PstI in scFV

• Primer 5.mut and &.RCF25: 2nd mutation and RCF25 suffix

Primer scFv: Primer 7.Rcf25 prefix and 8.RCF25 suffix

Further tasks: PCR and seuqencing

Sequence alignment of Geneart construct

Time: 2012-08-30 12 pm

Materials: Geneious, sequences delivered by Geneart

Results: sequence correct, no mutations, no undesired restriction sites

Transformation of Geneart construct Nanobody-Fc-LoxP-TEV-TMD-mcherry

Investigator:Maria

Time: 2012-08-30 17 pm

Materials: competent E. coli cells (XL1 blue), icebox, Bunsen burner, agar plate with kanamycin

Method: Transformation according to manual, 2µl of Geneart construct

Results: colonies ready for picking and overnight culture

Further tasks: Picking colonies

2012-08-31

Control of Primer and Ordering Primers

Investigator:Sascha, Maria

Time: 2012-08-31 11 am

Materials: Geneious

Results: 17 primer for Biobrick assembly with RCF25 standard

Further tasks: PCR

Overnight culture Geneart construct

Investigator:Maria

Time: 2012-08-31 5:00pm

Materials: colonies Geneart construct, 5ml LB media with kanaymycin

Methods: inoculation of LB-kanaymycin

Results: overnight culture for mini prep

Further tasks: Mini prep

Virus

2012-08-13

Topic: PCR

Investigator: Xenia

Aim:test primer prr_VP2_pstI_2 (reverse primer)

Materials:

primer combination:

• prr_VP2_pstI_2 (reverse primer) and prf_XbaI_koz_GGGGG_VP2 (forward primer)-> myc-

• prr_VP2_pstI_2 (reverse primer) and prf_XbaI_koz_GGGGG_myc_VP2(forward primer)--> myc+
  

Method:

• polymerase chain reaction
  

Mastermix

reagenz	volumen [µL]
HF buffer	5
dNTPs (NEB)	1.25
primer (prr_VP2_pstI_Temp68)	1.0
Primer (prf_XbaI_koz_GGGGG_VP2/prf_XbaI_koz_GGGGG_myc_VP2)	1.0
DNA (plasmid)	1.0
Phusion polymerase	1.0
water	33.75

program

step	temperature [°C]	duration [s]	cycles
denaturation	98	30	1
denaturation	98	10	30
annealing	70	40	30
elongation	72	40	30
final elongation	72	300	1
cooling	4	∞	1

Further tasks:

• agarose gel electrophoresis

2012-08-14

Topic: PCR von VP2

Investigators: Tobias

Materials:

• Phusion polymerase

• Templat: Plasmid (P10_pSB1C3_001_CMV_DARPin_ML_VP2/3_587KO_6xHis)

• primer:

• • prr_VP2_pstI_2 (reversed) and prf_XbaI_koz_GGGGG_VP2 (FP1)-> myc-

• • prr_VP2_pstI_2 (reversed) and prf_XbaI_koz_GGGGG_myc_VP2(FP2)--> myc+
    

Method:

• polymerase chain reaction
  

Mastermix

reagenz	volumen [µL]
HF buffer	10
dNTPs (NEB)	1
primer (prr_VP2_pstI_2)	2.0
Primer (prf_XbaI_koz_GGGGG_VP2/prf_XbaI_koz_GGGGG_myc_VP2)	2.0
DNA (plasmid)	1.0
Phusion polymerase	0.5
water	33.5

Program

step	temperature [°C]	duration [s]	cycles
denaturation	98	30	1
denaturation	98	10	30
annealing	65	40	30
elongation	72	40	30
final elongation	72	300	1
cooling	4	∞	1

Further tasks:

• PCR-clean up

2012-08-15

Topic: PCR-clean up

Investigator: Tobias

Materials: NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel)

Methods:

• CleanUp-protocol

Results:

-myc-product: 18 ng/µL --> 14 nM

+myc-product: 7 ng/µL --> 5 nM

Further tasks:

• digestion

Topic: ligation, transformation

Investigator: Tobias

Materials and Methods:

• the ligation and the transformation were done using the standard protocol

Further tasks:

