Team:Cornell/project/wetlab/results/qPCR

From 2012.igem.org

qPCR

RT-qPCR

We are currently using two-step RT-qPCR to confirm that our engineered Shewanella strains respond to arsenic and naphthalene. Total RNA will be isolated using the E.Z.N.A.â„¢ Bacterial RNA Isolation Kit from Omega bio-tek; cDNA will be synthesized using the qScriptâ„¢ Flex cDNA Kit from Quanta Biosciences; and we are using the ABI ViiA7 platform along with the KAPA SYBR(R) FAST qPCR Kit from KAPA Biosystems. Our primers are as follows:

FOR_enzA: CAGCCTTTTACCCAAGGTGA
REV_enzA: CACGATTCGAGAGGGTGATT
FOR_RecA: TTCCCCTCGACATTGTCATCATCGGA
REV_RecA: AAGGGCGATAAAATTGGTCAAGGCCG
3'_FOR_qPCR_mtrB: ACGCTCAATATCAAGCCACCGAGA
3'_REV_qPCR_mtrB: TGTGCGGTGTAGTCATGGCTGT