• picking clones

2012-08-17

Topic: pick clones, DNA preparation, gel electrophoresis

Investigators: Kathi

Materials:

• LB-medium

• GeneJET Plasmid Miniprep Kit

• gel electrophoresis

Methods:

• Pick clones, eight hours incubation (LB-medium, 37 °C)

• perform the DNA preparation

• control (agarose gel electrophorese)

results:

• p10_PsB1c3_CMV_kozak_sortase: c= 185 ng/µL v= 50 µL

• p10_PsB1c3_CMV_kozak_sortase_myc: c= 202 ng/µL v= 50 µL

further tasks: test digestion

2012-08-28

purification of plasmid DNA

Investigators: Xenia and Kathi

Materials methods

• endotoxin free preparation - Plasmid Plus Midi Kit (QIAGEN)- elution volume 200 µL

Results:

concentration of plasmids

• P01 (mVENUS linked on VP1): 1776.7 ng/µL

• P05 (VP2 knock out) : 2336.2 ng/µL

• P06 (VP1 knock out): 1256.7 ng/µL

• phelper: 1628 ng/µL

• psB1c (GOU=CFP): 493 ng/µL

Further tasks:

• test digestion

• gel electrophoresis

test digestion, Gelelectrophoresis

Investigator : Xenia

Materials and Method:

• test digestion

• 15 µL water + 2 µL 10x FD green buffer + 2 µL DNA (300 ng/µL) + 1 µL of each enzyme

• • psB1c (GOI=CFP): SpeI, XbaI und ApaI

• • phelper: NheI, SpeI, ApaI

• • P06 (VP1 knock out): XbaI, ApaI

• • P05 (VP2 knock out): XbaI, ApaI

• • P01 (YFP linked on VP1): XbaI, ApaI

• 1 hour at 37 °C

• gel electrophoresis

Results:

fragments calculated in Genious:

• psB1c (GOI=CFP): 4069 bp, 284 bp, 219 bp

• phelper: 6242 bp, 4011 bp, 906 bp, 492 bp

• P06 (VP1 knock out): 2119 bp, 290 bp, 631 bp, 2630 bp, 821 bp

• P05(VP2 knock out): : 2119 bp, 290 bp, 631 bp, 2630 bp, 821 bp

• P01(YFP linked on VP1): 2566 bp, 2169 bp, 821 bp, 323 bp

fragments - gel electrophoresis

• phelper: 6242 bp, 4011 bp, 906 bp, 492 bp

• P06 (VP1 knock out): 2119 bp, 290 bp, 631 bp, 2630 bp, 821 bp + ~ 3000 bp

• P05(VP2 knock out): : 2119 bp, 290 bp, 631 bp, 2630 bp, 821 bp + ~ 3000 bp

• P01(YFP linked on VP1): 2566 bp, 2169 bp, 821 bp, 323 bp

• psb1c3 (GOI=CFF): other fragments in the gel electrophoresis than calculated in Genious

Further Tasks:

• sequences of the psb1c3 (GOI=CFP)-plasmid

2012-08-29

Topic: transfection of plasmids

Investigators: Kerstin and Stefan

Aim:

• The plasmids were transfected in HEK-cells with the following plasmids:

• • pSB1C: GOI is CFP

• • phelper

• • P01: YFP linked on VP1

• • p06: VP1 knock out
    

Materials:

• Medium: opti Mem

• transfection reagenz: PEI

• 15 µg DNA per each transfection

Methods:

• transfection preparation

• • 1875 ng per plasmid; add 200 µL opti MEM-medium per each transfection

• • 4.8 * DNA --> 72 µL PEI add 200 µL per each transfection

• three times 10 s mixing

• 2 min RT

• centrifagation

• give the PEI preparation to the DNA preparation

• mixing

• 15 min RT

• give the transfection preparation to the HEK AAV 293 cells

Further tasks

• change medium (DMEM) after 16 hours

• after three days virus maturation, preparation of the primary virus stocks

2012-08-30

Topic: change medium

Investigators: Kerstin and Stefan

Aim: change the medium of the transfected cells

Materials:

• PBS

• DMEM

Methods:

• aspirate the old medium

• washed with PBS

• give new DMEM medium to the cells

Further tasks

• after three days virus maturation - virus preparation on 02.09.2012